WO2004035010A2 - Methodes et organismes pour la production de vitameres b6 - Google Patents

Methodes et organismes pour la production de vitameres b6 Download PDF

Info

Publication number
WO2004035010A2
WO2004035010A2 PCT/US2003/008880 US0308880W WO2004035010A2 WO 2004035010 A2 WO2004035010 A2 WO 2004035010A2 US 0308880 W US0308880 W US 0308880W WO 2004035010 A2 WO2004035010 A2 WO 2004035010A2
Authority
WO
WIPO (PCT)
Prior art keywords
vitamer
organism
microorganism
bacillus
nucleic acid
Prior art date
Application number
PCT/US2003/008880
Other languages
English (en)
Other versions
WO2004035010A3 (fr
WO2004035010A8 (fr
Inventor
Rogers R. Yocum
Mark K. Williams
Janice G. Pero
Original Assignee
Basf Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basf Aktiengesellschaft filed Critical Basf Aktiengesellschaft
Priority to US10/508,768 priority Critical patent/US20050164335A1/en
Priority to AU2003298508A priority patent/AU2003298508A1/en
Publication of WO2004035010A2 publication Critical patent/WO2004035010A2/fr
Publication of WO2004035010A8 publication Critical patent/WO2004035010A8/fr
Publication of WO2004035010A3 publication Critical patent/WO2004035010A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/10—Nitrogen as only ring hetero atom
    • C12P17/12—Nitrogen as only ring hetero atom containing a six-membered hetero ring

Definitions

  • Vitamin B6 also known as pyridoxine or pyridoxol (PN), or one of a number of closely related compounds, is an essential dietary nutrient for most, if not all, animals, while many microorganisms (bacteria, fungi, algae, etc.) and plants are capable of synthesizing their own vitamin B6 or compound(s) related to vitamin B6.
  • PN pyridoxine
  • Vitamin B6 acts as a cofactor for many important or essential enzymes in all living organisms, including transaminases, racemases, and decarboxylases. PLP and PMP are easily interconverted by ubiquitous transaminases.
  • Vitamin B6 is of commercial importance in vitamin pills, pharmaceutical applications, and as an animal feed additive that enhances growth or desirable growth characteristics in farm and domestic animals.
  • the currently used commercial process for producing vitamin B6 is a synthetic chemical process.
  • a fermentation process using a microorganism see US Patent application No. 09/667,569, filed ⁇ September 21, 2000, hereby incorporated in its entirety by reference
  • a biosynthetic process using a plant species can be more cost effective in the long run, and may be environmentally more attractive.
  • Enzymes encoded by the genes epd, pdxB, pdxF, andpdxA lead to synthesis of the precursor l-hydroxy-3 -amino acetone phosphate from erythrose- 4-phosphate and glutamate.
  • the enzyme encoded by dxs leads to the precursor 5'- deoxyxylulose phosphate from glycolytic intermediates.
  • the enzyme encoded by pdxJ then catalyzes the chemical coupling of the two precursors to give pyridoxol phosphate (also called pyridoxine phosphate or PNP).
  • PNP is then oxidized to the active form, PLP, by the enzyme encoded by pdxH.
  • This biosynthetic pathway to PLP in E. coli, as well as closely related pathways, are referred to herein as the Type A Pathway.
  • Partially characterized mutants of E. coli have been described that produce about three- to sevenfold more vitamin B 6 -related compounds than the parent strain (Dempsey and Arcement (1971) J. Bacteriol.107(2): 580-582).
  • Partially characterized mutants of B. subtilis have been reported that produce 1 - 5 mg/1 vitamin B 6 , but it was not stated what level the parent strain produced (Pflug, W., and Lingens, F., (1978) Hoppe-Seyler's Z. Physiol. Chem. 359: 559-570). Notably, these organisms were not recombinantly produced.
  • a second biosynthetic pathway for vitamin B6, referred to herein as the Type B pathway, may exist in some organisms other than E. coli (Mittengruber, G., (2001) J. Mol. Microbiol. Biotechnol. 3(1): 1-20).
  • some fungi for example from the genera Cercospora, Neurospora, Aspergillus and Saccharomyces
  • some bacteria for example B. subtilis and Staphylococcus aureus
  • SOR or SNZ
  • B. subtilis contains a gene, yhaF, that encodes a protein that is significantly homologous to E. colipdxF.
  • yhaF a gene that encodes a protein that is significantly homologous to E. colipdxF.
  • the resulting mutant B. subtilis strain is a serine auxotroph, but not a PL auxotroph (see Example 3, below).
  • the identification of a gene or genes involved in PLP biosynthesis in any given organism can not be done using sequence homology alone.
  • sequence homology between genes, in combination with the presence of one or more common biological activities may be used to identify homologs of genes involved in PLP biosynthesis.
  • subtilis have either pdxA and pdxJ homologs or SOR and SNO homologs, but not both, it appears that most organisms that are capable of synthesizing PLP have either the well characterized Type A Pathway (for example E. coli, Salmonella typhimurium, and many other genera), or a distinctly different and incompletely characterized pathway, e.g., the Type B Pathway.
  • Type A Pathway for example E. coli, Salmonella typhimurium, and many other genera
  • a distinctly different and incompletely characterized pathway e.g., the Type B Pathway.
  • Type B pathway Saccharomyces, Bacillus, Arabidopsis, and many other genera, appear to have a Type B pathway, and are lacking some of the genes involved in the Type A Pathway.
  • the intermediate compounds in the Type B Pathway have not yet been elucidated, although the final product must be PLP (as for the Type A Pathway) or PMP, since these are the active forms of vitamin B6 in all known organisms.
  • the present invention is based, at least in part, on the discovery of key enzyme-encoding genes of the B6 vitamer biosynthetic pathways in, e.g., Bacillus subtilis.
  • the invention is based, at least in part, on the discovery that the yaaD and yaaE genes of B. subtilis, or homologues thereof, are required for B6 vitamer synthesis.
  • the invention is further based on the discovery that the biosynthesis of vitamers by an organism can be increased by increasing the level of one or more enzymes involved in B6 vitamer synthesis.
  • yaaD and yaaE genes which are adj acent in an operon, e.g., the yaaDE operon
  • yaaDE operon Overexpression of the yaaDE operon or the deregulation of the expression of the yaaD and yaaE genes leads to significantly increased production of B6 vitamers in, e.g., B. subtilis strains.
  • the B. subtilis yaaDE operon is required for pyridoxal phosphate (PLP) biosynthesis, an active form of vitamin B6 in all living organisms.
  • PDP pyridoxal phosphate
  • the present invention describes that the expression of the B. subtilis yaaDE operon is a rate limiting step for production of compounds related to vitamin B6 in a wild type strain.
  • the present invention features methods of producing B6 vitamers, including, but not limited to, pyridoxine (or pyridoxol (P ⁇ )), pyridoxal (PL), pyridoxamine (PM), or the 5' phosphorylated derivatives of any of the three aforementioned compounds (P ⁇ P, PLP, and PMP), using organisms in which the B6 vitamer pathway has been manipulated such that B6 vitamers are produced.
  • Such methods include culturing an organism, e.g., a microorganism that overexpresses at least one B6 vitamer biosynthetic enzyme under conditions such that the B6 vitamer is produced.
  • the invention is also based, at least in part, on the discovery that modulation of YaaD and/or YaaE activity (e.g., YaaD and YaaE activity or YaaD activity) results in the modulation of B6 vitamer production.
  • the invention includes a method for producing a B6 vitamer comprising culturing an organism with an increased YaaD and/or YaaE activity (e.g., YaaD and YaaE activity or YaaD activity) as compared to the parent organism.
  • increased YaaD and/or YaaE activity is due to increased expression of a nucleic acid molecule encoding a YaaD polypeptide and/or YaaE polypeptide (e.g., a YaaD polypeptide and a YaaE polypeptide or a YaaD polypeptide) as compared to an unmodified parent organism.
  • increased y ⁇ D and/or y ⁇ E nucleic acid molecule expression is due to the introduction of nucleic acid molecules encoding a YaaD polypeptide and/or a YaaE polypeptide into the organism.
  • the invention provides methods for producing a B6 vitamer comprising culturing an organism with an increased Epd, PdxA, PdxJ, PdxF, PdxB, PdxH, or Dxs activity as compared to the parent micro.
  • increased Epd, PdxA, PdxJ, PdxF, PdxB, PdxH, or Dxs activity is due to increased expression of a nucleic acid molecule encoding an Epd, PdxA, PdxJ, PdxF, PdxB, PdxH, and/or a Dxs polypeptide as compared to an unmodified parent organism.
  • increased epd, pdxA, pdxJ, pdxF, pdxB, pdxH, and or dxs nucleic acid molecule expression is due to the introduction of nucleic acid molecules encoding an Epd, PdxA, PdxJ, PdxF, PdxB, PdxH, and/or a Dxs polypeptide into the organism.
  • the production methods of the present invention further can include recovering the B6 vitamer.
  • the instant invention also features genetically modified organisms, e.g., microorganisms, (i.e., organisms that contain one or more modifications or mutations in the genome) that are capable of producing significantly more of a B6 vitamer than an unmodified parent organism, h particular, this invention features microorganisms (including, for example, but not limited to bacteria, yeasts, fungi, and algae) or macro- organisms such as plants that, when genetically modified, produce an increased amount, e.g., at least about 10-fold more of a B6 vitamer, than the unmodified parent organism.
  • microorganisms including, for example, but not limited to bacteria, yeasts, fungi, and algae
  • macro- organisms such as plants that, when genetically modified, produce an increased amount, e.g., at least about 10-fold more of a B6 vitamer, than the unmodified parent organism.
  • Bacillus subtilis and Escherichia coli strains have been genetically modified such that they produce significant amounts of a B6 vitamer.
  • the present invention features organisms that have been genetically modified to increase the activity of one or more enzymes that catalyze(s) a step in the biosynthesis of a B6 vitamer, such that B6 vitamer production from said modified organism is increased compared to B6 production in an unmodified parent organism.
  • Yet another aspect of the invention features recombinant organisms, e.g., microorganisms which overexpress at least one Bacillus (e.g., B. subtilis) B6 vitamer biosynthetic enzyme (e.g., at least one of the yaaD, or yaaE gene products) or at least one of the epd, pdxA, pdxJ, pdxF, pdxB, pdxH, and or dxs gene products, are described.
  • Bacillus e.g., B. subtilis
  • B6 vitamer biosynthetic enzyme e.g., at least one of the yaaD, or yaaE gene products
  • epd, pdxA, pdxJ, pdxF, pdxB, pdxH, and or dxs gene products are described.
  • the recombinant microorganism is Gram positive (e.g., microorganisms belonging to the genus Bacillus, Cornyebacterium, Lactobacillus, Lactococci or Streptomyces).
  • the recombinant microorganism is Gram negative.
  • a Bacillus recombinant microorganism e.g., Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus pumilus, Bacillus halodurans, and the like).
  • Recombinant vectors that contain genes encoding Bacillus B6 vitamer biosynthetic enzymes, e.g., yaaD ox yaaE genes, or homologues thereof, or epd, pdxA, pdxJ, pdxF, pdxB, pdxH, or dxs genes, or homologues thereof, are also described.
  • Bacillus B6 vitamer biosynthetic enzymes e.g., yaaD ox yaaE genes, or homologues thereof, or epd, pdxA, pdxJ, pdxF, pdxB, pdxH, or dxs genes, or homologues thereof, are also described.
  • Figure 1 depicts the chemical structures of vitamin B6 and related compounds.
  • Figure 2 depicts the biosynthetic pathway for PLP in E. coli.
  • Figure 3 depicts the standard curves generated by Saccharomyces uarum strain ATCC 9080 after feeding serial dilutions of PN, PL, and PM (as described in Example 1).
  • Figure 4 is a schematic representation of the plasmid pDXIF.
  • Figure 5 is a schematic representation of the plasmid pDXl IF.
  • Figure 6 is a schematic representation of the plasmid pDX14R.
  • Figure 7 is a schematic representation of the plasmid pDX17R.
  • the present invention is based, at least in part, on the identification of Bacillus (e.g., B. subtilis) genes that encode essential enzymes of the B6 vitamer biosynthetic pathway.
  • Bacillus e.g., B. subtilis
  • the present invention features methods based on manipulation of the B6 vitamer biosynthetic pathway in an organism, e.g., a microorganism such that certain desirable compounds are produced.
  • the invention is based, at least in part, on the discovery that the y ⁇ D and y ⁇ E genes of B. subtilis are required for B6 vitamer synthesis, including, but not limited to, pyridoxine (or pyridoxol (PN)), pyridoxal (PL), pyridoxamine (PM), or the 5' phosphorylated derivatives of any of the three aforementioned compounds (PNP, PLP, and PMP).
  • the y ⁇ D and y ⁇ E genes are adjacent on an operon, e.g., the y ⁇ DE operon.
  • the y ⁇ D and y ⁇ E genes encode the YaaD and YaaE proteins, respectively.
  • the invention is also based, at least in part, on the discovery that modulation of YaaD and/or YaaE activity results in the modulation of B6 vitamer production.
  • the invention includes a method for producing a B6 vitamer comprising culturing an organism with an increased YaaD and/or YaaE activity (e.g., YaaD and YaaE activity or YaaD activity) as compared to the parent organism.
  • increased YaaD and/or YaaE activity e.g., YaaD and YaaE activity or YaaD activity
  • YaaD and YaaE activity or YaaD activity is due to increased expression of a nucleic acid molecule encoding a YaaD polypeptide and/or a YaaE polypeptide (e.g., a YaaD polypeptide and a YaaE polypeptide or a YaaD polypeptide) as compared to an unmodified parent organism.
  • increased y ⁇ D and/ov ⁇ E nucleic acid molecule expression is due to the introduction of nucleic acid molecules encoding a YaaD polypeptide and/or a YaaE polypeptide (e.g., a YaaD polypeptide and a YaaE polypeptide or a YaaD polypeptide) into the organism.
  • the y ⁇ D nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:21 and/or the y ⁇ E nucleic acid encodes a polypdptide comprising the amino acid sequence SEQ ID NO:23.
  • a y ⁇ D nucleic acid encodes a polypeptide comprising an amino acid sequence which is at least 30% identical to the amino acid sequence of SEQ LD NO:21, the polypeptide having a YaaD activity.
  • a y ⁇ E nucleic acid encodes a polypeptide comprising an amino acid sequence which is at least 30% identical to the amino acid sequence of SEQ LD NO:23, the polypeptide having a YaaE activity, h a further embodiment, the nucleic acid molecule comprising the nucleotide sequence of SEQ LD NO:20 and/or SEQ LD NO:22 is introduced.
  • the nucleotide sequence of y ⁇ D is set forth as SEQ LD NO:20 and the nucleotide sequence of y ⁇ E is set forth as SEQ ID NO:22.
  • the invention provides methods for producing a B6 vitamer comprising culturing an organism with an increased Epd, PdxA, PdxJ, PdxF, PdxB, PdxH, and/or Dxs activity as compared to the parent organism.
  • increased Epd, PdxA, PdxJ, PdxF, PdxB, PdxH, and/or Dxs activity is due to increased expression of a nucleic acid molecule encoding an Epd, PdxA, PdxJ, PdxF, PdxB, PdxH, and/or a Dxs polypeptide as compared to an unmodified parent organism.
  • increased epd, pdxA, pdxJ, pdxF, pdxB, pdxH, and/or dxs nucleic acid molecule expression is due to the introduction of nucleic acid molecules encoding an Epd, PdxA, PdxJ, PdxF, PdxB, PdxH, and/or a Dxs polypeptide into the organism.
  • fhepdxA nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:25 and/or wherein said pdxJ nucleic acid encodes a polypeptide comprising the amino acid sequence SEQ ID NO:27.
  • the pdxA nucleic acid encodes a polypeptide comprising an amino acid sequence which is at least 30% identical to the amino acid sequence of SEQ ID NO:25, the polypeptide having a PdxA activity.
  • the pdxJ nucleic acid encodes a polypeptide comprising an amino acid sequence which is at least 30% identical to the amino acid sequence of SEQ ID NO:27, and having a PdxJ activity.
  • the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:24 and/or SEQ ID NO:26 is introduced.
  • the nucleotide sequence of pdxA is set forth as SEQ ID NO:24.
  • the nucleotide sequence of pdxJ is set forth as SEQ ID NO:26.
  • the present invention features organisms, e.g., microorganisms that have been genetically modified to increase the activity of one or more enzymes that catalyze a step in the biosynthesis of a B6 vitamer, such that B6 vitamer production from the modified organism is increased compared to B6 production in an unmodified parent organism.
  • B6 vitamer production is at least ten-fold higher than from the unmodified parent organism.
  • the organism is genetically modified to overexpress one or more genes that encodes an enzyme that catalyzes a step in the biosynthesis of a B6 vitamer, e.g., yaaD or yaaE, or a homologue thereof, or epd, pdxA, pdxJ, pdxF, pdxB, pdxH, or dxs, or a homologue thereof.
  • the organism e.g., microorganism, may be, for example, B. subtilis or E. coli.
  • the present invention also features methods of producing a B6 vitamer comprising culturing an organism, e.g., a microorganism that has been genetically modified to overexpress one or more genes that encodes an enzyme that catalyzes a step in the biosynthesis of a B6 vitamer, such that B6 vitamer production from said modified organism is increased compared to B6 production in an unmodified parent organism, under conditions such that the B6 vitamer is produced.
  • the B6 vitamer may then be subsequently recovered.
  • the terms "B6 vitamer” or "B6 vitamers,” as used herein, shall refer to any compound or mixture of compounds that has any biological activity in any biological assay for vitamin B6.
  • B6 vitamers include, but are not limited to, pyridoxine (also called pyridoxol or PN), pyridoxal (PL), pyridoxamine (PM), the 5' phosphorylated derivatives of any of the three aforementioned compounds (PNP, PLP, and PMP), and any derivative or related compound that can be converted to the active forms (PLP or PMP) in a test organism.
  • pyridoxine also called pyridoxol or PN
  • PL pyridoxal
  • PM pyridoxamine
  • B6 vitamer biosynthetic pathway includes the biosynthetic pathway involving B6 vitamer biosynthetic enzymes (e.g., polypeptides encoded by biosynthetic enzyme-encoding genes), compounds (e.g., precursors, substrates, intermediates or products), cofactors and the like utilized in the formation or synthesis of B6 vitamers.
  • B6 vitamer biosynthetic pathway includes the biosynthetic pathway leading to the synthesis of B6 vitamers in a microorganism (e.g., in vivo) as well as the biosynthetic pathway leading to the synthesis of B6 vitamers in vitro.
  • B6 vitamer biosynthetic enzyme includes an enzyme which is involved in the synthesis of any B6 vitamer in an organism or microorganism, e.g., an enzyme that is rate limiting for B6 vitamer synthesis in said organism or microorganism.
  • B6 vitamer biosynthetic enzymes include, for example, YaaD, YaaE, Epd, PdxA, PdxJ, PdxF, PdxB, PdxH, and/or Dxs, or homologues thereof.
  • B6 vitamer biosynthetic enzyme activity includes, for example, any enzyme activity which results in B6 vitamer synthesis.
  • PdxA activity includes the catalysis of hydroxythreonine to hydroxyaminoacetone
  • PdxJ activity includes the catalysis of hydroxyaminoacetone and deoxyeylatose to pyridoxol phosphate.
  • Ove roduction or increased activity of the rate limiting enzyme for B6 vitamer production in any organism that is capable of producing B6 vitamers will lead to overproduction of B6 vitamers.
  • overexpression or increased activity of any of the E. coli genes involved in the PLP pathway will give a measurable increase in B6 vitamer production.
  • overexpression or increased activity of the E. coli genes epd, pdxA, pdxJ, pdxF, pdxB, pdxH, or dxs, homologues thereof, or a combination thereof, in E. coli may lead to an increase in B6 vitamer production.
  • overexpression or increased activity of genes of the type B pathway e.g., the yaaD or yaaE genes (e.g., the yaaD and yaaE genes or the yaaD gene) will result in increased B6 vitamer production in host organisms of the type A pathway, e.g., E. coli.
  • genes of the type A pathway e.g., the epd, pdxA, pdxJ, pdxF, pdxB, pdxH, or dxs genes will result in increased B6 vitamer production in host organisms of the type B pathway, e.g., B. subtilis.
  • a "biological assay for a B6 vitamer” includes, for example, any assay that is capable of quantifying B6 vitamer activity by measuring growth of an organism that requires the feeding of a B6 vitamer (i.e., a compound that the fed organism can convert into PLP or PMP) for growth. Samples to be assayed are diluted serially in an appropriate medium and fed to the appropriate organism. Standard curves are generated by serially diluting known amounts of PL, PN, or PM, and feeding these dilutions to the test orgamsm. By comparing dilutions of the unknown samples to the standard curves, total B6 vitamer activity can be determined, for example as PL equivalents if PL was used to generate the standard curve.
  • the present invention features targeting or modifying various biosynthetic genes or enzymes of the B6 vitamer biosynthetic pathway.
  • the invention features modifying various enzymatic activities associated with said pathways by modifying or altering the genes encoding said biosynthetic enzymes.
  • gene includes a nucleic acid molecule (e.g., a DNA molecule or segment thereof) that, in an organism, can be separated from another gene or other genes, by intergenic DNA (i.e., intervening or spacer DNA which naturally flanks the gene and/or separates genes in the chromosomal DNA of the orgamsm).
  • intergenic DNA i.e., intervening or spacer DNA which naturally flanks the gene and/or separates genes in the chromosomal DNA of the orgamsm.
  • a gene may slightly overlap another gene (e.g., the 3' end of a first gene overlapping the 5' end of a second gene), said overlapping genes separated from other genes by intergenic DNA.
  • a gene may direct synthesis of an enzyme or other protein molecule (e.g., may comprise coding sequences, for example, a contiguous open reading frame (ORF) which encodes a protein) or may itself be functional in the organism.
  • a gene in an organism may be clustered in an operon, as defined herein, said operon being separated from other genes and/or operons by the intergenic DNA.
  • an "isolated gene”, as used herein, includes a gene which is essentially free of sequences which naturally flank the gene in the chromosomal DNA of the organism from which the gene is derived (i.e., is free of adjacent coding sequences which encode a second or distinct protein, adjacent structural sequences or the like) and optionally includes 5' and 3' regulatory sequences, for example promoter sequences and/or terminator sequences.
  • an isolated gene includes predominantly coding sequences for a protein (e.g., sequences which encode Bacillus proteins).
  • an isolated gene includes coding sequences for a protein (e.g., for a Bacillus protein) and adjacent 5' and/or 3' regulatory sequences from the chromosomal DNA of the organism from which the gene is derived (e.g., adjacent 5' and/or 3' Bacillus regulatory sequences).
  • an isolated gene contains less than about 10 kb, 5 kb, 2 kb, 1 kb, 0.5 kb, 0.2 kb, 0.1 kb, 50 bp, 25 bp or 10 bp of nucleotide sequences that naturally flank the gene in the chromosomal DNA of the organism from which the gene is derived.
  • operon includes at least two adjacent genes or ORFs, optionally overlapping in sequence at either the 5' or 3' end of at least one gene or ORF.
  • the term “operon” includes a coordinated unit of gene expression that contains a promoter and possibly a regulatory element associated with one or more adjacent genes or ORFs (e.g., structural genes encoding enzymes, for example, biosynthetic enzymes). Expression of the genes (e.g., structural genes) can be coordinately regulated, for example, by regulatory proteins binding to the regulatory element or by anti-termination of transcription.
  • the genes of an operon e.g., structural genes
  • a “gene having a mutation” or “mutant gene” as used herein includes a gene having a nucleotide sequence which includes at least one alteration (e.g., substitution, insertion, deletion) such that the polypeptide or protein encoded by said mutant exhibits an activity that differs from the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene.
  • a gene having a mutation or mutant gene encodes a polypeptide or protein having an increased activity as compared to the polypeptide or protein encoded by the wild-type gene, for example, when assayed under similar conditions (e.g., assayed in microorganisms cultured at the same temperature).
  • an "increased activity” or “increased enzymatic activity” is one that is at least 5% greater than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene, preferably at least 5-10% greater, more preferably at least 10-25% greater and even more preferably at least 25-50%, 50-75% or 75-100% greater than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene. Ranges intermediate to the above-recited values, e.g., 75-85%, 85-90%, 90-95%, are also intended to be encompassed by the present invention.
  • an "increased activity” or “increased enzymatic activity” can also include an activity that is at least 1.25-fold greater than the activity of the polypeptide or protein encoded by the wild-type gene, preferably at least 1.5 -fold greater, more preferably at least 2-fold greater and even more preferably at least 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or greater than the activity of the polypeptide or protein encoded by the wild-type gene.
  • a gene having a mutation or mutant gene encodes a polypeptide or protein having a reduced activity as compared to the polypeptide or protein encoded by the wild-type gene, for example, when assayed under similar conditions (e.g., assayed in microorganisms cultured at the same temperature).
  • a mutant gene also can encode no polypeptide or have a reduced level of production of the wild-type polypeptide.
  • a "reduced activity” or “reduced enzymatic activity” is one that is at least 5% less than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene, preferably at least 5-10% less, more preferably at least 10-25% less and even more preferably at least 25-50%, 50-75% or 75-100% less than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene. Ranges intermediate to the above-recited values, e.g., 75-85%, 85-90%, 90-95%, are also intended to be encompassed by the present invention.
  • a “reduced activity” or “reduced enzymatic activity” can also include an activity that has been deleted or “knocked out” (e.g., approximately 100% less activity than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene).
  • Activity can be determined according to any well accepted assay for measuring activity of a particular protein of interest. Activity can be measured or assayed directly, for example, measuring an enzymatic or biological activity of a protein isolated or purified from a cell or microorganism. Alternatively, an activity can be measured or assayed within a cell or microorganism or in an extracellular medium. For example, assaying for a mutant gene (i.e., said mutant encoding a reduced enzymatic activity) can be accomplished by expressing the mutated gene in a microorganism, for example, a mutant microorganism in which the enzyme is temperature-sensitive, and assaying the mutant gene for the ability to complement a temperature sensitive (Ts) mutant for enzymatic activity.
  • Ts temperature sensitive
  • a mutant gene that encodes an "increased enzymatic activity" can be one that complements the Ts mutant more effectively than, for example, a corresponding wild-type gene.
  • a mutant gene that encodes a "reduced enzymatic activity” is one that complements the Ts mutant less effectively than, for example, a corresponding wild-type gene. It will be appreciated by the skilled artisan that even a single substitution in a nucleic acid or gene sequence (e.g., a base substitution that encodes an amino acid change in the corresponding amino acid sequence) can dramatically affect the activity of an encoded polypeptide or protein as compared to the corresponding wild-type polypeptide or protein.
  • a mutant gene (e.g., encoding a mutant polypeptide or protein), as defined herein, is readily distinguishable from a nucleic acid or gene encoding a protein homologue in that a mutant gene encodes a protein or polypeptide having an altered activity, optionally observable as a different or distinct phenotype in an organism expressing said mutant gene or producing said mutant protein or polypeptide (i.e., a mutant microorganism) as compared to a corresponding organism expressing the wild- type gene.
  • a protein homologue has an identical or substantially similar activity, optionally phenotypically indiscernible when produced in an organism, e.g., a microorganism, as compared to a corresponding organism, e.g., microorganism, expressing the wild-type gene.
  • nucleic acid molecules, genes, protein or polypeptides that serves to distinguish between homologues and mutants, rather it is the activity of the encoded protein or polypeptide that distinguishes between homologues and mutants: homologues having, for example, low (e.g., 30-50%) sequence identity) sequence identity yet having substantially equivalent functional activities, and mutants, for example sharing 99% sequence identity yet having dramatically different or altered functional activities.
  • homologue e.g., a y ⁇ D, y ⁇ E, epd, pdxA, pdxJ, pdxF, pdxB, pdxH, or dxs homologue, refers to a molecule having at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%), 99%, or more nucleotide or amino acid sequence identity to a y ⁇ D, y ⁇ E, epd, pdxA, pdxJ, pdxF, pdxB, pdxH, or dxs nucleic acid or protein molecule and having a specific functional activity, e.g., a y ⁇ D activity, a y ⁇ E activity, apdxA activity, or a pdxJ activity.
  • a y ⁇ D activity, a y ⁇ E activity, apdxA activity, or a pdxJ activity includes the ability of the homologue to rescue an auxotroph, e.g., an organism which is auxotrophic due to the mutation or deletion of a gene encoding the relevant enzyme involved in a B6 biosynthetic pathway, in a test system, or the ability of the homologue to produce a desired product, e.g., a B6 vitamer or intermediate in the B6 vitamer biosynthetic pathway.
  • an auxotroph e.g., an organism which is auxotrophic due to the mutation or deletion of a gene encoding the relevant enzyme involved in a B6 biosynthetic pathway, in a test system, or the ability of the homologue to produce a desired product, e.g., a B6 vitamer or intermediate in the B6 vitamer biosynthetic pathway.
  • methods for testing potential homologues include complementation assays.
  • a complementation assay includes an assay wherein the potential homologue, e.g., a potential homologue isolated, from a plant organism or a microorganism, is expressed in an auxotrophic Bacillus microorganism in which a portion of the yaaD ox yaaE gene has been deleted, and the ability of the potential homologue to rescue the microorganism from auxotrophy is measured.
  • a Bacillus promoter and ribosome binding site such as, for example, a ribosome binding site described herein, is utilized for the expression of the homologue in the Bacillus microorganism.
  • the potential homologue is expressed in an auxotrophic E.
  • coli microorganism for example, apdxA, pdxB, pdxF, pdxJ, dxs, or epd mutant, and the ability of the potential homologue to rescue the microorganism from auxotrophy is measured.
  • the amount of B6 vitamer produced may be measured by methods described herein, e.g., by HPLC analysis, and by other methods known in the art.
  • a “potential homologue” as used herein includes a molecule with 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more nucleotide or amino acid sequence identity to a y ⁇ D, y ⁇ E, epd, pdxA, pdxJ, pdxF, pdxB, pdxH, or dxs nucleic acid or protein molecule, where a functional activity of the molecule has not yet been established through, for example, an assay described herein for measuring functional activity.
  • the genes of the present invention are derived from Bacillus.
  • the term "derived from Bacillus” or “Bacillus-derived” includes a gene which is naturally found in microorganisms of the genus Bacillus.
  • the genes of the present invention are derived from a microorganism selected from the group consisting of Bacillus subtilis, Bacillus lentimorbus, Bacillus lentus, Bacillus firmus, Bacillus pantothenticus, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus circulans, Bacillus coagulans, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus thuringiensis, Bacillus halodurans, and other Group 1 Bacillus species, for example, as characterized by 16S rRNA type.
  • the gene is derived from Bacillus brevis or Bacillus stearothermophilus.
  • the genes of the present invention are derived from a microorganism selected from the group consisting of Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis, and Bacillus pumilus.
  • the gene is derived from Bacillus subtilis (e.g., is Bacillus subtilis-der ved).
  • the term "derived from Bacillus subtilis" or "Bacillus subtilis-derrved” includes a gene which is naturally found in the microorganism Bacillus subtilis.
  • Bacillus-de ⁇ ved genes e.g., B. subtilis-de ⁇ ved genes
  • Bacillus o B. subtilis yaaD or yaaE genes are included within the scope of the present invention.
  • the genes of the present invention are derived from Escherichia.
  • the term "derived from Escherichia” or "Escherichia-derived” includes a gene which is naturally found in microorganisms of the genus Escherichia.
  • the gene is derived from Escherichia coli (e.g., is Escherichia co/z-derived).
  • Escherichia coli or "Escherichia cob-derived” includes a gene which is naturally found in the microorganism Escherichia coli. Included within the scope of the present invention are Escherichia-de ⁇ ved genes (e.g., Escherichia co z ' -derived genes), for example, Escherichia or Escherichia coli epd, pdxA, pdxJ, pdxF, pdxB, pdxH, or dxs genes.
  • Escherichia-de ⁇ ved genes e.g., Escherichia co z ' -derived genes
  • genes of the present invention are derived, for example, from any one of the organisms or microorganisms listed in Section III or in either of Tables 9 or 10 (or in the GenBank records referred to by Accession Nos. listed therein).
  • the present invention further features recombinant nucleic acid molecules (e.g., recombinant DNA molecules) that include genes described herein (e.g., isolated genes), preferably Bacillus genes, more preferably Bacillus subtilis genes, even more preferably Bacillus subtilis B6 vitamer biosynthetic genes.
  • recombinant nucleic acid molecule includes an isolated nucleic acid molecule (e.g., a DNA molecule) that has been altered, modified or engineered such that it differs in nucleotide sequence from the native or natural nucleic acid molecule from which the recombinant nucleic acid molecule was derived (e.g., by addition, deletion or substitution of one or more nucleotides).
  • a recombinant nucleic acid molecule e.g., a recombinant DNA molecule
  • operably linked to regulatory sequence(s) means that the nucleotide sequence of the gene of interest is linked to the regulatory sequence(s) in a manner which allows for expression (e.g., enhanced, increased, constitutive, basal, attenuated, decreased or repressed expression) of the gene, preferably expression of a gene product encoded by the gene (e.g., when the recombinant nucleic acid molecule is included in a recombinant vector, as defined herein, and is introduced into a microorganism).
  • a "recombinant organism” is any organism that contains a recombinant nucleic acid molecule.
  • regulatory sequence includes nucleic acid sequences that affect (e.g., modulate or regulate) expression of other nucleic acid sequences (i.e., genes).
  • a regulatory sequence is included in a recombinant nucleic acid molecule in a similar or identical position and/or orientation relative to a particular gene of interest as is observed for the regulatory sequence and gene of interest as it appears in nature, e.g., in a native position and/or orientation.
  • a gene of interest can be included in a recombinant nucleic acid molecule operably linked to a regulatory sequence which accompanies or is adjacent to the gene of interest in the natural organism (e.g., operably linked to "native" regulatory sequences (e.g., to the "native" promoter).
  • a gene of interest can be included in a recombinant nucleic acid molecule operably linked to a regulatory sequence which accompanies or is adjacent to another (e.g., a different) gene in the natural organism.
  • a gene of interest can be included in a recombinant nucleic acid molecule operably linked to a regulatory sequence from another organism.
  • regulatory sequences from other microbes e.g., other bacterial regulatory sequences, bacteriophage regulatory sequences and the like
  • a regulatory sequence is a non-native or non- naturally-occurring sequence (e.g., a sequence which has been modified, mutated, substituted, derivatized, deleted including sequences which are chemically synthesized).
  • Preferred regulatory sequences include promoters, enhancers, termination signals, anti- termination signals, ribosome binding sites and other expression control elements (e.g., sequences to which repressors or inducers bind and/or binding sites for transcriptional and/or translational regulatory proteins, for example, in the transcribed mRNA).
  • Such regulatory sequences are described, for example, in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual.
  • Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in a microorganism (e.g., constitutive promoters and strong constitutive promoters), those which direct inducible expression of a nucleotide sequence in a microorganism (e.g., inducible promoters, for example, xylose inducible promoters) and those which attenuate or repress expression of a nucleotide sequence in a microorganism (e.g., attenuation signals or repressor sequences). It is also within the scope of the present invention to regulate expression of a gene of interest by removing or deleting regulatory sequences. For example, sequences involved in the negative regulation of transcription can be removed such that expression of a gene of interest is enhanced.
  • a recombinant nucleic acid molecule of the present invention includes a nucleic acid sequence or gene that encodes at least one bacterial gene product (e.g., a B6 vitamer biosynthetic enzyme, e.g., the gene product of y ⁇ D and/or y ⁇ E, (e.g., the gene product of y ⁇ D and y ⁇ E or y ⁇ D) or a homologue thereof) operably linked to a promoter or promoter sequence.
  • Preferred promoters of the present invention include Bacillus promoters and/or bacteriophage promoters (e.g., bacteriophage which infect Bacillus).
  • a promoter is a Bacillus promoter, preferably a strong Bacillus promoter (e.g., a promoter associated with a biochemical housekeeping gene in Bacillus or a promoter associated with a glycolytic pathway gene in Bacillus).
  • a promoter is a bacteriophage promoter. In a preferred embodiment, the promoter is from the bacteriophage SP01.
  • a promoter is selected from the group consisting of Pis, P26, or P veg having for example, the following respective sequences: GCTATTGACGACAGCTATGGTTCACTGTCCACCAACCAAAACTGTGCTCAGT ACCGCCAATATTTCTCCCTTGAGGGGTACAAAGAGGTGTCCCTAGAAGAGAT CCACGCTGTGTAAAAATTTTACAAAAAGGTATTGACTTTCCCTACAGGGTGT GTAATAATTTAATTACAGGCGGGGGCAACCCCGCCTGT (SEQ ID NO:9),
  • Additional preferred promoters include te/(the translational elongation factor (TEF) promoter) and pyc (the pyruvate carboxylase (PYC) promoter), which promote high level expression in Bacillus (e.g., Bacillus subtilis).
  • Additional preferred promoters, for example, for use in Gram positive microorganisms include, but are not limited to, amy and SPO2 promoters.
  • a recombinant nucleic acid molecule of the present invention includes a terminator sequence or terminator sequences (e.g., transcription terminator sequences).
  • terminator sequences includes regulatory sequences that serve to terminate transcription of mRNA. Terminator sequences (or tandem transcription terminators) can further serve to stabilize mRNA (e.g., by adding structure to mRNA), for example, against nucleases.
  • a recombinant nucleic acid molecule of the present invention includes sequences which allow for detection of the vector containing said sequences (i.e., detectable and/or selectable markers), for example, genes that encode antibiotic resistance or sequences that overcome auxotrophic mutations, for example, trpC, fluorescent markers, drug markers, and/or colorimetric markers (e.g., / ⁇ cZ/ ⁇ -galactosidase).
  • a recombinant nucleic acid molecule of the present invention includes an artificial ribosome binding site (RBS) or a sequence that becomes transcribed into an artificial RBS.
  • RBS ribosome binding site
  • artificial ribosome binding site includes a site within an mRNA molecule (e.g., coded within DNA) to which a ribosome binds (e.g., to initiate translation) which differs from a native RBS (e.g., a RBS found in a naturally-occurring gene) by at least one nucleotide.
  • Preferred artificial RBSs include about 5-6, 7-8, 9-10, 11-12, 13-14, 15-16, 17-18, 19-20, 21-22, 23-24, 25-26, 27-28, 29-30 or more nucleotides of which about 1-2, 3-4, 5-6, 7-8, 9-10, 11-12, 13-15 or more differ from the native RBS (e.g., the native RBS of a gene of interest, for example, the native y ⁇ D RBS GAAATCATATAACTATACCTTGATTAGGGGGACCAAGAAATG (SEQ LD NO : 12) or the native y ⁇ E RBS
  • nucleotides that differ are substituted such that they are identical to one or more nucleotides of an ideal RBS when optimally aligned for comparisons.
  • Artificial RBSs can be used to replace the naturally-occurring or native RBSs associated with a particular gene. Artificial RBSs preferably increase translation of a particular gene.
  • Preferred artificial RBSs e.g., RBSs for increasing the translation of y ⁇ E, for example, of B. subtilis
  • RBS2 TCTAGAGG AGGAG AAAACATG 16
  • RBS101 TAAGAACAA AGGAGGAGAGCTGACATG 17
  • the present invention further features vectors (e.g., recombinant vectors) that include nucleic acid molecules (e.g., genes or recombinant nucleic acid molecules comprising said genes) as described herein.
  • recombinant vector includes a vector (e.g., plasmid, phage, phasmid, virus, cosmid or other purified nucleic acid vector) that has been altered, modified or engineered such that it contains greater, fewer or different nucleic acid sequences than those included in the native or natural nucleic acid molecule from which the recombinant vector was derived.
  • the recombinant vector includes a biosynthetic enzyme-encoding gene or recombinant nucleic acid molecule including said gene, operably linked to regulatory sequences, for example, promoter sequences, terminator sequences and/or artificial ribosome binding sites (RBSs), as defined herein.
  • a recombinant vector of the present invention includes sequences that enhance replication in bacteria (e.g., replication-enhancing sequences).
  • replication-enhancing sequences are derived from E. coli.
  • replication-enhancing sequences are derived from pBR322.
  • replication-enhancing sequences are derived from pSClOl.
  • a recombinant vector of the present invention includes antibiotic resistance sequences.
  • antibiotic resistance sequences includes sequences which promote or confer resistance to antibiotics on the host organism (e.g., Bacillus).
  • the antibiotic resistance sequences are selected from the group consisting of cat (chloramphenicol resistance) sequences, tet (tetracycline resistance) sequences, erm (erythromycin resistance) sequences, neo (neomycin resistance) sequences, kan (kanamycin resistance) and spec (spectinomycin resistance) sequences.
  • Recombinant vectors of the present invention can further include homologous recombination sequences (e.g., sequences designed to allow recombination of the gene of interest into the chromosome of the host organism).
  • homologous recombination sequences e.g., sequences designed to allow recombination of the gene of interest into the chromosome of the host organism.
  • bpr, vpr, and/or amyE sequences can be used as homology targets for recombination into the host chromosome.
  • the design of a vector can be tailored depending on such factors as the choice of microorganism to be genetically engineered, the level of expression of gene product desired and the like.
  • the present invention further features organisms, i.e., recombinant organisms e.g., recombinant microorganisms, that include vectors or genes (e.g., wild- type and/or mutated genes) as described herein.
  • recombinant organisms e.g., recombinant microorganisms
  • vectors or genes e.g., wild- type and/or mutated genes
  • the term "recombinant organism” includes an organism or a microorganism (e.g., bacteria, yeast cell, fungal cell, plant cell, etc.) that has been genetically altered, modified or engineered (e.g., genetically engineered) such that it exhibits an altered, modified or different genotype and/or phenotype (e.g., when the genetic modification affects coding nucleic acid sequences of the organism) as compared to the naturally-occurring organism from which it was derived, e.g., a wild type or unmodified organism or parent organism or host organism.
  • a microorganism e.g., bacteria, yeast cell, fungal cell, plant cell, etc.
  • modified or engineered e.g., genetically engineered
  • Possible host organisms include, for example, plants, algae, fungi, yeasts, and other organisms and microorganisms.
  • the plant may be a monocot, dicot or gymnosperm.
  • Preferred microbes are those used in agriculture or by industry, and those that are pathogenic for plants or animals.
  • Plants include arabidopsis; field crops (e.g., alfalfa, barley, bean, cereals, corn, cotton, flax, lucerne, hemp, millet, oats, pea, rape, rice, rye, safflower, sorghum, soybean, sunflower, tobacco, triticale, and wheat); vegetable crops (e.g., asparagus, beet, broccoli, cabbages, capsicum, carrot, cauliflower, celery, cucumber, eggplant, lettuces, onion, pepper, potato, pumpkin, maize, radish, spinach, squash, taro, tomato, and zucchini); fruit and grapevine and nut species (e.g., almond, apple, apricot, banana, black- berry, blueberry, cacao, cherry, coconut, cranberry, date, faJoa, filbert, grape, grapefruit, guava, kiwi, lemon, lime, mango, melon, nectarine, orange, papaya, passion fruit, peach, peanut,
  • Fungi which may be used as host organisms include organisms in both the mold and yeast morphologies.
  • Possible fungal host organisms include the phylum Ascomycota, including, for example, the subphyla Neolectomycetes, Pezizomycotina, Pneumocystidomycetes, Saccharomycotina, Schizosaccharomycetes, Taphrinomycetes, mitosporic Ascomycota, and unclassified Ascomycota; the phylum Basidiomycota, including, for example, the subphyla Hymenomecetes, Urediniomycetes, Ustilaginomycetes, Mitosporic, Masidiomycota, and unclassified Basidiomycota; the phylum Chytridiomycota, including, for example, the subphyla, Blastocladiales, Chytridiales, Monoblepharidales, Neocallimasticales, Spizellomycetales, and unclassified Chyt
  • Algae which may be used as host organisms include, for example, green algae, red algae, yellow-green algae, Cryptomonads, haptophytes, golden algae, euglenids, diatoms, and brown algae.
  • microorganisms which maybe used as host organisms include Gram negative bacteria (e.g., a microorganisms which excludes basic dye, for example, crystal violet) and Gram positive bacteria (e.g., a microorganism which retains basic dye, for example, crystal violet, due to the presence of a Gram- positive wall surrounding the microorganism).
  • Gram negative bacteria e.g., a microorganisms which excludes basic dye, for example, crystal violet
  • Gram positive bacteria e.g., a microorganism which retains basic dye, for example, crystal violet, due to the presence of a Gram- positive wall surrounding the microorganism.
  • Gram negative bacteria include, for example, Acetobacteriaceae, Alcaligenaceae, Bacteroidaceae, Chromatiaceae, Enterobacteriaceae, Legionellaceae, Neisseriaceae, Nitrobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Rickettsiaceae, Spirochaetaceae, Vibrionaceae.
  • Gram positive bacteria include, for example, Bacillaceae, Micrococcaceae, and Peptococcaceae.
  • the recombinant microorganism is a Gram positive microorganism belonging to a genus selected from the group consisting of Bacillus, Corny ebacterium, Lactobacillus, Lactococci and Streptomyces.
  • the recombinant microorganism is of the genus Bacillus.
  • the recombinant microorganism is selected from the group consisting of Bacillus subtilis, Bacillus lentimorbus, Bacillus lentus, Bacillus firmus, Bacillus pantothenticus, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus circulans, Bacillus coagulans, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus thuringiensis, Bacillus halodurans, and other Group 1 Bacillus ' species, for example, as characterized by 16S rRNA type.
  • the recombinant microorganism is Bacillus brevis or Bacillus stearothermophilus. h another preferred embodiment, the recombinant microorganism is selected from the group consisting of Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis, and Bacillus pumilus. hi another preferred embodiment, the recombinant microorganism is a
  • the recombinant microorganism is of the genus Escherichia.
  • the recombinant microorganism is Escherichia coli.
  • the recombinant microorganism is Saccharomyces (e.g. , S. cerevisiae).
  • a preferred "recombinant" organism, e.g., microorganism of the present invention is an organism, e.g., a microorganism having a deregulated B6 vitamer biosynthesis pathway or enzyme.
  • deregulated includes the alteration or modification of at least one gene in an organism, e.g., a microorganism that encodes an enzyme in a biosynthetic pathway, such that the level or activity of the biosynthetic enzyme in the organism, e.g., the microorganism is altered or modified.
  • at least one gene that encodes an enzyme in a biosynthetic pathway is altered or modified such that the gene product is enhanced or increased.
  • the phrase "deregulated pathway” can also include a biosynthetic pathway in which more than one gene that encodes an enzyme in a biosynthetic pathway is altered or modified such that the level or activity of more than one biosynthetic enzyme is altered or modified.
  • a pathway e.g., to simultaneously deregulate more than one gene in a given biosynthetic pathway
  • an organism e.g., a microorganism in some cases arises from the particular phenomenon of organisms, e.g., microorganisms in which more than one enzyme (e.g., two or three biosynthetic enzymes) are encoded by genes occurring adjacent to one another on a contiguous piece of genetic material termed an "operon" (defined herein).
  • an "operon" defined herein. Due to the coordinated regulation of genes included in an operon, alteration or modification of the single promoter and/or regulatory element can result in alteration or modification of the expression of more than one gene product encoded by the operon.
  • Alteration or modification of the regulatory element can include, but is not limited to removing the endogenous promoter and/or regulatory element(s), adding strong promoters, inducible promoters or multiple promoters or removing regulatory sequences such that expression of the gene products is modified, modifying the chromosomal location of the operon, altering nucleic acid sequences adjacent to the operon or within the operon such as a ribosome binding site, increasing the copy number of the operon, modifying proteins (e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like) involved in transcription of the operon and/or translation of the gene products of the operon, or any other conventional means of deregulating expression of genes routine in the art (including but not limited to use of antisense nucleic acid molecules, for example, to block expression of repressor proteins).
  • Deregulation can also involve altering the coding region of one or more genes to yield, for example, an enzyme that is feedback resistant or has a higher or lower specific activity.
  • a recombinant organism e.g., microorganism is designed or engineered such that at least one B6 vitamer biosynthetic enzyme, is o ⁇ erexpressed.
  • the term "overexpressed” or “overexpression” includes expression of a gene product (e.g., a biosynthetic enzyme) at a level greater than that expressed prior to manipulation of the microorganism or in a comparable organism, e.g., microorganism which has not been manipulated.
  • the organism e.g., the microorganism can be genetically designed or engineered to overexpress a level of gene product greater than that expressed in a comparable organism, e.g., microorganism which has not been engineered.
  • Genetic engineering can include, but is not limited to, altering or modifying regulatory sequences or sites associated with expression of a particular gene (e.g., by adding strong promoters, inducible promoters or multiple promoters or by removing regulatory sequences such that expression is constitutive), modifying the chromosomal location of a particular gene, altering nucleic acid sequences adjacent to a particular gene such as a ribosome binding site, increasing the copy number of a particular gene, modifying proteins (e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like) involved in transcription of a particular gene and/or translation of a particular gene product, or any other conventional means of deregulating expression of a particular gene routine in the art (including but not limited to use of antisense nucleic acid molecules, for example, to block expression of repressor proteins).
  • modifying proteins e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like
  • Genetic engineering can also include deletion of a gene, for example, to block a pathway or to remove a repressor.
  • organisms having deleted genes the skilled artisan will appreciate that at least low levels of certain compounds may be required to be present in or added to the culture medium in order that the viability of the organism is not compromised. Often, such low levels are present in complex culture media as routinely formulated.
  • processes featuring culturing organisms having deleted genes cultured under conditions such that commercially or industrially attractive quantities of product are produced it may be necessary to supplement culture media with slightly increased levels of certain compounds.
  • the microorganism can be physically or environmentally manipulated to overexpress a level of gene product greater than that expressed prior to manipulation of the organism or in a comparable microorganism which has not been manipulated.
  • a organism can be treated with or cultured in the presence of an agent known or suspected to increase transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation are enhanced or increased.
  • a organism can be cultured at a temperature selected to increase transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation are enhanced or increased. IV.
  • culturing includes maintaining and/or growing a living microorganism of the present invention (e.g., maintaining and/or growing a culture or strain).
  • a microorganism of the invention is cultured in liquid media
  • a microorganism of the invention is cultured in solid media or semi-solid media.
  • a microorganism of the invention is cultured in media (e.g., a sterile, liquid media) comprising nutrients essential or beneficial to the maintenance and/or growth of the microorganism (e.g., carbon sources or carbon substrate, for example carbohydrate, hydrocarbons, oils, fats, fatty acids, organic acids, and alcohols; nitrogen sources, for example, peptone, yeast extracts, meat extracts, malt extracts, soy flour, urea, ammonium sulfate, ammonium chloride, ammonium nitrate and ammonium phosphate; phosphorus sources, for example, phosphoric acid, sodium and potassium salts thereof; trace elements, for example, magnesium, iron, manganese, calcium, copper, zinc, boron, molybdenum, and/or cobalt salts; as well as growth factors such as amino acids, vitamins, and the like).
  • media e.g., a sterile, liquid media
  • microorganisms of the present invention are cultured under controlled pH.
  • controlled pH includes any pH which results in production of the desired product, h one embodiment microorganisms are cultured at a pH of about 7. In another embodiment, microorganisms are cultured at a pH of between 6.0 and 8.5.
  • the desired pH may be maintained by any number of methods known to those skilled in the art.
  • microorganisms of the present invention are cultured under controlled aeration.
  • controlled aeration includes sufficient aeration (e.g. , oxygen) to result in production of the desired product.
  • aeration is controlled by regulating oxygen levels in the culture, for example, by regulating the amount of oxygen dissolved in culture media.
  • aeration of the culture is controlled by agitating the culture. Agitation may be provided by a propeller or similar mechanical agitation equipment, by revolving or shaking the culture vessel (e.g. , tube or flask) or by various pumping equipment. Aeration may be further controlled by the passage of sterile air or oxygen through the medium (e.g., through the fermentation mixture).
  • microorganisms of the present invention are cultured without excess foaming (e.g., via addition of antifoaming agents).
  • microorganisms of the present invention can be cultured under controlled temperatures.
  • controlled temperature includes any temperature which results in production of the desired product (e.g., a B6 vitamer).
  • controlled temperatures include temperatures between 15°C and 95°C.
  • controlled temperatures include temperatures between 15°C and 70°C.
  • Preferred temperatures are between 20°C and 55°C, more preferably between 30°C and 50°C.
  • Microorganisms can be cultured (e.g., maintained and/or grown) in liquid media and preferably are cultured, either continuously or intermittently, by conventional culturing methods such as standing culture, test tube culture, shaking culture (e.g., rotary shaking culture, shake flask culture, etc.), aeration spinner culture, or fermentation.
  • the microorganisms are cultured in shake flasks.
  • the microorganisms are cultured in a fermentor (e.g., a fermentation process). Fermentation processes of the present invention include, but are not limited to, batch, fed-batch and continuous processes or methods of fermentation.
  • batch process or “batch fermentation” refers to a closed system in which the composition of media, nutrients, supplemental additives and the like is set at the beginning of the fermentation and not subject to alteration during the fermentation, however, attempts may be made to control such factors as pH and oxygen concentration to prevent excess media acidification and/or microorganism death.
  • fed- batch process or “fed-batch” fermentation refers to a batch fermentation with the exception that one or more substrates or supplements are added (e.g., added in increments or continuously) as the fermentation progresses.
  • continuous process or “continuous fermentation” refers to a system in which a defined fermentation media is added continuously to a fermentor and an equal amount of used or “conditioned” media is simultaneously removed, preferably for recovery of the desired product (e.g., a B6 vitamer).
  • desired product e.g., a B6 vitamer
  • culturing under conditions such that a desired compound is produced includes maintaining and/or growing microorganisms under conditions (e.g., temperature, pressure, pH, duration, etc.) appropriate or sufficient to obtain production of the desired compound or to obtain desired yields of the particular compound being produced.
  • culturing is continued for a time sufficient to produce the desired amount of a compound (e.g., a B6 vitamer).
  • culturing is continued for a time sufficient to substantially reach suitable production of the compound (e.g., a time sufficient to reach a suitable concentration of a B6 vitamer).
  • culturing is continued for about 12 to 24 hours.
  • culturing is continued for about 24 to 36 hours, 36 to 48 hours, 48 to 72 hours, 72 to 96 hours, 96 to 120 hours, 120 to 144 hours, or greater than 144 hours.
  • the methodology of the present invention can further include a step of recovering a desired compound (e.g., a B6 vitamer).
  • the term "recovering" a desired compound includes extracting, harvesting, isolating or purifying the compound from culture media. Recovering the compound can be performed according to any conventional isolation or purification methodology known in the art including, but not limited to, treatment with a conventional resin (e.g., anion or cation exchange resin, non-ionic adsorption resin, etc.), treatment with a conventional adsorbent (e.g., activated charcoal, silicic acid, silica gel, cellulose, alumina, etc.), alteration of pH, solvent extraction (e.g., with a conventional solvent such as an alcohol, ethyl acetate, hexane and the like), dialysis, filtration, concentration, crystallization, recrystallization, pH adjustment, lyophilization and the like.
  • a conventional resin e.g., anion or cation exchange resin, non-ionic adsorption resin, etc.
  • a conventional adsorbent e.g., activated
  • a compound can be recovered from culture media by first removing the microorganisms from the culture. The resulting solutions are then passed through or over a cation exchange resin to remove cations and/or through or over an anion exchange resin to purify or concentrate the desired product. The resulting compound can subsequently be converted to a salt (e.g., a chloride or sulfate salt) by ion exchange.
  • a salt e.g., a chloride or sulfate salt
  • a desired compound of the present invention is “extracted,” “isolated” or “purified” such that the resulting preparation is substantially free of other media components (e.g., free of media components and/or fermentation byproducts).
  • the language “substantially free of other media components” includes preparations of the desired compound in which the compound is separated from media components or fermentation byproducts of the culture from which it is produced, hi one embodiment, the preparation has greater than about 80% (by dry weight) of the desired compound (e.g., less than about 20% of other media components or fermentation byproducts), more preferably greater than about 90% of the desired compound (e.g., less than about 10% of other media components or fermentation byproducts), still more preferably greater than about 95% of the desired compound (e.g., less than about 5% of other media components or fermentation byproducts), and most preferably greater than about 98- 99% desired compound (e.g., less than about 1-2% other media components or fermentation byproducts).
  • the compound When the desired compound has been derivatized to a salt, the compound is preferably further free of chemical contaminants associated with the formation of the salt.
  • the compound When the desired compound has been derivatized to an alcohol, the compound is preferably further free of chemical contaminants associated with the formation of the alcohol.
  • the desired compound is not purified from the microorganism, for example, when the microorganism is biologically non-hazardous (e.g., safe).
  • the entire culture (or culture supernatant) can be used as a source of product (e.g., crude product).
  • the culture (or culture supernatant) is used without modification.
  • the culture (or culture supernatant) is concentrated.
  • the culture (or culture supernatant) is dried or lyophilized.
  • a production method of the present invention results in production of the desired compound, e.g., a B6 vitamer, at a significantly high yield.
  • the phrase "significantly high yield” includes a level of production or yield which is sufficiently elevated or above what is usual for comparable production methods, for example, which is elevated to a level sufficient for commercial production of the desired product (e.g., production of the product at a commercially feasible cost).
  • the invention features a production method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g. , a B6 vitamer) is produced at a level greater than 5 mg/L.
  • the invention features a production method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g., a B6 vitamer) is produced at a level greater than 10 mg/L. In another embodiment, the invention features a production method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g., a B6 vitamer) is produced at a level greater than 50 mg/L. In yet another embodiment, the invention features a production method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g., a B6 vitamer) is produced at a level greater than 150 mg/L.
  • the desired product e.g., a B6 vitamer
  • biosynthetic precursor or “precursor” includes an agent or compound which, when provided to, brought into contact with, or included in the culture medium of a microorganism, serves to enhance or increase biosynthesis of the desired product.
  • the biosynthetic precursor or precursor is glutamine.
  • the biosynthetic precursor or precursor is ribose.
  • the amount of glutamine or ribose added is preferably an amount that results in a concentration in the culture medium sufficient to enhance productivity of the microorganism (e.g., a concentration sufficient to enhance production of a B6 vitamer).
  • the term "excess ribose or glutamine” includes ribose or glutamine levels increased or higher that those routinely utilized for culturing the microorganism in question. For example, culturing the Bacillus microorganisms described in the instant Examples can be done in the presence of about 0-5 g/L ribose or glutamine.
  • excess ribose or glutamine levels can include levels of about 5-10 g/L or more preferably about 5-20 g/L ribose or glutamine.
  • Biosynthetic precursors of the present invention can be added in the form of a concentrated solution or suspension (e.g., in a suitable solvent such as water or buffer) or in the form of a solid (e.g., in the form of a powder).
  • biosynthetic precursors of the present invention can be added as a single aliquot, continuously or intermittently over a given period of time. Methods for culturing other recombinant organisms, e.g., the recombinant plant organisms of the present invention, are known to one of skill in the art.
  • EXAMPLE 1 Biological assay for B6 vitamers using Saccharomyces uvarum.
  • B6 vitamers Quantitation of B6 vitamers in supernatants of cultures of microorganisms or extracts of organisms that have been genetically modified to increase production of B6 vitamers is conveniently done using Saccharomyces uvarum (formerly and still often named S. carlsbergensis) strain ATCC 9080 as the indicator strain or test organism.
  • Saccharomyces uvarum formerly and still often named S. carlsbergensis
  • the method is essentially that described in the Difco Manual (1984, Difco Laboratories, Detroit, MI, 10th Edition, pp. 1104-1106), with the modification that 50 mg/liter of streptomycin sulfate is added to the liquid growth medium for the test organism.
  • any other appropriate indicator organism may be used, together with a medium that is appropriate for that organism that is free of B6 vitamers.
  • colipdxB mutant can be used in a standard minimal medium that is well known in the art, such as M9 glucose minimal medium (Miller, J., (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).
  • M9 glucose minimal medium Miller, J., (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • S. uvarum strain ATCC 9080 Bacto Pyridoxine Y Medium (Difco Laboratories, available through VWR Scientific, Inc.), supplemented with 50 mg/liter streptomycin sulfate, is used for the serial dilutions, and PN, PL, or PM is used to generate the standard curve.
  • the responses to these three standard compounds are almost identical to each other with S. uvarum strain ATCC 9080 ( Figure 3).
  • EXAMPLE 2 Deletion of a portion of the yaaDE operon in B. subtilis.
  • the SOR and SNO genes of Cercospora nicotianae were originally identified by mutations that lead to hypersensitivity to singlet oxygen-generating reagents (Ehrenschaft, M., et al. (1999) Proc. Natl. Acad. Sci. USA 96: 9347-9378). Mutations in either of these genes also lead to PL auxotrophy.
  • the protein sequences obtained from translation of the SOR and SNO open reading frames were used as homology probes to search through the B. subtilis genome sequence using the BLAST homology search program of the Subtilist website.
  • the S ⁇ R protein was significantly homologous to the YaaD protein
  • the S ⁇ O protein was significantly homologous to the YaaE protein.
  • the genes encoding the YaaD and YaaE proteins occur adjacent to each other on the B. subtilis chromosome as a two gene operon.
  • General methods for growth, storage, transformation, and molecular biology ofB. subtilis strains are given in Harwood, C, and Cutting, S. (1990), Molecular Biological Methods for Bacillus, John Wiley and Sons, New York, NY, hereby incorporated in its entirety by reference.
  • the yaaDE operon DNA sequence was amplified using the Polymerase Chain Reaction (PCR) with Pfu Turbo DNA polymerase (Stratagene, Inc., used according to the manufacturer's instructions).
  • the DNA primers used were RY395 (SEQ LD NO:l) and RY396 (SEQ ID NO:2).
  • RY395 the upstream primer, introduces an Xbal site and artificial ribosome binding site.
  • RY396, the downstream primer introduces a BamHI site.
  • the template DNA was chromosomal DNA isolated form wild type B. subtilis strain PY79.
  • the blunt ended PCR product was ligated into the EcoRV site of pGEM5Zf(+) (Promega, Inc.) to give plasmid pAN368.
  • pDXIF plasmid pDXIF (SEQ ID NO:5, Figure 4).
  • pDXIF therefore is deleted for a portion of yaaD and a portion of yaaE.
  • pDXIF was used to transform wild type B. subtilis strain PY79 to 5 mg/liter chloramphenicol resistance, and a double crossover event was confirmed using PCR and the same primers used to clone yaaDE.
  • the resulting strain was named PXl .
  • PXl was able to grow on Spizizen's minimal medium with trace elements (SMM) (Harwood, C, and Cutting, S.
  • EXAMPLE 3 Deletion of yhaF in B. subtilis.
  • the protein sequence of the E. colipdxF gene was used as a probe to search the B. subtilis genome as described in Example 1. The only significant homolog was yhaF. In a fashion similar to that of Example 1 , the yhaF was cloned and deleted from the chromosome of PY79 using plasmid pDXl IF (SEQ ID NO:6, Figure 5), to give strain PXl 1.
  • the PCR primers used to clone yhaF were RY407 (SEQ LD NO:3) and RY408 (SEQ ID NO:4).
  • the restriction sites used for insertion of the antibiotic resistance gene were the PshAl and Ehel sites in the yhaF coding region.
  • PXl 1 is a serine auxotroph, but not a PL auxotroph.
  • yhaF functions in serine synthesis and probably encodes the equivalent of SerC, but that the YhaF protein is not required for PLP synthesis in B. subtilis. Therefore, it is established that sequence homology alone does not necessarily imply functional homology.
  • EXAMPLE 4 Overexpression of the yaaDE operon in B. subtilis.
  • the Xbal to BamHI fragment from pAN368 that contains the yaaDE operon and artificial ribosome binding site was inserted into either of two expression vectors, to yield plasmids pDX14R (SEQ LD NO:7) and pDX17R (SEQ ID NO:8), respectively.
  • pDX14R and pDX17R the yaaDE operon is expressed from the strong constitutive B. subtilis phage SP01 promoters, P 2( j and P 15 , respectively (see Figures 6 and 7).
  • pDX14R and pDX17R were each transformed into wild type B. subtilis strain PY79, selecting for chloramphenicol resistance.
  • the plasmids integrate into the chromosome at the yaaDE locus by single crossover.
  • the resulting strains were named PX14 and PX17, respectively.
  • PX14 and PX17 were grown for 48 hours at 37°C in 5 ml test tube cultures in a roller drum at about 100 rotations per minute.
  • the culture medium was SNY (20 g Difco Veal Infusion Broth, 5 g Difco Yeast Extract, 2 g ammonium sulfate, 5 g sodium glutamate, and 30 g glucose per liter, buffered with 200 mM potassium phosphate, pH 7.0).
  • strain PX14 After subtracting the B6 vitamers contained in the medium, strain PX14 produced 7.0 mg/liter PL equivalents, while the parent PY79 produced only 0.6 mg/liter of PL equivalents.
  • expression of the yaaDE operon has been shown to be rate limiting for B6 vitamer production in B. subtilis.
  • EXAMPLE 5 Shake flask experiments to determine Be vitamer production from B. subtilis strain PX14 containing an amplifiable P 26 yaaDE cassette.
  • PX14 and PY79 were grown in parallel in shake flasks in soy flour, maltose, MOPS medium (SMM).
  • SMM MOPS medium
  • the 200 ml baffled shake flasks contained 40 ml of medium, were covered with 4X Bioshield covers, and shaken at 37°C and 300 rpm. Samples were taken at 24 and 48 hours and analyzed for vitamer concentration by HPLC (Table 3).
  • Titers produced by the parental control strain PY79 were 3 mg/1.
  • PXl 4 produced a B 6 titer of 45 mg/L when grown in shake flasks containing SMM. In shake flasks, where the overall vitamer concentration increased with time, the amount of PN produced increased and exceeded that of PMP at 48 hours (Table 3).
  • B. subtilis has a fairly broad temperature range of growth up to approximately 50°C.
  • a significant increase of B 6 titer was seen with B. subtilis strain PX14 when grown in shake flasks with SMM at 43°C as compared to 37°C (Table 4).
  • the B 6 titer increased more than 25% at 43°C as compared to that at 37°C.
  • Total vitamer is equal to the sum of PMP, PM, PL and PM and reported in mg/1.
  • 3 SMM contains in a final volume of 200 ml: 4.0 g soy flour, 1.6 g (NH 4 ) 2 S0 4 , 1.0 g monosodium glutamate, 2.0 ml 100 X PSTE trace minerals, 5.0 ml 4 M potassium phosphate buffer pH 7.2, 40 ml 1.5 M MOPS buffer pH 7.2, and deionized water. Added after autoclaving at 20X concentrate to give a final concentration of 3% maltose with 5 mM magnesium chloride and 0.7 mM calcium chloride.
  • 100 X PSTE contains 0.2 g/1 MnCl 2 ⁇ 2 0, .15 g/1 ZnS0 4 7 H 2 0, 0.2 g/1 CoCl 2 6 H 2 0, 0.025 CuS0 4 5 H 2 0 and 0.075 g/1 Na 2 MoCV2H 2 0.
  • Total vitamer is equal to the sum of PMP, PM, PL and PM and reported in mg/L.
  • EXAMPLE 6 Complementation of E. colipdx mutants by plasmids that express the B. subtilis yaaDE operon.
  • Plasmid pDX14R described above in Example 4, was used to transform various E. coli strains that contained mutations that lacked function in each of the known genes involved in PLP biosynthesis (except for dxs , which is an essential gene for E. coli). The selection was for resistance to 250 mg/liter ampicillin. Each transformant was then tested for growth on minimal medium (SMM with 0.5 % glucose, see Example 2) supplemented with 100 mg/liter serine, and compared to growth of its respective untransformed parent on the same medium. All mutations tested were complemented by pDX14R. Specifically,/? ⁇ , pdxB, pdxF, pdxJ, andpdxH, were all complemented by pDX14R.
  • coli PLP biosynthetic pathway (for example that in apdxB mutant) does not prevent y ⁇ DE from complementation, the substrates for the enzyme(s) encoded by y ⁇ DE are not likely to be the same as for the last step in PMP or PLP synthesis in wild type E. coli.
  • B6 vitamers using B. subtilis y ⁇ DE or the homologous genes from another organism (for example, but not limited to, SOR and SNO from Cercospora nicotianae or PDXl and PDX2 from S. cerevisiae) in a heterologous host species, including, but not limited to, E. coli and Oryza sativa.
  • EXAMPLE 7 Overexpression of the yaaDE operon in E. coli.
  • Plasmids pDX14R and pDX17R were transformed into E. coli strain DH5 ⁇ (New England Biolabs), selecting for ampicillin resistance. The transformants were grown for 48 hours in 5 ml test tube cultures at 37°C, and the supernatants were worked up as in Example 3. The assay results for PL equivalents are shown in Table 5, below. Table 5: Production of B6 vitamers by Escherichia coli harboring plasmids containin en ineered Bacillus subtilits enes 1
  • E. coli test tube cultures are grown in SVY for 48 hours.
  • the yaaD and yaaE genes can be expressed in a heterologous host strain, and B6 vitamers can still be overproduced.
  • the yaaD and yaaE genes of B. subtilis can be overexpressed in any organism where an overexpression system exists, and in the resulting strains, B6 vitamers will be overproduced.
  • Overproduction of the rate limiting enzyme for B6 vitamer production in any organism that is capable of producing B6 vitamers will lead to overproduction of B6 vitamers.
  • EXAMPLE 8 Test tube experiment to determine Be vitamer production from E. coli strain DH5 (pDX14) grown on SVY supplemented with pentose or hexose carbon sources.
  • E. coli strain DH5 ⁇ harboring a plasmid containing the P 2 y ⁇ DE cassette were grown in a variety of SVY based media containing a pentose (xylose or ribose) or hexose (glucose or maltose) as the carbohydrate source. The strains were also grown on SVY medium containing no carbohydrate source as a control. Production of B 6 vitamers from E.
  • coli strain DH5 ⁇ (pDX14) grown in SVY ribose is greater than that from E. coli strain DH5 ⁇ (pDX14) grown in SVY xylose, glucose , arabinose or maltose. More than 60 mg/1 of total B 6 vitamers have been produced in the DH5 ⁇ (pDX14) cultures grown in SVY ribose test tube with PN as the major product (Table 6). TABLE 6. Production of B 6 vitamers by -E. coli harboring a plasmid containing engineered B. subtilis genes and grown in the presence or absence of hexose or pentose carbon sources.
  • EXAMPLE 9 Vitamin B ⁇ titers of a pdxB E. coli strain producing YaaD in the absence of YaaE
  • E. coli strain WG1012 pdxB was transformed with pDX14 and pDX24 (plasmid isolates N2, D2 and D6), and control plasmid pBR322.
  • pDX14 and pDX24 plasmid isolates N2, D2 and D6
  • control plasmid pBR322 were grown in 5 mL test tube cultures in SVY ribose in roller drums at 37°C for 48 hours. Ribose was chosen as the carbon source, since past experiments showed that ribose improved B 6 vitamer production in E. coli transformants.
  • B 6 titers of culture supernatants were determined by HPLC assay.
  • the plasmids that complemented the pdxB strain led to measurable production of B 6
  • the plasmids (i.e. pBR322) that did not complement did not lead to any measurable B 6 (Tables 7 and 8).
  • pDX24 which contains the yaaD ORF, produced approximately 7-10 mg/L of the B 6 vitamers.
  • E. coli strain WG1012 (pdxB) containing pDX24 produced only a fraction of the amount of B 6 as compared to the E. coli strain WG1012 harboring pDX14 containing the P26y aDE cassette (Table 8).
  • YaaD is functional by itself and can catalyze the synthesis of vitamers similar in composition to those synthesized by YaaDE, albeit less efficiently. It appears that while YaaE is not absolutely essential for B 6 synthesis, it provides a supportive role to YaaD, thereby leading to higher B 6 titers. YaaD is also able to function independently of YaaE in B. subtilis, however, less efficiently than when YaaE is present. Expressing a copy of P ' 26 yaaD in either PXl or PY79 resulted in higher titers of B 6 vitamers as compared to the respective parental controls.
  • YaaD complements a pdxB E. coli auxotroph.
  • test tube cultures 5 mL test tube cultures were grown in SVY-ribose and roller drams at approximately 100 RPM, 37°C for 48 hours. Vitamers were quantified by HPLC.
  • the YaaD and YaaE protein sequences were used as probes to search the NCBI database for homologs in plants using the BLASTTM program which can be found at the National Center for Biotechnology Information website (Altschul S.F (1990) J. Mol. Biol. 215(3):403-10).
  • BLASTTM program which can be found at the National Center for Biotechnology Information website.
  • Several homologs of YaaD were found in several genera of plants, including Arabidopsis, Oryza, Ginkgo, Hevea, Phaseolus, and Stellaria.
  • Two homologs of YaaE were found in Arabidopsis thaliana. However, no homologs of pdxA and pdxJ were found. Therefore, the plant kingdom appears to use the Type B Pathway for B6 vitamer biosynthesis.
  • the overexpression of the yaaDE operon leads to an increase in the amount of the encoded enzyme(s), which in turn leads to an increase in the total activity of said enzyme(s). Increase in this activity leads to an increase in the production B6 vitamer.
  • Other methods can be used to increase the activity of the relevant enzyme(s) under conditions of B6 vitamer production. For example, in addition to increasing the amount of a relevant enzyme(s), the total activity of the relevant enzyme(s) can be increased by mutating the gene(s) to increase the specific activity of the enzyme(s), and/or by mutating the gene(s) to encode a feedback resistant variant of the enzyme(s).
  • Such desirable mutations can be obtained by screening large numbers of mutants for the increased activity as evidenced by an increase in B6 vitamer production as described in Example 4, or by selecting for mutants that are resistant to inhibitors that are specific for the PLP biosynthetic pathway, and screening among those mutants for an increase in B6 vitamer production.
  • inhibitors are isoniazid, iproniazid, and ginkgotoxin (4'-methoxy pyridoxine) (Dempsey and Arcement (1971) J. Bacteriol. 107(2 : 580-582; Pflug, W., and Lingens, F., (1978) Hoppe-Seyler's Z. Physiol. Chem. 359: 559-570; Fiehe, K., et al., (2000) J. Nat. Prod. 63(2): 185-189).
  • EXAMPLE 11 Processing of biosynthetic B6 vitamers.
  • a B6 vitamer produced by a genetically modified organism of the invention can be harvested and processed into a format that is appropriate for commercial use. For example, after culturing a B6 vitamer producing micro-organism in liquid culture, the entire culture, including cells can be dried by evaporation or by spray drying, and the resulting powder can be mixed into animal feeds. Alternatively, the cells can be first removed by centrifugation or filtration, and the resulting supernatant solution can be dried as described above.
  • the B6 vitamer can be purified from the culture broth by techniques well known in the art, such as filtration, reverse osmosis, column chromatography (ion exchange, hydrophobic or hyrophilic adsorption, gel filtration, etc.), solvent extraction, precipitation, distillation, evaporation, and the like.
  • the B6 vitamer producing organism is a plant
  • the appropriate portion of the plant for example the leaves, stems, roots, flowers, fruits, seeds, or any combination thereof
  • the plant material can be dried and used directly, or the material can be pulverized or ground and the B6 vitamer extracted and/or processed as described above for cultures.
  • the production organism can be a micro-organism that normally inhabits the gut of humans or an animal if interest (for example one of many bacteria of the genus Lactobacillus, such as E. acidophilus ), and the B6 vitamer can be delivered by ingestion of the organism.
  • EXAMPLE 12 Genes homologous to yaaDE expressed in host organisms for the production of B6.
  • Preferred methods for the production of vitamin B6 involve expression of Bacillus subtilis yaaD and/or yaaE or expression of genes that are homologous to Bacillus subtilis yaaD and/or yaaE in host organisms (type A or type B organisms) such as E. coli, S. cerevisiae, Arabidopsis thaliana, etc.
  • BLASTTM Basic Alignment Search Tool
  • the BLASTTM search tool can be found and used at the National Center for Biotechnology Information website.
  • BLASTTM is an algorithm designed to compare sequences and provide sequence alignments between two or more previously characterized sequences and also provides a method for rapid searching of nucleotide and protein databases.
  • a typical description line of a BLAST output table is given as "gi
  • the E value also reflects the size of the database and the scoring value used. The lower the E value, the more significant the homology.
  • the description lines in the BLASTTM output table (Table 9, below) represents a typical BLASTTM query of the primary amino acid sequence of B. subtilis YaaD and is sorted by increasing E value with the most significant alignments (lowest E values) at the top.
  • a similar BLASTTM query of primary amino acid sequence of B. subtilis YaaE is represented in Table 10, below. These alignments represent a small portion of the protein sequences homologous to YaaD and YaaE protein sequences from various organisms as the sequences from many organisms have not been, or only partially, categorized into the current databases.
  • Table 9 Sequences producing significant alignments to Bacillus subtilis YaaD
  • Score E (bits) Value gi 586857
  • Score E (bits) Value gi 467402 I dbj
  • EXAMPLE 13 Characterizing functional B. subtilis yaaD and yaaE homologs by complementation of E. colipdx mutants by plasmids that express the B. subtilis yaaD and/or yaaE homologs.
  • DNA homologous to yaaD and yaaE sequences or DNA encoding proteins homologous to YaaD and/or YaaE, identified by BLASTTM or other methods can be amplified using the Polymerase Chain Reaction (PCR) with Pfu Turbo DNA polymerase (Stratagene Inc., used according to the manufacturers instructions) using appropriately designed DNA primers.
  • PCR Polymerase Chain Reaction
  • Pfu Turbo DNA polymerase (Stratagene Inc., used according to the manufacturers instructions) using appropriately designed DNA primers.
  • subtilis described in Example 4 a DNA fragment that contains a homologous gene or operon (Type B pathway) and artificial ribosome binding site can be inserted into an appropriate expression vector for example either of two expression vectors from Example 4.
  • the yaaDE homologs would be expressed from a strong constitutive B. subtilis phage SP01 promoter such as P JS or R 2 ,j.
  • the resulting plasmids can be used to transform various E. coli or B. subtilis strains that contain mutations that lack function in known genes involved in PLP synthesis.
  • the transformants can be selected for resistance to an appropriate antibiotic (such as ampicillin) that is encoded by the plasmid harboring the yaaDE homologs.
  • Transformants can be tested for growth on minimal medium (SMM with 0.5% glucose) supplemented with 100 mg/L serine, and compared to growth of its respective untransformed parent on the same medium.
  • True transformants (as opposed to revertants) that grow on minimal medium without any added B6 vitamer(s), can be concluded to contain a gene or genes that function in the biosynthesis of B6.
  • EXAMPLE 14 Assay for the detection of B6 vitamers.
  • An assay for the detection of B6 vitamers produced in heterologous systems can be performed by using Sacchromyces uvarum as an indicator strain described in Example 1.
  • An alternative assay is an HPLC assay. Quantitation of B6 vitamers in supematants of cultures of microorganisms or extracts of organisms that have been genetically modified to increase the production of B6 vitamers can be accomplished by filtration (Centricon, 0.45 ⁇ m), followed by high pressure liquid chromatography (HPLC). Quantitation is accomplished by comparing samples to standard curves generated by running a known solution of PMP, PLP, PNP, PM , PL or PN.
  • filtered supematants are diluted 1/5 with 0.45 ⁇ m filtered Buffer A (50mM KPO 4 , 5 mM EDTA, 2% acetonitrile, pH 7.0) and 10 ⁇ L of this solution is injected onto a 250 x 4.6 mM AquaTM 5 ⁇ C18 column run on an AgilentTM 1100 series HPLC equipped with a G1321 A fluorescence detector.
  • the excitation wavelength is 330 nM and the emission wavelength is 380 nM.
  • An isocratic flow is maintained on the C18 column for 15 minutes with buffer A at 1 mL/min.
  • EXAMPLE 15 Genes homologous to the type A B6 biosynthetic pathway expressed in host organisms for the production of B6.
  • Preferred methods for the production of vitamin B6 feature the expression of a gene of the type A pathway, e.g., epd, pdxA, pdxJ, pdxF, pdxB, pdxH or dxs homologs, or a combination thereof, in host organisms (type A or type B organisms) such as E. coli, S. cerevisiae, Arabidopsis thaliana, etc.
  • host organisms type A or type B organisms
  • a procedure such as a protein or nucleotide BLASTTM search can be implemented as described in Example 12 (Altschul, Stephen F. (1997) Nucleic Acids Res. 25 :3389-3402). Function can further be confirmed as described in Example 13.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne des méthodes de production de vitamères B6 consistant à cultiver un organisme surexprimant une enzyme qui catalyse une étape dans la biosynthèse d'un vitamère B6 dans des conditions permettant la production d'un vitamère B6. La présente invention concerne en outre des méthodes de production de vitamères B6 consistant à cultiver des micro-organismes recombinés présentant une activité accrue d'au moins une enzyme biosynthétique de vitamère B6, telle que YaaD ou YaaE, ou d'un homologue correspondant, ou de Epd, PdxA, PdxJ, PdxF, PdxB, PdxH et/ou Dxs, ou d'un homologue correspondant.
PCT/US2003/008880 2002-03-22 2003-03-21 Methodes et organismes pour la production de vitameres b6 WO2004035010A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US10/508,768 US20050164335A1 (en) 2002-03-22 2003-03-21 Methods and organisms for production of b6 vitamers
AU2003298508A AU2003298508A1 (en) 2002-03-22 2003-03-21 Methods and organisms for production of b6 vitamers

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US36708902P 2002-03-22 2002-03-22
US60/367,089 2002-03-22
US36786302P 2002-03-25 2002-03-25
US60/367,863 2002-03-25
US36861802P 2002-03-29 2002-03-29
US60/368,618 2002-03-29
US45182403P 2003-03-03 2003-03-03
US60/451,824 2003-03-03

Publications (3)

Publication Number Publication Date
WO2004035010A2 true WO2004035010A2 (fr) 2004-04-29
WO2004035010A8 WO2004035010A8 (fr) 2004-06-10
WO2004035010A3 WO2004035010A3 (fr) 2006-01-26

Family

ID=32398253

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/008880 WO2004035010A2 (fr) 2002-03-22 2003-03-21 Methodes et organismes pour la production de vitameres b6

Country Status (2)

Country Link
AU (1) AU2003298508A1 (fr)
WO (1) WO2004035010A2 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007142222A1 (fr) * 2006-06-09 2007-12-13 Daiichi Fine Chemical Co., Ltd. Procédé de production de pyridoxamine
CN105148987A (zh) * 2015-07-15 2015-12-16 上海师范大学 一种吡哆醛类催化剂及其合成方法与应用
WO2018207930A1 (fr) 2017-05-12 2018-11-15 三井化学株式会社 Micro-organisme recombinant et procédé de production de pyridoxamine ou d'un sel de celle-ci, à l'aide dudit micro-organisme recombinant
WO2018207931A1 (fr) 2017-05-12 2018-11-15 三井化学株式会社 Micro-organisme recombinant, procédé de production de pyridoxamine ou d'un sel de celle-ci en utilisant un micro-organisme recombinant et procédé de production de pyridoxal ou d'un sel de celui-ci en utilisant un micro-organisme recombinant
CN114657159A (zh) * 2022-05-24 2022-06-24 中国科学院天津工业生物技术研究所 4-磷酸羟基-L-苏氨酸脱氢酶PdxA突变体及其在制备维生素B6中的应用

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE MEDLINE [Online] 1997 KUNST ET AL: 'The complete genome sequence of the Gram-positive bacterium Bacillus subtilis.' Retrieved from stn Database accession no. (S66041) *
DREWKE ET AL: 'Biosynthesis of Vitamin B6 and Structurally Related Derivatives.' VITAMINS AND HORMONES. vol. 61, 2001, pages 121 - 155 *
EHRENSHAFT ET AL: 'Isolation of PDX2, a Second Novel Gene in the Pyridoxine Biosynthesis Pathway of Eukaryotes, Archaebacteria, and a Subset of Eubacteria.' J BACTERIOL. vol. 183, no. 11, June 2001, pages 3383 - 3390 *
MITTENHUBER G. ET AL: 'Phylogenetic Analyses and Comparative Genomics of Vitamin B6 (Pyridoxine) and Ppyridoxal Phosphate Biosynthesis Pathways.' J MOL MICROBIOL BIOTECHNOL. vol. 3, no. 1, January 2001, pages 1 - 20 *
PFLUG ET AL: 'Vitamin B 6 Biosynthesis in Bacillus Subtilis.' PHYSIOL CHEM. vol. 359, no. 5, May 1978, pages 559 - 570 *
RASCHLE ET AL: 'On the Two Components of Pyridoxal 5'-Phosphate Synthase from Bacillus Subtilis.' J BIOL CHEM. vol. 280, no. 37, 16 September 2005, pages 32291 - 32300 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007142222A1 (fr) * 2006-06-09 2007-12-13 Daiichi Fine Chemical Co., Ltd. Procédé de production de pyridoxamine
CN105148987A (zh) * 2015-07-15 2015-12-16 上海师范大学 一种吡哆醛类催化剂及其合成方法与应用
WO2018207930A1 (fr) 2017-05-12 2018-11-15 三井化学株式会社 Micro-organisme recombinant et procédé de production de pyridoxamine ou d'un sel de celle-ci, à l'aide dudit micro-organisme recombinant
WO2018207931A1 (fr) 2017-05-12 2018-11-15 三井化学株式会社 Micro-organisme recombinant, procédé de production de pyridoxamine ou d'un sel de celle-ci en utilisant un micro-organisme recombinant et procédé de production de pyridoxal ou d'un sel de celui-ci en utilisant un micro-organisme recombinant
CN114657159A (zh) * 2022-05-24 2022-06-24 中国科学院天津工业生物技术研究所 4-磷酸羟基-L-苏氨酸脱氢酶PdxA突变体及其在制备维生素B6中的应用
CN114657159B (zh) * 2022-05-24 2022-08-23 中国科学院天津工业生物技术研究所 4-磷酸羟基-L-苏氨酸脱氢酶PdxA突变体及其在制备维生素B 6中的应用

Also Published As

Publication number Publication date
AU2003298508A1 (en) 2004-05-04
AU2003298508A8 (en) 2004-05-04
WO2004035010A3 (fr) 2006-01-26
WO2004035010A8 (fr) 2004-06-10

Similar Documents

Publication Publication Date Title
JP5392957B2 (ja) パント−化合物を産生するための方法および微生物
Rachid et al. Deciphering regulatory mechanisms for secondary metabolite production in the myxobacterium Sorangium cellulosum So ce56
JP2009501547A (ja) 微生物におけるメチオニン生産を改善するためのバチルス属ｍｅｔＩ遺伝子の使用
WO2021156509A1 (fr) Micro-organisme modifié et procédé pour la production améliorée d'ectoïne
EA011232B1 (ru) Биохимический синтез 1,4-бутандиамина
US11254709B2 (en) Method for promoting Bacillus subtilis to synthesize surfactin based on multi-gene synergy
US8232081B2 (en) Methods and microorganisms for production of panto-compounds
JP7497426B2 (ja) 葉酸生産菌株およびその製造と使用
Tran et al. Production of 5-aminolevulinic acid by recombinant Streptomyces coelicolor expressing hemA from Rhodobacter sphaeroides
US20050164335A1 (en) Methods and organisms for production of b6 vitamers
CN110484481B (zh) 一种通过改造林可链霉菌slcg_3128基因提高林可霉素产量的方法
CN113461789B (zh) 一种来源于伯克霍尔德氏菌的LysR家族转录调控蛋白、基因及应用
KR20200134333A (ko) 발효에 의한 히스타민 생산을 위해 조작된 생합성 경로
WO2004035010A2 (fr) Methodes et organismes pour la production de vitameres b6
CN109136253B (zh) 一种通过糖多孢红霉菌sace_5754基因途径提高红霉素产量的方法
JP2005531326A (ja) パントテン酸の高生産のための微生物及び方法
KR20020029767A (ko) 환상 뎁시펩티드 합성효소 및 그의 유전자 및 환상뎁시펩티드의 대량생산계
JP5587763B2 (ja) 二次代謝物の製造方法
CN107723308B (zh) 一种化合物balanol的生物合成方法及基因簇
Cheng et al. Investigation of proteomic responses of Streptomyces lydicus to pitching ratios for improving streptolydigin production
Rodionova et al. A riboflavin transporter in Bdellovibrio exovorous JSS
AU7449600A (en) Transformant producing secondary metabolite modified with functional group and novel biosynthesis genes
EP4215601A1 (fr) Bactéries génétiquement modifiées résistant à la lyse cellulaire de masse
CN116096881A (zh) 生产5-甲基叶酸盐的微生物
Dwars Synthesis of fungal secondary metabolites via heterologous expression

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: IN PCT GAZETTE 18/2004 UNDER (30) REPLACE "NOT FURNISHED" BY "60/451,824"

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 10508768

Country of ref document: US

122 Ep: pct application non-entry in european phase
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP