WO2004007720A2 - Traitement de troubles proliferatifs - Google Patents

Traitement de troubles proliferatifs Download PDF

Info

Publication number
WO2004007720A2
WO2004007720A2 PCT/GB2003/002993 GB0302993W WO2004007720A2 WO 2004007720 A2 WO2004007720 A2 WO 2004007720A2 GB 0302993 W GB0302993 W GB 0302993W WO 2004007720 A2 WO2004007720 A2 WO 2004007720A2
Authority
WO
WIPO (PCT)
Prior art keywords
enzyme
inhibitor
pgm
host
cancer
Prior art date
Application number
PCT/GB2003/002993
Other languages
English (en)
Other versions
WO2004007720A3 (fr
Inventor
David Hugh Beach
Hiroshi Kondoh
Original Assignee
University College London
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University College London filed Critical University College London
Priority to AU2003254447A priority Critical patent/AU2003254447A1/en
Publication of WO2004007720A2 publication Critical patent/WO2004007720A2/fr
Publication of WO2004007720A3 publication Critical patent/WO2004007720A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the invention also relates to methods for the identification of substances useful in the treatment of proliferative disorders.
  • the invention relates to a method for immortalising cells.
  • This invention is based on the identification of a gene encoding phosphoglycerate mutase (PGM) that leads to an extension of life span when over-expressed in primary mouse fibrob lasts (MEFs).
  • MEFs isolated from day 13.5 mouse embryos undergo replicative senescence after a limited number of cellular divisions in tissue culture. When PGM was over-expressed in primary MEFs, they bypassed senescence and continued to proliferate indefinitely.
  • PGM is a glycolytic enzyme converting 3 -phosphoglycerate to 2- phosphoglycerate in the presence of 2,3-biphosphoglycerate (Figure 1).
  • Mammalian cells express two isoforms of PGM. The brain isoform is predominantly expressed in most tissues, whereas the muscle isoform is predominantly restricted to muscle tissues. Both the brain and muscle isoforms of PGM were capable of bypassing senescence in the MEF model.
  • GPI phospho glucose isomerase
  • an inhibitor of an enzyme of the glycolytic pathway in the manufacture of a medicament for use in the treatment of a cancer or other proliferative disorder.
  • the invention also provides: an inhibitor of an enzyme of the glycolytic pathway for use in the treatment of a cancer or other proliferative disorder; - a pharmaceutical composition comprising an inhibitor of an enzyme of the glycolytic pathway and a pharmaceutically acceptable carrier or diluent; a method for the treatment of a host suffering from a cancer or other proliferative disorder, which method comprises administering to the host a therapeutically effective amount of an inhibitor of an enzyme of the glycolytic pathway; - a method for identifying a substance for use in the treatment of a cancer or other proliferative disorder, which method comprises: (a) providing a polynucleotide construct comprising a promoter of a gene encoding an enzyme of the glycolytic pathway, or a functional equivalent thereof, operably linked to a coding sequence; (b) contacting a test substance with the polynucleotide construct under conditions that, in the absence of the test substance, would permit expression of the polypeptide encoded by the coding sequence; and (c) determining the level of expression
  • (c) administering to the host a therapeutically effective amount of the pharmaceutical composition formulated in (b); a method for the diagnosis of a cancer or other proliferative disorder in a host, which method comprises determining the level of expression and/or activity of an enzyme of the glycolytic pathway in the host, thereby to determine whether the host is suffering from a cancer of other proliferative disorder; a method for determining the effectiveness of treatment for a cancer or other proliferative disorder in a host, which method comprises determining the level of expression and/or activity of an enzyme of the glycolytic pathway in the host, thereby to determine the effectiveness of the treatment for a cancer or other proliferative disorder in the host; a method for immortalising a cell, which method comprises activating the level of expression and/or activity of an enzyme of the glycolytic pathway in the cell. a cell obtainable by a such a method; and - a method of treatment of a host suffering from a condition treatable with immortalised cells, which method comprises:
  • Figure 1 shows the glycolytic pathway
  • Figure 2 shows an outline of the senescence screen used to identify PGM: (i) generate early passage MEF; (ii) infect target cells with mouse embryo cDNA library; (iii) hygromycin selection; (iv) seed cells at low density; (v) grow cells for colony formation; (vi) identify individual immortal colonies; and (vii) positive cDNAs isolated and identified.
  • FIG 3 shows the growth characteristics of MEFs infected with retrovirus's expressing different cDNAs.
  • the growth promoting effects of PGM were as penetrant as that of p53 inactivation (cells expressing the p53DN allele).
  • Figure 3d shows that, at passage 10, vector infected cells (right panel) are senescent with a large flattened morphology, while cells immortalised by p53DN (middle panel) or PGM-M(right) are not.
  • Figure 3e shows that the PGM-B (brain) form is much more abundant than the PGM-M (muscle) form in MEFs.
  • Figure 3f 5 shows that wild-type MEFs quickly stopped dividing after ras introduction.
  • Figure 3g shows that p53DN + ras cells could form colonies, but PGM-M + ras cells could not
  • Figure 4 shows the PGM activity of whole cell lysates. Activity in MEFs expressing BPGM and MPGM was increased almost two fold in comparison to the activity in early passage replicative MEFs (MEF p4). The PGM activity in two mouse
  • CGR8 and DE3 10 embryonic stem cell lines which are naturally immortal was also elevated two fold compared to early passage MEF cells.
  • FIG. 5 shows that PGM activity is spontaneously immortalised in CD1 MEF cells.
  • the PGM activity of spontaneously immortalised MEF lines (SI1 -SI10) was compared to that of early passage MEFs (MEF p3) and to mouse embryonic stem cell
  • Figure 6 shows that immortalisation of MEF cells by PGM is reversible. In vivo CRE excision was used to excise PGM expressing integrated provirus. In vivo excision
  • Figure 7a shows mutations that were introduced into PGM, which correspond to Saccharomyces cerevisiae mutations known to inactivate either the substrate binding or
  • FIG. 7b shows the growth rates of primary MEFs into which the mutated alleles had been introduced as determined by the 3T3 protocol.
  • Three of the mutations introduced (R90Q, R116Q and R117Q) abolished the life extending properties of PGM when introduced into MEFs.
  • One of the mutations (E89D) prevented replicative senescence, but the growth rate of this cell line was slower than cells immortalised with
  • FIG. 7c shows the effect of the mutated alleles on cell morphology.
  • Cells expressing R90Q, Rl 16Q and Rl 17Q had a large flattened morphology typical of senescent cells and similar to cells infected with the pMaRXTVhygro control.
  • Cells infected with PGM, p53DN control and E89D had morphologies indicative of replicative cells (small fibroblast like cells).
  • Figure 7e shows PGM activation during spontaneous immortalisation.
  • the upper panel shows cell number (solid line) and glycolytic flux measured by the metabolic ratio of D-[3- Ffjglucose (open bar). Phosphoglycerate kinase (PGK), PGM and enolase activities were measured at various passages during 3T3 protocol of wild type MEF.
  • Figure 7f shows the glycolytic flux in a number of different cell lines as measured by the metabolic ratio of D-[3- 3 H]glucose.
  • Figure 7g shows the ratio of lactate accumulation versus glucose consumption measured in a number of different cell lines.
  • Figure 7h shows the activities of several glycolytic enzymes measured in MEF, mouse ES cells, CGR8 and DE3.
  • FIG 8 shows the use of RNAi to reduce the expression level of PGM in primary MEF cells. Specific RNAi molecules were generated to either the brain (PGM-
  • Figure 9 shows that a senescence phenotype was provoked in wild-type MEFs by the inactivation of PGM or glucose phosphate isomerase (GPI) by siRNA.
  • Wild-type MEFs were transfected with siRNA after seeding at 0.5 million cells per 10cm dish. Five days after transfection, cells were collected for a glycolytic enzyme assay (Figure 9a) or fixed for SA- ⁇ -GAL staining ( Figures 9b and c).
  • Figure 9d shows that PGM activity was reduced by specific siRNA.
  • Figure 9e shows that blue SA- ⁇ -GAL stained cells were increased by PGM siRNA.
  • Figure 10 shows the results of overexpression of PGM in MEFs on glucose metabolism. Glucose consumption and lactate production in culture supernatants from MEFs infected with PGM or the vector alone. Glucose consumption is reduced in PGM cells, whilst lactate production remains relatively unaltered.
  • Figure 11 shows the viability of PGM-M, p53DN and vector only cell lines after 24 hours treatment with H 2 O 2 was measured using trypan blue staining.
  • Figure 11a shows the results of various concentrations of H 2 O 2 used.
  • Figure 1 lb shows a semi- quantitative RT-PCR evaluation of the p53 response after 24 hours treatment of PGM cells with H O 2 was carried out.
  • Figure l ie shows the results of a p53 responsive promotor luciferase assay.
  • Bax promotor luciferase or p21 promotor luciferase plasmid - was co-transfected with p53wt plasmid and a glycolytic enzyme cDNA plasmid into p53 null MEFs.
  • Figure l id shows that p53 protein was less induced by H O 2 treatment in PGM cells.
  • Figure l ie shows that PGM modulated p53 protein levels in the presence of Mdm2.
  • Figure 1 If shows that Trxl and pi 07 mRNA expression were strongly repressed in PGM cells.
  • Figure 12 shows the results of WT or mutant PGM plasmid introduced into immortalised MEF, p53DN or p21RM (p21null+ras+myc) cells. After drug selection, 1 million cells were seeded on 10cm dishes. 10 days later, plates were fixed for Crystalviolet staining (see Figure 12 a). The lower panel of Figure 12a shows that a senescent phenotype was induced by mutant PGM in p53DN cells.
  • Figure 12b shows that PGM siRNA induced senescence in p53DN or p53DN+ras expressing cells. PGM siRNA induced senescence in several cancer cell lines. Human PGM siRNA was designed and transfected into indicated cells. 5 days later, cells were collected for enzymatic assay (see Figure 12c), cell 'number counting (see Figure 12d) or fixed for SA- ⁇ -GAL staining (see Figure 12e).
  • the present invention relates to the use of an inhibitor of an enzyme of the glycolytic pathway in the treatment of a cancer or other proliferative disorder.
  • An inhibitor of an enzyme of the glycolytic pathway is a substance which reduces/attenuates/decreases or eliminates expression and/or activity of such an enzyme.
  • Expression of the enzyme in this context is used to refer to any of the steps of transcription and translation.
  • Activity of the enzyme in this context is used to refer to • enzymatic activity of a polypeptide encoded by a gene of the glycolytic pathway.
  • An inhibitor suitable for use in the invention may exert inhibition via any mechanism. Any suitable inhibitor of expression and or activity of an enzyme of the glycolytic pathway may be employed in the present invention.
  • a suitable inhibitor maybe capable of inhibiting hexokinase, phosphoglucose isomerase, phosphofructokinase, aldolase, triose phosphate isomerase, glyceraldehyde 3- phosphate dehydrogenase, phosphoglycerate kinase, phosphoglycerate mutase, enolase or pyruvate kinase.
  • a suitable inhibitor may be capable of inhibiting more than one enzyme within the glycolytic pathway, for example two, three, four or more enzymes of the glycolytic pathway.
  • a suitable inhibitor will be capable of specifically inhibiting one enzyme of the glycolytic pathway.
  • An inhibitor which is capable of specifically inhibiting one enzyme of the glycolytic pathway is an inhibitor which inhibits that enzyme to a greater degree than it does any other enzyme of the glycolytic pathway.
  • a specific inhibitor will inhibit the enzyme for which it is specific to a substantially greater degree than any other enzyme of the glycolytic pathway.
  • a specific inhibitor will inhibit the enzyme for which it is specific to a degree of about 2 to 1000 times, for example about 10 to 500 times, in particular about 50 to 100 times that to which it inhibits any other enzyme of the glycolytic pathway.
  • a specific inhibitor may be one which inhibits an enzyme of the glycolytic pathway, but which substantially does not inhibit any other such enzyme.
  • an inhibitor suitable for use in the invention is one which is capable of inhibiting phosphoglycerate mutase (PGM) and/or phosphoglucose isomerase (GPI).
  • a suitable inhibitor will be one which is specific for PGM or specific for GPI.
  • Mammalian cells express two isoforms of PGM: a brain isoform (B PGM); and a muscle isoform (M PGM).
  • An inhibitor suitable for use in the invention may be capable of being specific for both isoforms (i.e. may be a specific PGM inhibitor) or may be capable of specifically inhibiting one or other of the isoforms (i.e. maybe a specific inhibitor of B PGM or M PGM).
  • an inhibitor of an enzyme of the glycolytic pathway suitable for use in the invention is not capable of crossing the blood-brain barrier. This may help to minimise the effect of the inhibitor on glycolysis in the brain.
  • An inhibitor of the expression of an enzyme of the glycolytic pathway may act by binding directly to the promoter of a gene encoding such an enzyme, thus preventing the initiation of transcription.
  • the inhibitor could bind to a polypeptide/polypeptide complex which is associated with the promoter and is required for transcription. This may result in reduced levels of transcription.
  • An inhibitor may also inhibit expression of an enzyme of the glycolytic pathway by binding directly to the untranslated region of an mRNA corresponding to such an enzyme. This may prevent the initiation of translation.
  • an inhibitor may bind to a polypeptide/polypeptide complex associated with the untranslated region and prevent that polypeptide/polypeptide associating with the untranslated region.
  • An inhibitor of the activity of an enzyme of the glycolytic pathway may do so by binding to such an enzyme.
  • Such enzyme inhibition may be reversible or irreversible.
  • An irreversible inhibitor dissociates very slowly from its target enzyme because it becomes very tightly bound to the enzyme, either covalently or non-covalently.
  • Reversible inhibition in contrast with irreversible inhibition, is characterised by a rapid dissociation of the enzyme-inhibitor complex.
  • the inhibitor may be a competitive inhibitor. In competitive inhibition, the enzyme can bind substrate (forming an enzyme-substrate complex) or inhibitor (enzyme- inhibitor complex) but not both. Many competitive inhibitors resemble the substrate and bind the active site of the enzyme. The substrate is therefore prevented from binding to the same active site.
  • a competitive inhibitor diminishes the rate of catalysis by reducing the proportion of enzyme molecules bound to a substrate.
  • the inhibitor may be a non-competitive inhibitor.
  • non-competitive inhibition which is also reversible, the inhibitor and substrate can bind simultaneously to an enzyme molecule. This means that their binding sites do not overlap.
  • a non-competitive inhibitor acts by decreasing the turnover number of an enzyme rather than by diminishing the proportion of enzyme molecules that are bound to substrate.
  • the inhibitor can be a mixed inhibitor.
  • Mixed inhibition occurs when an inhibitor affects both the binding of substrate and alters the turnover number of the enzyme.
  • An inhibitor of an enzyme of the glycolytic pathway may act by binding to the substrate of such an enzyme.
  • the substance may itself catalyze a reaction of the substrate, so that the substrate is not available to the enzyme.
  • the inhibitor may simply prevent the substrate binding to the enzyme.
  • Suitable inhibitors may be antibody products (for example, monoclonal or polyclonal antibodies, single chain antibodies, chimaeric antibodies, CDR-grafted or humanised antibodies) which are, for example, specific for an enzyme of the glycolytic pathway.
  • antibody products for example, monoclonal or polyclonal antibodies, single chain antibodies, chimaeric antibodies, CDR-grafted or humanised antibodies
  • a suitable inhibitor may be a chemical compound, for example a small molecule.
  • An inhibitor of an enzyme of the glycolytic pathway may act via an antisense mechanism or via an RNA interference mechanism (RNAi).
  • RNAi RNA interference mechanism
  • An inhibitor of an enzyme of the glycolytic pathway which acts via an antisense mechanism may comprise a polynucleotide which has substantial complementarity to all or part of an mRNA of such an enzyme.
  • a polynucleotide which has substantial sequence complementarity to all or part of an mRNA of an enzyme of the glycolytic pathway is typically one which is capable of hybridizing to such an mRNA. If the inhibitor has substantial complementarity to a part of the mRNA of an enzyme of the glycolytic pathway, it generally has substantial complementarity to a contiguous set of nucleotides within that mRNA.
  • a vector which allows for the expression of a polynucleotide which has substantial sequence complementarity to all or part of an mRNA of an enzyme of the glycolytic pathway (i.e. a polynucleotide which can hybridize to an mRNA of such an enzyme).
  • a polynucleotide which can hybridize to an mRNA of such an enzyme This results in the formation of an RNA- RNA duplex which may result in the direct inhibition of translation and/or the destabilization of the target message, by rendering it susceptibility to nucleases, for example.
  • the vector will typically allow the expression of a polynucleotide which hybridizes to the ribosome binding region and/or the coding region of the mRNA of an enzyme of the glycolytic pathway.
  • an oligonucleotide may be delivered which is capable of hybridizing to the mRNA of an enzyme of the glycolytic pathway.
  • Antisense oligonucleotides are postulated to inhibit target gene expression by interfering with one or more aspects of RNA metabolism, for example processing, translation or metabolic turnover.
  • Chemically modified oligonucleotides may be used and may enhance resistance to nucleases and/or cell permeability.
  • the vector is capable of expressing a polynucleotide which has substantial sequence complementarity to all of part of an mRNA of an enzyme of the glycolytic pathway.
  • a polynucleotide will be capable of hybridizing to the mRNA.
  • such a polynucleotide will be an RNA molecule.
  • Such a polynucleotide may hybridize to all or part of the mRNA of an enzyme of the glycolytic pathway Generally, therefore the polynucleotide will be complementary to all of or part of the such an mRNA.
  • the polynucleotide may be the exact complement of such an mRNA.
  • polynucleotides which have sufficient complementarity (i.e. substantial complementarity) to form a duplex having a melting temperature of greater than 40°C under physiological conditions are particularly suitable for use in the present invention.
  • the polynucleotide maybe a polynucleotide which hybridises to the mRNA of an enzyme of the glycolytic pathway under conditions of medium to high stringency, such as 0.03M sodium chloride and 0.03M sodium citrate at from about 50 to. about 60 degrees centigrade.
  • the polynucleotide hybridizes to a region of an mRNA of an ' enzyme of the glycolytic pathway corresponding to a coding sequence.
  • a polynucleotide maybe employed which hybridises to all or part of the 5'- or 3'- untranslated region of such an mRNA.
  • the polynucleotide will typically be at least 40, for example at least 60 or at least 80, nucleotides in length and up to 100, 200, 300, 400, 500, 600 or 700 nucleotides in length or even up to a few nucleotides, such as five or ten nucleotides, shorter than the full-length mRNA of an enzyme of the glycolytic pathway.
  • the polynucleotide (i.e. the "antisense” polynucleotide), maybe expressed in a cell from a suitable vector.
  • a suitable vector is typically a recombinant replicable vector comprising a sequence which, when transcribed, gives rise to the polynucleotide
  • RNA typically an RNA
  • the sequence encoding the polynucleotide is operably linked to a control sequence which is capable of providing for the transcription of the sequence giving rise to the polynucleotide.
  • control sequence typically linked to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
  • a control sequence "operably linked" to a sequence giving rise to an antisense RNA is ligated in such a way that transcription of the sequence is achieved under conditions compatible with the control sequences.
  • the vectors may be for example, plasmid or virus vectors provided with an origin of replication, optionally a promoter for transcription to occur and optionally a regulator of the promoter.
  • the vectors may contain one or more selectable marker genes, for example ah ampicillin resistance gene in the case of bacterial plasmid or a neomycin resistance gene for a mammalian vector.
  • Vectors may be used in vitro, for example for the production of antisense RNA, or used to transfect or transform a host cell.
  • the vector may also be adapted for used in vivo, for example in a method of gene therapy.
  • Promoters/enhancers and other expression regulation signals may be selected to be compatible with the host cell for which the expression vector is designed.
  • mammalian promoters such as b-actin promoters
  • Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLN LTR), the promoter rous sarcoma virus (RSN) LTR promoter, the SN40 promoter, the human cytomegalovirus (CMN) IE promoter, herpes simplex virus promoters or adeno virus promoters. All these promoters are readily available in the art.
  • Preferred promoters are tissue specific promoters, for example promoters driving expression specifically within vascular tissue.
  • Vectors may further include additional sequences, flanking the sequence giving rise to the antisense polynucleotide, which comprise sequences homologous to eukaryotic genomic sequences, preferably mammalian genomic sequences, or viral genomic sequences. This will allow the introduction of the polynucleo tides of the invention into the genome of eukaryotic cells or viruses by homologous recombination.
  • retro viruses examples include retro viruses, including lentiviruses, adenoviruses, adeno-associated viruses and herpes simplex viruses. Gene transfer techniques using such viruses are will known to those skilled in the art. Retrovirus vectors, for example, may be used to stably integrate the polynucleotide giving rise to the antisense RNA into the host genome. Replication-defective adenovirus vectors by contrast remain episomal and therefore allow transient expression.
  • a suitable oligonucleotide will typically have a sequence such that it will bind to an mRNA of an enzyme of the glycolytic pathway. Therefore, it will typically have a sequence which has substantial complementarity to a part of such an mRNA.
  • a suitable oligonucleotide will typically have substantial complementarity to a contiguous set out of nucleotides within the rnRNA of an enzyme of the glycolytic pathway.
  • An antisense oligonucleotide will generally be from about 6 to about 40 nucleotides in length. Preferably it will be from 12 to 20 nucleotides in length.
  • the oligonucleotide Used will have a sequence that is absolutely complementary to the target sequence. However, absolute complementarity may not be required and in general any oligonucleotide having sufficient complementarity (i.e. substantial complementarity) to form a stable duplex (or triple helix as the case may be) with the target nucleic acid is considered to be suitable.
  • the stability of a duplex (or triplex) will depend inter alia on the sequence and length of the hybridizing , oligonucleotide and the degree of complementarity between the antisense oligonucleotide and the target sequence. The system can tolerate less complementarity when longer oligonucleotides are used.
  • oligonucleotides especially oligonucleotides of from 6 to 40 nucleotides iri length, which have sufficient complementarity to from a duplex having a melting temperature of greater than 40°C under physiological conditions are particularly suitable for use in the present invention.
  • the polynucleotide may be a polynucleotide which hybridises to under conditions of medium to high stringency such as 0.03M sodium chloride and 0.03M sodium citrate at from about 50 to about 60 degrees centigrade.
  • oligonucleotides may be chemically modified.
  • phosphorothioate oligonucleotides may be used.
  • Other deoxynucleotide analogs include methylphosphonates, phosphoramidates, phosphorodithioates, N3'P5'-phosphoramidates and oligoribonucleotide phosphorothioates and their 2'-O-alkyl analogs and 2'-O- methylribonucleotide methylphosphonates.
  • MBOs Mixed backbone oligonucleotides
  • MBOs contain segments of phosphothioate oligodeoxynucleotides and appropriately placed segments of modified oligodeoxy- or oligoribonucleotides.
  • MBOs have segments of phdsphorothioate linkages and other segments of other modified oligonucleotides, such as methylphosphonate, which is non-ionic, and very resistant to nucleases or 2 -O- alkyloligoribonucleotides.
  • An inhibitor suitable for use in the invention may act via an RNA interference (RNAi) mechanism.
  • RNAi RNA interference
  • Such an inhibitor is typically a double-stranded RNA and has a sequence substantially similar to part of an mRNA of an enzyme of the glycolytic pathway.
  • Preferred inhibitors of this type are typically short, for example 15mers to 25mers, in particular 18mers to 22mers, preferably 21mers.
  • RNAi inhibitor will have a sequence that is absolutely complementary to the target sequence. However, absolute complementarity may not be required. In general an RNAi inhibitor which has a sequence that has sufficient complementarity (i.e. substantial complementarity) such that it would form a: stable duplex with the target nucleic acid is considered to be suitable. The stability of such a duplex will depend inter alia on the sequence and length of the sequence of the RNAi inhibitor and the degree of complementarity between the RNAi inhibitor and the target sequence. RNAi inhibitors of from 15 to 25 nucleotides in length, which have a sequence which has sufficient complementarity to from a duplex having a melting temperature of greater than 40°C under physiological conditions are particularly suitable for use in the present invention.
  • the RNAi inhibitor may have a sequence which hybridizes to the mRNA of an enzyme of the glycolytic pathway under conditions of medium to high stringency such as 0.03M sodium chloride and 0.03M sodium citrate at from about 50 to about 60 degrees centigrade.
  • a particularly preferred inhibitor suitable for use in the invention may have the sequence:
  • AAGGACACCATTGCCCGGGCC (specific for M PGM); ' AAGAGGGGAAAAGGGTCTTGA (specific for B PGM); or AATCATGGAGCTGAACCTGCC (targets both PGM isoforms)
  • the use of short inhibitors of this type is preferred because such inhibitors do not appear to trigger viral defence mechanisms of higher organisms.
  • Such inhibitors can be used to inhibit translation of the mRNA.
  • small fragments of sequence encoding an enzyme of the glycolytic pathway may be provided, cloned back to back in a suitable vector.
  • the vectors described above are suitable for expression of such back to back sequences. Expression of the sequence leads to production of the desired double-stranded RNA,
  • Preferred types of the inhibitor suitable for use in the invention and as described above are inhibitors which are specific for both mammalian isoforms of PGM, are specific for either B PGM or M PGM or are specific for GPI.
  • the invention also provides a method for identifying a substance for use in the treatment of a cancer or other proliferative disease, which method comprises: (a) providing a polynucleotide construct comprising a promoter of a gene encoding an enzyme of the glycolytic pathway, or a functional equivalent thereof, Operably linked to a coding sequence; (b) contacting a test substance with the polynucleotide construct under conditions that, in the absence of the test substance, would permit expression of the polypeptide encoded by the coding sequence; and (c) determining the level of expression of the polypeptide encoded by coding • sequence, thereby to determine whether the test substance is useful in the treatment of a cancer or other proliferative disease.
  • a functional equivalent of a promoter of a gene encoding an enzyme of the glycolytic pathway is one which has a sequence similar to that of a corresponding wild- type promoter and which retains ability to drive, transcription.
  • the functional equivalent may be a promoter from a homolog or orfholog.
  • the promoter may be a PGM or GPI gene promoter or a functional equivalent thereof.
  • the coding sequence encodes a reporter polypeptide.
  • the reporter polypeptide may be any suitable reporter polypeptide, for example GUS, the lacZ gene product or a GFP.
  • any suitable assay format may be used for carrying out such a method.
  • the method is adapted for use in a Mgh-throughput screen.
  • the method can ' be carried out in a single well of a microtitre plate.
  • a typical assay a cell harbouring a promote ⁇ reporter polypeptide construct is used as follows:
  • - a defined number of cells are inoculated, in for example lOO ⁇ l of growth medium, into the wells of a plastics micro-titre plate in the presence of a test substance; - optical density (OD) at 590nm may be measured as may expression of the reporter polypeptide according to any method appropriate for the reporter polypeptide being used;
  • micro-titre plates are covered and incubated at 37°C in the dark;
  • the OD is read again and expression of the reporter polypeptide assayed at convenient time intervals.
  • the change in OD is a measure of cell proliferation.
  • Control experiments can be carried out, in which the test substance is omitted. Also, the substance may be tested with any other known promoter to exclude the possibility that the test substance is a general inhibitor of gene expression.
  • GUS expression may assayed by measuring the hydrolysis of a suitable substrate, for example 5-bromo-4-chloro-3- indolyl- ⁇ -D-glucoronic acid (X-gluc)or 4-methylumbelliferyl- ⁇ -glucuronide (MUG).
  • X-gluc 5-bromo-4-chloro-3- indolyl- ⁇ -D-glucoronic acid
  • MUG 4-methylumbelliferyl- ⁇ -glucuronide
  • the hydrolysis of MUG yields a product which can be measured fluorometrically.
  • GFP is quantified by measuring fluorescence at 590nm after excitation at 494nm. These methods are well known to those skilled in the art.
  • the coding sequence may be a coding sequence of an enzyme of the glycolytic pathway. In such an experiment, an immortalised cell line which shows overexpression of an enzyme of the glycolytic pathway could be used.
  • the expression of the enzyme may be followed by, for example, Northern/RNA blotting, Western/antibody blotting or biochemical assay.
  • the invention provides a further method for identifying a substance for use in the treatment of a cancer or other proliferative disease, which method comprises:
  • Suitable enzyme for the assay can be obtained, for example, recombinantly by any method known to those skilled in the art.
  • a polypeptide substantially similar substantial to an enzyme of the glycolytic pathway is one which shares sequence similarity with that enzyme and also retains similar glycolytic activity thereto.
  • a fragment suitable for use in the assay will also retain similar glycolytic activity to the enzyme of the glycolytic pathway (or a polypeptide substantially similar thereto).
  • the enzyme will be a PGM, GPI or a polypeptide substantially similar thereto or a fragment of either thereof.
  • test substance may be tested with any other known enzyme to exclude the possibility that the test substance is a general inhibitor of enzyme activity, for example a protease.
  • reaction mixture can contain a suitable buffer.
  • a suitable buffer includes any suitable biological buffer that can provide buffering capability at a pH conducive to the reaction requirements of the enzyme in question.
  • Suitable test substances include antibody products (for example, monoclonal and polyclonal antibodies, single chain antibodies, chimaeric antibodies, CDR-grafted antibodies and humanised antibodies) which are specific for an enzyme of the glycolytic pathway.
  • antibody products for example, monoclonal and polyclonal antibodies, single chain antibodies, chimaeric antibodies, CDR-grafted antibodies and humanised antibodies
  • combinatorial libraries, defined chemical entities, peptide and peptide mimetics, oligonucleotides. and natural product libraries may be screened for activity as inhibitors of an enzyme of the glycolytic pathway in assays such as those described below.
  • the candidate substances may be chemical compounds.
  • the candidate substances may be used in an initial screen often, for example, test substances per reaction, and the test substance of those batches which show inhibition may then be tested individually.
  • a substance suitable for use in the treatment of a cancer or other proliferative disorder is one which produces a measurable reduction in expression and/or activity of an enzyme of the glycolytic pathway in an assay described above.
  • Preferred substances are those which inhibit expression and/or activity an enzyme of the glycolytic pathway by at least 10%, at least 20%, at least 30%, at least 40% at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% at a concentration of the inhibitor of l ⁇ g ml "1 , lO ⁇ g ml "1 , lOO ⁇ g ml “1 , 500 ⁇ g ml "1 , lmg ml "1, lOmg ml "1 , lOO g ml "1 .
  • the percentage inhibition represents the percentage decrease in expression/activity in a comparison of assays in the presence and absence of the test substance. Any combination of the above mentioned degrees of percentage inhibition and concentration of inhibitor may be used to define a substance suitable for use in the treatment of a cancer or other proliferative disorder. Substances having greater inhibition at lower concentrations being preferred. Preferred inhibitors are specific inhibitors of one or both mammalian PGM isoforms or of GPI.
  • Candidate substances suitable for use in the treatment of a cancer or other proliferative disorder i.e. candidate inhibitors of an enzyme of the glycolytic pathway which show activity in assays such as those described above, can be tested on mammalian cell lines for the ability to inhibit the activity and/or expression of an enzyme of the glycolytic pathway or for the ability to inhibit cell proliferation.
  • Candidate inhibitors could be tested for their ability to inhibit expression and/or activity of an enzyme of the glycolytic pathway or to inhibit proliferation in a cancer cell line in which . such an enzyme is up-regulated.
  • Inhibitors of an enzyme of the glycolytic pathway including those identified according to a method set out above (ie.
  • Substances identified by a method of the invention in particular inhibitors specific for one or both the mammalian isoforms of PGM of specific for GPI, may be used in a method of treatment of the human or animal body by therapy.
  • inhibitors may be used in the treatment of a cancer or other proliferative disease.
  • the invention provides an inhibitor of an enzyme of the glycolytic pathway, for example an inhibitor identified in a method of the invention for use in a method of treatment of the human or animal body by therapy.
  • the invention also provides use of such inhibitors in the manufacture of a medicament for use in the treatment of a cancer or other proliferative disease.
  • the invention also provides a method of treatment of a cancer or other proliferative disease, which method comprises the step of administering to the host an effective amount of an inhibitor of an enzyme of the glycolytic pathway, for example an inhibitor identified in a method of the invention.
  • the host may be a human or an animal.
  • the condition of a patient suffering from a cancer or other proliferative disorder can be improved by the administration of inhibitor of an enzyme of the glycolytic pathway, for example an inhibitor identified in a method of the invention.
  • a therapeutically effective amount of inhibitor of an enzyme of the glycolytic pathway for example an inhibitor identified in a method of the invention may be given to a patient in need thereof.
  • cancers that may be treated according to the invention include primary and secondary cancers.
  • the cancer may be, for example, a leukaemia, a lymphoma, a sarcoma, a carcinoma, or an adenocarcinoma.
  • cancers that may be treated according to the invention include breast, colon, brain, lung, ovary pancreatic, prostate stomach, skin, testicular, and tongue cancers.
  • An inhibitor of an enzyme of the glycolytic pathway is typically formulated for administration in the present invention with a pharmaceutically acceptable carrier or diluent.
  • the pharmaceutical carrier or diluent may be, for example, an isotonic solution.
  • solid oral forms may contain, together with the active compound, diluents, e.g. lactose, dextrose, saccharose, cellulose, corn starch or potato starch; lubricants, e.g.
  • binding agents e.g. starches, arabic gums, gelatin, methylcellulose, carboxymethylcellulose or polyvinyl pyrrolidone
  • disaggregating agents e.g. starch, alginic acid, alginates or sodium starch glycolate
  • dyestuffs effervescing mixtures
  • sweeteners efferv
  • Such pharmaceutical preparations may be manufactured in known manner, for example, by means of mixing, granulating, tabletting, sugar-coating, or film coating processes.
  • Liquid dispersions for oral administration may be syrups, emulsions and suspensions.
  • the syrups may contain as carriers, for example, saccharose or saccharose with glycerine and/or mannitol and/or sorbitol.
  • Suspensions and emulsions may contain as carrier, for example a natural gum, agar, sodium alginte, pectin, methylcellulose, carboxymethylcellulose, or polyvinyl alcohol.
  • the suspensions or solutions for intramuscular injections may contain, together with the active compound, a pharmaceutically acceptable carrier, e.g. sterile water, olive oil, ethyl oleate, glycols, e.g. propylene glycol, and if desired, a suitable amount of lidocaine hydrochloride.
  • Solutions for intravenous or infusions may contain as carrier, for example, sterile water or preferably they may be in the form of sterile, aqueous, isotonic saline solutions.
  • a suitable inhibitor is administered to a patient.
  • the dose of a suitable inhibitor may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the patient to be treated; the route of administration; and the required regimen. Again, a physician will be able to determine the required route of administration and dosage for any particular patient.
  • a typical dose is from about 0.1 to 500 mg.
  • Appropriate dosages may depend on a variety of factors, for example, body weight, according to the activity of the specific antagonist, the age, weight and conditions of the subject to be treated, the type and severity Of the degeneration and the frequency and route of administration.
  • a dose may be given, for example, once only, or more than once for example 2, 3, 4 or 5 times.
  • the dose may be given, for example daily, every other day, weekly or monthly.
  • the antisense oligonucleotides or RNA interference (RNAi) molecules described above may be administered by direct injection into the site to be treated.
  • the antisense oligonucleotides or RNAi molecules are combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition.
  • Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline.
  • the composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular or transdermal administration.
  • the dose at which an antisense oligonucleotide or RNAi molecule is administered to a patient will depend upon a variety of factors such as the age, weight and general condition of the patient, the cancer or proliferative condition that is being treated and the stage which the cancer or proliferative condition has reached, and the particular antisense oligonucleotide or RNAi molecule that is being administered.
  • a suitable dose may, however, be from 0.1 to 100 mg/kg body weight such as 1 to 40 mg/kg body weight.
  • a polynucleotide having substantial sequence complementarity to all or part of an mRNA of an enzyme of the glycolytic pathway or a vector capable of expressing such a polynucleotide may be administered directly as a naked nucleic acid construct.
  • Uptake of naked nucleic acid constructs by mammalian cells is enhanced by several known transfection techniques for example those including the use of transfection agents.
  • these agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants (for example lipofectam and transfectam ).
  • nucleic acid constructs are mixed with the transfection agent to produce a composition.
  • polynucleotide, vector or composition is combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition.
  • Suitable carriers and diluents include isotonic saline solutions, for example phosphate- buffered saline.
  • the composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular or transdermal administration.
  • the pharmaceutical composition is administered in such a way that the polynucleotide or vector can be incorporated into cells at an appropriate area.
  • the amount of virus administered is in the range of from 10 to 10 pfu, preferably from 10 to 10 pfu, more preferably about 10 6 pfu for herpes viral vectors and from 10 to 10 1 pfu, preferably
  • nucleic acid typically in the range of from 1 ⁇ g to 10 mg.
  • the polynucleotide giving rise to the antisense RNA is under the control of an inducible promoter, it may only be necessary to induce gene expression for the duration of the treatment. Once the condition has been treated, the inducer may be removed and expression of the polypeptide of the invention ceases.
  • Such a system may, for example, involve administering the antibiotic tetracycline, to activate gene expression via its effect on the tet repressor/VPl6 fusion protein.
  • tissue-specific promoters will be of assistance in the treatment of disease using the polypeptides, polynucleotide and vectors of the invention.
  • tissue-specific promoters will be of assistance in the treatment of disease using the polypeptides, polynucleotide and vectors of the invention.
  • several neurological disorders are due to aberrant expression of particular gene . products in only a small subset of cells. It will be advantageous to be able express therapeutic genes in only the relevant affected cell types, especially where such genes are toxic when expressed in other cell types.
  • the invention also provides a method -for the diagnosis of a cancer or other proliferative disorder in a host, which method comprises determining the level of expression and/or activity of an enzyme of the glycolytic pathway in the host, thereby to determine whether the host is suffering from a cancer or other proliferative disorder.
  • the host may be a human or an animal. Abnormally high elevated levels of an enzyme of the glycolytic pathway may be indicative of a cancer or other proliferative disorder.
  • the level of expression and/or activity of an enzyme of the glycolytic pathway in a host may be determined by determining the level of expression and/or activity in a tissue sample, for example in a biopsy.
  • the level of expression and/or activity of an enzyme of the glycolytic pathway in the host may be determined globally, for example by the use of posititron emission tomography (PET) scanning using [18F]- fluoro2-deoxy-glucose (FDG) for example.
  • PET posititron emission tomography
  • FDG fluoro2-deoxy-glucose
  • the invention also provides a method for determining the effectiveness of a treatment for a cancer or other proliferative disorder in a host, which method comprises determining the level of expression and/or activity of an enzyme of the glycolytic • pathway in the host, thereby to determine the effectiveness of the treatment for a cancer or other proliferative disorder in the host.
  • the host may be a human or an animal.
  • the level of expression and/or activity of an enzyme of the glycolytic pathway in the host maybe monitored during the course of treatment, for example by chemotherapy or radiotherapy, to determine whether that course of treatment is having any effect.
  • the method may be used to monitor a host after a course of treatment has finished, for example during a remission period, to monitor potential recurrence of the cancer or other proliferative disorder.
  • the level of expression and/or activity of an enzyme of the glycolytic pathway in a host may be determined according to the methods set out above in relation to the diagnostic method.
  • the level of expression and/or activity of PGM or GPI it is preferred for the level of expression and/or activity of PGM or GPI to be determined in the host.
  • the invention also provides a method for immortalising a cell.
  • the method comprises activating the level of expression and/or activity of an enzyme of the glycolytic pathway in the cell.
  • the enzyme of the glycolytic pathway is PGM .
  • the level of expression and/or activity of an enzyme of the glycolytic pathway may be activated according to any suitable method.
  • the relevant enzyme itself may be contacted with the cell.
  • the cells may be infected with a virus, for example a retrovirus, which expresses the relevant enzyme:
  • Such a technique may be useful in situations where cells which are available in only small numbers, for example stem cells.
  • Such cells may be immortalised according to the method of the invention and then proliferated generating large number of such cells.
  • Such cells are advantageous because they may be produced in large numbers and may be stored for subsequent treatment.
  • immortalised cells prepared by the method of the invention may be used in therapy by introducing them into a host. That is the invention provides cells obtainable by the method set out above for use in the treatment of the human or animal body by therapy.
  • cells may be withdrawn from the host, immortalised using the method of the invention, proliferated to generate large numbers of such cells and then reintroduced into the host.
  • This approach has the advantage that the immune system recognises the cells as self-cells and therefore there is no rejection and no requirement to for the use of immunosuppressants.
  • the cells may be modified in vitro prior to introduction into a host. For example, lymphocytes and other immune effector cells may be modified to recognise and attack tumour cells. Also, cells may be modified to produce factors that stimulate recovery or increase the activity of surrounding cells in vivo.
  • Cells obtained according to the method of the invention may thus be used in the treatment of: bum victims (skin cells); haemophilia, leukemia, sickle cell anaemia (blood cells); a cancer (modified immune cells); Parkinson's disease, Alzheimer's disease, spinal injuries (neural cells); muscular dystrophy, myocardial infarction (muscle cells); diabetes (pancreatic cells); arthritis, osteoporosis (bone/cartilage cells); cirrhosis, hepatitis (liver cells); and hypothyroidism,balism, reproductive disorders (pituitary cells).
  • bum victims skin cells
  • haemophilia leukemia
  • sickle cell anaemia blood cells
  • a cancer modified immune cells
  • Parkinson's disease Alzheimer's disease, spinal injuries (neural cells); muscular dystrophy, myocardial infarction (muscle cells); diabetes (pancreatic cells); arthritis, osteoporosis (bone/cartilage cells); cirrhosis,
  • Example 1 Identification of phosphoglycerate mutase during a senescence screen . An outline of the screen is presented in Figure 2. MEFs were prepared from day
  • Oligo(dT)- ⁇ rimed cDNA was produced with the ZapJJ cDNA synthesis kit (Stratagene). Fragments were cloned into the retroviral expression vector pHygroMaRXU at the EcoRI and XhoKL sites. The library was transfected into the LinX ⁇ packaging cell line by the calcium phosphate method. At 72h post-transfection, the viral supernatants were collected, filtered, diluted 1 :2 with fresh media and. supplemented with 4 ⁇ g/ml polybrerie, and used to infect M ⁇ Fs.
  • M ⁇ Fs from a single embryo were grown to confluence in a 10 cm cell culture dish, and then the cells were treated with trypsin and split 1 :4 into fresh media and grown overnight prior to infection. 18 million M ⁇ Fs were infected and grown for 2 days at 32°C, before changing the media to hygromycin supplemented media (50 ⁇ g/ml). After 8 days drug selection at 37°C, the cells were harvested and plated at a density of 100,000 cells per 10cm dish. Plates were incubated for 1 month with media changes every three days. During this time, M ⁇ Fs expand and undergo replicative senescence. Cells infected with cDNAs capable of bypassing senescence can continue to grow and form colonies on the plate. Colonies were removed from the plates using trypsin soaked filter paper discs and transferred to 24 well plates for expansion.
  • Genomic DNA was extracted from the expanded clones using a standard proteinase K/SDS method. Genomic DNAs (lO ⁇ g) were treated with CR ⁇ recpmbinase, phenol extracted, ethanol precipitated, and used to transform electrocompeteht E. coli DH10B. Plasmids recovered from the genomic DNA (about 10 per clone) were sequenced. A subset of these clones was reintroduced into M ⁇ Fs as described above, to confirm that each clone was capable of bypassing senescence. During this screen several clones were identified containing the cDNA corresponding to the muscle isoform of phosphoglycerate mutase MPGM.
  • Example 2 Comparison of the growth characteristics of MEF cells infected with PGM To compare the life extending capability of the PGM clone, the cDNA isolated from the senescence screen was subcloned into pMaRXTVhygro vector, where expression of the gene is driven from the CMV promoter. We also cloned into pMaRXTVhygro vectors the brain isoform of PGM, p53D/N allele and phosphofructokinase.
  • the brain isoform of PGM was isolated by RT-PCR from total MEF RNA using the following primers: BPGM-3, GGCGGGCTGCGAAGAGAATCTCGGCGATCC; BPGM-4, CTGGGGAGGGTGCAGGAGGCAGGAACAGGC.
  • the p53D/N allele is a 175H substitution and human liver-type phosphofructokinase (PFK-1) cDNA was obtained from Kevin Brindle at the University of Cambridge UK.
  • the pMaRXrVhygro constructs were transfected into the LinX E packaging cell line by the calcium phosphate method.
  • the viral supernatants were collected, filtered, diluted 1 :2 with fresh media and supplemented with 4 ⁇ g/ml polybrene, and used to infect MEFs.
  • MEFs from a single embryo were grown to confluence in a 10 cm cell culture dish, and then the cells were treated with trypsin and split 1 :4 into fresh media and grown overnight prior to infection.
  • FIGs 3 a, b and c show the growth characteristics of MEFs infected with retrovirus's expressing the different cDNAs.
  • PFK phosphofructokinase
  • the growth promoting effects of PGM were as penetrant as that of p53 inactivation (cells expressing the p53DN allele).
  • vector infected cells are senescent with a large flattened morphology, while cells cells immortalized by p53DN or PGM-M are not (see Figure 3d).
  • RNA extract from infected MEF cells was prepared at passage 8. Full length cDNAs were used as probes for Northern blotting.
  • the PGM-B (brain) form is much more abundant than the PGM-M (muscle) form in MEFs (see Figure 3e).
  • the probes did not cross react with each other in muscle and brain extracts from adult mice.
  • Ras-vall2 retro vims or control vector was infected into wild-type MEFs at passage 4, p53DN or PGM-M cells at passage 6.
  • the wild-type MEFs quickly stopped dividing after ras introduction (see Figure 3f).
  • Each immortalised cell was then grown on soft agar plate for 4 weeks.
  • the p53DN + ras cells could form colonies, but PGM-M + ras cells could not (see Figure 3g).
  • PGM-M can bypass ras induced senescence but not transform cells.
  • Example 3 PGM activity is increased in PGM immortalised cells
  • Cell lines were grown and prepared as described above in Example 1.
  • Whole cell lysates were prepared by removal of cells from culture dishes by brief trypsin treatment. Trypsin was inactivated by washing the cells in IX MEF media, followed by washing the cells with PBS. The cells were pelleted by centrifugation and resuspended in lysis buffer (50 mM Tris-HCl, 2 mM EDTA, 2 mM dithiothritol, 1% triton). After vigorous resuspension, the cellular debris was pellet by centrifugation (14,000 rpm). The protein content of the cleared supernatant was determined using the BIORAD protein determination kit.
  • the PGM activity activity of the whole cell lysates was then measured spectrophotometrically at 37°C, according to the method of Beutler and Stratton (Beutler, E (ed.), 1975, Monophosphoglyceromutase (MPGM). h Red Cell Metabolism. pp56-58. Grune & Stratton: New York).
  • the reaction mixture contained 100 mM Tris-HCl, 0.5 mM EDTA, 100 mM KC1, 10 mM MgCl, 1.5 mM ADP, 2 mM 3-phosphoglycerate, lO ⁇ M 2,3-biphosphoglycerate, 0.2 mM NADH, lactate dehydrogenase (0.5 U/ml), pyruvate kinase (0.15 U/ml) and enolase (0.3 U ml).
  • Nm a refers to the maximum rate decrease in milliODunits/minute at 340nm.
  • MEF p4 Early passage replicative MEFs (MEF p4) contained about 150 units of activity, whereas the activity in MEFs expressing BPGM and MPGM was increased almost two fold.
  • Spontaneously immortalised MEF lines (SI1-SI10) were isolated by continual culture of senescent MEF cells by the 3T3 protocol for a prolonged period. After approximately 15-20 passages spontaneous mutants arise that are not growth arrested and take over the population. PGM activity was determined as described above in Example 3. The PGM activity of the spontaneously immortalised cell lines was compared to that of early passage MEF cells (MEF p3) and to mouse embryonic stem cell lines CGR8 and DE3. Figure 5 shows that the PGM activity of SI2, SB SI5, SI8, SI9 and the naturally immortal ES cell lines were elevated compared to primary MEF cells indicating that immortalisation correlates with increased PGM activity.
  • the pMaRXIV vectors contain LoxP sites flanking the pro vims. Subsequent in vivo expression of CRE recombinase causes excision at these LoxP sites, leading to removal from the genome and eventual loss of the construct.
  • Spontaneously immortalised 3T3 cells infected with pMaRXIVhygro vector and MEFs immortalised by expression of either MPGM or p53DN expressing vectors were infected with a provirus expressing ere recombinase (pWZL-neo-CRE). After drug selection for the CRE expressing clones, the cells were plated at equal densities and cultured for 5-10 days, fixed and stained with crystal violet staining.
  • Example 6 Catalytic activity of the PGM enzyme is required for extending the life span of MEFs
  • Catalytic activity of the PGM enzyme is required for extending the life span of MEFs. Mutations were introduced into PGM, corresponding to Saccharomyces cerevisiae mutations known to inactivate either the substrate binding or catalytic activity ofPGM.
  • the crystal structure of PGM from S. cerevisiae has been solved (REF) and amino acid residues involved in substrate binding and catalysis have been determined. Alignment of the primary amino acid sequence of the mouse M PGM and S. cerevisiae PGM enabled us to predict corresponding substrate binding and catalytic residues in the mouse PGM.
  • the mutated alleles were introduced into primary MEFs and the their subsequent growths rates compared by the 3T3 protocol (see Figure 7b).
  • Three of the mutations introduced (R90Q, Rl 16Q and Rl 17Q) abolished the life extending properties of PGM when introduced into MEFs.
  • One of the mutations (E89D) prevented replicative senescence, but the growth rate of this cell line was slower than cells immortalised with the native PGM.
  • Two of the clones (Rl 16Q and Rl 17Q) induced premature senescence when infected into MEF cells compared to the pMaRXIV vector control. Expression of the mutated alleles also induced morphological changes (see Figure 7c).
  • Cells expressing R90Q, Rl 16Q and Rl 17Q had a large flattened morphology typical of senescent cells and similar to cells infected with the pMaRXIVhygro control. Cells infected with PGM, p53DN control and E89D had morphologies indicative of replicative cells (small fibroblast like cells).
  • the 3T3 protocol was carried out using wild-type MEFs until the outbreak of spontaneous immortalisation.
  • Phosphoglycerate kinase (PGK), PGM and enolase activities were measured at various passages during the 3T3 protocol of the wild-type MEFs. The results are set out in Figure 7e.
  • Glycolytic flux was measured in a number of different cell lines by the metabolic ratio of D-[3- 3 H]glucose (see Figure 7f).
  • Example 7 Reduction in the level of PGM activity in primary MEF cells by RNAi leads to a reduction in growth yield RNAi was used to reduce the expression level of PGM in primary MEF cells.
  • RNAi molecules were generated to either the brain (PGM-B1), muscle (PGM- Ml) or to both (PGM-MB) isoforms of PGM.
  • PGM siRNA molecules were generated by Dharmacon Research Inc (USA) specific to: muscle (PGM-M1 ; AAGGACACCATTGCCCGGGCC); brain (PGM-B1; AAGAGGGGAAAAGGGTCTTGA); or both (PGM-MB; AATCATGGAGCTGAACCTGCC).
  • SiRNAs 100 nM were transfected into passage 3 primary MEF's using oligofectamine transfection reagent (Invitrogen). Transfection was repeated after 24 hour cell culture, and then the protein content and PGM activity of total cell lysates was determined 4 days after the last transfection. PGM activity and protein content was determined as described above in Example 3. The results are set out in Figure 8. Transfection of these molecules into p3 MEF cells led to a reduction in growth yield (mg protein/dish) after 4 days, confirming that PGM is required for growth.
  • Example 8 Glycolytic inhibition induces senescence A senescence phenotype was provoked in wild-type MEFs by the inactivation of PGM or glucose phosphate isomerase (GPI) by siRNA. Wild-type MEFs were transfected with siRNA after seeding at 0.5 million cells per 10cm dish. Five days after transfection, cells were collected for a glycolytic enzyme assay (see Figure 9a) or fixed for SA- ⁇ -GAL staining (see Figures 9b and c).
  • Glycolytic inhibition inducesenescence A senescence phenotype was provoked in wild-type MEFs by the inactivation of PGM or glucose phosphate isomerase (GPI) by siRNA. Wild-type MEFs were transfected with siRNA after seeding at 0.5 million cells per 10cm dish. Five days after transfection, cells were collected for a glycolytic enzyme assay (see Figure 9a) or fixed for SA- ⁇ -GAL staining (see Figures 9b and c).
  • PGM and GPI activity was knocked down by specific siRNA (see Figure 9a).
  • Cell number was decreased up to 50% by inhibition of PGM or GPI (see Figure 9b).
  • Blue SA- ⁇ -GAL stained cells were increased in PGM or GPI targeted cells (see Figure 9c).
  • PGM inactivation leads to senescence in human primary fibroblasts, WI-38 (see
  • MEF cells infected with either MPGM or pMaRXIV were grown according to the
  • Example 10 PGM expression can impair p53 response after radical stress, which renders MEF to be H 2 O 2 resistant.
  • a p53 responsive promotor luciferase assay was carried out.
  • Bax promotor luciferase or p21 promotor luciferase plasmid was co-transfected with p53wt plasmid and a glycolytic enzyme cDNA plasmid into ⁇ 53 null MEFs.
  • PGM wt and PGM E89D reduced luciferase activity in a similar fashion to p53DN.
  • the other three mutant PGM alleles could not repress the p53 response (see Figure 1 lc).
  • p53 protein was less induced by H 2 O 2 treatment in PGM cells (see Figure lid).
  • PGM modulated p53 protein levels in the presence of Mdm2 (see Figure 1 le).
  • the plasmids indicated in Figure l ie were cotransfected into p53 null MEFs. Cells were collected for western blotting analysis 48 hours later. GFP levels show transfection efficiency in each lane.
  • Trxl and pi 07 mRNA expression were strongly repressed in PGM cells (see Figure 1 If).
  • MEF cells were infected with the indicated plasmids. At passage 8, cells were treated with H O for 24 hours. Cell extracts were analysed by semi-quantitative RT-PCR.
  • Example 11 PGM inactivation can induce senescence even in immortalized MEF or cancer cell lines
  • WT or mutant PGM plasmid were introduced into immortalised MEF, ⁇ 53DN or p21RM (p21null+ras+myc) cells. After drug selection, 1 million cells were seeded on 10cm dishes. 10 days later, plates were fixed for Crystalviolet staining (see Figure 12 a). The lower panel of Figure 12a shows that a senescent phenotype was induced by mutant PGM in p53DN cells.
  • PGM siRNA induced senescence in several cancer cell lines Human PGM siRNA was designed and transfected into indicated cells. 5 days later, cells were collected for enzymatic assay (see Figure 12c), cell number counting (see Figure 12d), and fixed for SA- ⁇ -GAL staining (see Figure 12e). PGM siRNA knocked down PGM activity specifically (see Figure 12c). The prostate cancer cell line PC-3 in particular was very sensitive to PGM siRNA, showing a senescence phenotype (see Figures 12d and e).

Abstract

L'invention concerne l'utilisation d'un inhibiteur d'une enzyme de la voie glycolytique, pour produire un médicament destiné à traiter un cancer ou un autre trouble prolifératif.
PCT/GB2003/002993 2002-07-11 2003-07-11 Traitement de troubles proliferatifs WO2004007720A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003254447A AU2003254447A1 (en) 2002-07-11 2003-07-11 Treatment of proliferative disorders

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0216097.6 2002-07-11
GB0216097A GB0216097D0 (en) 2002-07-11 2002-07-11 Treatment of proliferative disorders

Publications (2)

Publication Number Publication Date
WO2004007720A2 true WO2004007720A2 (fr) 2004-01-22
WO2004007720A3 WO2004007720A3 (fr) 2004-04-22

Family

ID=9940259

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2003/002993 WO2004007720A2 (fr) 2002-07-11 2003-07-11 Traitement de troubles proliferatifs

Country Status (3)

Country Link
AU (1) AU2003254447A1 (fr)
GB (1) GB0216097D0 (fr)
WO (1) WO2004007720A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1595957A1 (fr) * 2004-05-12 2005-11-16 Erich Eigenbrodt Phosphoglycerate mutases et produits enzymatiques
US8563730B2 (en) 2008-05-16 2013-10-22 Takeda San Diego, Inc. Pyrazole and fused pyrazole glucokinase activators

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6255046B1 (en) * 1997-10-31 2001-07-03 The Picower Institute For Medical Research Inducible phosphofructokinase and the warburg effect
WO2001068667A1 (fr) * 2000-03-14 2001-09-20 The Johns Hopkins University School Of Medicine Arret de la proliferation de tumeurs fortement glycolitiques

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6255046B1 (en) * 1997-10-31 2001-07-03 The Picower Institute For Medical Research Inducible phosphofructokinase and the warburg effect
WO2001068667A1 (fr) * 2000-03-14 2001-09-20 The Johns Hopkins University School Of Medicine Arret de la proliferation de tumeurs fortement glycolitiques

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DEMIR G ET AL: "USE OF RNA INTERFERENCE (RNAI) TO DISRUPT C-KIT GENE EXPRESSION IN MALIGNANT HUMAN HEMATOPOIETIC AND NEUROEPITHELIAL CELLS" BLOOD, vol. 96, no. 11, PART 2, 16 November 2000 (2000-11-16), page 378B, XP009004894 ISSN: 0006-4971 *
LIU H ET AL: "Hypersensitization of tumor cells to glycolytic inhibitors" BIOCHEMISTRY, vol. 40, no. 18, 8 May 2001 (2001-05-08), pages 5542-5547, XP002261273 ISSN: 0006-2960 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1595957A1 (fr) * 2004-05-12 2005-11-16 Erich Eigenbrodt Phosphoglycerate mutases et produits enzymatiques
US8563730B2 (en) 2008-05-16 2013-10-22 Takeda San Diego, Inc. Pyrazole and fused pyrazole glucokinase activators
US9139598B2 (en) 2008-05-16 2015-09-22 Takeda California, Inc. Glucokinase activators

Also Published As

Publication number Publication date
GB0216097D0 (en) 2002-08-21
AU2003254447A1 (en) 2004-02-02
WO2004007720A3 (fr) 2004-04-22

Similar Documents

Publication Publication Date Title
US8029980B2 (en) Identification and use of agents that modulate oncogenic transcription agent activity
EP1954709B1 (fr) Interaction proteine porteuse d'ubiquitine (ucp) e2epf-von hippel-lindau, et ses utilisations
EP1689786B1 (fr) Procedes et agents pour mettre en oeuvre une modulation immunitaire et procedes d'identification de modulateurs immunitaires
CA2487427A1 (fr) Procedes et compositions pour traiter une neoplasie associee aux molecules d'acides nucleiques de a1 et a2 de hnrnp
WO2004007720A2 (fr) Traitement de troubles proliferatifs
JP4265402B2 (ja) ｐ３００ヒストンアセチル化酵素インヒビターを含む転写阻害用組成物及び該ｐ３００ヒストンアセチル化酵素インヒビターを阻害し得る阻害物質のスクリーニング方法
US8404435B2 (en) Enigma-Mdm2 interaction and uses thereof
WO2009045403A2 (fr) Régulation par la ménine de la prolifération des cellules d'îlots bêta
JP2007282628A (ja) 抗癌剤のスクリーニング方法
US20130095107A1 (en) Biomarker specific to brain/nerve or specific to neuronal differentiation
CN114042160B (zh) Ctd-2256p15.2及其编码微肽作为靶点在开发肿瘤治疗药物中的应用
EP3358012A1 (fr) Prévention, diagnostic et traitement du cancer surexprimant le gpr160
EP1474175A2 (fr) Agents regulateurs de l'apoptose
JP2011219375A (ja) オルニチンアミノトランスフェラーゼ酵素活性阻害剤の使用
KR100992239B1 (ko) Ｍｉｇ１２ 유전자의 신규한 용도
CN115369163A (zh) Ryr2及其下调剂在治疗转移性结直肠癌中的应用
WO2003083117A2 (fr) Gene regulant la vascularisation
WO2007138253A1 (fr) Procédé de criblage
JPWO2005093068A1 (ja) 新規タンパク質及びプロモーター
JP2006325524A (ja) 神経幹細胞及び脳神経疾患のためのマーカー
WO2001010883A1 (fr) Gene de mort cellulaire et ses applications
KUN Exploration of the functional significance of mig-2 in human cancer cell susceptibility to cytotoxic agents and cell growth control: A pilot study
JP2006166703A (ja) 軟骨分化制御遺伝子

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP