WO2003104441A2

WO2003104441A2 - Novel bacterial strain, compositions derived therefrom and methods of using same for treating beta-ap-associated deseases

Info

Publication number: WO2003104441A2
Application number: PCT/IL2003/000485
Authority: WO
Inventors: Beka Solomon; Eugene Rosenberg
Original assignee: Ramot At Tel Aviv University Ltd.
Priority date: 2002-06-10
Filing date: 2003-06-10
Publication date: 2003-12-18
Also published as: WO2003104441A3; AU2003233175A8; AU2003233175A1

Abstract

An isolated bacterial strain is provided. The isolated bacterial strain has a genome comprising a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1. Also provided are compositions derived from the isolated bacterial strains and methods of using same for treating betaAP-associated diseases.

Description

NOVEL BACTERIAL STRAIN, COMPOSITIONS DERIVED THEREFROM AND METHODS OF USING SAME FOR TREATING βAP-ASSOCIATED DISEASES

FIELD AND BACKGROUND OF THE INVENTION The present invention relates to a novel bacterial strain compositions derived therefrom and methods of using same for treating βAP-associated diseases such as Alzheimer's disease.

The most common neurodegenerative disease, Alzheimer's disease (AD) constitutes about two thirds of cases of dementia overall, ranging in various studies from 42 to 81 percent of all dementias, with vascular causes and other neurodegenerative diseases such as Pick's disease and diffuse Lewy-body dementia making up the majority of the remaining cases (Moore and Wolfe, 1999).

Alzheimer's disease is a progressive neurologic disease that results in the irreversible loss of neurons, particularly in the cortex and hippocampus. The clinical hallmarks are progressive impairment in memory, judgment, decision making, orientation to physical surroundings, and language.

One of the major pathological features of AD is the abundant presence of amyloid plaques in the brain tissue of affected individuals (Selkoe, 1994). These plaques are largely found in the cerebral cortex and hippocampus, both associated with higher brain functions, and deposition in these regions correlates with loss of mental function (Cummings & Cotman, 1995). These plaques are predominantly composed of β-amyloid (βAP), a 39-43 amino acid peptide (Mori et al, 1992). A considerable body of experimental evidence has accumulated in recent years indicating that aggregation of βAP to form neurotoxic fibrils plays a central role in the etiology of AD. The conformational transition of βAP from an α-helix to a β-sheet, with concomitant peptide aggregation, is the proposed mechanism of plaque formation. The contribution of the C-terminal region of βAP in the initiation and progression of β-sheet formation has been well established (Jarrett et al, 1993). The importance of the N-terminal domain for fibrillar genesis is also now recognized (Saido, 1995; Solomon et al, 1997).

In light of the above it is clear that therapies designed to inhibiting the production of βAP or inhibiting amyloidogenic assembly thereof may be useful for treating Alzheimer's disease. Current attempts to design such therapies are summarized hereinbelow. Destabilizing antibodies - Anti-β-amyloid monoclonal antibodies have been shown to be effective in disaggregating β-amyloid plaques and preventing β-amyloid plaque formation in vitro. Selected mAbs raised against βAP interfered with in vitro aggregation, maintaining βAP solubility under conditions in which the peptide self-aggregates and precipitates have been previously described (Solomon, 1996). Furthermore, antibodies raised against the N-terminal region of βAP were shown to bind to preformed βAP aggregates, leading to disaggregation of the fibrils and partial restoration of the peptide's solubility (Solomon et al, 1997). However, therapeutic efficacy of these antibodies is yet to be determined. Destabilizing compounds - Heparin sulfate has been identified as a component of all amyloids and has also been implicated in the earliest stages of inflammation-associated amyloid induction. Kisilevsky and co-workers (Mature Med. 1:143-148, 1995) described the use of low molecular weight anionic sulfonate or sulfate compounds that interfere with the interaction of heparin sulfate with the inflammation-associated amyloid precursor and the β peptide of Alzheimer's disease (AD). Heparin sulfate specifically influences the secreted amyloid precursor (SAA2) to adopt an increased β-sheet structure characteristic of the protein-folding pattern of amyloids. These anionic sulfonate or sulfate compounds were shown to inhibit heparin-accelerated Aβ fibril formation and were able to disassemble preformed fibrils in vitro, as monitored by electron micrography. Moreover, these compounds substantially arrested murine splenic inflammation-associated amyloid progression in vivo in acute and chronic models. However, the most potent compound [i.e., poly-(vinylsulfonate)] showed acute toxicity. Similar toxicity has been observed with another compound, IDOX (Anthracycline 4'-iodo-4'-deoxy-doxorubicin), which has been observed to induce amyloid resorption in patients with immunoglobin light chain amyloidosis (AL) [Merlini et al. (1995) Proc. Natl. Acad. Sci. USA].

Destabilizing peptides - The finding that the addition of synthetic peptides that disrupt the β-pleated sheets ("β-sheet breakers") dissociated fibrils and prevented amyloidosis [Soto et al. (1998) Nat. Med. 4:822-6] is particularly promising from a clinical point of view, h brief, a penta-residue peptide inhibited amyloid beta-protein fibrillogenesis, disassembled preformed fibrils in vitro and prevented neuronal death induced by fibrils in cell culture. In addition, the β-sheet breaker peptide significantly reduced amyloid beta-protein deposition in vivo and completely blocked the formation of amyloid fibrils in a rat brain model of amyloidosis.

Small molecules - The potential use of small molecules which. bind the amyloid polypeptide, stabilizing the native fold of the protein' has been attempted in the case of the transthyretin (TTR) protein [Peterson (1998) Proc. Natl. Acad. Sci. USA 95:12965-12960; Oza (1999) Bioorg. Med. Chem. Lett. 9:1-6]. Thus far, it has been demonstrated that molecules such as thyroxine and flufenamic acid are capable of preventing the conformation change leading to amyloid formation. However, the use of the compounds in animal models has not been proved yet and might be compromised due to the presence in blood of proteins, other than TTR, capable of binding these ligands.

Antioxidants - Another proposed therapy has been the intake of antioxidants in order to avoid oxidative stress and maintain amyloid proteins in their reduced state (i.e., monomers and dimers). The use of sulfite was shown to lead to more stable monomers of the TTR both in vitro and in vivo [Altland (1999) Neurogenetics 2:183-188]. However, a complete characterization of the antioxidant effect is still not available and the interpretation of results concerning possible therapeutic strategies remains difficult.

There is thus a widely recognized need for, and it would be highly advantageous to have, bacteria-derived compositions and methods of using same for treating βAP-associated diseases devoid of the above limitations.

SUMMARY OF THE INVENTION

According to one aspect of the present invention there is provided an isolated bacterial strain having a genome comprising a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1.

Accordmg to another aspect of the present invention there is provided a biologically pure culture of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1. According to further features in preferred embodiments of the invention described below, the 16S nucleic acid sequence region is as set forth in SEQ ID NO: 1.

According to yet another aspect of the present invention there is provided an isolated nucleic acid being at least 97 % identical to SEQ ID NO: 1. According to still another aspect of the present invention there is provided an isolated nucleic acid as set forth in SEQ ID NO: 1.

Accordmg to an additional aspect of the present invention there is provided an oligonucleotide being specifically hybridizable with an isolated nucleic acid at least 97 % identical to SEQ ID NO: 1.

According to still further features in the described preferred embodiments the oligonucleotide includes at least 10 nucleotides and no more than 50 nucleotides.

Accordmg to still further features in the described preferred embodiments the oligonucleotide is hybridizable in either sense or antisense orientation to nucleotide coordinates 145-182 of SEQ ID NO: 1.

According to yet an additional aspect of the present invention there is provided a bacterial cell culture comprising a bacterial strain capable of synthesizing an endogenous composition capable of preventing β-amyloid peptide self-assembly and/or of disassembling pre-assembled β-amyloid peptide aggregates. According to still further features in the described preferred embodiments the bacterial strain has a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1.

According to still further features in the described preferred embodiments the endogenous composition is anthranilic acid and/or cyclic tyrosyl-proline. Accordmg to still an additional aspect of the present invention there is provided a composition-of-matter comprising an intracellular or secreted fraction of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1.

According to a further aspect of the present invention there is provided a method of obtaining a composition capable of preventing β-amyloid peptide self-assembly and/or of disassembling pre-assembled β-amyloid peptide aggregates, the method comprising collecting an intracellular or secreted fraction of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97

% identical to SEQ ID NO: 1, thereby obtaining the composition capable of preventing β-amyloid self-assembly and/or disassembling pre-assembled β-amyloid aggregates.

According to yet a further aspect of the present invention there is provided a method of purifying agents capable of preventing β-amyloid self-assembly and/or of disassembling pre-assembled β-amyloid aggregates, the method comprising: (a) collecting an intracellular or secreted fraction of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID

NO: 1; and (b) purifying aromatic agents from the intracellular or secreted fraction of the bacterial strain, thereby purifying agents capable of preventing β-amyloid self-assembly and/or disassembling pre-assembled β-amyloid aggregates.

According to still further features in the described preferred embodiments the bacterial strain has all the identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242).

According to still further features in the described preferred embodiments the collecting the intracellular or secreted fraction of the bacterial strain is effected by ethyl acetate extraction.

According to still further features in the described preferred embodiments the bacterial strain has all the identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242). According to still further features in the described preferred embodiments the purifying is effected by chromatography.

According to still further features in the described preferred embodiments the aromatic agents include cyclic tyro syl-proline and/or anthranilic acid.

According to still further features in the described preferred embodiments the aromatic agents have a molecular weight less than 1000 daltons.

According to still a further aspect of the present invention there is provided a method of treating a β-amyloid associated disease in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of an intracellular or secreted fraction of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1.

According to still a further aspect of the present invention there is provided a method of treating a β-amyloid associated disease in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of anthranilic acid and/or cyclic tyrosyl-proline, thereby treating the β-amyloid associated disease in the subject.

According to still a further aspect of the present invention there is provided a pharmaceutical composition suitable for preventing β-amyloid peptide self-assembly and/or disassembling pre-assembled β-amyloid peptide, the pharmaceutical composition comprising a therapeutic effective amount of an intracellular or secreted fraction of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1 and a pharmaceutical acceptable carrier or diluent. According to still a further aspect of the present invention there is provided a pharmaceutical composition suitable for preventing β-amyloid peptide self-assembly and/or disassembling pre-assembled β-amyloid peptide, the pharmaceutical composition comprising a therapeutically effective amount of anthranilic acid and/or cyclic tyrosyl-proline and a pharmaceutical acceptable carrier or diluent. According to still a further aspect of the present invention there is provided a biologically pure culture of a bacterial strain having all the identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242).

According to still a further aspect of the present invention there is provided use of anthranilic and/or cyclic tyrosyl-proline in a medicament for preventing β-amyloid peptide self-assembly and/or disassembling pre-assembled β-amyloid peptide in a subject in need thereof.

According to still further features in the described preferred embodiments the cyclic tyrosyl-proline is selected from the group consisting of c-D-Tyr-D-Pro, c-D-Tyr-L-Pro, c-L-Tyr-L-Pro, c-L-Tyr-D-Pro and peptidomimetics thereof. The present invention successfully addresses the shortcomings of the presently known configurations by providing bacteria-derived compositions and methods of using same for treating βAP-associated diseases.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

BRIEF DESCRIPTION OF THE DRAWINGS

The invention is herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice. In the drawings: FIG. 1 is a histogram depicting screening of bacterial extracellular supernatant for binding to βAP. Aliquots of 0.2 ml of each supernatant were incubated with βAP -coated ELISA plates. After removing the unbound compounds and washing the plates with buffer, the amount of immuno complex formed after incubation with anti- βAP mAB 10D5 was estimated using peroxidase-labeled anti-mouse antibody, h the control, 0.2 ml of MB medium was used in place of the extracellular supernatants. Note that in addition to the 9 strains shown here, 11 additional strains behaved like the control.

FIG. 2 is a histogram depicting dose dependent binding of AZ4-S to βAP-coated ELISA plates using a depletion experiment. Each well contained 100 ng bound βAP. AZ4-S (40 μg in 0.1 ml K buffer) was added to well 1 and allowed to incubate for 24 h. The liquid was then removed and added to well 2 and allowed to incubate for 24 h. The procedure was repeated sequentially six times (wells 1-6). After the depleted AZ4-S liquid was removed, each well was washed and then incubated with 50 ng mAbl0D5 for 1 h at 37°C. Bound mAblOD5 was measured using peroxidase-labeled anti-mouse antibody. The control (O) consisted of ethylacetate-extracted medium that had not been inoculated with bacteria.

FIG. 3 is a graph depicting inhibition of βAP aggregation by AZ4-S. Disassembly of βAP aggregates was measured by ThT binding assay, using 25 μg βAP and different quantities of AZ4-S in a final volume of 50 μl. The values presented are the average of four determinations ± S.E.M.

FIG. 4 is a histogram depicting disaggregation of βAP fibrils by AZ4-S. Preformed βAP fibrils (10 μg, 10 d at 37°C) were incubated with 100 μg AZ4-S at 37°C. At the indicated times samples were removed for estimation of aggregated βAP by the ThT binding assay. Data presented are the mean ± S.E.M. (n = 3).

FIGs. 5a-c are photomicrographs depicting the effect of AZ4-S on .βAP fibril formation and dissociation as observed by electron microscopy. Figure 5a shows 250 μM βAP following 2 weeks at 37°C. Figure 5b shows 250 μM βAP in the presence of 100 μg AZ4-S following 2 weeks at 37 °C. Figure 5c depicts similar conditions as in Figure 5a except for an additional 24 h in the presence of 100 μg AZ4-S.

FIG. 6 is a histogram depicting partial prevention of βAP neurotoxicity by

AZ4-S by PC- 12 cells. Rat pheochromocytoma PC 12 cells were exposed for 48 h to 10 μg AZ4-S, 25 μM βAP (preincubated 10 d), and 10 μg AZ4-S + 25 μM βAP

(preincubated together 10 d). Cell survival was measured using the MTT assay. The control was untreated cells. Data presented are the mean ± S.E.M. (n = 3).

FIG. 7 is a histogram depicting inhibition of βAP toxicity by AZ4-S in rat cerebral cortical cultures. Neuron cultures were incubated for 5 d with 10 μg βAP (2.5 μM), 10 μg Aβ + 80 μg AZ4-S, or buffer alone (control). Neuron survival was estimated following NSE staining. Data are the mean ± S.E.M. (n = 4).

FIG. 8 is a graph showing the ^-NMR spectrum of c-D-Tyr-D-Pro and c-L-Tyr-L-Pro in CDC1₃ and MeOD.

FIG. 9 is a graph showing the ^-NMR spectrum of 1H-NMR spectrum of c-D-Tyr-L-Pro and c-L-Tyr-D-Pro in CDC1₃ and MeOD.

FIG. 10 is a graph showing the ^-NMR spectrum of 1H-NMR spectrum of anthranilic acid in d₆-DMSO.

FIG. 11 is a graph depicting a dose response effect of cyclic peptides on inhibition of β-amyloid aggregation as determined using the standard THT assay. c-L-tyrosyl-L-proline (•), c-D-tyrosyl-D-proline (o) and anthranlic acid (Δ).

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention is of a novel bacterial strain and compositions derived therefrom which can be used to treat βAP-associated diseases. The principles and operation of the present invention may be better understood with reference to the drawings and accompanying descriptions.

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein . is for the purpose of description and should not be regarded as limiting. Alzheimer's Disease (AD) is a degenerative brain disorder characterized clinically by progressive loss of memory, cognition, reasoning, judgment and emotional stability which gradually leads to profound mental deterioration and ultimately death. AD is believed to represent the fourth most common medical cause of death in the United States. The disease has been observed in races and ethnic groups worldwide and is at present incurable.

One of the major pathological features of AD is the abundant presence of amyloid plaques in the brain tissue of affected individuals (Selkoe, 1994). These plaques are largely found in the cerebral cortex and hippocampus, both associated with higher brain functions, and deposition in these regions correlates with loss of mental function (Cummings & Cotman, 1995). These plaques are predominantly composed of β-amyloid (βAP), a 39-43 amino acid peptide (Mori et al, 1992). A considerable body of experimental evidence has accumulated in recent years indicating that aggregation of βAP into neurotoxic fibrils plays a central role in the etiology of AD.

Numerous therapeutic approaches for prevention of βAP fibril formation or disaggreagtion of βAP have been described in the prior art. However, current therapeutic approaches are limited by cytotoxicity, non-specificity, bioavailability and in vivo stability.

While reducing the present invention to practice and while searching for a novel therapeutic modality to Alzheimer's disease, the present inventors have uncovered a novel bacterial strain, which is capable of synthesizing an endogenous composition capable of preventing β-amyloid peptide fibril formation or disaggregation of β- amyloid peptide (βAP).

As illustrated in the Examples section, which follows, endogenous compositions extracted from newly isolated marine bacterium bind βAP, inhibit fibril formation, disaggregate β-amyloid fibrils and exhibit neuroprotective properties.

Interestingly, the compositions of the present invention do not inhibit aggregation of amyloid peptide secreted from pancreatic islet β-cells (Jaikaran and Clark, 2001) or prion precursors, thus establishing the specificity of the compositions of the present invention towards βAP-associated diseases, such as Alzheimer's disease.

Thus, according to one aspect of the present invention there is provided a bacterial cell culture including a bacterial strain capable of synthesizing an endogenous composition capable of preventing assembly and/or disassembling of βAP aggregates.

As is mentioned hereinabove, βAP refers to a 39-43 amino acid peptide

(GenBank Accession No. P05067) including mutations and post-translational modifications thereof. According to one preferred embodiment of this aspect of the present invention the bacterial strain of the present invention is an isolated bacterial strain or a biologically pure culture of a bacterial strain having a 16S nucleic acid sequence region (rDNA) which is at least 97 %, at least 98 %, at least 99 % or essentially 100 % identical to SEQ ID NO: 1. As used herein the phrase "isolated bacterial strain" is a bacterial strain that has undergone at least some degree of purification from the natural environment thereof.

The phrase "biologically pure culture" refers to a bacterial culture in which at least 20 % of the bacteria are from one bacterial strain. According to preferred embodiments of this aspect of the present invention the culture is at least 30 % pure, more preferably at least 40 % pure, even more preferably at least 50 % pure and most preferably at least 90 % pure.

According to another preferred embodiment of this aspect of the present invention, the bacterial strain has all the identifying characteristics of the AZ-4 strain, which has been deposited under the Budapest Treaty in the American Type Culture Collection (ATCC) on June 2, 2003, as strain PTA-5242.

As described in Example 1 of the Examples section, which follows, strain AZ4 is a motile, rod shaped Gram negative Bacillus bacterium having thin walls. The strain forms cream-colored colonies on Marine Broth agar. The AZ-4 strain is positive for β-glucosidase and nitrate reduction and negative for β-galactosidase, urease, ' gelatinase, arginine dihydrolase and indole production from tryptophan. Strain AZ-4 is able to assimilate glucose, arabinose, mannose, N-acetyl-glucosamine, maltose, gluconate and adipate but not caprate. Other bacterial strains capable of synthesizing the compositions of the present invention can be identified as described in Example 1 of the Examples section using a variety of functional assays for monitoring amyloid assembly or disassembly which are well known in the art. Examples of such functional assays, include, but are not limited to, kinetic aggregation assays monitoring aggregation (e.g., ThT assay, Solomon et al, (1997) PNAS (USA), 94:4109-4112) and insolubilization kinetics using turbidity measurements at 405 nm, average particle size formed in the presence of the various bacterial preparations screened as determined using dynamic light scattering (DLS) experiments, Congo Red (CR) staining combined with polarization microscopy measuring the concentration of amyloid fibrils by the ability of the fibrils to bind CR and exhibit gold/green birefringence under polarized light [Cooper (1974) Lab. Invest. 31:232-8; Lansbury (1992) Biochemistry 31:6865-70] and electron microscopy.

As mentioned hereinabove the bacterial strains of the present invention are capable of synthesizing an endogenous composition capable of preventing fibril formation or disaggregation of β-amyloid polypeptide (βAP). Such an endogenous composition can be either synthesized by, or accumulated within, the bacterial strain of the present invention.

The endogenous compositions of the present invention may be derived from bacterial conditioned medium, bacterial lysates, bacterial membranes, or semi-purified or purified fractionation products thereof. Preferably, the compositions of this aspect of the present invention are derived from the intracellular or secreted fraction of the bacterial strain of the present invention.

As is shown in Examples 8-9 of the Examples section which follows the compositions of the present invention are polar in nature and can include, for example anthranilic acid and/or cyclic tyrosyl-proline

The endogenous compositions of the present invention may be obtained by collecting the intracellular or secreted fraction of the bacterial strains of the present invention such as the AZ-4 bacterial strain. As mentioned hereinabove, AZ-4 strain is a marine bacterial strain that can be isolated from many different types of corals. A preferred source for isolating of AZ-4 is the mucus of the coral Pocillopora damicornis from the Red Sea. The isolation, identification, and culturing of AZ-4 can be effected using standard microbiological techniques. Examples of such techniques may be found in

Gerhardt, P. (ed.) Methods for General and Molecular Microbiology. , American

Society for Microbiology, Washington, D.C. (1994) and Lennette, E. H. (ed.) Manual of Clinical Microbiology, Third Edition. American Society for Microbiology, Washington, D.C. (1980).

Isolation is preferably effected by streaking the specimen on solid medium to obtain a single colony which is characterized by the phenotypic traits described hereinabove (e.g., cream colored) and to reduce the likelihood of working with a culture which has become contaminated and/or has accumulated mutations.

Medium for growing the AZ-4 bacterial strain includes a carbon source, a nitrogen source and inorganic salts as well as specially required substances such as vitamins, amino acids, nucleic acids and the like.

Examples of suitable carbon sources which can be used for growing the AZ-4 strain of the present invention include, but are not limited to, sugars such as glucose, arabinose, mannose, glucosamine, maltose, and the like; organic acids such as acetic acid, fumaric acid, adipic acid, propionic acid, gluconic acid, malic acid, pyruvic acid, malonic acid and the like; alcohols such as ethanol and glycerol and the like; oil or fat such as soybean oil, rice bran oil, olive oil, corn oil, sesame oil. The amount of the carbon source added varies according to the kind of carbon source and is typically between 1 to 100 gram per liter medium.

Examples of suitable nitrogen sources which can be used for growing the AZ-4 strain of the present invention include, but are not limited to, potassium nitrate, ammonium nitrate, ammonium chloride, ammonium sulfate, ammonium phosphate, ammonia or combinations thereof. The amount of nitrogen source varies according the nitrogen source, typically between 0.1 to 30 gram per liter medium.

As the inorganic salts, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, disodium hydrogen phosphate, magnesium sulfate, magnesium chloride, ferric sulfate, ferrous sulfate, ferric chloride, ferrous chloride, manganous sulfate, manganous chloride, zinc sulfate, zinc chloride, cupric sulfate, calcium chloride, sodium chloride, calcium carbonate, sodium carbonate can be used alone or in combination. The amount of inorganic acid varies accordmg to the kind of the inorganic salt, typically between 0.001 to 10 gram per liter medium. Examples of specially required substances include, but are not limited to, vitamins, nucleic acids, yeast extract, peptone, meat extract, malt extract, dried yeast and combinations thereof.

For optimal growth, the medium is preferably adjusted to pH 7.5 - 8.5 and cells are grown with aeration in 30 °C to stationary phase (see Example 3 of the

Examples section).

It will be appreciated that commercially available media may also be used to culture the AZ-4 strain of the present invention, such as MBT (marine broth + 0.5 %

Tryptone) available from Difco, Detroit, MI. Validating the presence of the AZ-4 strain of the present invention in the culture can be effected using a variety of biochemical (e.g., β-glucosidase activity) and functional assays (i.e., amyloid disassembly) known in the art.

Alternatively or additionally, an oligonucleotide which is specifically hybridizable with the genomic 16S rDNA sequence region of the bacterial strain of the present invention can be used to detect and measure the amount of the bacteria of the present invention. Such an oligonucleotide can be used in a variety of methods involving nucleic acid hybridization such as Southern blot analysis and FISH

(fluorescent in situ hybridization) analysis.

To specifically detect the genomic 16S rDNA sequence region of the bacterial strain of the present invention, measures are taken to design specific oligonucleotide probes, which would not hybridize with other related genes under the hybridization conditions used.

For example, for an oligonucleotide probe specifically hybridizable with the

16S rDNA sequence of the present invention one may use the following oligonucleotide sequence: 5'-

TTCCCTCATGAGAGGGAAAGGATTATCCGGTATTAGCT -3' (SEQ ID NO: 4), which hybridizes in antisense orientation to nucleotide coordinates 145-182 of SEQ ID

NO: 1. Hybridization is effected under conditions, which allow the detection of the

16S rDNA sequence of the present invention and not homologous prior art sequences. Suitable methods and conditions are described in details in U.S. Pat. No. 6,500,650 and Hugenholtz (2002) Methods Mol. Biol. 179:29-42.

Typically, the oligonucleotide of this aspect of the present invention includes at least 10 nucleotides and no more than 50 nucleotides. Hybridization of short nucleic acids (below 200 bp in length, e.g. 17-40 bp in length) can be effected by the following hybridization protocols depending on the desired stringency; (i) hybridization solution of 6 x SSC and 1 % SDS or 3 M

TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS, 100 μg/ml denatured salmon sperm DNA and 0.1 % nonfat dried milk, hybridization temperature of 1 - 1.5 °C below the T_m, final wash solution of 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS at 1 - 1.5 °C below the T_m. (ϋ) hybridization solution of 6 x SSC and 0.1 % SDS or 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS, 100 μg/ml denatured salmon spemi DNA and 0.1 % nonfat dried milk, hybridization temperature of 2 - 2.5 °C below the T_m, final wash solution of 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS at 1 - 1.5 °C below the T_m, final wash solution of 6 x SSC, and final wash at 22 °C; (iii) hybridization solution of 6 x SSC and 1 % SDS or 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS, 100 μg/ml denatured salmon sperm DNA and 0.1 % nonfat dried milk, hybridization temperature of 37 °C, final wash solution of 6 x SSC and final wash at 22 °C.

It will be appreciated that for PCR-based methods a pair of oligonucleotides is used which is specifically hybridizable with the isolated nucleic acid described herein in an opposite orientation so as to direct exponential amplification of a portion thereof in a nucleic acid amplification reaction, such as a polymerase chain reaction. The polymerase chain reaction and other nucleic acid amplification reactions are well known in the art and require no further description herein. The pair of oligonucleotides according to this aspect of the present invention are preferably selected to have compatible melting temperatures (Tm), e.g., melting temperatures which differ by less than that 7 °C, preferably less than 5 °C, more preferably less than 4 °C, most preferably less than 3 °C, ideally between 3 °C and 0 °C.

Oligonucleotides of the present invention can be synthesized using methods which are well known in the art. Preferably, the oligonucleotides of the present invention are labeled using any detectable label. Examples of suitable labels include but are not limited to radioactive labels, fluorescent labels and the like. Methods of labeling oligonucleotides are well known to those of skill in the art [see for example, Sambrook and Maniatis, Molecular

Cloning -A laboratory manual, 2^nd addition (1989), Cold Spring Harbor Press].

It will be appreciated that validating the identity of the bacterial strain may be effected prior to and/or following growing the bacteria. Preferably, when bacterial typing is effected immediately following isolation, identification is effected using a hybridization based technique which due to high sensitivity thereof requires only a small amount of bacterial cells.

Once the identity of the bacterial strain is confirmed and bacteria are grown sufficiently, the compositions of the present invention may be isolated and purified from the culture using methods which are well known in the art such as centrifugation or filtration and extraction of the composition using a suitable solvent such as methanol, ethanol, acetone, ethyl acetate, tetrahydrofuran (THF), acetonitrile, benzene, ether, bicarbonate salts, dichloromethane, chloroform, petroleum ether, hexane, cyclohexane, diethyl ether and the like. According to prefened embodiments of this aspect of the present invention the extracting solvent is ethyl acetate.

Purification of the composition of the present invention from the extract can be effected using conventional procedures such as absorption, elution, dissolving and the like. The extracted fraction is functionally assayed using the assays described hereinabove. Preferably, such assays are effected throughout the purification procedure to determine the active portion and loss of activity.

The extracted functional composition may be further utilized to purify active agents, which are capable of preventing the assembly and/or disassembling βAP aggregates.

Purification of active agents may be effected using standard methods, such as liquid-liquid, liquid-solid, or affinity chromatography with normal phase, reverse-phase, ion-exchange, and gel filtration techniques being implemented as needed (Box, (1991) in Discovery and Isolation of Microbial Products, Verall, M. S., Ed., Ellis Horwood, Chichester, 1985; Franco et al. (1991) Crit. Rev. in Biotech.

11:193-276). The purification can be monitored by co-fractionation of the biological activity, using any of the screening assays described above. Once purified, the identity of the isolated agent can be determined using standard methods, including nuclear magnetic resonance (see Example 8 of the Examples section), mass spectroscopy, and

X-ray crystallography.

Using the hereinabove described methodology the present inventors were able to isolate aromatic compounds of less than 1000 daltons such as cyclic tyrosyl-proline and anthranilic acid, each being separately capable of preventing the assembly of βAP and/or disassembling βAP aggregates (see Examples 8-9 of the Examples section).

It will be appreciated that the purified agents of the present invention need not be isolated from a bacterial source, rather synthesized or commercially purchased when possible. As is illustrated in Examples 8-9 of the Examples section which follows, anthranilic acid obtained from Merck Laboratories (Darmstadt, Germany) was able to inhibit βAP aggregation.

Alternatively, the cyclic tyrosyl proline peptides of the present invention may be bacterial products or synthesized peptides or recombinant peptides and peptidomimetics (typically, synthesized peptides), as well as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, CA. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein. Further details in this respect are provided hereinunder.

Peptide bonds (-CO-NH-) within the short peptides of the present invention may be substituted, for example, by N-methylated bonds (-N(CH3)-CO-), ester bonds (-C(R)H-C-O-O-C(R)-N-), ketomethylene bonds (-CO-CH2-), α-aza bonds (-NH-N(R)-CO-), wherein R is any alkyl, e.g., methyl, carba bonds (-CH2-NH-), hydroxyethylene bonds (-CH(OH)-CH2-), thioamide bonds (-CS-NH-), olefinic double bonds (-CH=CH-), retro amide bonds (-NH-CO-), peptide derivatives (-N(R)-CH2-CO-), wherein R is the "normal" side chain, naturally presented on the carbon atom.

Tyrosine, for example, a natural aromatic amino acid may be substituted for synthetic non-natural acid such as o-methyl-Tyr.

In addition to the above, the peptides of the present invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g., fatty acids, complex carbohydrates, etc). As used herein in the specification and in the claims section below the term

"amino acid" or "amino acids" is understood to include the naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline and both D- and L-amino acids. Cyclic tyrosyl proline of the present invention can either be synthesized in a cyclic form or configured so as to assume a cyclic form under desired conditions (e.g., physiological conditions).

For example, the tyrosyl proline peptide according to the teachings of the present invention can include at least two cysteine residues flanking the core peptide sequence, hi this case, cyclization can be generated via formation of S-S bonds between the two Cys residues. Side-chain to side chain cyclization can also be generated via formation of an interaction bond of the formula -(-CH2-)n-S-CH2-C-, wherein n = 1 or 2, which is possible, for example, through incorporation of Cys or homoCys and reaction of its free SH group with, e.g., bromoacetylated Lys, Orn, Dab or Dap. Furthermore, cyclization can be obtained, for example, through amide bond formation, e.g., by incorporating Glu, Asp, Lys, Orn, di-amino butyric (Dab) acid, di-aminopropionic (Dap) acid at various positions in the chain (-CO-NH or -NH-CO bonds). Backbone to backbone cyclization can also be obtained through incorporation of modified amino acids of the formulas H-N((CH2)n-COOH)-C(R)H-COOH or H-N((CH2)n-COOH)-C(R)H-NH2, wherein n = 1-4, and further wherein R is any natural or non-natural side chain of an amino acid.

Preferably, other modes of cyclization may also be effected to combinatorially detect the most active peptide configuration of the cyclic peptide of the present invention [Ulysse (1995) Photoregulation of cyclic peptides conformation. J. Am. Chem. Soc. 117, 8466-8467; Behrendet (1999) Photomodulation of conformational states. Synthesis of cyclic peptides with backbone-azobebzene moieties. J. Peptide Sci. 5, 519-529; Renner, C, Behrendet, R., Sporlein, S., Wachtveitl, J. and Moroder, L. (2000) Photomodulations of conformational states. I. Mono- and bicyclic peptides with (4-amino)ρhenylazobenzoic acid as backbone constituent. Biopolymers 54, 489-500; Renner (2000) Photomodulations of conformational states. II. Mono- and bicyclic peptides with (4-aminomethyl)-phenylazobenzoic acid as backbone constituent. Biopolymers 54, 501-514; Kumita (2000) Photo-control of helix content in a short peptide. Proc. Natl acad. Sci. USA 97, 3803-3808].

As mentioned hereinabove, the compositions (i.e., intracellular or secreted fraction of bacterial cells) or active agents (e.g., cyclic tyrosyl-proline and anthranilic acid) of the present invention can be used to treat βAP-associated diseases such as brain dysfunctions in mammals, such as familial autonomic diseases, neurofibroma, neuroblastoma, pheochromocytoma, various types of dementia such as senile dementia, Alzheimer's disease and the like, Parkinson's disease, Huntington's chorea,

Creutzfeldt- Jakob disease, bovine spongiform encephalopathy, and scrapie. Thus, according to another aspect of the present invention, there is provided a method of treating an amyloid associated disease in a subject.

As mentioned hereinabove, prefened individual subjects according to the present invention are mammals such as canines, felines, ovines, porcines, equines, bovines, humans and the like. The term "treating" refers to reducing or preventing βAP-plaque formation, or substantially decreasing βAP-plaque occunence in the affected tissue.

The method is effected by administering to an individual subject in need thereof, a therapeutically effective amount of the composition of the present invention. The composition of the present invention can be administered to the individual subject per se, or as part of a pharmaceutical composition where it is mixed with a pharmaceutically acceptable carrier.

As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

Herein the term "active ingredient" refers to the composition (i.e., secreted bacterial fraction and/or agents deriving therefrom), described hereinabove, which is accountable for the biological effect.

Hereinafter, the phrases "physiologically acceptable carrier" and

"pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases. One of the ingredients included in the pharmaceutically acceptable carrier can be for example polyethylene glycol (PEG), a biocompatible polymer with a wide range of solubility in both organic and aqueous media (Mutter et al. (1979)).

Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.

Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

Techniques for formulation and administration of drugs may be found in

"Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.

Suitable routes of administration may, for example, include oral, rectal, fransmucosal, especially fransnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections.

Alternately, one may administer a preparation in a local rather than systemic manner, for example, via injection of the preparation directly into a specific region of a patient's body.

Pharmaceutical compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

For injection, the active ingredients of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For fransmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical compositions, which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration. For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by nasal inhalation, the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount.

Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The preparations described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, friglycerides or liposomes.

Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use. The preparation of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides. Pharmaceutical compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.

For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro assays. For example, a dose can be formulated in animal models and such information can be used to more accurately determine useful doses in humans.

Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. [See e.g., Fingl, et al., (1975) "The Pharmacological Basis of Therapeutics", Ch. 1 p.l]. Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.

Compositions including the preparation of the present invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition. Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.

Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

EXAMPLES Reference is now made to the following examples which, together with the above descriptions, illustrate the invention in a non limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al, "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al, "Recombinant DNA", Scientific American Books, New York; Bkren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987;

3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R. L, ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

EXAMPLE 1 Screening of bacterial marine strains for production of extracellular material that bind to β-amyloid peptide Materials and Experimental Procedures

Bacteria and growth conditions- Bacteria were isolated from the surface of corals taken from the Red Sea, near Eilat, Israel. The pure cultures were grown in Marine Broth (MB) (Difco Marine Broth 2216; Becton-Dickinson, Sparks, MD, U.S.A) or MBT (MB plus 0.5% Tryptone) media at 30 °C with aeration.

Binding of the various extracted bacterial supernatant fluids to βAP (1-40) - - Supernatant fluid was separated from the cellular fraction by centrifugation of the cell culture at 5300 x g, for 45 minutes at 4°C. Samples (100 μl) of extracted bacterial growth supernatant fluid were added to the βAP (US Peptide, CA, USA) coated plate and incubated overnight at 4 °C (Solomon et al (1996) PNAS (USA) 93:452-455). After binding, the residual supernatant was transferred from well to well a number of times. After washing the plate (5 times with water), mAb 10D5 (50ng/well) (Elan, San Francisco, USA) was added to the plate for an additional hour at 37 °C. After extensive washings HRP goat anti-mouse IgG antibody (1:5000)

(Bio-Rad, Hercules, CA, U.S.A.) in blocking solution (1% non-fat milk) was added and incubated for 1 h at 37 °C. The amount of immunocomplex formed was estimated by measuring absorbance at 492 mm. Results

Twenty different marine bacteria, isolated from Red Sea corals, were grown in MB medium, centrifuged and the cell-free supernatant fluids extracted with ethylacetate. Following removal of the solvent in vacuo, the dissolved materials were screened for βAP binding properties by an ELISA test. The screening for anti-aggregating compounds was based on the concept that a bacterial material that binds βAP would inhibit the subsequent binding of known anti-βAP antibodies. As shown in Figure 1, only one of the supernatants tested, derived from strain AZ4, showed significant inhibition of binding of an anti- βAP antibody (mAb 10D5) known to have anti-aggregating properties.

EXAMPLE 2 Characterization of strain AZ4 Bacterial classification tests - Bacterial classification tests were carried out with the Biolog GN2 Microplate™ (Biolog Inc., Hayward, CA) and Api-20 NE (Bio Merieux SA, Marcy-Ietoil, France). Standard methods were used except that media were adjusted to 3% NaCI (Kushmaro et al, 2001).

16S rDNA sequence determination - For identifying the 16S rDNA sequence of strain AZ4, genomic DNA was isolated from an overnight culture, using the Wizard genomic DNA purification kit (Promega, Madison, WI). 16S rDNA (SEQ ID NO: 1) was amplified using ex taq DNA polymerase (Takara Shuzo Co., Japan) and general prokaryotic 16S rDNA primers (SEQ ID NOs: 2 and 3). Amplification conditions for the PCR included denaturation at 94 °C for 5 minutes (min), followed by 30 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 45 seconds (sec). The final extension step was at 72 °C for 5 min. Reaction products were purified and sequenced by the chain termination method in ABI PRISM (Model 377, version 3.3) automatic sequencer. The 16S rDNA sequence was compared with homologous published sequences. Results

Bacterial classification tests found that strain AZ4 is a motile, rod-shaped

Gram-negative bacterium that forms cream-colored colonies on Marine Broth Agar.

The organism .showed positive tests for β-glucosidase and nitrate reduction, and negative tests for β-galactosidase, urease, gelatinase, arginine dihydrolase and indole production from tryptophan. Strain AZ4 was able to assimilate glucose, arabinose, mannose, N-acetyl-glucosamine, maltose, gluconate and adipate, but not caprate. The sequence of the 16S rDNA (SEQ ID NO: 1) indicated that strain AZ4 is a novel species. The closest known bacterial strain based on its 16S rDNA sequence is Bacillus aestuarii (96% identity) as determined by using NCBI sequence database and BLAST analysis.

EXAMPLE 3 Preparation ofAZ4-S Preliminary experiments indicated that the maximum amount of extracellular βAP -binding activity was produced by strain AZ4 when grown in MBT medium for 50 hours (to stationary phase) at 30 °C with aeration. Under these conditions, the culture reached a turbidity of 2.5 at A₆₂₀ and pH 8.3. Following centrifugation to remove cells, the supernatant fluid was extracted three times with an equal volume of ethylacetate. The solvent was evaporated to dryness in vacuo and the residual material, refened to as AZ4-S, dried to constant weight. The yield of AZ4-S was 100-150 mg per 2 liter culture fluid (i.e., 4 preparations).

EXAMPLE 4 Competitive inhibition of mAb 10D5 binding to βAP by increasing amounts of

AZ4-S Materials and Experimental Procedures

Binding of AZ4-S to the N-terminal region of βAP - Samples (lOOμl) of extracted bacteria growth medium were added to the βAP coated plate and incubated overnight at 4 °C. hi cases wherein several serial supernatant fractions were tested, each incubation was performed overnight at 4°C. Following 5 times washing with water, mAb 105D (50ng/well) was added to the plate for 1 h at 37 °C. The plate was washed again and HRP goat anti-mouse IgG antibody, diluted 1:5000 in blocking solution, was added and incubated for 1 h at 37 °C. The amount of immunocomplex formed after antibody binding was estimated by measuring optical density at 492 mm.

Results

AZ4-S contained material which bound to βAP-coated ELISA plates and prevented the binding of anti-βAP antibodies 10D5 (Figure 2). In the initial experiment (well 1), the bound AZ4-S caused a 72% inhibition of mAb 10D5 binding. The same inhibition was achieved when the unbound material from well 1 was transfened to well 2, indicating that the active material was in excess. Further transfers of the liquid from one βAP-coated well to another resulted in reduction of the inhibition of antibody binding. After 5 transfers (well 6), the active component was completely removed and no inhibition of antibody binding was observed.

EXAMPLE 5 Inhibition ofAβ aggregation by AZ4-S. Materials and Experimental Procedures

ThT assay - The effect of AZ4-S compound on in vitro βAP fibrillogenesis was evaluated using a fluorometric assay that measures thioflavine T (ThT) fluorescence emission (Solomon et al. 1997). Aliquots of βAP (125 μM in PBS) were incubated with different supernatant fractions of AZ4-S in 3% milk blocked tubes at 37 °C. After 4 days - 2 weeks incubation, samples (20 μl) were added to 1 ml of 1 μM ThT solution and fluorescence intensity was measured spectrophotometrically at excitation and emission wavelengths of 435 nm and 482, respectively.

Electron Microscopy - βAP (250μm) was incubated for two weeks at 37 °C in the presence of AZ4-S supernatant (lOOμg) or in its absence. In parallel βAP, preincubated for 10 days at 37 °C, was treated for another day with AZ4-S supernatant (100 μg). Negatively stained amyloid fibrils were prepared by floating carbon-coated grids with peptide solutions in DDW and air-drying. Then the fibrils were negatively stained with aqueous (2% wt/vol) uranyl acetate. Sample visualization was performed using a JEOL model 1200 EX electron microscope operated at 80 kV. Results

The effect of AZ4-S on βAP fibrillation was tested using a ThT binding assay. As shown in Figure 3, using 25 μg βAP in 50 μl (0.12 mM), 81% and 93% inhibition of aggregation were achieved with 50 μg and 100 μg AZ4-S, respectively. Medium control samples did not inhibit the formation of βAP fibrils. For comparative purposes, 1 unit of inhibitory activity is defined as the concentration that causes a

50% inhibition of βAP aggregation under these experimental conditions. Accordingly, the AZ4-S preparation used in this experiment had a specific activity of 31 units per mg, conesponding to 1.9 units per ml culture. The two other preparations of AZ4-S yielded 1.5 and 1.6 units per ml culture.

As shown in Figure 5a, inhibition of βAP aggregation was also observed by electron microscopy. Following 2 weeks at 37 °C, βAP formed clearly defined fibrillar structures. Consistently, in the presence of AZ4-S, βAP remained in its diffuse state (Figure 5b).

EXAMPLE 6 Disaggregation of preformed βAP fibrils byAZ4-S. Materials and Experimental Procedures - See Example 5.

Results

To determine whether AZ4-S was capable of dissolving preformed βAP aggregates, preincubated βAP samples were exposed to 100 μg of AZ4-S for varying times, and levels of fibrillar βAP were assessed by ThT assay. As shown in Figure 4, approximately 40% and 60% of the fibrils were solubilized in 3 days (d) and 7 d, respectively. Disaggregation of βAP fibrils by AZ4-S was also observed by electron microscopy (Figure 5c).

EXAMPLE 7 Effect ofAZ4-S on the neurotoxicity of βAP

Materials and Experimental Procedures

Cell cultures and cytotoxicity assays - Rat pheochromocytoma PC- 12 cells were cultured in tissue culture flasks with 20 ml growth medium (Dulbecco's Modified Eagle Medium (DMEM), supplemented with 8% fetal calf serum, 8% horse serum, 2mM L-glutamine, and 100 units penicillin-streptomycin-nystatin; Biological Industries, Beit Haemek, Israel) at 37 °C under 5% CO₂ and subcultured with 2 ml EDTA-trypsin every 3 days. Freezing cells was done in growth medium supplemented with 10% DMSO at -70 °C and every few months cells were replaced. Neuronal cell culture preparation - Dissociated cerebral cortical tissue of a newborn rat were placed with 1 ml trypsin and 1 ml Hank's Balanced Salt Solution

(HBSS) (Biological Industries, Beit Haemek, Israel) in the incubator for 20 min.

Cells were extracted with neuronal growth medium containing 5 % horse serum, 1 % N3 solution (Romijn et al. 1982), 0.1 % tetramycin in 4.5 mg/ml D-glucose DMEM (Biological Industries, Beit Haemek, Israel). At the end of the procedure, cells were centrifuged for 5 min at 1500 rpm. The pellet was resuspended with 12 ml of neuronal growth medium and cells counted under a microscope using a hemocytometer. The cells were seeded into a dish at a concentration of 10⁶ cells/ml. The plates were incubated for 8 days at 37 °C.

Evaluation of βAP neurotoxicity in PC-12 cells and in rat cerebral cortical neuron based on NSE staining - Mixed samples of 10 μl βAP (250 μM) and AZ4-S aliquots, to a total volume of 100 μl, were added to the plate and incubated for 5 days. The cells were fixed with paraformaldehyde and the neurons were immunocytochemically stained with antiserum against neuron specific enolase (Research Diagnostics, Inc., Flanders, NJ, U.S.A.) and detected with peroxidase-anti-peroxidase antibody using DAB substrate (Vector Laboratories, Inc., Burlingame, CA, U.S.A.). The surviving neuronal cells were counted in each culture plate. Neurotoxicity of βAP in PC-12 cells - Pheochromocytoma PC 12 cells were exposed to increasing concentrations of preincubated βAP with AZ4-S aliquots and the cell viability was assessed by MTT. The assay is based on the conversion of the yellow tetrazolium salt, 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) to the colored formazan product by mitochondrial enzymes in viable cells (Sigma Chemical Co., St. Louis, MO, U.S.A., Sadowsky et al. 1993). Cell viability is calculated as the percentage of untreated cells which is considered as 100% viability. Results Prevention of βAP neurotoxicity by AZ4-S was tested in two neural cell systems: PC-12 cells and rat cerebral cortical cultures, hi the PC-12 cell system, βAP was incubated for two weeks in the presence of crude AZ4-S and then added to the cells. As shown in Figure 6, the difference in cell survival between PC-12 cells exposed to untreated βAP and βAP incubated in the presence of AZ4-S demonstrated that crude AZ4-S partially inhibited the neurotoxicity of βAP. Under the conditions used, 50%» of the cells were killed by βAP in 48 h. The crude AZ4-S by itself was slightly toxic, causing 18% cell death. Cell death was reduced from 50% to 20% when βAP was preincubated with AZ4-S. The ability of crude AZ4-S to prevent βAP neurotoxicity by disaggregation of previously aggregated βAP was estimated in rat cerebral cortical cultures. βAP samples were incubated for two weeks, then crude AZ4-S was added and the mixture incubated overnight. The resulting preparations of βAP fibrils alone and fibrils + AZ4-S were then added to the cells. As shown in Figure 7 βAP fibrils caused a 25 % reduction in the number of neurons, while the number of surviving neurons in samples that were incubated with βAP fibrils + AZ4-S was similar to the surviving neuron number of the control (i.e., no βAP or AZ4-S).

EXAMPLE 8 Isolation ofc-Tyr-Pro and anthranilic acid (AA) from AZ4 extract

Materials, Experimental Procedures and Results

The ethyl acetate extract of AZ-4 was evaporated to dryness and then was repeatedly washed with water to give 106 mg of dry substance, which was subjected to partitioning by the method of Kupchan et al. (1977). The chloroform fraction (72 mg), which showed the highest anti-aggregration activity, was chromatographed on a Sephadex LH-20 column, and eluted with heptane-CHCl₃-MeOH (2:1:1). As shown in Table 1, below, Fractions 5 and 8 showed high activities. Fraction 5 appeared to be ca. 90 % c-Tyr-Pro by NMR analysis. The major component of fraction 8 (3.5 mg) was anthranilic acid. Fraction 5 was further purified by vacuum-liquid chromatography (VLC) over silica gel, using ethylacetate with increasing concentrations of methanol as eluent. The active fraction was eluted with 1% MeOH in ethyl acetate (7.5 mg). Table 1

- The standard ThT assay was performed using 0.25 mg of the sample

EXAMPLE 9

Identification of c-L-Tyr-L-Pro andAA as active components of AZ-4.

Materials and Experimental Procedures

Synthesis of c-L-Tyr-L-Pro, c-D-Tyr-D-Pro, c-L-Tyr-D-Pro, c-D-Tyr-L-Pro

- All chemicals used for the syntheses were obtained from Bachem AG, Bubendorf, Switzerland, and were the highest purity available. Boc-Tyrosine (112 mg, 0.4 mmoles) was dissolved in methylene chloride (2 ml) at zero degrees and the proline methyl ester hydrochloride (52 mg, 0.4 mmoles) and triethylamine (56 μl, 0.4 mmoles) were added. Following addition of N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide hydrochloride ( 77 mg, 0.4 mmoles), the solution was stored at 4° overnight. The reaction mixture was then washed sequentially with water, citric acid (1 N), sodium bicarbonate (1 N), water, and the solution was then evaporated to dryness. The crude peptide (147 mg) was then subjected to vacuum-liquid chromatography (VLC) over silica gel, using heptane with increasing proportions of ethyl acetate as eluent. The Boc-dipeptide ester (113 mg) was afforded by elution with 50 % ethyl acetate in heptane. The latter was dissolved in formic acid (12 ml, 98 %) and the solution was kept at room temperature for 2 h. After removal of the excess formic acid in vacuo, the crude dipeptide formate ester was dissolved in sec-butyl alcohol (12 ml) and toluene (8 ml). The solution was refluxed for 3 h and then the solvent was evaporated and the residue was subjected to VLC over silica gel, using ethyl acetate with increasing proportions of MeOH. e-Tyr-Pro (40 mg) was afforded by elution with 1 % MeOH in ethyl acetate [Nitecki, D.E.; Halpern, B. Westley, J.L J. Org. Chem. (1967), 32, 864-866] .³ Results

In order to determine which of the c-Tyr-Pro isomers isolated from the bacterial extract (see Example 8) was active, the four following possible isomers were chemically synthesized: c-L-Tyr-L-Pro: an oil; [α]²⁵ _D -82° (c 1.65, MeOH) c-D-Tyr-D-Pro: an oil; [α]²⁵ _D +82° (c 1.61, MeOH) c-L-Tyr-D-Pro: an oil; [α]²⁵ _D +51° (c 1.24, MeOH) c-D-Tyr-L-Pro: an oil; [α]²⁵ _D -51° (c 1.50, MeOH)

It will be appreciated that while c-D-Tyr-D-Pro as well as c-D-Tyr-L-Pro are new compounds, the other two stereoisomers synthesized, c-L-Tyr-L-Pro and c-L-Tyr-D-Pro, are known compounds [Registry no. 61117-56-4, 4549-02-4, respectively; Stierle, A.C.; Cardellina, J.H, II; Strbel, G.A. Proceedings of the

National Academy of Sciences of the United States of America (1998), 85,

8008-8011; Milne, P.J.; Oliver, D.W.; Ross, H.M. J. Crys. Spec. Research (1992), 22, 643-649].

As shown in Figures 8-9, the chemically synthesized LL and DD isomers gave identical NMR patterns and opposite values in optical rotation. The purified fraction

5 gave an identical NMR pattern as the LL and DD isomers, but showed 5-10% impurities. The purified fraction 5 showed a negative [α]25π, indicating the natural compound was the LL isomer.

Although the chemically synthesized pure c-L-Tyr-L-Pro showed good activity (68%, see Table 1, above), it was significantly lower than the impure natural compound. It is possible that an unknown impurity in the fraction was highly active or acted synergistically with the LL isomer. As shown in Figure 10, the NMR of fraction 8 indicated that the major component was anthranilic acid (ca. 80-90% pure). The pure compound, purchased from Merck Laboatories, gave 56% inhibition, again significantly lower than the impure natural compound (Table 1, above).

Consistent with their identification as active components of AZ4, each of the above three pure compounds (i.e., c-L-tyrosyl-L-proline, c-D-tyrosyl-D-proline and anthranlic acid) showed a concentration-dependent inhibition of β-amyloid aggregation (Figure 11), substantiating their use as putative drugs for Alzheimer's disease. It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention.

References cited by authors

(additional references are cited in the text)

1. Moore, C.L. & Wolfe, M.S. Inhibition of β-amyloid formation as a therapeutic strategy. Exp. Opin. Ther. Patents 9, 135-146 (1999)

2. Selkoe, D.J. Cell biology of the amyloid beta-protein precursor and the mechanism of Alzheimer's disease. Ann. Rev. Cell. Biol. (1994) 10, 373-403

3. Cummings, B.J. & Cotman, C.W. Image analysis of β-amyloid load in Alzheimer's disease and relation to dementia severity. Lancet 346, 1524-1528 (1995)

4. Mori, H., Taiko, K., Ogawara, M. & Selkoe, D.J. Mass spectrometry of purified amyloid beta protein in Alzheimer's disease. J. Biol. Chem. (1992) 267, 17082-17086

5. Jarrett, J.T., Berger, E.P. & Lansbury, P.T. Jr. The carboxy terminus of the beta amyloid protein is critical for the sending of amyloid formation: implications for the pathogenesis of Alzheimer's disease. Biochemistry 32, 4693-4697 (1993)

6. Saido (1995) Neuron 14:457-64

7. Solomon, B., Koppel, R., Frankel, D. & Hanan-Aliaron, E. Disaggregation of Alzheimer beta-amyloid by site-directed mAb. Proc. Natl. Acad. Sci. 94, 4109-4112 (1997)

8. Solomon, B., Koppel, R., Hannan, E. & Katzav, T. Proc. Natl. Acad. Sci. USA 93, 452-455 (1996)

9. Natassery, G.T. Vitamin E and other endogenous anti-oxidants in the central nervous system. Geriatrics 53, (Suppl. 1) S25-27 (1998)

10. Kang, J., Lemaire, H.G., Unterbeck A. et al. The precursor of Alzheimer's disease amyloid A4 protein resembles a cell-surface receptor. Nature 325, 733-736 (1987)

11. Lorenzo, A. & Hanker, B.A. Beta-amyloid neurotoxicity requires fibril formation and is inhibited by Congo red. Proc. Natl. Acad. Sci. USA 91, 12243-12247 (1994)

12. Camilleri, P., Haskins, NY. & Howlett, D.R. FEBS Lett. 341, 256-258 (1994)

13. Tjernberg, L.O., Naslund, J., Lindqvist, F., Johansson, J._? Karlstrom, A.R., Thyberg, J., Terenius L. & Nordstedt, C. Anest of β-amyloid fibril formation by apentapeptide ligand. J. Biol. Chem. 271, 8545-8548 (1996) 14. Turnell, W.G. & Finch, J.T. J. Mol. Biol. 227, 1205-1223 (1992)

15. Jaikaran, Ema T.A.S. & Clark, A. Islet amyloid and type 2 diabetes: from molecular misfolding to islet pathophysiology. Biochim. Biophys. Acta 1537: 179-203 (2001)

16. Kushmaro, et al. 2001 IJSEM

17. Romijn, H.J., Habets, A.M.M.C., Mud, M.T., Wolters, P.S. 1982. Nerve outgrowth, synaptogenesis and bioelectric activity in fetal rat cerebral cortex tissue cultured in serum-free, chemically defined medium. Develop. Brain Res. 2:583-589.

18. Sladowski D., Steer, S.J., Clothier, R.H., Balls M. 1993. An improved MTT assay. J. Immunol. Methods 157:203-207.

STRAIN DEPOSIT INFORMATION

A deposit of bacterial strain AZ-4 of the present invention is maintained by American Type Culture Collection (Manassas, Va. 20110) since June 2, 2.003 under the following depository number: PTA-5242.

Access to this deposit will be available during the pendency of this application to persons determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 CFR 1.14 and 35 USC 122. Upon allowance of any claims in this application, all restrictions on the availability to the public of the strain will be inevocably removed by affording access to the deposit.

Claims

WHAT IS CLAIMED IS:

1. An isolated bacterial strain having a genome comprising a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1.

2. The isolated bacterial strain of claim 1, wherein said 16S nucleic acid sequence region is as set forth in SEQ ID NO: 1.

3. A biologically pure culture of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: l.

4. The biologically pure culture of claim 3, wherein said bacterial strain has all the identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242).

5. The biologically pure culture of claim 3, wherein said 16S nucleic acid sequence region is as set forth in SEQ ID NO: 1.

6. An isolated nucleic acid being at least 97 % identical to SEQ ID NO: 1.

7. An isolated nucleic acid as set forth in SEQ ID NO: 1.

8. An oligonucleotide being specifically hybridizable with an isolated nucleic acid at least 97 % identical to SEQ ID NO: 1.

9. The oligonucleotide of claim 8, wherein the oligonucleotide includes at least 10 nucleotides and no more than 50 nucleotides.

10. The oligonucleotide of claim 8, wherein the oligonucleotide is hybridizable in either sense or antisense orientation to nucleotide coordinates 145-182 of SEQ ID NO: 1.

11. A bacterial cell culture comprising a bacterial strain capable of synthesizing an endogenous composition capable of preventing β-amyloid peptide self-assembly and/or of disassembling pre-assembled β-amyloid peptide aggregates.

12. The bacterial cell culture of claim 11, wherein said bacterial strain has all identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242).

13. The bacterial cell culture of claim 11, wherein said bacterial strain has a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1.

14. The bacterial cell culture of claim 11, wherein said endogenous composition is anthranilic acid and/or cyclic tyrosyl-proline.

15. A composition-of-matter comprising an intracellular or secreted fraction of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1.

16. The composition-of-matter of claim 15, wherein said bacterial strain has all the identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242).

17. A method of obtaining a composition capable of preventing β-amyloid peptide self-assembly and/or of disassembling pre-assembled β-amyloid peptide aggregates, the method comprising collecting an intracellular or secreted fraction of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1, thereby obtaining the composition capable of preventing β-amyloid self-assembly and/or disassembling pre-assembled β-amyloid aggregates.

18. The method of claim 17, wherein said collecting said intracellular or secreted fraction of said bacterial strain is effected by ethyl acetate extraction.

19. The method of claim 17, wherein said bacterial strain has all the identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242).

20. A method of purifying agents capable of preventing β-amyloid self-assembly and/or of disassembling pre-assembled β-amyloid aggregates, the method comprising:

(a) collecting an intracellular or secreted fraction of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1; and

(b) purifying aromatic agents from said intracellular or secreted fraction of said bacterial strain, thereby purifying agents capable of preventing β-amyloid self-assembly and/or disassembling pre-assembled β-amyloid aggregates.

21. The method of claim 20, wherein said collecting said intracellular or secreted fraction of said bacterial strain is effected by ethyl acetate extraction.

22. The method of claim 20, wherein said bacterial strain has all the identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242).

23. The method of claim 20, wherein said purifying is effected by chromatography.

24. The method of claim 20, wherein said aromatic agents include cyclic tyrosyl-proline and/or anthranilic acid.

25. The method of claim 23, wherein said cyclic tyrosyl-proline is selected from the group consisting of c-D-Tyr-D-Pro, c-D-Tyr-L-Pro, c-L-Tyr-L-Pro, c-L-Tyr-D-Pro and peptidomimetics thereof.

26. The method of claim 20, wherein said aromatic agents have a molecular weight less than 1000 daltons.

27. A method of treating a β-amyloid associated disease in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of an intracellular or secreted fraction of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1.

28. The method of claim 27, wherein said bacterial strain has all the identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242).

29. A method of treating a β-amyloid associated disease in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of anthranilic acid and/or cyclic tyrosyl-proline, thereby treating the β-amyloid associated disease in the subject.

30. The method of claim 29, wherein said cyclic tyrosyl-proline is selected from the group consisting of c-D-Tyr-D-Pro, c-D-Tyr-L-Pro, c-L-Tyr-L-Pro, c-L-Tyr-D-Pro and peptidomimetics thereof.

31. A pharmaceutical composition suitable for preventing β-amyloid peptide self-assembly and/or disassembling pre-assembled β-amyloid peptide, the pharmaceutical composition comprising a therapeutic effective amount of an intracellular or secreted fraction of a bacterial strain having a genome including a 16S nucleic acid sequence region being at least 97 % identical to SEQ ID NO: 1 and a pharmaceutical acceptable carrier or diluent.

32. The pharmaceutical composition of claim 31, wherein said bacterial strain has all the identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242).

33. A pharmaceutical composition suitable for preventing β-amyloid peptide self-assembly and/or disassembling pre-assembled β-amyloid peptide, the pharmaceutical composition comprising a therapeutically effective amount of anthranilic acid and/or cyclic tyrosyl-proline and a pharmaceutical acceptable carrier or diluent.

34. Use of anthranilic and/or cyclic tyrosyl-proline in a medicament for preventing β-amyloid peptide self-assembly and/or disassembling pre-assembled β-amyloid peptide in a subject in need thereof.

35. The use of claim 34, wherein said cyclic tyrosyl-proline is selected from the group consisting of c-D-Tyr-D-Pro, c-D-Tyr-L-Pro, c-L-Tyr-L-Pro, c-L-Tyr-D-Pro and peptidomimetics thereof.

36. A biologically pure culture of a bacterial strain having all the identifying characteristics of the AZ4 strain (ATCC Deposition No: PTA-5242).