WO2003100054A1 - Regulation de la formation de phragmoplaste vegetal et procede de construction d'un vegetal sterile male - Google Patents

Regulation de la formation de phragmoplaste vegetal et procede de construction d'un vegetal sterile male Download PDF

Info

Publication number
WO2003100054A1
WO2003100054A1 PCT/JP2002/012268 JP0212268W WO03100054A1 WO 2003100054 A1 WO2003100054 A1 WO 2003100054A1 JP 0212268 W JP0212268 W JP 0212268W WO 03100054 A1 WO03100054 A1 WO 03100054A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
protein
dna
acid sequence
plant
Prior art date
Application number
PCT/JP2002/012268
Other languages
English (en)
Japanese (ja)
Inventor
Yasunori Machida
Ryuichi Nishihama
Original Assignee
Ishihara Sangyo Kaisha, Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ishihara Sangyo Kaisha, Ltd. filed Critical Ishihara Sangyo Kaisha, Ltd.
Priority to AU2002349481A priority Critical patent/AU2002349481A1/en
Publication of WO2003100054A1 publication Critical patent/WO2003100054A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
    • C12N15/8289—Male sterility
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/30—Animal feeding-stuffs from material of plant origin, e.g. roots, seeds or hay; from material of fungal origin, e.g. mushrooms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to regulation of formation and Z or development / differentiation control of a plant diaphragm-forming body, and a molecule used for the regulation.
  • the present invention relates to a technique for controlling a cytokinesis process in a plant or the like.
  • the present invention also relates to a male sterile plant produced by controlling a gene involved in cell division, and a technique for using the same. Further, the present invention relates to a method for producing a plant with reduced fertility, and a molecule used for the method.
  • Controlling the formation of septal swelling bodies in plants has various important significances in the agricultural field.
  • plant-specific cytokinesis processes can be controlled by controlling the formation of adult adults. It will be possible to produce plants with new production value and shape. In particular, by suppressing meiosis in living cells, it is possible to produce plants with reduced fertility, which contributes to the improvement of breeding techniques.
  • Cell division is one of the basic phenomena of life, and cells proliferate by repeating division.
  • Cells undergo a series of processes called the cell cycle consisting of four phases: G1 (gap 1), S (DNA synthesis), G2 (gap 2), and M (transversion).
  • G1 gap 1
  • S DNA synthesis
  • G2 gap 2
  • M transversion
  • the M phase of somatic cells also called mitosis, is the time when chromosomes replicated in the S phase are correctly distributed to cells.
  • the process of bisecting the cytoplasm after chromosome distribution is called cytokinesis.
  • the process of cytokinesis differs greatly between animal cells and plant cells.
  • cytokinesis of animal cells after the chromosome is distributed, a structure mainly composed of actin and myosin, which is called a condensed ring, appears inside the cell membrane, and the cell membrane is drawn in by contraction of this transfusion.
  • the shrinkage by decondensation proceeds to the spindle region located in the middle of the separated chromosome called the middle ⁇ book And the middle ⁇ ⁇ is lost, cytokinesis is completed.
  • a structure called fragmoplast which forms microtubules and actin, is formed between the distributed chromosomes.
  • vesicles are transported to the distended vesicles and fused with the vesicles to form new cells called cell plates in the central part of the distended distended body.
  • the cell plate expands toward the cell wall of the parent cell, and the cell wall and the cell plate of the parent cell fuse to complete the cytokinesis.
  • kinesin-like proteins are involved.
  • KatAp, TKRP125, KCBP, and AtPAKRPl are known as plant heritage that show the localization of proteins in the distant swelling body.
  • the structure of the kinesin-like protein, the characteristic of Lh, is that it moves on microtubules through a region where amino acids are conserved, called the motor domain, and forms a homodimer in the ⁇ region other than the motor domain.
  • Germ cells are formed through a division process called meiosis. Meiosis is composed of two cell divisions, one of which does not involve DNA replication.Thus, in pollen formation, four cells are formed from one fiber mother cell, and each nucleus has a homologous chromosome. Pollen 4 which does not have sorghum is formed. The microspores dissociated from the four pollen molecules undergo two more pollen mitosis, and finally form a pollen in which one vegetative cell incorporates two sperm cells.
  • the lat52 gene of tomato has been reported as a gene that is strongly expressed in the vesicles, especially in the organs related to the flower f.
  • AGAAA and TCCACCATA have been found as transcriptional regulatory sequences for genes that are strongly expressed in organs involved in flowering. The cooperative action of these two sequences is ⁇ It is strongly reported that it has the current specificity (Rogers et al., Plant Mol. Biol., 45: 577 (1998)).
  • NP which is Mitogen-activated protein kinase kinase kinase (MAPKKK) in tobacco It has been suggested that Kl is involved in the signal ⁇ for various syllables.
  • NPK1 since NPK1 sends various signals, it is unclear whether the phenotype observed in kinase-inactive image-changing octopus is the result of only altered cytokinesis control. No factors have been reported that specifically control division only.
  • NPK1 has an inactive kinase activity in insects.
  • CK1 protein and NACK2 protein which have a similar structure to kinesin-like protein, are known as factors that activate this kinase activity of NPK1 in yeast. It has been reported that NPK1 protein exhibits kinase activity by binding to NACK1 protein or NACK2 protein in yeast (Nishihama et al., NPK1 kinase by tobacco kinesin-like protein NAK1 in yeast cells ( ⁇ ⁇ ) Activation of the Japan ⁇ ? Biology Society Annual Meeting 1995).
  • the region of the NACK1 protein that is essential for the binding between the NPK1 protein and the NACK1 protein is C-terminal to the motor domain and is a coiled-coinole structure predicted to be formed in this region (Ishikawa et al., NPK1 protein kinase ( ⁇ ) and Interaction of NAK1 kinesin-like protein, Japan Biological Society 1996 Annual Meeting). It has been reported that both NPK1 and NACK1 proteins are present in distant F adults in plant cells during cell division. This indicates that NACK1 protein, which shows similarity to kinesin-like protein, is NPK1 tanno. It binds to proteins and is separated by moving microtubule cells.
  • NACK 1 protein is present in adults, and the function of NACK 1 protein is still reported in plants. (Machida et al., MAP kinase cascade involving NPK1 MAPKKK and plant cell proliferation, The Japan Society of Biology 2000 Annual Meeting).
  • the accumulation pattern of NPK1 protein in the cell cycle is S phase, G2 phase, M phase,
  • the accumulation pattern of NACK1 protein in the cell cycle is specific to the M phase. From this, it is strongly predicted that the activator of NPK1 in the M phase is NACK1.
  • the nucleotide sequence and amino acid sequence of the NACK1 gene and the NACK2 gene have not been disclosed (Nishihama et al., Involvement of NPK1 protein kinase and its activator NAKs kinesin-like protein in cell division, Japan The Society of Molecular Biology 1996 Annual Meeting).
  • M-specific activator M-specific activator
  • a technique has been reported that suppresses the formation of pollen, especially pollen, by transforming a plant by linking a protein that is toxic to cells, such as RNaseTl or barnase, to a promoter that is specifically expressed in pollen. You. These are all factors that are toxic to animal cells, and are highly safe for animals. Factors that function only in plant cells are used to suppress the formation of spores. The technology has been reported, not. Disclosure of the invention
  • An object of the present invention is to share plant cytokinesis control technology.
  • An object of the present invention is to share the NACK1 gene, its analogs, the proteins encoded by these genes, the proteins that function dominant-negative thereto, and the genes encoding them.
  • Another object of the present invention is to control the formation and developmental differentiation of septal S adults, which are the cytokinesis devices of plants, by using these fragments.
  • the present invention provides a method for observing the expression status of NACK1 gene or its similar gene in a plant, a plant fiber, a plant organ, or a plant culture cell, whereby the plant, the plant thread, or the plant organ is observed.
  • the present invention also relates to a method for ascertaining the state of a plant culture cell, or a method for assuring the environmental conditions or growth conditions under which those specimens are placed.
  • Another object of the present invention is to provide a technique for controlling the formation of Okada spores in plants and a technique for versatility for efficiently producing plants with reduced fertility. Another object of the present invention is to share a protein encoded by the NACK2 gene. Another object of the present invention is to provide a technique for efficiently producing a plant with reduced fertility by utilizing this residue. An object of the present invention is to develop a technology that can be widely applied to plants.
  • the present inventors conducted intensive research to address the above problems, and succeeded in determining the nucleotide sequences of the NACK-related genes: NACK1 cDNA and MCK2 cDNA, and the cDNAs of their orthologous genes. And succeeded in finding that the NACK1 and MCK2 proteins, which are NACK-related proteins, and their orthologous proteins show amino acid sequences similar to the motor domain of kinesin-like proteins. did.
  • the inventors of the present invention have so far clarified that the NACK1 protein and the ACK2 protein bind to the NPK1 protein and activate the kinase activity of the NPK1 protein. Domain-deleted molecular force We succeeded in finding a dominant-negative function for the endogenous endogenous NACK protein.
  • NACK NACK
  • OsNACK tanno
  • the formation of an isolated adult means the formation of an isolated S adult, the expansion of a bimonthly neoplasm, the formation of a cell plate, and the expansion of a Z or cell plate.
  • the developmental differentiation means the morphology of the tissue, the size of the paper weave, the morphology of the organ, the size of the organ, the morphology of the plant, the size of the plant, and / or the growth rate of the plant.
  • a decrease in fertility means a flower! ⁇ It means suppression of pollen formation, including changes in cells, paper texture and organs involved in growth.
  • meiosis was included as a change in cells involved in pollen formation.
  • Changes in cell division, the number of nuclei contained in the cells, the size of the cells, the number of cells, pollen tube germination ability, fertilization ability and the like can be mentioned.
  • examples of changes in weaving relating to pollen formation include changes in the epidermis, inner coat, middle layer, tape yarn, and cysts.
  • changes in organs involved in pollen formation include changes in the form and function of anthers and filaments.
  • the present invention relates to NACK1 gene, NACK2 gene, similar genes and proteins encoded by these genes, which are also involved in plant cell division, and the formation of isolated Jtff adults in plants targeting these genes.
  • the present invention relates to, for example, control of enlargement, and / or control of outbreak, and further relates to a technique for male sterilization.
  • a certain amino acid or amino acid sequence is defined as "positive” by using Pairwise Blast's Blast 2 Sequences (http://www.ncbi.nlm.nih.gov/BLAST/) to convert the amino acid sequence.
  • Pairwise Blast's Blast 2 Sequences http://www.ncbi.nlm.nih.gov/BLAST/
  • the ratio of positive amino acids indicates the sum of the ratio of the same amino acid and the ratio of similar amino acids.
  • the comparison of the amino acid sequences is performed by arranging two amino acid sequences of interest in an optimal form.
  • the two amino acid sequences were arranged in an optimal manner. More specifically, the present invention relates to the following.
  • SEQ ID NO: DNA encoding a protein having an amino acid sequence described in 2, 4, 6, 22, or 51 and an amino acid sequence in which 65% or more of the amino acid is positive, each of which is represented by SEQ ID NO: : DNA encoding a protein having a function equivalent to that of the protein having the amino acid sequence of 2, 4, 6, 22, or 51;
  • SEQ ID NO: 2, 4, 6, 22, or 51 has an amino acid sequence wherein the motor domain of the kinesin-like protein and 70% or more amino acids are positive in the amino acid sequence of SEQ ID NO: 2, 4, 6, 22, or 51;
  • amino acid sequence described in SEQ ID NO: 2, 4, 6, 22, or 51 and 65% or more of the amino acid are positive, and the sequence is SEQ ID NO: 2, 4, 6, 22, or 51;
  • RNA which, when expressed in a plant cell, suppresses the expression of the DNA according to any of (a) to (i) in (1) due to an RNA interference effect (RNAi).
  • RNAi RNA interference effect
  • a ti-transformed plant comprising the transformed plant cell according to (13).
  • a transformed plant which is a progeny or a clone of the transformed plant according to (14).
  • At least the base sequence is MCGG, or the base sequence strength is an MSA sequence that is CCGTT,
  • a transformed plant cell comprising a vector containing the DNA of (21) or (22) or the DNA of (23).
  • transgenic plant that is a progeny or a clone of the transgenic plant according to (26).
  • the present inventors have found that particularly strong expression is observed in organs involved in pollen formation by the promoter of the AtNACK2 gene. As described above, the present inventor specifically suppressed the formation and expansion of isolated adults by using the NACK gene and similar genes in cells constituting organs involved in pollen formation. It has been found that fertility of a plant can be reduced. That is, the present invention is a flower 3 ⁇ 4 tissue-specific inheritance? ⁇ ⁇ This is related to the promoter region of the AtNACK2 gene including the regulatory region of the current control.
  • the present invention provides
  • the nucleotide sequence represented by SEQ ID NO: 20 is to be used as a promoter of a gene that is strongly expressed in an organ involved in flowering!
  • the present invention provides
  • nucleotide sequence at positions 3401 to 4418 shown in SEQ ID NO: 20 is to be used as a consequent motor that is strongly expressed in organs related to flowers. More preferably, the present invention provides
  • Nucleotide sequence at positions 3844-4418 shown in SEQ ID NO: 20 is flower! ⁇ It is used as a promoter of a gene expression that is strongly expressed in organs involved in growth.
  • Tori Ban The base sequence from 4000 to 4418 shown in 20 is to be used as a consequent promoter that is strongly expressed in organs involved in flower formation.
  • (40) A sequence containing at least one of the following (a), (b) and (c): (a) at least the nucleotide sequence; ⁇ 'MCGG, or the nucleotide sequence strength CGTT MS A sequence,
  • a sequence comprising at least one of the following sequences (a) and (b) or (c):
  • a method for preparing a transformed plant which comprises transforming a host plant cell with the DNA according to any of (8) or the vector according to (9).
  • SEQ ID NO: 2, 4, 6, 22, or 51 comprising an amino acid sequence in which the binding region to the NPK1 protein or its ortholog and 70% or more of the amino acid in the amino acid sequence described in SEQ ID NO: 2, 4, 6, 22, or 51 are positive;
  • DNA selected from the group consisting of:
  • Plant thread having an activity of controlling the form of ⁇ , the size of thread and tissue, the form of an organ, the size of an organ, the form of a plant, the size of a plant and / or the growth rate of a plant The DNA of (49).
  • the promoter (i) can be transcribed in a plant cell as the promoter (21), (22) and (35) to (4).
  • a transformed plant comprising the transformed plant cell according to (55).
  • the DNA to be synthesized according to the present invention has the following sequence number: Force defined by the ratio containing the amino acid sequence described in 2, 4, 6, 22 or 51 and the positive amino acid, the ratio being 65% or more, preferably 71% or more, more preferably Is at least 77%, more preferably at least 86%, and even more preferably at least 90%.
  • the DNA shared by the present invention has a SEQ ID NO: 2 Containing the same amino acid as the amino acid sequence described in 4, 6, 22, or 51 It can also be vertical depending on the ratio.
  • the ratio should be 50% or more, preferably 56% or more, more preferably 64% or more, more preferably 76% or more, and further preferably 90% or more.
  • the DNA to be shared by the present invention is, as described in the above (1) and (46) to (49), when the amino acid sequence of the protein encoded by the DNA is arranged in an optimum form, SEQ ID NO: 2, Force defined by the ratio of the amino acid sequence of the motor domain of the kinesin-like protein in the amino acid sequence described in 4, 6, 22, or 51 and the ratio containing the amino acid that is positive, if the ratio is 70% or more It is preferably at least 79%, more preferably at least 83%, and even more preferably at least 93%.
  • the amino acid sequence of the protein encoded by the DNA when the amino acid sequence of the protein encoded by the DNA is optimally arranged, SEQ ID NO: 2 , 4, 6, 22, or 51, the amino acid sequence may be defined by a ratio containing the same amino acid as the motor domain of the kinesin-like protein. This ratio should be 60% or more, preferably 68% or more, more preferably 74% or more, more preferably 87% or more, and further preferably 90% or more.
  • the force defined by the ratio of the amino acid sequence in the binding region to the NPK1 protein or its orthologue and the ratio containing the amino acid that is positive It should be 70% or more, preferably 85% or more, more preferably 89% or more, more preferably 90% or more, and even more preferably 97% or more.
  • the amino acid sequence of the protein encoded by the DNA when the amino acid sequence of the protein encoded by the DNA is arranged in an optimal form, the DM to be shared by the present invention has a SEQ ID NO: 2 , 4, 6, 22, or 51, the amino acid sequence may be defined by a ratio containing the same amino acid as that of the NPK1 protein or an ortholog thereof. The ratio should be at least 65%, preferably at least 72%, more preferably at least 80%, and even more preferably at least 90%.
  • the DNA used in the present invention is as described in the above (1) and (46) to (49).
  • the amino acid sequence of the protein encoded by the DNA is optimally arranged, the amino acid sequence of SEQ ID NO: 2, 4, 6, 22, or 51 is used to determine the kinesin-like protein in each sequence. It is defined by the ratio of the amino acid rooster with the main deleted and the amino acid that is positive, and the ratio should be 60% or more, preferably 65% or more, more preferably 67% or more. , More preferably at least 71%, more preferably at least 77%, and even more preferably at least 90%.
  • the DNA to be shared by the present invention is: SEQ ID NO: 2, 4, 6, 22, or 51 is defined by the ratio of the amino acid sequence containing the same amino acid as the amino acid sequence obtained by deleting the motor domain of the kinesin-like protein in each sequence from the amino acid sequence described in If the ratio is 40% or more, it is preferably 47% or more, more preferably 51% or more, more preferably 57% or more, more preferably 60% or more, and further preferably 90% or more.
  • DNA to be used in accordance with the present invention iii is defined based on the amino acid sequence of SEQ ID NO: 2, 4, 6, 22, or 51 in the above description of (1) and (46) to (49).
  • the force is determined based on the amino acid sequence described in SEQ ID NO: 2, 4 or 22.
  • the two DNA-encoded tannos "Blast 2 Sequences of Pairwise Blast (http: //www.ncbi. Use nlm. nih. gov / BLAST /).
  • a promoter which is transmissible in a plant cell for transcribing any of the DNAs according to (8) in a plant cell or for expressing a dominant negative ⁇ of a NACK-related protein Is not limited to the AtNACK2 promoter, but is a promoter of Arabidopsis thaliana AVP1 that is a highly expressed gene in male organs or cells (Mitsuda et al., Plant Mol. Biol, 46: 185 (2001)), Arabidopsis DAD 1 gene ⁇ Promoter 1 (Ish iguro et al., Plant Cell, 13: 2191 (2001)).
  • Figure 1 shows a comparison of optimally aligned amino acid sequences for NACK-related proteins NACK1, AtNACKl, and OsNACK. The sequence is continuous in FIGS.
  • Figure 2 shows a comparison of optimally aligned amino acid sequences for NACK-related proteins NACK1, AtNACKl, and OsNACK.
  • the sequence is a continuation of Figure 1 and is linked to Figure 3.
  • Figure 3 shows a comparison of optimally aligned amino acid sequences for NACK-related proteins NACK1, AtNACKl, and OsNACK.
  • FIG. 5 shows the construction process of the vector pTA7 HA-MCK1: ST (in the figure, indicated as pT7 HA-NACK1ST).
  • FIG. 6 is a photograph showing the morphology of cells showing a comparison between polynucleated BY-2 cells and normal BY-2 cells.
  • FIG. 7 shows the results of measuring the size of multinucleated BY-2 cells. wt: Wild Evening Eve BY -Who
  • FIG. 8 is a photograph showing the morphology of the outer fiber of the transgenic plant ( ⁇ nucleated tobacco individual) according to the present invention.
  • FIG. 9 shows the structure of a control sequence including a promoter region of the AtNACK2 gene.
  • a predetermined nucleic acid can be isolated and sequenced, a recombinant can be prepared, and a predetermined peptide can be obtained by utilizing a “genetical recombination technique”.
  • Techniques for replacing ⁇ 3 ⁇ 4a that can be used herein include those known in the art, for example, J. Sambrook, EF Friends & T. Maniatis, "Molecular Cloning: A Laboratory Manual (2nd edition) ", Cold Spring Harbor Laboratory Press, Cold
  • the nucleotide sequence of the NACK1 gene cDNA is shown in SEQ ID NO: 1
  • the amino acid rooster B ⁇ tJ of the NACK1 protein encoded by this preference is shown in SEQ ID NO: 2
  • the nucleotide sequence of the NACK2 gene cDNA is SEQ ID NO: 3.
  • SEQ ID NO: 4 shows the amino acid sequence of the NACK2 protein encoded by this preference.
  • the present invention provides a dominant-negative function for a NACK1 protein or a protein having a function equivalent to that of a NACK1 protein, and a part of a NACK-related protein that controls the shape of a swelling body or controls the expansion and use thereof. Tree method.
  • a protein containing an amino acid sequence predicted to have a coiled-coinole structure of a NACK-related protein has lost its ability to move on microtubules or has lost its ability to bind to microtubules, that is, the motor of a kinesin-like protein Inactive molecule
  • NACK1 NACK2, AtNACKl, AtNACK2 or OsNACK
  • NACK-related protein is NACK1, NACK2, or OsNACK in (1)
  • the liver functioning as a dominant negative
  • the force defined by the ratio of the amino acid sequence of the molecule described in (1) to (e) and the positive amino acid sequence may be 60% or more, preferably 65% or more, more preferably 67% or more, more preferably 71% or more, more preferably 77% or more, and even more preferably 90% or more.
  • the ratio should be at least 40%, preferably at least 47%, more preferably at least 51%, more preferably at least 57%, more preferably at least 60%, even more preferably at least 90%.
  • NACK-related proteins are NACK-related proteins.
  • the coiled coiled protein of the NACK-related protein contains an amino acid sequence that is predicted and does not have the ability to move on microtubules;
  • NACK-related protein is ACK1, NACK2, AtNACKU AtNACK2 or OsNA
  • V a NACK-related protein that has lost the ability to translocate on microtubules by introducing amino acid substitution into the amino acid sequence of the kinesin-like motor domain;
  • NACK-related protein power NACK1, NACK2, AtNACKk AtNACK2 or OsNA
  • V NACK-related protein power
  • NACK1, NACK2, AtNACKk AtNACK2 or OsNA A molecule of the above (V) which is CK
  • NACK-related protein is NACK1, NACK2, AtNACKl. AtNACK2 or OsNACK.
  • NACK-related protein More preferably, there is at least one molecule selected from the group consisting of NACK-related protein, NACK1, NACK2, and OsNACK in the above (i), (iiii), (v) or (vii).
  • NACK1 protein Transgenic plants using a part of NACK-related protein did not form or expand isolated SIff adults (Examples 14, 15 and 23), indicating that NACK1 protein, The NACK2 protein is a factor that controls the formation and / or expansion of plant S-bulges, and demonstrates that molecules that use a portion of these NACK-related proteins function dominantly negatively with the NPK1 protein I can do it.
  • the present invention relates to a promoter region of “rAtNACK2” including a regulatory region of the flower-specific expression.
  • the genomic DNA sequence containing this region is shown in SEQ ID NO: 20.As shown in Example 16, the promoter region of AtNACK2 already contains a large number of pollens near the MSA sequence which is already essential for M-phase-specific expression control, or Pollen-forming cell-specific regulatory regions have been found. Does this fact mean that the MNACK2 promoter is strongly expressed in organs involved in pollen formation? ⁇ It proves that it shows current regulation.
  • the present invention shares a protein functionally equivalent to the NACK1 or NACK2 protein. In the present invention, "having the same function" or “functionally equivalent” means that the protein is a plant!
  • the ability to function in the formation of distended plastids of protein porcelain can be determined by tanno in transformation, functional phase by expression of proteins, and bimonthly imperfections in plants in which dominant negative molecules have been transformed.
  • the change can be determined by detection of changes in the formation and expansion ( ⁇ nucleated cells) and the localization of Z or protein spores.
  • NACK-related proteins can also be "@@" from amino acid sequences. That is, as shown in Example 5, this is apparent from the homology of the amino acid sequences of the two regions essential for the function of the NACK1 protein.
  • the two regions are regions that are essential for binding to motor domains and NPK1-related proteins, which are essential for exhibiting the ability to move on microtubules.
  • the regions that are essential for binding to NPK1-related proteins are coiled coil experiments. It is important to be able to shape
  • the plant for isolating the attached protein is not particularly limited, and is widely cultivated, and can be used by selecting from those known as useful plants.
  • Such plants include, for example, Solanaceae, Brassicaceae, Gramineae, Leguminosae, Lily, Apiaceae, Papaceae, etc .; r preferably Tano ⁇ coco, Arabidopsis, soybean, azuki, endu , Broad bean, Laccasei, Rice, Wheat, Oats, Rye, Emberk, Bentgrass, Maize, Brassica, Potato, Satsumaimo, Taro, Konnyaku, Kyassaba.
  • a method for introducing a mutation into an amino acid in a protein is well known to those skilled in the art. That is, a person skilled in the art can use a known method to obtain the heavenly “NACK1” protein (for example, the protein described in Rooster J number: 2) or the heavenly “NACK2” protein (for example, SEQ ID NO: It is Rikikawa ability to prepare an altered protein having a function equivalent to that of the protein described in (4) by assassination deletion or addition of amino acids in the protein. Amino acid mutations can also occur in nature.
  • the protein of the present invention includes the heavenly “NACK1” protein or heavenly “NACK2” also includes proteins having an amino acid sequence in which one or more amino acids have been substituted, deleted or added in the amino acid sequence of the "NACK2" protein, and which has a function equivalent to that of a natural protein.
  • Amino acid alterations in proteins are usually within 50 amino acids of all amino acids, preferably within 30 amino acids, more preferably within 10 amino acids, and even more preferably within 3 amino acids.
  • Amino acid modification is performed using, for example, the Transformer Site-directed Mutagenesis Kit or the Excite PCR-Based Site-directed Mutagenesis Kit (CI ontechnet) for mutations and substitutions. If it is a deletion, it can be done using Qimntmn leap Nested Deletion Kit J (Clontech3 ⁇ 4), etc.
  • amino acid substitutions or deletions may cause a favorable change, or may cause a change in the physiological or chemical properties of the polypeptide constituting the protein.
  • the polypeptide having the substitution, deletion or insertion may be one which is assumed to be substantially the same as that having no such substitution, deletion or insertion.
  • Substantially identical substitutions of amino acids in the amino acid sequence can be selected from other amino acids of the class to which the amino acid belongs.
  • sex (hydrophobic) amino acids include alanine, phenylalanine, leucine, isoleucine, ⁇ phosphorus, proline, tributofan, methionine, etc .; and polar (neutral) glycine, serine, threonine, etc.
  • examples include cysteine, tyrosine, asparagine, and glutamine.
  • Examples of positively charged amino acids (basic amino acids) include arginine, lysine, and histidine.
  • negatively charged amino acids (acidic amino acids) include: Aspartic acid, glutamic acid and the like.
  • cysteine may be replaced with serine, glycine with alanine or leucine, or oral isin with alanine, isoleucine, valine, and the like.
  • the protein of the present invention can be used to modify the amino acid bacterium contained therein by a dangling technique, and peptidases such as pepsin, chymotrypsin, and the like. Enzymes such as pine, bromelain, endopeptidase, and exopeptidase can be modified or partially degraded to enhance their attractiveness. In addition, it is expressed as a fusion protein when produced by the recombinant method, and has a biological activity substantially the same as that of a natural protein of the present invention in vivo or in vitro. Converted to ⁇ May be processed. 5) The ability to use fusion production methods that are commonly used in engineering. Such fusion proteins can be purified by affinity chromatography or the like using the fusion.
  • Such fusion proteins include those fused to a histidine tag, ⁇ -galactosidase (/ 3-gal), maltose-binding protein (MBP), and gnoretathion-S -Transferase (GST), thioredoxin (TRX) or Cre Recombinase fused to the amino acid sequence.
  • the polypeptide may be tagged with a heterogeneous epitope so that it can be purified by immunoaffinity chromatography using an antibody that specifically binds to the epitope. it can.
  • the epitope tag includes, for example, AU5, c-Myc, CruzTag 09, CruzTag 22, CruzTag 41, Glu-Glu, HA, Ha.
  • the fusion protein may be one that has been given an advantage so as to be a detectable protein.
  • the detectable marker may be a biotin Avi Tag based on a biotin / streptavidin system or a substance that emits fluorescence.
  • the fluorescent substance examples include a fluorescent protein (green fluorescent protein: GFP) derived from a luminescent jellyfish such as Aequorea victorea.
  • GFP green fluorescent protein
  • GFP cyan fluorescent protein
  • BFP blue fluorescent protein
  • GFP derived from mushroom (Renilla reniformis) (edited by Atsushi Takawaki, Experimental Medicine Separate Volume, Post-Genome Experiments Lecture 3—GFP and Bioimaging, Yodosha (2000)).
  • antibodies including monoclonal antibodies and fragments thereof) that specifically recognize the fusion tag are used. The detection can also be performed by im.
  • a method known in the field of peptide synthesis for example, a chemical synthesis method such as a liquid phase synthesis method or a solid phase synthesis method is used. it can.
  • a chemical synthesis method such as a liquid phase synthesis method or a solid phase synthesis method
  • an appropriately protected amino acid is sequentially bonded to a desired amino acid sequence on the resin by various condensation methods known per se.
  • condensation reaction a force using various activations known per se is preferable.
  • carposimids such as dicyclohexylcarposimid can be preferably used. It has a strong protecting group: fi ⁇ can be obtained by removing the protecting group as needed.
  • the protein of the present invention can be prepared not only as a natural protein but also as a recombinant protein prepared using genetic and recombination techniques, by methods known to those skilled in the art.
  • a natural protein is prepared by immunizing a small animal such as a rabbit with a recombinant protein prepared by the following method, and binding the antibody to an appropriate adsorbent (CNBr-activated agarose or tosyl-activated agarose). It is possible to prepare the protein extract by using the obtained column and purifying the protein extract of rice leaves using the obtained column.
  • the recombinant protein may be obtained by a conventional method, for example, by inserting a DNA encoding the protein of the present invention into an appropriate expression vector, introducing the vector into an appropriate cell, and purifying from the transformed cell.
  • Examples of cells used for producing a recombinant protein include plant cells, animal cells such as Escherichia coli and yeast, animal cells, and insect cells.
  • Vectors for expressing recombinant proteins in cells include, for example, plasmids “ ⁇ 121” and “pBI101” (for Clontech) for plants and yeast cells, and plasmids for E. coli.
  • P "PET Expression system” (Stratagene), "GST gene fusion Vectors” (Pharmacia ⁇ iM), plasmid “pM AMJ (Clontech3 ⁇ 4hS)” for mammalian cells, “pBacPAK8.9” for insect cells (Manufactured by Clontech). Insertion of DNA into a vector is performed by a conventional method, for example, Cloning (Maniatis et al., Cold Spring harbor Laboratry Press). In addition, the introduction of the vector into the host cell can be carried out by a conventional method such as an electrification method, a microinjection method, or a no-tickle gun method depending on the host cell.
  • Purification of the recombinant protein of the present invention from the obtained transformed cells may be carried out by salting out, precipitation with an organic solvent, ion exchange chromatography, affinity chromatography, or column chromatography using an immunoadsorbent, depending on the properties of the protein.
  • the recombinant protein of the present invention when expressed as a fusion protein with a label such as gnoretathion S-transferase, it can be purified by affinity chromatography or the like on the label. is there. Purification of the recombinant protein of the present invention from the obtained transformed pseudo-spores is carried out by salting out, precipitation with an organic solvent, ion-exchange chromatography, ion exchange chromatography, and immunoadsorbent, depending on the properties of the protein. Chromatography
  • the recombinant protein of the present invention was expressed as a fusion protein with a label such as glutathione s-transferase; ⁇ indicates that the label can be purified by affinity chromatography or the like. It is.
  • the present invention also provides a DNA encoding the protein of the present invention.
  • the DNA of the present invention is not particularly limited as long as it can encode the protein of the present invention, and includes genomic DNA, cDNA, DNA synthesized from DNA and the like.
  • the genomic DNA is, for example, the genomic DNA prepared according to the method described in the literature (Rogers and Bendich, Plant Mol. Biol.
  • the plant protein mR can be obtained by a conventional method (Maniatis et al. Molecular Cloning Cold Spring harbor Laboratry Press). It can be prepared by preparing NA, performing a reverse transcription reaction, and performing PCR using the same primer as above.
  • a genomic DNA library or a cDNA library is prepared by a conventional method, and the library is subjected to, for example, the S sequence of the DM of the present invention (for example, SEQ ID NO: 3). It can also be prepared strongly by screening using a probe synthesized based on the described base sequence).
  • another embodiment of the method for isolating a functionally equivalent protein includes the methods described in No. Ibridization Technology (Southern, J. Mol. Biol. 98: 503 (1975); Maniatis et al., "Molecular Cloning ", Cold Spring harbor Laboratry Press) and PCR technology (HA Erich (ed.),” PCR technology ", Stockton Press, New York (1989)). That is, for those skilled in the art, the nucleotide sequence of "NACK1" (SEQ ID NO:
  • PCR generally refers to a method as described in Saiki et al., Science, 239: 487 (1988); US Pat. No. 4,683,195, and the like.
  • PCR refers to a method for enzymatically amplifying the desired nucleotide sequence in the mouth.
  • PCR involves the following steps: (1) using two oligonucleotide nucleotide primers capable of hybridizing preferentially to a nucleic acid, and repeatedly performing a cycle for performing a primer extension synthesis.
  • the primers used in the PCR method are capable of generating primers complementary to the internal nucleotide to be amplified B ⁇ j, for example, A nucleotide sequence that is highly complementary to both ends thereof, or the nucleotide sequence to be amplified Can be used preferably.
  • ff ⁇ is 5
  • the primer at the end is at least a force containing the initiation codon, or is selected so that it can be amplified including the initiation codon, and the primer at the 3 'end is selected. It is strongly preferred to use at least a stop codon-containing force or to select such a condition that amplification can be performed including the stop codon.
  • the primer is preferably an oligonucleotide consisting of 5 or more bases, more preferably an oligonucleotide consisting of 10 or more: ⁇ 3 ⁇ 4, and more preferably an oligonucleotide consisting of 18 to 35: ⁇ S. .
  • PCR can be performed by a method known in the art or a method substantially similar thereto or a modified method, for example, in addition to the above-mentioned documents, R. Saiki, et al., Science, 230: 1350, 1985; HA Brlich ed., PCR Technology, Stockton Press, 1989; DM Glover et al. Ed., "DNA Cloning", 2nd ed., Vol. 1, (The Practica 1 Approach Series), IRL Press, Oxford University Press. (1995); MA Inn is et al. Ed., "PCR Protocols: a guide to methods and applications", Aca demic Press, New York (1990)); MJ McPherson, P.
  • PCR Quirke and GR Tayl or ( Ed.), PCR: a practical approach, IRL Press, Oxford (1991); MA Frohman et al., Proc. Natl. Acad. Sci. USA, 85, 8998-9002 (1988), or the like. It can be done according to modified or modified methods.
  • PCR can be performed using a commercially available kit suitable for the PCR, and can also be performed according to a protocol specified by a kit manufacturer or a kit distributor.
  • PCR is typically performed by combining, for example, a summary (for example, DNA synthesized using mRNA as type III; 1st strand DNA, etc.) and a primer designed based on the gene in a 10X reaction buffer. (Attached to the Taq DNA polymerase), dNTPs (doxynucleoside triphosphate dATP, dGTP, dCTP, (mixture of ⁇ )), Taq DNA polymerase and deionized distilled water.
  • dNTPs doxynucleoside triphosphate dATP, dGTP, dCTP, (mixture of ⁇ )
  • Taq DNA polymerase deionized distilled water.
  • an automatic thermal cycler such as GeneAmp 2400 PCR system, Perkin-Elmer / Cetus, etc., the cycle is repeated 25 to 60 times under a typical PCR cycle condition, but the cycle for amplification is repeated.
  • PCR cycle conditions include, for example, denaturation 90-95 ° C 5-100 seconds, annealing 40-68 ° C 5-150 seconds, extension 65-75 ° C 30-900 seconds, preferably denaturation 94 ° C 15 Seconds, annealing at 58 ° C for 15 seconds, elongation at 72 ° C for 45 seconds, a suitable force, annealing reaction and time can be selected by play experiment, denaturation reaction and elongation An appropriate value can also be selected for the reaction time according to the expected chain length of the PCR product.
  • the reaction temperature of the reaction is usually varied depending on the Tmi of the hybrid between the primer and the DNA.
  • the time for the extension reaction is generally about 1 minute per 100 bp of chain length, but it is possible to select a shorter and shorter time.
  • the nucleotide sequence of the obtained DNA can be strongly determined by using, for example, "Sequencer I Model310" (ABI Sake).
  • the DNA of the present invention can be used, for example, for preparing a recombinant protein as described above. Furthermore, by expressing the DNA of the present invention in a straight body, it is possible to obtain a transformed plant in which synthesis of cells is promoted or a transformed plant in which development and differentiation are promoted.
  • Hybridization to isolate a residue encoding a protein functionally equivalent to NACK1 was carried out by hybridization at 55 ° C, followed by 2XSSC (3M NaCl) containing 0.1% SDS. , 0.3 M sodium citrate) or 2XSSPE (3.6 M NaCl, 0.2 M sodium phosphate (pH 7.7), 0.02 M Na 2 -EDTA) at 55 ° C for 10 minutes. You can do it on the condition that you do it three times in total. For more stringent hybridization, after hybridization at 65 ° C., washing may be performed three times in total at 65 ° C. for 10 minutes in a 2 ⁇ SSC or 2 ⁇ SSPE solution containing 0.1% SDS.
  • the plate was washed in 2XSSC or 2XSSPE solution containing 0.13 ⁇ 4SDS at 65 ° C for 10 minutes, and then washed.
  • washing may be performed twice at 65 ° C for 10 minutes. No, the solution was described in “Molecular cloning (Maniatis T. et al. Cold Spring Harbor Laboratory Press)”. You can use things, etc.
  • the amino acid ffi ⁇ [J, a NACK-related protein with a function equivalent to that of the NACK1 protein, is at least 60% higher than the NACK1 protein in the region of high homology to the motor domain of the kinesin-like protein found at the N-terminal side of the protein.
  • the amino acid sequence is the same, and the NPK1 protein corresponding to the amino acid sequence at positions 686 to 759 of the NACK1 protein, or its orthologues!
  • the present invention relates to a molecule capable of suppressing the expression of the DNA of the present invention in a plant.o “Suppression of the expression of the DNA of the present invention” includes suppression of gene transcription and suppression of translation into protein. Power included. It also includes a decrease in expression as well as a brief stop in DNA expression.
  • the action of the antisense nucleic acid to suppress the expression of the target gene includes several factors as follows. In other words, inhibition of transcription initiation by triplex formation, suppression of transcription by hybridization with a site where an open-loop structure was locally formed by RNA polymerase, transcription by hybridization with RNA that is undergoing synthesis Inhibition, splicing at the junction of intron and exon 1, splicing suppression by formation, splicing suppression by hybrid formation with spliceosome formation site, suppression of translocation from nucleus to cytoplasm by hybridization with mRNA, capping site Of splicing by hybridization with the site of addition of poly (A) and poly (A), translation initiation factor?
  • the antisense sequence used in the present invention may suppress the expression of the target gene by the above-mentioned effect of the shift. Designing an antisense sequence complementary to the nearby untranslated region would be effective in inhibiting translation of 5 ⁇ , but could be complementary to the coding region or the 3 'untranslated region.
  • the antisense DNA used in the present invention includes a DNA containing an antisense sequence of not only a translated region but also a sequence of a non-translated region.
  • the DNA is prepared downstream of the motor; preferably has a sequence containing a transcription termination signal on the 3 'side.
  • the DNA thus prepared can be transformed into a desired plant by a known method.
  • the sequence of the antisense DNA is preferably a sequence complementary to the endogenous residue ⁇ or "" ⁇ of the plant to be transformed, but is completely complementary as long as the expression of the residue can be effectively inhibited.
  • the transcribed RNA preferably has at least 90%, most preferably at least 95% complementarity to the transcript of the target gene. Sequence complementarity can be determined by the search described above.
  • the length of the antisense DNA should be at least 15 3 ⁇ 43 ⁇ 4, preferably over 100 salts, more preferably at least 500 S. is there. Usually, the length of the antisense DNA used is shorter than 5 kb, preferably shorter than 2.5 kb. Suppression of endogenous gene expression can also be achieved using ribozyme-encoding DNA.
  • Ribozyme refers to an RNA molecule having a media activity. The ability of ribozymes to have various activities, especially the study of ribozymes as RNA-cleaving enzymes, has enabled the design of ribozymes for site-specific cleavage of RNA.
  • Ribozymes have a force of 400 bases or more, such as group I intron type or M1RNA contained in RNaseP, and an active domain of hammerhead type ⁇ hairpin type, 40 salt fiber No.
  • the self-cleaving domain of a hammerhead ribozyme has the ability to cleave the 3 'side of C13 of G13U14C15, and it is important for U14 to form a base pair with A at position 9 for its activity.
  • Has been shown to be cleaved by A or U in addition to 0 M. Koizumi et al., (1988) FEBS Lett. 228: 225).
  • RNA sequence near the target site a restriction enzyme-like RNA-cleaving ribozyme that recognizes the UC, UU, or UA sequence in the target RNA can be created.
  • a restriction enzyme-like RNA-cleaving ribozyme that recognizes the UC, UU, or UA sequence in the target RNA.
  • Hairpin ribozymes are also useful for the purpose of the present invention. Hairpin-type ribozymes are found, for example, in the minus chain of the satellite tobacco ring spot virus (JM Buzayan, Nature, 323: 349, 1986). It has been shown that this ribozyme can also be designed to cause target-specific RNA cleavage (Y. Kikuchi and Sasaki, Nucleic Acids Res., 19: 6751 (1992)). Ribozymes designed to cleave targets can be transcribed in plant cells It is linked to a promoter such as the cauliflower mosaic virus 35S promoter and a transcription termination sequence.
  • a promoter such as the cauliflower mosaic virus 35S promoter and a transcription termination sequence.
  • Co-suppression '' refers to the phenomenon that when a gene having the same or similar sequence as the target endogenous gene is introduced into a plant by transformation, the expression of both the introduced foreign gene and the target endogenous gene is suppressed. Means The nature of the co-suppression mechanism is not clear, but is often observed in plants (Curr. Biol., 7.-R793, 1997; Curr. Biol., 6: 810, 1996). For example, in order to obtain a plant in which the NACK2 gene is cosuppressed, the target plant was transformed with a vector-DNA prepared to express the NACK2 gene or a DNA having a sequence similar to the NACK2 gene. A plant having multinucleated cells may be selected from the plant.
  • RNAi means that when a plant is introduced by transformation with DNA in which a sequence identical or similar to the target endogenous gene is arranged in an inverted repeat in a plant, strand RNA derived from foreign DNA is strongly expressed, and It refers to a phenomenon in which expression is suppressed.
  • a complementary RNA chain is formed as a primer with a sequence that forms a complex with the target gene's mRNA and a strand RNA force complex derived from the introduced sequence, and is formed as a first-order intrinsic sequence.
  • the complex is fragmented by the RNase and, as a third step, the strand RNA that has been fragmented to 20-30 base pairs functions as a signal for secondary RNA interference. It is thought to degrade the mRNA of the target gene. (Curr. Biol., 7: R793, 1997; Curr. Biol., 6: 810, 1996).
  • RNA interference in order to obtain a plant in which the NACK1 gene or NACK2 gene has been suppressed by RNA interference, expression of DNA in which the NACK1 gene or NACK2 gene or a DM having a similar sequence is arranged in an inverted repeat is performed.
  • the vector DNA thus prepared is transformed into a target plant, and a plant having cells obtained by multiplying the obtained plant stamina may be selected.
  • the gene used for RNA interference does not need to be completely identical to the target gene, but is preferably at least 10 nucleotides or more, preferably 20 nucleotides or more, more preferably 50 nucleotides or more. Are the same. Sequence identity can be determined using the above-described search.
  • RNAi can also be achieved by infection with plant viruses.
  • a plant virus having single-stranded RNA as its genome takes a form of single-stranded RNA during its replication process. Therefore, the target gene sequence is inserted into the genome of the plant virus together with an appropriate promoter, the age at which this recombinant virus is transmitted to the plant, and the replication of the virus is accompanied by the replication of the virus. Force will be generated.
  • the effect of RNAi can be enhanced (Angel 1 et al., Plant J. 20, 357-362, (1999)).
  • the suppression of the expression of the endogenous gene in the present invention can also be achieved by transforming a plant having a dominant negative trait of the target gene into a plant.
  • DNA encoding a protein encodes a protein having a function of eliminating or reducing the activity of a protein encoded by the endogenous gene of the present invention inherent in a plant by expressing the DNA.
  • DNA refers to DNA. Whether or not the target DNA has the function of eliminating or reducing the activity of the endogenous endogenous activity of the present invention depends on whether the target DNA has the function of suppressing the formation and expansion of plant f / f adults as described above. Can be determined based on whether or not the force at which the multinucleated cells appear appears.
  • Dominant Negative Endogenous', ACK-related protein Degradation of N ° protein can be achieved by transforming the ACK-related protein into a plant species different from the isolated plant species.
  • the protein exhibiting the dominant negative trait contains amino acids 686 to 759 of NACK1 protein, or contains amino acids 686 to 759 of NACK2 protein, and the protein is preferred. It is strongly desirable that the mouse that has lost the ability to bind to microtubules or lacks motor activity. Motor activity refers to the activity of the NACK1 protein or NACK2 protein to move on microtubules, and a method for deleting this activity is to delete at least one amino acid in the motor domain. And to introduce a mutation by amino acid substitution.
  • the present invention also relates to a recombinant DNA or vector having a DNA inserted therein which suppresses the expression of the DNA of the present invention or the DNA of the present invention or the expression of a protein encoded by the DNA of the present invention.
  • S-recombinant DNA or vector include the above-described vector used for production of a recombinant protein, and the expression of the DNA of the present invention or the expression of the DNA of the present invention in a plant cell for producing a transformed plant.
  • a vector for transferring a DNA that suppresses the expression of a protein encoded by the DNA are also included.
  • Such a thread-recombinant DNA or vector is particularly preferable if it contains a promoter sequence that can be transcribed in a plant cell and a homozygous sequence containing a polyadenylation site necessary for stabilizing the transcript. restricted not, for example, plasmid "pBI121", r p BI221J, ⁇ (both Clontech ne: t3 ⁇ 4), "pTA7001", “pTA7002” (Aoyama et al. (1997) Plant J. 11: 605 ) , and the like .
  • the self-recombinant DNA or vector of the present invention may It may contain a promoter for inducible expression.
  • promoters for constitutive expression include cauliflower mosaic virus 35S promoter (Odell et al., Nature, 313: 810 (1985)) and rice actin promoter (Zhang et al., Plant). Cell, 3: 1155 (1991)), corn ubiquitin promoter (Cornejo et al., Plant Mol. Biol., 23: 567 (1993)), etc.
  • Promoters for inducible expression include exogenous factors such as filamentous fungi, bacteria, virus infection and infestation, low temperature, high temperature, drying, irradiation of ultraviolet spring, and spraying of specific compounds. Promoters that are known to be expressed are exemplified. Examples of such a promoter include, for example, the promoter of a rice kinase gene expressed by infection of a filamentous fungus 'bacterium' virus or ⁇ ! ⁇ (Xu et al., Plant Mol.
  • PTA7001 and pTA7002 (Aoyama et al., Plant J., 11: 605 (1997)) can be used to induce expression by glycocorticoid treatment, and pER10 can be used to induce expression by estrogen treatment. (Zuo et al., Plant J., 24: 265 (2000) ).
  • Arabidopsis AtNACK2 gene promoter Arabidopsis AtNACK2 gene promoter, Arabidopsis AVP1 gene promoter, Arabidopsis DAD1 gene promoter, tobacco TA20 and TA29 gene promoters, which are promoters of genes that are highly expressed in organs involved in pollen formation.
  • Rice 0 sg6B gene promoter tomato La 2 gene promoter, tobacco glO promoter ⁇ promoter, cauliflower mosaic virus 35S promoter, anther-specific inheritance ⁇ expression promoter inserted with regulatory sequence, etc. It is.
  • the present invention also provides a transformed cell of the present invention, into which the recombinant DNA or the vector has been introduced.
  • the cells of the present invention include, in addition to the above-described cells used for producing a recombinant protein, plant cells for producing a transformed plant.
  • the plant cells are not particularly limited, and can be selected from known plants, for example, cultivated plants, useful plants, and the like, and can be applied to them, and plants known as cereals, beans, potatoes, mm, vegetables, fruits, Furthermore, those derived from horticultural flowers and trees can be mentioned.
  • plant cells include, for example, solanaceae, cruciferous, gramineous, legume, lily, crocodile, crocodile, and the like, preferably tobacco, Arabidopsis, oilseed rape, soybean, azuki, Endo, Broad bean, Laccasei, Sesame, Rice, Wheat, Komamu, Rye, Jumpa, Maize, Potato, Tomato, Piman, Cabbage, Broccoli, Parsley, Spinach, Satsumaimo, Taroimo, Konjakya, Grape , Apples, peaches, pears, oysters, chichi ', blueberry, plum, melon, kiuri, sugarcane, mandarin, lemon, orange, olive, cotton and other cells.
  • the plant cells of the present invention include cells in a plant in addition to ⁇ culture cells. It also includes protoplasts, shoot primordia, multiple shoots, and hairy roots.
  • the introduction of a vector into a plant cell can be performed by, for example, the induction method using agrobacterium (Hood et al., Transgenic Res., 2: 218 (1993); Hiei et al., Plant J., 6: 271). (1994)).
  • Electroporation method (Tada et al., Theor. Appl. Genet, 80: 475 (1990)), polyethylene glycol method (Lazz eri et al., Theor. Appl. Genet, 81: 437 (1991)), particle gun method (Sanford et al., J. Part. Sci. tech., 5:27 (1987)) Can be selected from the methods known in the art: 11
  • Transformed plant cells can regenerate plants by redifferentiation.
  • the method of redifferentiation differs depending on the type of plant cell. For example, in the case of rice, the method of Fuj imura et al. (Plant Tissue Culture Lett., 2:74 (1995)) is used. In the case of corn, Shill 0 et al. (Bio / Technology, 7: 581 (1989)) and Gorden-Kamm et al. (Plant Cell, 2: 603 (1990)). For potatoes, Visser et al. (Theor. Appl.
  • the progeny of the plant are propagated by virtue of the plant viability and the like. It is possible to get power.
  • Propagation materials eg, seeds, fruits, cuttings, ⁇ oni stems, ⁇ oni, roots, calli, protoplasts, etc.
  • the present invention provides a DNA of the present invention or a plant cell into which DNA that suppresses the expression of the DNA of the present invention is strongly introduced, a plant containing the cell, a progeny and a close of the plant, and a plant comprising the same. Includes progeny and clonal propagation material.
  • the transformed plant of the present invention may have a change in cell division or pollen formation which is altered by controlling the expression of ⁇ ⁇ ⁇ in the present invention as compared to an individual having normal pollen formation.
  • “Changes in cell division” include, for example, changes in the size of adult adults, changes in the formation of adult humans, changes in cell plate expansion, changes in cell plate formation, changes in the number of cell divisions, and cell division.
  • Changes in development and differentiation include, for example, changes in tissue morphology, changes in the size of threadwork, It includes morphological changes, changes in organ size, changes in plant morphology, changes in plant size, and changes in plant growth rate.
  • change in pollen formation includes, for example, suppression of flower formation, change in the number of nuclei in pollen cells, size of pollen cells, suppression of pollen tube germination, and change in decreased fertilization ability. Point.
  • the nucleic acids including mRNAs and oligonucleotides
  • DNAs disclosed in this specification can be obtained by using them, or by using antisense technology, monoclonal technology. It can be applied to genomics and proteomics technology in combination with antibodies, including antibodies, and transgenic plants.
  • RNAi RNA interference
  • dsRNA ⁇ llA
  • SNPs single nucleotide polymorphisms
  • It is mainly based on single nucleotide polymorphisms (SNPs), and is a translation of polymorphisms, nucleic acid arrays, and protein arrays. It is important to perform horns, protein-protein interaction analysis, gene analysis, and pesticide analysis.
  • a cDNA library can be used, or DNA obtained by the PCR technology can be used as a basis. Is done.
  • the arraying is performed by using a needle or a pin, or by using an ink-jet printing technique or the like, by attaching DNA to a unique position on a substrate such as a slide glass, a silicon plate, or a plastic plate.
  • Obtain the signal by observing the signal resulting from the hybridization on the acid array, and use a signal such as a fluorescent dye (for example, Cy3, Cy5). , BODIPY, FITC, Alexa Fluor dyes (trade name), Texas' red (trade name), etc.
  • a laser-scanner can be used, and the obtained data can be used. May be processed by a computer system with a program according to an appropriate algorithm.
  • the term “antibody” may be used in a broad sense, and refers to a monoclonal antibody to a desired NACK1 protein or NACK2 protein, its constituent polypeptides and related peptide fragments.
  • the antibody composition may be a single monovalent antibody or an antibody composition having specificity for various epitopes, and may include a monovalent antibody or a multivalent antibody as well as a polyclonal antibody and a monoclonal antibody.
  • Particularly preferred antibodies of the present invention include those capable of specifically binding to a polypeptide selected from the 1-365 region of SEQ ID NO: 2 and SEQ ID NO: 4. ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ Monoclonal antibodies raised against a substance can be produced using any method that allows the production of antibody molecules to be produced by ⁇ g of growing cell lines. .
  • Each monoclonal antibody indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and indicates that the antibody must be produced by any particular method. Do not consider it.
  • Each monoclonal antibody contains a population of antibodies that are identical except that there may be small amounts of variants that may occur naturally.
  • Monoclonal antibodies are highly specific, being directed against sites with a single fibril.
  • Each monoclonal antibody compared to a conventional (polyclonal) antibody preparation, which typically contains various antibodies directed against different 3 ⁇ 43 ⁇ 4i determinants (epitopes), has a single antibody on the antigen of interest. It is directed against antigenic determinants.
  • monoclonal antibodies are synthesized by cultivation of immunoglobulins and are excellent in that there are no or few male iminoglobulins.
  • Monoclonal antibodies include hybrid antibodies and recombinant antibodies. They may replace the variable region domain with a constant region domain, replace the light chain with a heavy chain, or substitute for the light chain with a heavy chain, regardless of their origin or immunoglobulin class I subclass IJ, as long as they exhibit the desired biological activity. Can be obtained by displacing the chain with another type of chain, or by fusing with a heterogeneous protein (for example, US Pat. No. 4,816,567; Monoclonal Antibody Production Techniques and Applications, pp. 79). -97, Ma reel Dekker, Inc., New York, 1987).
  • Suitable methods for producing monoclonal antibodies include the hybridoma method (G. Kohler and C. Milstein, Nature, 256, pp. 495-497 (1975)); the human B cell hybridoma method ( Kozbor et al., Immunology Today, 4, pp. 72-79 (1983); Kozbor,
  • the antibody of the present invention can be used for lings, necks, and the like of the substance, and has various uses.
  • transcript includes products that form transcription such as genes and nucleotide sequences, including in vitro, in vivo, intracellular and extracellular, and for example, RNA such as mRNA. And the like.
  • the degree of mitosis of the plant is evaluated by measuring the gene expression product including the car transcript (including qualitative measurement *). It can be used as a material for judging the growth state and activity of plants, for determining the proliferative properties of plant cells, for example, for determining the growth potential of callus, and for determining whether the plants are in a steady state or vigorously activate. It is also possible to judge whether the cell is growing, and to make a statement such as a condition for culturing plant cells. ⁇ row
  • MAPKKK modified strains of Stell
  • MAPKK Ste7
  • FUS3 / KSSKMAPK modified strains of Stell
  • MAPKKK Ste7
  • FUS3 / KSSKMAPK FUS3 / KSSKMAPK
  • a SY1984 strain (MAT a leu2 ura3 trpl his3A ura3 canl FUS1:: HI S3 reporter gene expressed by the FUS1 gene) was inserted into the chromosome of the Stel 1 (MAPKKK) gene-disrupted strain of budding.
  • HIS3 stell A :: ura3
  • Stepvenson et al., Gene Dev., 6: 1293 (1992) can assess the FUS3 APK activity by growing it in a medium with or without histidine.
  • Dsorl sul a Drosophila MAPKKK that can be expressed by the CYC promoter, was introduced into the trpl locus of this SY1984 strain to create the llSul strain (Irie (1994) Sience 265: 1716).
  • a USulN strain was created by inserting NPK1 cDNA that can be expressed by the GAL1 promoter into the leu2 locus on the chromosome of the llSul strain.
  • the HSu strain can express NP K1 strongly by adding galactose.
  • NPK1 is able to perform the function of Stell.
  • full-length NPK1 is ftM kinase-inactive, it cannot grow on a medium without galactose and without histidine.
  • One-nin tobacco factor activates NPK1 kinase activity in USulN strain
  • a cDNA library of the tobacco cultured cell BY-2 in the growing phase was prepared, and the HSuN strain was transformed.
  • the cDNA library was used to purify mRNA from BY-2 ⁇ ⁇ cultured cells by a conventional method, perform reverse transcription reaction, synthesize cDNA, and use EcoRI and Sail site of KTll plasmid. was prepared by inserting a BY-2 cDNA into the DNA.
  • the cDNA library 1 was transformed into the budding yeast strain USulN to obtain ⁇ 3 ⁇ 3 ⁇ 10 5 transformed yeast cells.
  • Plasmid was recovered from this clone, and the nucleotide sequence of the cDNA was determined to reveal the nucleotides of NACK1 cDNA and NACK2 cDNA.
  • NACK1 cDNA sequence cloned as a factor that activates NPK1 expressed in yeast is shown in SEQ ID NO: 1
  • NACK2 cDNA sequence is shown in SEQ ID NO: 3. Difficult case 2
  • Example 5 The amino acid sequence of the AtNACKl protein encoded by the cDNA of AtNACKl shown in SEQ ID NO: 5 is shown in SEQ ID NO: 6.
  • Example 5 The amino acid sequence of the AtNACKl protein encoded by the cDNA of AtNACKl shown in SEQ ID NO: 5 is shown in SEQ ID NO: 6.
  • the OsNACk cDNA can be strongly isolated by performing PCR using a synthetic oligo DNA designed based on SEQ ID NO: 8 as a primer and using rice c thigh as a primer.
  • NACK 1 AtNACK 1 and OsNACK, the optimal alignment of amino acid sequences is shown in Figures 1-3. The ratio of the same amino acid and the ratio of similar amino acids are shown in Tables 1 to 3. o Angle ? Blast 2 Sequences of Pairwise Blast (http://www.ncbi.nlm.nih.gov/BLAST/) It was used. The main parameters such as the parameters at the time of the finest time were as follows: Matrix is BL0SUM62, gap open is 11, ap extension is 1, dropoff is 50, expect is 10.0, and others are used in the initial state . In the output results showing the similarity of the two amino acid sequences, the positive and the same amino acid, plus the ratio of the addition of similar amino acids.
  • NACK 1 and AtNACK 1 were identical with 76% identical amino acids and 86% amino acids were positive.
  • NACK 1 and OsNACK 65% of the amino acids were the same, and 79% of the amino acids were positive.
  • Motor domain of kinesin-like protein Corresponds to positions 27-364 in the amino acid sequence of the NACK 1 protein, positions 28-364 in the amino acid sequence of the AtNACK 1 protein, and positions 31-362; ⁇ in the amino acid sequence of the OsNACK protein. In this region, 87% of the amino acids were identical in NACK 1 and AtNACK 1, and 93% of the amino acids were positive. In NACK 1 and OsNACK, 76% of the amino acids were the same, and 86% of the amino acids were positive.
  • NACK 1 protein which is a region essential for the binding of the NPK1 protein and the NACK 1 protein, is from position 686 to 759, and the amino acid sequence of the OsNA CK protein is the position 699 to 773 in the amino acid sequence of the AtNACK 1 protein. Then 675-749 th In this region, NACK 1 and AtNACK 1 were 82% identical and 95% positive. In NACK1 and OsNACK, 80% were the same and 90% were positive.
  • Example 10 High similarity of the amino acid sequence constituting the motor domain shown in Example 8, Example 9; high similarity in the region that binds to the NPK1 protein; formed in the region that binds to the NPK1 protein The coiled koinoren experiment showed that both AtNACKI protein and OsNACK protein had the same function as Pico NACK1 protein.
  • Example 10 High similarity of the amino acid sequence constituting the motor domain shown in Example 8, Example 9; high similarity in the region that binds to the NPK1 protein; formed in the region that binds to the NPK1 protein The coiled koinoren experiment showed that both AtNACKI protein and OsNACK protein had the same function as Pico NACK1 protein.
  • Example 10 Example 10
  • the following experiments show that the amino acid sequence shown by the case 8 and the case 9 is NACK1 protein and functional sinus.
  • One is to create a protein that is functionally fused with the Green Fluorescent Protein (GFP) at the C-terminal end of the target protein, and this protein can be expressed under the control of the 35S promoter, for example, the PUS121 GUS gene?
  • GFP Green Fluorescent Protein
  • a binary vector capable of being introduced to the tobacco cultured cells BY-2 by the agrobacterium method is constructed.
  • Agrobacterium tumefacience LBA4404 strain (Ago rbacterium tumefacience LBA4404 strain) carrying this binary vector and BY-2 cells were co-cultured in the dark at 25 ° C.
  • Example 11 shows that the target protein exhibits the same function as NA CK1 protein. Provable.
  • Example 10 the amino acid sequence at the N-terminal side of the amino acid sequence assumed to be a motor domain in the target protein, and in Example 2, the amino acid sequence at positions 1-360, was In Example 4, a DNA sequence encoding a protein in which the amino acid sequence at positions 1-359 has been deleted is inserted into the PTA7001 binary vector. Using this Agrobacterium tumefacience LBA4404 strain which retains the binary vector, a tobacco culture cell BY-2 is transformed. The resulting transformed BY-2 cells were shake-cultured in an LSD liquid medium (Nagata et al. (1981) Mol. Gen. Genet.
  • Example 10 the fluorescence emitted by the GFP protein is localized in the separated adult, and the multi-nucleated BY-2 cells are observed in Example 11.
  • the target protein power ⁇ NA CK1 It is possible to show the same function as protein. Difficult case 12
  • NACK1 and NACK2 cDNA Cloning of NACK1 and NACK2 cDNA is performed based on the experimental manual and the instructions of various commercially available 1 ⁇ . Extract total RNA from BY-2 cells on day 3 of culture and purify mRNA. From this mRNA, a NACKl cDNA can be isolated by preparing a library using a superscript lambda system (Invitrogen) and performing plaque hive dilation. Probes used for hybridization can be prepared by using the synthetic oligo DNAs shown in SEQ ID NO: 11 and SEQ ID NO: 12 as primers and performing RT PCR with the above-mentioned mRNA awake.
  • a superscript lambda system Invitrogen
  • PSKHA2 force is generated by inserting a piece into pBluescript SK- at the site created by EcoRI and BamHI cleavage.
  • pNACKl STSK is generated.
  • pNACKl digested with BamHI and NotI of STSK, and inserted into the BamHI and Notl sites of PSKHA2 a fragment containing the sequence shown in SEQ ID NO: 1 to generate pSKHA2NACKl: ST.
  • This plasmid contains the DNA encoding HA-NACK1: ST.
  • pSKHA2NACKl ST was digested with Notl, Notl raw ⁇ was blunt-ended with a Klenow fragment of DNA polymerase, and further digested with Sail. The obtained fragment containing the sequence shown in Sequence 4 was cut with Spel of PTA7001, and further, Spel raw ⁇ was blunt-ended with Klenow fragment of DNA polymerase, and then inserted into the site cut with Xhol.
  • PTA7 G HA-NACK1 ST force is generated.
  • pTA7-HA-NACK1 ST was treated with dexamethasone on the plant into which it was introduced, and the tandem hemagglutinin polypeptide shown in SEQ ID NO: 17 and the 36th NACK1 protein shown in SEQ ID NO: 2 were treated with dexamethasone.
  • This is a binary vector for plant transformation capable of inducing the expression of HA-NACK1: ST, a fusion protein in which the 959th amino acid is functionally fused.
  • PTA7 HA-N ACK1: ST structure Figure 5 shows the process. Difficult case 14
  • HA-NACK1 Inhibition of BY-2 cytokinesis by ST
  • Transformation of BY-2 cultured tobacco cells was carried out via Ammbacterium tumefacience LBA4404 strain. After inoculation in a new LSD liquid medium, 4 days of tobacco cultured cells BY-2 and pTA7 HA-NACK1: ST or 4 strains of agrobacterium 'mmefaciens LBA440 carrying pTA7001 as vector control Cultures cultured for two days in YEB medium were mixed, and co-cultured at 25 ° C in the dark.
  • the tobacco cultured cells BY-2 are washed using LSD liquid medium, and then LSD-0.2% gel light medium containing 50 ⁇ g / ml of idaromycin B and 300 / g / mL of carpenicillin. And the cells were cultured in the dark at 25 ° C.
  • the hygromycin B-resistant callus obtained 2-3 weeks later was transferred as a transformant to LSD solution * ⁇ ⁇ ground, and the transformed cells were fiberized by suspension culture.
  • HA-NACK1 ST-transformed medium-growth cells that are in stationary phase of growth. Transfer to LSD liquid # ⁇ medium containing 0.1 zM and dexamethasone 0.1 zM and 50 g / ml of hygromycin B or LSD liquid medium supplemented with 50 / g / ml of hygromycin B and start culture. -Observed phenotype on the 4th. The cells of the culture medium were fixed by adding 3.7% formaldehyde (50 mM sodium phosphate buffer (pH 7.5) containing formaldehyde), and allowed to stand for 1 hour. Then, 0.005% calcofluor (1%) was added.
  • formaldehyde 50 mM sodium phosphate buffer (pH 7.5) containing formaldehyde
  • HA-NACK1 ST in the transformed BY-2 cells: a large number of multinucleated cells with multiple nuclei in a single cell were found in ⁇ alone. The appearance of multinucleated cells increased as the number of days in culture increased. In addition, some of the multinucleated cells contain unnecessary cell walls.
  • HA-NACK1 ST transformed BY-2 cells
  • progression through the G1, S, and G2 phases in the cell cycle progression is normal, and the cells are formed by diagenesis and adults in the ⁇ phase. Only the normal formation of the cell plate was strongly controlled.
  • Figure 6 shows a comparison of multinucleated BY-2 cells with normal BY-2 cells.
  • -DEX is HA-NACK1: ST-transformed BY-2 cells cultured without dexamethasone: t
  • + DEX is HA-NACK1: ST-transformed BY-2 cells cultured with dexamethasone Then, the cells that had undergone multinuclei were shown.
  • Nl, N2, N3, and N4 indicate multiple nuclei observed in one cell, and the arrow indicates an incomplete cell.
  • FIG. 7 shows the result of measuring the size of the multinucleated cells.
  • HA-NACK1 Inhibition of cytokinesis in Tano'co plants by ST
  • HA-NACK1 ST in transgenic tobacco, use PTA71-HA-NACK1 -.ST or pTA7001 as a vector control. Transformation of Nicotiana tabacum cultivar SRKNicotiana tabacum ver. SRI was carried out by the leaf disk method via Agrobacterium tumefacience LBA4404 strain.
  • the phenotype was observed using T2 plants generated from seeds obtained from the obtained hygromycin B-resistant individuals.
  • Detamethasone (dexamethasone) -added ⁇ ⁇ ⁇ -transformed tabacco in MS medium, vector-transformed tobacco sown in MS medium without dexamethasone, and HA-NACK1: ST-transformed tobacco all grow normally. No morphological, histological, or cellular phenotype was observed. However, in HA-NACK1: ST-transformed tobacco seeded on dexamethasone-supplemented medium, cotyledons were reduced in size. Observation of the cells showed that multinuclei with multiple nuclei in one cell Transformed cells were stolen. Multinucleated cells were found in mesophyll cells, guard cells, and epidermal cells in cotyledons.
  • HA-NACK1 ST-transformed tobacco cells have normal cell cycle progression through G1, S, and G2 phases, and cell plates formed by distant J5 adult adults in M phase. Only the normal formation of was controlled.
  • Fig. 8 shows a photograph of the transformed plant.
  • the ⁇ g sequence shown in SEQ ID NO: 20 is a genomic DNA sequence of Arabidopsis thaliana, and includes a promoter region of AtNA CK2 gene. Translations of ⁇ atnack2 '' Around 1720 bases upstream from the start codon, a large number of additional polyadenylation signals that terminate transcription in plants are found, and this region is the end of the AtNACK2 gene and the hidden gene.
  • nucleotide sequence shown as SEQ ID NO: 20 or the nucleotide sequence at positions 2801-4418 or 3401-4418 shown in SEQ ID NO: 20 as the promoter region of AtNACK2 is the same as that of pBI-121 (Clontech). Replace with 35S promoter.
  • These plasmids can be transformed into Nicotiana tapa cultivar 31 ⁇ 1 (1 ⁇ (: ( ⁇ 11 1 & 1) ⁇ 1] 111 ( ⁇ . SR1) by the method described in Example 15 or Arabidopsis thaliana. If this is the case, the Eco-type Colombian species can be transferred to the species via the Agrobacterium tumefacience EHA101 strain carrying these plasmids by the Floral Dip method (Clough et al., Plant J Hibiki, 16: 735 (1998)). Therefore, it is possible to change the character.
  • GUS enzyme activity was expressed in organs involved in flower formation, and staining was performed based on X-Gulc (5-bromo-4-chloro-3-indolin beta-D-glucuronide). Intense staining is observed in male organs or cells. So-called column 18
  • AtNACK2 promoter Reduced fertility of NACK2: ST transformants
  • the DNA encoding the amino acid sequence at positions 363 to 955 of the NACK2 protein is functionally fused to replace the 35S promoter of BI-121 (Clontech) with the GUS residue.
  • the resulting plasmid can be used to transform octopus and Arabidopsis by the method of fe Example 17. In this transgenic plant, and finally in male organs or cells, cytokinesis is suppressed, and a plant with reduced fertility is produced.
  • AVP1 promoter NACK2: ST transgenic plants have reduced fertility
  • PBI-121 (Clontech) Functionally fuses the DNA encoding the 360th to 955th amino acid sequence of the NACK2 protein with a DNA sequence of about 400 bases upstream from the vicinity of the transcription start site of Arabidopsis AVP1. Replace 35S promoter with GUS residue.
  • the method of Example 17 can be used to transform tobacco and Arabidopsis thaliana with the plasmid thus obtained. In this transformed plant, a plant with reduced fertility, which suppresses cytokinesis by producing male or female organs or cells, is produced. Difficult case 20
  • TA29 promoter NACK2: Reduced fertility of ST transformed plants
  • the DNA encoding the 360-955 amino acid sequence of the NACK2 protein is functionally fused with a DNA sequence of approximately 1500 bases near the transcription start site of the tobacco TA29 gene, and the pBI-121 (Clontech) 35S promoter and GUS gene are fused.
  • the ability to transform octopus and Arabidopsis can be obtained.
  • cytoplasm is suppressed in the organs or cells of the male plant, thereby producing a plant with reduced fertility.
  • the seeds were sucrose, 30 g / l, 2 g to N6CIi land (N6 inorganic salt, N6 vitamin (Chu et al. (1975), Sientia Sinica 18: 659)) , 4-D 2 mg / l, gelrite 2 g / l were added to induce callus derived from S on pH 5.8).
  • ®S uses Ex taq (Takara), and uses a reaction buffer attached to Ex taq, 200 // M each of dATP, dP, dCTP, dGTP, primer 1 and primer 2 at 1 M each, Performed with a liquid volume of # 1.
  • a step of 94 ° C. for 30 seconds, 64 ° C. for 30 seconds, and 72 ° C. for 15 minutes was repeated for 45 cycles.
  • primer RB-5 (5'-gccagatctggggaacc ctg-3 ;; SEQ ID NO: 25) and primer RB-3 (5, -agattgtcgtttcccgccttc-3; SEQ ID NO: 26) were used.
  • PCR was performed to amplify the sequence containing the right border (RB) of T-DNA. Cut this DNA fragment with pBluescript using Kpnl and cut with Klenow fragment. The truncated ends were inserted into blunted sites to generate PR.
  • primer LB-5 (5, -cagtacattaaaaacgtccgcaatg-3 '; SEQ ID NO: 27) and primer LB-3 (5, -cagatctggggtcgatcagccg-3 ;; SEQ ID NO: 28)
  • a PCR reaction was performed to amplify a sequence containing the Left border (LB) of the ⁇ -DNA.
  • This DNA fragment was cut into pR with Sad, and inserted into a site where the cut end was blunted using a Klenow fragment to generate pRL.
  • a blunt-ended DNA fragment containing hygromycin resistance formed by the CaMV 35S promoter-1 HPT: Nos terminator-1 was added to a site in which pRL was digested with Xhol and the cut ends were blunt-ended using the Klenow fragment. Insertion generated pRHL. Cleavage of pRHL with Bglll and replacement of the excised DNA fragment containing RB, NO, iglomycin resistance gene and LB with the fragment generated by cleaving pB1121 (Clontech) with Bgl11 to generate pBI-RLH did. The Nos terminator derived from pBI221 (Clontech) was cut with pBluescripK Stratagene (Xbal) and inserted into a site blunted using a Klenow fragment to generate pTnos.
  • Xbal pBluescripK Stratagene
  • the plasmid containing the full-length cDNA of NACK2 was converted to primer NACK2- 1078K5'-tccccgcggactgcgcaagtaacatgg-3; SEQ ID NO: 29), primer NACK2-R (5'-ctacaagtgtagtaagtttga-3 ,; ) was used to amplify NACK2-ST lacking the motor region.
  • This DNA fragment encodes amino acids 360 to 955 of NACK2.
  • This DNA fragment was digested with SacII, pTnos was digested with Notl, blunted with Klenow fragment, and inserted into the site digested with SacII to generate pNACK2ST-T.
  • PDBINACK2ST is a plant transformation plasmid by the agrobacterium method into which a NACK2S T promoter can be inserted using Invitrogen's Gateway system.
  • Shiroi As a promoter for NACK2ST expression, Shiroi has been reported to be highly expressed in anthers Use the promoter region of AVP1 ⁇ 5 ⁇ , the promoter region of TA29 tobacco and the H region of Arabidopsis AtNACK2 H.
  • the AVP1 promoter extracts genomic DNA from Arabidopsis thaliana type Col-0 by a conventional method, and primers AW1 + 4A (5, -ccatcttctctcctccgvaagag-3 '; SEQ ID NO: 31), primer AVPl-298s (5'- A PCR reaction was performed using cggga t ccaaa 11 cggacaaa t agagcg t ag t caac-3 ,; SEQ ID NO: 32), and the amplified DNA fragment was inserted into the site obtained by cutting PENTR2B of Invitrogen with BamHI and EcoRV. , Generates pENTRAVPl * no
  • the TA29 promoter extracts genomic DNA from tobacco cultivar SRI according to a conventional method, and primers TA29 + 52A (5, -ctaagcttagcaaaatcataaaag-3 ;; SEQ ID NO: 33), primer — TA29-1477s (5, -cgggatccggctatattaattgtttactttttctaac-3, A PCR reaction was performed using SEQ ID NO: 34), and the amplified DNA fragment was inserted into a site obtained by cutting PENTR2B of Invitrogen with BamHI and EcoRV to generate pENTRTA29.
  • the AtNACK2 promoter extracts genomic DNA from Arabidopsis thaliana type Co 1 -0 in a conventional manner, and primers NACK2 + 4 (5, -acatcttctacacacaaaatcgaaacc -3 '; up to 1618 bases upstream from the AtNACK2 start codon; 35), Primer NACK2-1816 s '-cggga t cc t aaacaaa 111 caaaa t aca t tag taa tat aac-3'; PCR reaction using rooster [No .: 36), amplified DNA fragment was inserted into a site obtained by cutting pENTR2B of Invitrodin with BamHI and EcoRV to generate pENTRl.
  • Primer NACK2 + 4 (5, -accatcttc tacacacaaaatcgaaacc-3; SEQ ID NO: 35), Primer NACK2-1018s (5, -cggga t cctttagtatttatacacgagacgtg -3 '; SEQ ID NO: 37) ), And the amplified DNA fragment was transferred to a site where pENTR2B of Invitrodin was cut with BamHI and EcoRV to generate pENTRl.O.
  • Primer NACK2 + 4 (5 '-acatcttc PCR reaction was carried out using tacacacaaaatcgaaacc-3, rooster sequence number: 35), and primer NACK2-419s (5, -cgggatccg attttgcctctgcgaaaac-3 '; SEQ ID NO: 39), and the amplified DNA fragment was subjected to invitrodin.
  • PENTR2B was inserted into a site cut with BamHI and EcoRV to generate ENTRO. So far, the PCR reaction performed at the time of constructing the plasmid was performed using Takara Pyr obest under the recommended conditions attached to the enzyme.
  • the plasmid containing these promoter regions was mixed with PDBINACK2ST, and the reaction was carried out according to the protocol attached to Invitrogen's LR clonase, and the promoter sequence was inserted upstream of NACK2ST.
  • NACK2ST is expressed by the AtNACK2 promoter (1018 bp) pExpNl. 0-ST
  • NACK2ST is expressed by the AtNACK2 promoter (419 bp).
  • the Agrobacterium tumefacience EHAIOI strain is transformed using the binary vector (1) to (6) generated in the above (1), and the Agrobacterium holding these plasmids is transformed using the Agrobacterium tumefacience EHAIOI strain.
  • Arabidopsis thaliana cotype Co 1-0 was transformed by Floral dip method. Seeds obtained from flower buds infected with Agrobacterium were sterilized using dichloric acid and sterilized water, and sown on MSfe3 ⁇ 4Ji containing 25 g / ml of iglomycin and 100 ⁇ g / ml of urenobenicillin. Transformed plants capable of growing in a culture medium supplemented with hygromycin were selected, and these were replanted in soil, and darkened at 20 ° C. for 16 hours in the light and 8 hours in the dark. (3) Reduced fertility of transformed plants
  • Primer RB-5 (5'-gccagatctggggaacc ctg-3 ,; rooster sequence number: 25) and primer RB-3 (5, -agattgtcgtttcccgccttc-3 '; pBI121 (clotting agent) as type II; so-called number: 26 ) was performed to amplify the sequence containing the right border (RB) of T-DNA.
  • This DNA fragment was cut into pBluescript with Kpnl and inserted into a site where the cut end was blunted using a Klenow fragment to generate pR.
  • Primer LB-5 (5,-cagtacat taaaaacgtccgcaatg -3 ,; SEQ ID NO: 27) and Primer LB-3 (5,-cagatctggggtcgatcagccg -3 ,; Roger's column number: 28, with BI121 (Clontech) as «
  • a PCR reaction was performed using PCR to amplify a sequence containing the Left border (LB) of T-DNA. This DNA fragment was cut into pR with Sad, and inserted into a site where the cut end was blunted using a Klenow fragment to generate pRL.
  • RHL was digested with BglII, and the DNA fragment containing the excised RB, hygromycin resistance gene and LB was replaced with a fragment produced by digesting PBI121 (Clontech) with BgUI to generate pBT RHL.
  • a DNA fragment of Reading Frame A commercially available from Invitrogen was added to a site obtained by cutting pUC19 (evening color) with Smal to generate pUC-RFA. Reading frame A, which was obtained by cutting pUC-RFA with BamHI and Spel, was inserted into a site where pBI-RLH was cut with BamHI and Spel, to generate pDESTBI-2.
  • the CaMV 35S promoter derived from pB1221 (Clontech) was inserted into the Ehel site of the plasmid pENTR2B commercially available from Invitrogen, and the Nos terminator derived from pBI221 (Clontech) was inserted into the EcoRV site to generate pENTR35ST-1. . 02 12268
  • OsNACK cDNA was converted to pBluescript (staratagene) by using the plasmid pBS-OsNACK as a primer. PCR reaction was performed using SEQ ID NO: 41) to amplify a DNA fragment of OsNACKST lacking the motor domain. This DNA fragment encodes 358-954 amino acids of OsNACK,
  • a protein consisting of the amino acid sequence at position 954 can be expressed. After digesting this DNA fragment with Kpnl and Notl, it was inserted into the site of PENTR35ST-1 that had been digested with Kpnl and Notl to generate pENTR35S0sNACKST.
  • a DNA fragment encoding sGFP was cut out from the plasmid pTH2 containing sGFP (Chiu et al., Curr Biol 1996 Mar 1; 6 (3): 325-30) by digestion with Sail and NotI, and pBNTR35ST-l was converted into Sal. It was inserted into the site generated by cleavage of I and No 11 to generate pENTRGFP.
  • pDESTBI-2 and pENTR35S0sNACKST were mixed, and pDBIOsNACKST was generated by site-specific recombination using Gateway LR Clonase mix.
  • pDESTBI-2 and pENTRHA2 NACK1ST were mixed, and pDB IHA2NACK1ST was generated by a site-specific recombination reaction using Gateway LR Clonase mix.
  • PDBINACK2ST and PENTR35S described in Example 22 were mixed, and PDBI35SNACK2ST was generated by site-specific recombination RJB using Gateway LR Clonase mix.
  • pDES TBI-2 and pENTRGFP were mixed, and PDBIGFP was generated by a site-specific recombination reaction using Gateway LR Clonase mix.
  • the site-specific thread recombination reaction using Gateway LR Clonase mix was performed according to the attached protocol.
  • the pDBI0sNACKST, pDBIHA2NACKlST.pDBI35SNACK2ST and pDBIGFP are CaMV 3 It is a plasmid vector that expresses OsNACKSTs HA2NACK1ST. NACK2ST and sGFP by the 5S promoter, respectively, and is an initiator vector that enables plant transformation by the agrobacterium method.
  • Agrobacterium tumefacience EHA101 strain was transformed.
  • the agrobacterium retaining these plasmids was shaken at 30 ° C for 2 days in YEB medium, and the culture was cultured in 100 a1 and LSD liquid medium and subcultured.
  • Day BY-2 cells # 1 were mixed and co-cultured at B-sound at 25 ° C.
  • the BY-2 cells in the co-culture were fixed with an equal mixture of lactic acid and propionic acid containing 1% olcein, nuclear staining was performed, and the cells were observed under a differential interference microscope.
  • PCR using primer RB-5 (5'-gccagatctggggaaccct g-3 '; SEQ ID NO: 25) and primer RB 3 (5 agattgtcgtttcccgccttc-3 ;; SEQ ID NO: 26) Reaction was performed to amplify a sequence containing the right border (RB) of T-DM.
  • This DNA fragment was cut into pBluescript with Kpnl and inserted into a site where the cut end was blunted using a Klenow fragment to generate pR.
  • the primer LB-5 (5'-cagtacattaaaaacgtccgcaatg-3 ;; SEQ ID NO: 27) and the primer LB-3 (5, -cagatctggggtcgatcagccg-3 '; SEQ ID NO: 28) PCR reaction was used to amplify a sequence containing T-DM Left border (LB).
  • This MA fragment was cut into pR with Sacl and inserted into a site where the cut end was blunted using the Klenow fragment to generate pRL.
  • the pRL was cut with Xhol, and the cut end was blunt-ended using a Klenow fragment.
  • PBI221 as type II primer (5, -tccccgcggatgtta cgtcctgtagaaac-3; Rooster sequence number: 44) and primer (5'-gtaaaacgacggccagt-3 '; Rooster sequence number: 45) were performed to amplify a DNA fragment containing GUS and Nos terminator. This DNA fragment was inserted into the site where pBluescripK (Staratagene) was cut with Smal to generate pGUS-T.
  • pGUS-T is cut with SacI I, blunted with Klenow fragment, DNA fragment containing GUS and Nos terminator after Spel cleavage
  • pBI-RLH is cut with BamHI, Klenow fragment is blunted with Klenow fragment, site generated by Spel cleavage And generated pBIHm-GUS.
  • Reading Frame A Invitrogen was inserted to generate pDBI-GUS.
  • Plasmid pExpNl.0-GUS which expresses GUS at the AtNACK2 promoter (1018 bp)
  • Plasmid pExpNO.4-GUS which expresses GUS at the AtNACK2 promoter (417 bp), was generated.
  • the Agrobacterium tumefacience EHA101 strain (Agrobacterium tumefacience EHAIOI strain) is transformed using the plasmids (1) to (4) described above, and an Agrobacterium holding these plasmids is used.
  • Arabidopsis thaliana (CoH) by the Floral dip method. Seeds obtained from flower buds infected with Agrobacterium are sterilized using chloric acid and sterile water, and are sown at 13 times ⁇ with hygromycin 25 / g / nil and norepenicillin 100 zg / ml I do.
  • the reaction was carried out using Ex Taq CTakara, Inc., using a reaction buffer attached to taq, 200 ⁇ M each of dATP, dTTP, dCTP, dGTP and primers in a volume of 50 ⁇ l.
  • GeneAmp PCR system 9700 PE Applied Biosystems
  • a step of 94 ° C for 30 seconds, 64 ° C for 30 seconds, and 72 ° C for 15 minutes was repeated 45 cycles.
  • the DNA fragment was excised using an agarose gel and found to have a single DNA fragment of approximately 3 kbp. This DNA fragment was reconstituted with EcoRV from BluescripKSK-) (Stratagene). Closed HfS and closed.
  • the ⁇ 3 ⁇ 4 sequence of the obtained plasmid pBS-AtNACKl was determined, and its nucleotide sequence was set to SEQ ID NO: 5, and the amino acid sequence encoded by this cDNA was set to SEQ ID NO: 6.
  • the primers used for the PCR reaction are shown in SEQ ID NO: 48 and SEQ ID NO: 49. The primer is It was designed based on the base sequence of the genomic DNA shown in SEQ ID NO: 47.
  • the reaction was carried out using Ex taq (Takara), using a reaction buffer attached to Ex taq and 200 zM dATP ⁇ ( ⁇ ⁇ dCTP, dGTP and primer each 1 each) at 50 zl.
  • a step of 94 ° C for 30 seconds, 64 ° C for 30 seconds, and 72 ° C for 15 minutes was repeated 45 cycles.
  • Analysis using a single gel revealed that a single DNA of approximately 2.8 kbp was strongly amplified, and this DNA fragment was inserted into the EcoRV cleavage site of BluescripKSK-) (Stratagene). It was cloned.
  • the nucleotide sequence of the obtained plasmid pBS-AtNACK2 was determined, and its: ⁇ S sequence was shown in SEQ ID NO: 50, and the amino acid sequence encoded by this cDNA was shown in SEQ ID NO: 51.
  • Example 26 The nucleotide sequence of the obtained plasmid pBS-AtNACK2 was determined, and its: ⁇ S sequence was shown in SEQ ID NO: 50, and the amino acid sequence encoded by this cDNA was shown in SEQ ID NO: 51.
  • Plasmid pBS-AtNACK1 in which AtNACKl cDNA was inserted with pBluescript (staratagene) was used as a type I primer (5, -gggggtaccatggttgtctctgataagcaac-3 ,; SEQ ID NO: 52) and primer T3 (5, -aattaaccctcactaaaggg-3 ,; A PGR reaction is performed using No. 41) to amplify the AtNACKlST DNA fragment from which one motor region has been deleted.
  • At NACK1ST DNA encodes the 361st to 974th amino acids of the amino acid sequence of AtNACKl shown in SEQ ID NO: 6, and lacks a motor domain. After digestion of this DNA fragment with Kpnl and Notl, the DNA fragment is inserted into the site of BNTR35ST-1 that has been digested with Kpnl and Notl to generate pENTR35SAtNACKlST.
  • AtNACK2 cDNA was inserted into pBluescripK Starata Gene. Plasmid pBS-AtNA CK2 into which the inserted plasmid was type I was used as a primer (5, -gggggtaccatggttgtctcagaaaaaag-3 ;; Torimoto column number: 53) and a primer T3 (5, -aattaaccctcactaaaggg-3, A PCR reaction is performed using SEQ ID NO: 41) to amplify an AtNACK2ST DNA fragment from which one motor region has been deleted.
  • AtNA CK2ST DNA encodes amino acids 356 to 938 of the amino acid sequence of AtNACK2 shown in SEQ ID NO: 51, and lacks a motor domain. After digesting this DNA fragment with Kpnl and Notl, insert into the site of PENTR35ST-1 by digestion with Kpnl and Notl, and pE Press NT 35SAtNACK2ST.
  • pDBIAtNACKlST and pDBIAtNACK2ST are one of the most powerful ingredients capable of transforming plants by the Agrobacterium method in which AtNACKlST and AtNACK2ST are strongly expressed by the CaMV 35S promoter.
  • the Agrobacterium tumefacience EHA101 strain is transformed using the binary vector (1), pDBIAtNACK1ST, pDBIAtNACK2ST and pDBI35SGFP of (1).
  • the agrobacterium containing these plasmids was shake-cultured in YEB medium at 30 ° C for 2 days, and the culture was cultured on a 100/1 LSD solution in ⁇ ⁇ ⁇ ground. Mix 4 ml of BY-2 cells and co-culture at 25 ° C in the dark. Lactic acid containing 1% Orusein the BY-2 cells co ⁇ , fixed with an equal volume mixture of propionic acid, subjected to nuclear staining, perform cell observation under fine ⁇ 11 Wataru microscope.
  • AtNACK 1ST and AtNACK2ST were also found to inhibit cytokinesis similarly to NACK1ST.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Botany (AREA)
  • Polymers & Plastics (AREA)
  • Physiology (AREA)
  • Animal Husbandry (AREA)
  • Mycology (AREA)
  • Food Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

L'invention concerne des techniques de régulation de cytokinèse végétale. Puisqu'un végétal mâle génétiquement stérile est utile, on a besoin de techniques efficacement applicables à des végétaux appartenant à une gamme très variée. L'invention permet d'obtenir une technique de régulation de formation et de croissance d'un phragmoplaste végétal par le biais d'un procédé consistant à commander l'expression du gène NACK1, du gène NACK2, d'un gène analogue à ceux-ci ou d'un gène associé à ceux-ci, et à utiliser une protéine de NACK1 ou de NACK2 modifiée, en tant que molécule négative dominante. L'invention concerne une technique de commande de l'expression d'un pollen formant un gène spécifique à un tissu dans un promoteur de NACK2 ou dans un gène associé à celui-ci. Ceci est avantageux dans les domaines de l'agriculture et de l'horticulture, pour réguler la formation et la croissance du phragmoplasme, puisque la cytokinèse a été modifiée, un végétal à développement/différenciation modifié, peut être construit, et un végétal présentant une formation inhibée de pollens présentant une fonction normale et une stérilité mâle peut être construit, ce qui permet de favoriser la sélection et d'augmenter la productivité d'une culture agricole.
PCT/JP2002/012268 2002-05-27 2002-11-25 Regulation de la formation de phragmoplaste vegetal et procede de construction d'un vegetal sterile male WO2003100054A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002349481A AU2002349481A1 (en) 2002-05-27 2002-11-25 Regulation of the formation of plant phragmoplast and method of constructing male sterile plant

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2002-153081 2002-05-27
JP2002-153092 2002-05-27
JP2002153092 2002-05-27
JP2002153081 2002-05-27

Publications (1)

Publication Number Publication Date
WO2003100054A1 true WO2003100054A1 (fr) 2003-12-04

Family

ID=29585987

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2002/012268 WO2003100054A1 (fr) 2002-05-27 2002-11-25 Regulation de la formation de phragmoplaste vegetal et procede de construction d'un vegetal sterile male

Country Status (2)

Country Link
AU (1) AU2002349481A1 (fr)
WO (1) WO2003100054A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101037695B (zh) * 2006-03-16 2011-08-17 华中农业大学 一种控制水稻花粉育性基因及应用
US8686221B2 (en) 2007-04-30 2014-04-01 Cropdesign N.V. Plants having improved growth characteristics under reduced nutrient availability and a method for making the same

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ISHIKAWA M. ET AL.: "The NPK1 mitogen-activated protein kinase contains a functional nuclear localization signal at the binding site for the NACK1 kinesin-like protein", PLANT JOURNAL, vol. 32, no. 5, December 2002 (2002-12-01), pages 789 - 798, XP002964307 *
ITO M. ET AL.: "A novel cis-acting element in promoters of plant B-type cyclin genes activates M phase-specific transcription", THE PLANT CELL, vol. 10, no. 3, March 1998 (1998-03-01), pages 331 - 341, XP002964310 *
ITO M. ET AL.: "G2/M-phase-specific transcription during the plant cell cycle is mediated by c-Myb-like transcription factors", THE PLANT CELL, vol. 13, no. 8, August 2001 (2001-08-01), pages 1891 - 1905, XP002964309 *
LAWRENCE C.J. ET AL.: "Maximum likelihood methods reveal conservation of function among closely related kinesin families", J. MOL. EVOL., vol. 54, no. 1, January 2002 (2002-01-01), pages 42 - 53, XP002964311 *
MACHIDA Y. ET AL.: "MAPKKK-related protein kinase NPK1: regulation of the M phase of plant cell cycle", J. PLANT RES., vol. 111, no. 1102, 1998, pages 243 - 246, XP002964312 *
NISHIHAMA R. ET AL.: "Expansion of the cell plate in plant cytokinesis requires a kinesin-like protein/MAPKKK complex", CELL, vol. 109, no. 1, 5 April 2002 (2002-04-05), pages 87 - 99, XP002964308 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8853492B2 (en) 2005-11-07 2014-10-07 Cropdesign N.V. Plants having improved growth characteristics and a method for making the same
CN101037695B (zh) * 2006-03-16 2011-08-17 华中农业大学 一种控制水稻花粉育性基因及应用
US8686221B2 (en) 2007-04-30 2014-04-01 Cropdesign N.V. Plants having improved growth characteristics under reduced nutrient availability and a method for making the same

Also Published As

Publication number Publication date
AU2002349481A1 (en) 2003-12-12

Similar Documents

Publication Publication Date Title
Fukaki et al. Lateral root formation is blocked by a gain‐of‐function mutation in the SOLITARY‐ROOT/IAA14 gene of Arabidopsis
Rorat Plant dehydrins—tissue location, structure and function
US9856488B2 (en) Plant with reduced protein productivity in seeds and method for producing same
Gancheva et al. Identification, expression, and functional analysis of CLE genes in radish (Raphanus sativus L.) storage root
Kim et al. CHRK1, a chitinase-related receptor-like kinase, interacts with NtPUB4, an armadillo repeat protein, in tobacco
Royo et al. Two maize END-1 orthologs, BETL9 and BETL9like, are transcribed in a non-overlapping spatial pattern on the outer surface of the developing endosperm
Ueda et al. The Arabidopsis thaliana carboxyl-terminal domain phosphatase-like 2 regulates plant growth, stress and auxin responses
JP2001516582A (ja) サイクリン依存性キナーゼ阻害物質およびその使用
US8648232B2 (en) Early-maturing transgenic plants
JP2002538769A (ja) アポトーシス遺伝子の異種間移入及びそれにより開発されたトランスジェニック植物
Kandasamy et al. Arabidopsis actin-related protein ARP5 in multicellular development and DNA repair
WO2019101179A1 (fr) Gène de résistance aux herbicides et application associée dans la sélection des plantes
RU2349642C2 (ru) Растительные клетки и организмы растений с модифицированным клеточным ростом, развитием и дифференцировкой
EP1190039A2 (fr) Gene codant pour sin et ses utilisations
EP0967278A2 (fr) Gène pour la régulation de l'induction de la floraison et son utilisation
WO2003100054A1 (fr) Regulation de la formation de phragmoplaste vegetal et procede de construction d'un vegetal sterile male
JP4064184B2 (ja) ブラシノステロイド合成に関与する遺伝子
JP2001517450A (ja) 花弁特異的プロモーターおよび花弁のない花を有する植物を作出する方法
JP2004236653A (ja) 植物の隔膜形成体の形成制御及び雄性不稔植物作出の方法
US20030018995A1 (en) Plants with a modified flower and seed development
KR100455620B1 (ko) 벽판-특이적 아연 핑거 전사 인자 유전자를 이용한 화분수정률의 감소 방법
US20030061635A1 (en) Pollen-specific novel calmodulin-binding protein, NPG1 (No Pollen Germination1), promoter, coding sequences and methods for using the same
CA2321269C (fr) Gene des soies du mais et region regulatrice
Purwestri et al. Functional Analysis of OsKANADI1, A Florigen Hd3a Interacting Protein in Rice (Oryza sativa L.)
JP5850079B2 (ja) 種子のタンパク質含量を減少させる遺伝子及びその利用方法

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase