WO2003099229A2 - Functional protein expression for rapid cell-free phenotyping - Google Patents

Abstract

Disclosed herein are methods for assaying the phenotype of a bioactive molecule in the presence and absence of compounds that are known inhibitors of the phenotypable activity of the bioactive molecule. Also disclosed are methods for discovering compounds that can inhibit the phenotypable activity of a bioactive molecule. The methods and assays of the present invention are useful in developing and monitoring a chemotherapy regimen for a patient, to detect or prevent the emergence of a drug resistant phenotype.

Description

FUNCTIONAL PROTEIN EXPRESSION FOR RAPID CELL-FREE PHENOTYPING

FIELD OF THE INVENTION

The invention provides methods and compositions for performing in vitro drug resistance assays. More specifically, the invention provides methods and compositions for determining the suitability of one or more candidate drugs prior to or during the course of chemotherapy or anti-infective therapy, and for their capacity to inhibit microorganisms and their bioactive molecules.

BACKGROUND OF THE INVENTION It is generally known that microorganisms become resistant to drugs through evolution. Resistance to an anti-infective agent develops in microorganisms during the course of patient anti-infective therapy. Through mutational events at the molecular level, microorganisms modify the molecular structures of their proteins, most commonly enzymes that regulate growth or metabolism. Mutations are normal, and occur in the absence of anti-infective therapy, but mutations in proteins that are targets for anti-viral, anti-bacterial, and anti-fungal therapeutic agents can modify the affinities between the target and the agent, or prevent interaction or access to the target's active sites, thereby nullifying the agent's ability to deliver a therapeutic effect and destroy the microorganism. Drug therapy exerts a selection pressure on the microorganisms that selects for mutations that allow the microorganism to survive, resulting in re-infection of the patient with microbe displaying a new drug-resistant phenotype.

Drug resistance is now recognized as a common therapeutic complication in patient treatments with essentially all infective drugs. For example, penicillin, methicillin, and vancomycin resistance is often seen in anti-bacterial therapy and anti-retroviral agent resistance is commonly reported in anti-HIV therapies. Drug resistance can only be measured by limited methods for certain diseases, and HIV infection provides a well-studied example. For HIV infections, a viral load test (such as PCR, bDNA, and NASBA) can be used to determine viral replication levels in a patient. When a patient has a substantial increase in viral load while undergoing anti-retroviral drug therapy, this increase typically indicates the development of drug resistance. However, viral load tests do not assess directly the susceptibility of the virus to anti-viral compounds. Therefore, while load testing can be used to identify a patient whose virus may have developed resistance, this method cannot be used to determine the most effective drug for patient therapy. A method is needed for the evaluation and monitoring of a chemotherapeutic regimen at the onset and during the course of patient therapy.

Currently, the most common methods employed to measure resistance of HIV and other viral and bacterial infections to anti-infective agents are genotypic and phenotypic testing methods. Genotypic tests look for the presence of specific mutations that are known to cause resistance to certain drugs. These genotypic test methods are very time-intensive, requiring one to two weeks to generate conclusive test results, and suffer from further disadvantages. It can be difficult to translate mutational analysis data into meaningful clinical information useful in patient therapy, in cases, for example, where the mutation is novel or not well characterized. In fact, while HIV genotypic testing is widely used in clinical laboratories, this type of assay is not as well established for other diseases.

Computer-assisted mutational interpretation programs used by scientists and clinicians do not yet share standard analytical algorithms, and keeping these algorithms current with the newest reported mutations in the scientific literature is difficult.

Phenotypic testing methods measure the actual susceptibility of the microbes to specific drugs. Traditional phenotypic assays require the ability to grow the disease-causing microbe in culture. Measuring the ability of drugs to inhibit bacterial growth has been a routine laboratory procedure for many years. The ability to culture the disease-causing microorganism from a patient specimen provides a first method to identify the microorganism and elect a therapeutic regimen. These assays also provide reliable in vitro methods of evaluating drug resistance or susceptibility to an anti-infective agent during the course of therapy, and thus can be used to monitor for the emergence or potential for drug resistance.

However, for viruses or cancers and certain fungi and bacteria, the methods of phenotypic analysis are both expensive and time-intensive, taking many weeks or months to complete. This disadvantage has hindered routine drug resistance analysis for viruses, such as CMV or HSV. Moreover, phenotypic testing cannot be applied to unculturable viruses, such as HCV. For HIV, a recombination phenotypic assay has been developed by inserting the amplified key components of patient-obtained HIV genetic material into engineered reference vectors of HIV in order to shorten this process. See, Petropoulos et al., Antimicrobial Agents and Chemotherapy, 44: 920-928 (2000) and Hertogs et al., Antimicrobial Agents and Chemotherapy, 42: 269-276 (1998), both incorporated herein by reference. While viral cultivation and propagation time has been reduced, this method still takes two to four weeks to produce the test results. In addition, the assay is labor intensive and tedious, requiring molecular construction of the vectors, cell culture and transfection, viral particle collection, and infection.

Thus, a need remains in the art for a more cost-effective and rapid phenotypic assay for measuring drug resistance in various diseases.

SUMMARY OF THE INVENTION The present invention provides phenotypic testing assays and methods for evaluating the suitability of a chemotherapeutic regimen for a patient afflicted with a disease state. Embodiments of the invention have applications in many disease states resulting from, for example, viral infections, bacterial infections, genetic disorders, and cancers.

In one embodiment, the present invention is a diagnostic assay comprising reagents for extracting and purifying nucleic acid from an individual afflicted with a disease state, reagents for amplifying a nucleic acid sequence encoding one or more bioactive molecules expressed in the individual where the bioactive molecule is associated with the disease state, reagents for cell-free transcription of the amplified nucleic acid sequence encoding the bioactive molecule for cell-free translation of the amplified nucleic acid transcripts encoding the bioactive molecule, and reagents for phenotypic characterization of the polypeptide resulting from translation of the bioactive molecule, wherein the phenotype provides data useful for rapid evaluation or prediction of the response of an individual to at least one therapy designed to ameliorate the disease state. Reagents for phenotypic characterization include, e.g., an anti-viral compound, an anti-bacterial compound, an anti-fungal compound, an anti-cancer compound, an immunosuppressive compound, a hormone, a cytokine, a lymphokine, a chemokine, an enzyme, a polypeptide, a polynucleotide, and a nucleoside analogue.

In another embodiment, the reagents for amplifying the nucleic acid sequence encoding the bioactive molecule are used for polymerase chain reaction amplification of the nucleic acid sequence, such as a plurality of nucleic acid primers. In yet another such embodiment, the nucleic acid primers are nested. In still another embodiment, the primers have sequences selected from the group consisting of: SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l 1, SEQ ID NO:12, SEQ ID NO: 13, SEQ ID NO:14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, or degenerate variant thereof (see, Table 1). In still another aspect of the invention, the amplification of nucleic acids encoding the bioactive molecule further comprises adding one or more secondary nucleic acid sequences to the nucleic acid sequence encoding the bioactive molecule during the amplification steps. In one embodiment, these sequences can regulate transcription of the amplified nucleic acid. In another embodiment, these sequences encode polypeptides that facilitate purification of the bioactive molecule, for example, purification of the bioactive molecule by metal chelate chromatography, affinity chromatography, size exclusion chromatography, anion exchange chromatography, and cation exchange chromatography. In one embodiment, the purified bioactive molecules are studied for changes in their phenotype by, for example, changes assessing the bioactivity of a bacterial DNA gyrase or a domain thereof, and its ability to super-coil DNA in the presence of one or more antibiotics agents across a concentration range. Assays and methods useful to the present invention for determining enzyme structure and function, as well as target/ligand binding and dissociation kinetics include radioligand binding assays, protein co-immunoprecipitation, sandwiched ELISA, fluorescence resonance emission tomography (FRET), surface plasmon resonance (SPR), mass spectroscopy, nuclear magnetic resonance including 2-D NMR, and x-ray crystallography.

In one embodiment of the invention, the phenotypic assay comprises cell-free based assays and methods for transcription of the amplified nucleic acid sequence encoding he bioactive molecule, and cell-free translation of the nucleic acid transcripts thereby produced. In another embodiment, a coupled transcription/translation system, for example, a rabbit reticulocyte lysate system is employed.

In one embodiment, the present invention provides assays and methods comprising isolating nucleic acid from an individual infected with a bacteria of the genus, for example, Streptococcus, Staphylococcus, Enterococus, Neisseria, Salmonella, Mycobacteria, Bacillus, Mycoplasma, Chlamydia, Francisella, Pasturella, Brucella, Pseudomonas, Listeria, Clostridium, Yersinia, Vibrio, Shigella, Escherichia, or Enterobacteriaceae. In one aspect, a bacterial nucleic acid sequence encoding bioactive DNA gyrase, or a domain thereof, or a topoisomerase IV is amplified by polymerase chain reaction, and from the nucleic acid isolated from the infected individual, the polymerase or topoisomerase IV is transcribed and translated in a cell-free system. In another embodiment, the bioactivity of the bacterial DNA gyrase, or a domain thereof, or topoisomerase IV is characterized to determine the phenotype, which provides data useful for rapid evaluation or prediction of the response of the individual to at least one therapy designed to ameliorate the bacterial infection. In one embodiment, the present invention provides assays and methods comprising isolating nucleic acid from an individual infected with a bacteria of the genus, for example Streptococcus, Staphylococcus, Enterococus, Neisseria, Salmonella, Mycobacteria, Bacillus, Mycoplasma, Chlamydia, Francisella, Pasturella, Brucella, Pseudomonas, Listeria, Clostridium, Yersinia, Vibrio, Shigella, Escherichia, or Enterobacteriaceae. In one aspect, a bacterial nucleic acid sequence encoding bioactive DNA gyrase, or a domain thereof, or a topoisomerase IV is amplified by polymerase chain reaction, and from the nucleic acid isolated from the infected individual, the polymerase or topoisomerase IV is transcribed and translated in a cell-free system. In another embodiment, the bioactivity of the bacterial DNA gyrase, or a domain thereof, or topoisomerase IV is characterized to determine the phenotype, which provides data useful for rapid evaluation or prediction of the response of the individual to at least one therapy designed to ameliorate the bacterial infection.

In one embodiment, the present invention provides assays and methods comprising isolating nucleic acid from an individual infected with a virus, for example a retrovirus , a herpesvirus, a hantavirus, a hepatitis virus, an influenza, a myxovirus, a paramyxovirus, a picornavirus, an adenovirus, a poxvirus, a flavivirus, a parvovirus, a erythrovirus, or a coronavirus. In one aspect, a viral nucleic acid sequence encoding bioactive reverse transcriptase, protease, DNA-dependent RNA polymerase, or RNA-dependent RNA polymerase is amplified by polymerase chain reaction, and from the nucleic acid isolated from the infected individual, the polymerase, reverse trasncriptase or protease is transcribed and translated in a cell-free system. In another embodiment, the bioactivity of the viral reverse transcriptase, protease, DNA-dependent RNA polymerase, or RNA-dependent RNA polymerase is characterized to determine the phenotype, which provides data useful for rapid evaluation or prediction of the response of the individual to at least one therapy designed to ameliorate the viral infection.

In one embodiment, the present invention provides a method for producing and evaluating a kinase by providing an amplified nucleic acid sequence comprising the kinase, expressing the kinase encoded by the nucleic acid sequence and then detecting the phenotype of the kinase in the presence or absence of a test compound. In one embodiment, the phenotype is determined, for example, by detecting a change in the phosporylation activity of the kinase toward a substrate. The kinase can be a bacterial kinase, a viral kinase, a mammalian kinase, or a human kinase. In one aspect, the kinase phosphorylates on at least a serine residue, a threonine residue, or a tyrosine residue. In one embodiment the nucleic acid sequence encoding bioactive v-Abl protein tyrosine kinase, ABL, or BCR/ABL is amplified by polymerase chain reaction, and from the nucleic acid isolated from the diseased individual, the v-Abl protein tyrosine kinase, ABL, or BCR/ABL is transcribed and translated in a cell-free system. In another embodiment, the bioactivity of the v-Abl protein tyrosine kinase, ABL, or

BCR/ABL is characterized to determine the phenotype, which provides data useful for rapid evaluation or prediction of the response of the individual to at least one therapy designed to ameliorate the disease.

The assays and methods of the present invention have application in all areas of chemotherapy. In one aspect, the invention has applications in the field of anti-bacterial therapy, providing phenotype information to a physician about the bacteria that is causing the disease state in the patient, the information used in the selection and monitoring of an antibacterial chemotherapy regimen. In another aspect, the invention has applications in the field of anti-viral therapy, providing phenotype information to a physician about the virus that is causing the disease state in the patient, the information used in the selection and monitoring of an anti-viral chemotherapy regimen. In still another aspect, the invention has applications in the field of cancer therapy, providing phenotype information to a physician about the cancer that is causing the disease state in the patient, the information used in the selection and monitoring of an anti-cancer chemotherapy regimen. Methods and compositions embodied herein are envisioned for human and veterinary use. Veterinary use includes application to cows, horses, sheep, goats, pigs, dogs, cats, rabbits, and all rodents. The methods of the invention are also useful to agricultural workers and pet owners to combat infections contracted by exposure to livestock or pet animals.

BRIEF DESCRIPTION OF THE DRAWINGS The following drawings illustrate the principles of the invention disclosed herein, are intended to be exemplary only, and should not be construed to limit the scope of the claims of the invention.

Figure 1 illustrates the inhibition of wild-type DNA gyrase activity by fluoroquinolones. Inhibition of the DNA steadily rises with increased antibiotic and levels off at about 400-500μg/mL.

Figure 2 illustrates a comparison of moxifloxacin-mediated inhibition of wild-type gyrase activity and mutant DNA gyrase activity. 400μg/mL of antibiotic inhibits the wild type DNA gyrase almost completely, while the same concentration inhibits the two mutants by only about 60 and 70%. Figure 3 illustrates a comparison of gatifloxacin-mediated inhibition of wild-type gyrase activity and mutant gyrase activity. 500μg/mL of antibiotic inhibits the wild type DNA gyrase almost completely, while the same concentration inhibits the two mutants by only about 40 and 60%.

Figure 4 illustrates the Reverse Transcriptase Assay, and the colorimetric quantitative determination of the HIV reverse transcriptase acitivity by measuring the ability of the enzyme to freshly synthesize DNA template, starting from the RNA template/primer hybrid poly (A) x oligo (dT) containing digoxigenin- and biotin-labeled nucleotides. The detection of the synthesized DNA template with the incorporated modified nucleotide is used as a parameter for RT activity following a sandwich ELISA protocol methodology. The absorbance of the sample is directly associated to the level of reverse transcriptase activity.

Figure 5 illustrates the measurement of reverse transcriptase activity at different Nevirapine concentrations to determine the inhibitory effect of the drug on enzymatic activity. RT's from patients E and C have mutations which cause resistance to this drug. Figure 6 illustrates the inhibition of HIV wild-type reverse transcriptase activity measured at various Delavirdine concentrations. RT's from patients E and C have mutations which cause resistance to this drug.

DETAILED DESCRIPTION OF THE INVENTION

DEFINITIONS

As used herein in the specification and claims, the following words and phrases have the meanings as indicated.

"Quinolones" are antibiotics that target the bacterial enzyme DNA gyrase, and act by inhibiting the coiling of bacterial DNA thus interfering with bacterial replication. Quninolones include Cipro (ciprofloxacin), Floxin (ofloxacin), Levaquin (levofloxacin),

Tequin (gatifloxacin), Trovan (trovafloxacin), and other compounds having a similar mode of action.

"DNA Gyrase" is an enzyme (of the family known as topoisomerases) that alters the topological state of supercoiled DNA. DNA gyrase can induce negative supercoils in closed circular DNA. DNA gyrase is also known as DNA helicase. Natural DNA gyrase is comprised of two sub-units. The A subunit (gyrA) breaks and rejoins DNA, and the B subunit (gyrB) hydrolyzes ATP. Natural DNA gyrase is an A2B2 tetramer.

"A viral infection" or "viral disease state" refers to localized viral infections of tissues or systemic infection (viremia) in human and animal subjects. Examples of viral infections amenable to detection and monitoring by the invention disclosed herein comprise an adenovirus infection (such as infantile gastroenteritis, acute hemorrhagic cystitis, non- bacterial pneumonia, and viral conjunctivitis), a herpesvirus infection (such as herpes simplex type I and type II, varicella zoster (chicken pox), cytomegalovirus, and mononucleosis (Epstein-Barr virus)), a poxvirus infection (such as smallpox (variola major and variola minor), vaccinia virus, and molluscum contagiosum), a picornavirus infection (such as rhinovirus (the common cold, also caused by coronavirus)) poliovirus (poliomyelitus)), an orthomyxovirus or paramyxovirus infection (such as influenza, and respiratory syncytial virus (RS)), parainfluenza virus (including such diseases as mumps), and rubeola (measles), a rhabdovirus infection (rabies), vesicular stomatitis (VSV), a togavirus infection such as encephalitis (EEE, WEE, and VEE), a flavivirus infection such as Dengue Fever, West Nile Fever, yellow fever, and encephelitis, bunyavirus and arenavirus, a togavirus infection such as rubella (German measles), a reovirus infection, a coronavirus infection, a hepatitis virus infection, a papovavirus infection such as papilloma virus, a retroviral infection such as HIV, HTLV-1, and HTLV-II, a parvovirus infection and an erythrovirus infection. "A bacterial infection" or "bacterial disease state" refers to Gram positive and Gram negative bacterial infections in human and animal subjects. Gram positive bacterial species are exemplified by, but not limited to, genera including: Staphylococcus, such as S. epidermis and S. aureus; Micrococcus; Streptococcus, such as S. pyogenes, S. equis, S. zooepidemicus, S. equisimilis, S. pneumoniae and S. agalactiae; Corynebacterium, such as C. pyogenes and C. pseudotuberculosis; Erysipelothrix such as E. rhusiopathiae; Listeria, such as L. monocytogenes; Bacillus, such as B. anthracis; Clostridium, such as C. perfringens; and Mycobacterium, such as M. tuberculosis and M. leprae. Gram negative bacterial species are exemplified by, but not limited to genera including: Escherichia, such as E. coli 0157:H7; Salmonella, such as S. typhi and S. gallinarum; Shigella, such as S. dysenteriae; Vibrio, such as V. cholerae; Yersinia, such as Y. pestis and Y. enterocolitica; Proteus, such as P. mirabilis; Bordetella, such as B. bronchiseptica; Pseudomonas, such as P. aeruginosa; Klebsiella, such as K. pneumoniae; Pasteurella, such as P. multocida; Moraxella, such as M. bovis; Serratia, such as S. marcescens; Hemophilus, such as H. influenza; and Campylobacter species. Other species suitable for assays of the present invention include Enterococcus, Neisseria, Mycoplasma, Chlamidia, Francisella, Pasteurella, Brucella, and Enterobacteriaceae.

Further examples of bacterial pathogenic species that are inhibited according to the invention are obtained by reference to standard taxonomic and descriptive works such as Bergey 's Manual of Determinative Bacteriology, 9^th Ed., 1994, Williams and Wilkins, Baltimore, MD.

"A fungal infection" or "fungal disease state" refers to fungal infections in human and animal subjects. Suitable fungal genera are exempflied, but not limited to: Candida, such as C. albicans; Cryptococcus, such as C. neoformans; Malassezia (Pityrosporum); Histoplasma, such as H. capsulatum; Coccidioides, such as C. immitis; Hyphomyces, such as H. destruens; Blastomyces, such as B. dermatiditis; Aspergillus, such as A. fumigatus; Penicillium, such as P. marneffei; Pseudallescheria; Fusarium; Paecilomyces; Mucor/Rhizopus; and Pneumocystis, such as P. carinii. Subcutaneous fungi, such as species of Rhinosporidium and Sporothrix, and dermatophytes, such as Microsporum and Trichophyton species, are amenable to prevention and treatment by embodiments of the invention herein. Other disease casing fungi include Trichophyton, Microsporum; Epidermophyton; Basidiobolus; Conidiobolus; Rhizopus Cunninghamelia; Rhizomucor; Paracoccidioides; Pseudallescheria; Rhinosporidium; and Sporothrix.

"A protozoal infection" or "protozoal disease state" refers to infection with one or more single-celled, usually microscopic, eukaryotic organisms, such as amoebas, ciliates, flagellates, and sporozoans, for example, plasmodium, trypanosoma or cryptosporydia.

"A cancer" or "a cancer disease state" refers to any of various malignant neoplasms characterized by the proliferation of anaplastic cells that tend to invade surrounding tissue and metastasize to new body sites. "A cancer disorder" refers to the pathological condition characterized by such growths, for example, but not limited to, lung cancer, pancreatic cancer, colon cancer, ovarian cancer, cancers of the liver, leukemia, lymphoma, melanoma, thyroid follicular cancer, bladder carcinoma, glioma, myelodysplastic syndrome, breast cancer or prostate cancer.

"An autoimmune disorder" or "an autoimmune disease state" refers to an immune response by the body against one of its own tissues, cells, or molecules, wherein the immune response creates a pathological disease state. Examples of immune disorders comprise such disorders as systemic lupus erythematosus, (SLE), rheumatoid arthritis, Crohn's disease, asthma, DiGeorge syndrome, familial Mediterranean fever, immunodeficiency with Hyper- IgM, severe combined immunodeficiency, ulcerative colitis, Graves disease, autoimmune hepatitis, autoimmune thrombocytopenia, myesthenia gravis, sjogren's syndrome, and scleroderma.

"A genetic disorder" or "a genetic disease state" refers to a disease state resulting from the presence of a gene, the expression product of the gene being a bioactive molecule that causes or contributes to the disease state, or the absence of a gene where the expression product of the gene in a healthy individual is a bioactive molecule that ameliorates or prevents the disease state. An example of the former is cystic fibrosis, wherein the disease state is caused by mutations in the CFTR protein. An example of the latter is PKU, where the disease state is caused by the lack of an enzyme permitting the metabolism of phenylalanine. Examples of genetic disorders appropriate for screening with the present assays and methods include, for example Alzheimer disease, Amyotrophic lateral sclerosis, Angelman syndrome, Charcot-Marie-Tooth disease, Epilepsy, Essential tremor, Fragile X syndrome, Friedreich's ataxia, Huntington disease, Niemann-Pick disease, Parkinson disease, Prader-Willi syndrome, Rett syndrome, Spinocerebellar atrophy, Williams syndrome, Ellis-van Creveld syndrome, Marfan syndrome, Myotonic dystrophy, leukodystrophy, Atherosclerosis, Best disease, Gaucher disease, Glucose galactose malabsorption, Gyrate atrophy, Juvenile onset diabetes, Obesity, Paroxysmal nocturnal hemoglobinuria, Phenylketonuria, Refsum disease, and Tangier disease. "Amplification reaction mixture" refers to a combination of reagents that is suitable for carrying out a nucleic acid amplification, for example, but not limited to, rolling circle amplification or isothermic amplification methods.

"Polymerase chain reaction mixture" refers to a combination of reagents that is suitable for carrying out a polymerase chain reaction. The reaction mixture typically consists of oligonucleotide primers, nucleotide triphosphates, and a DNA or RNA polymerase in a suitable buffer.

"Amplification conditions" refers to reaction conditions suitable for the amplification of the target nucleic acid sequence. The amplification conditions refer both to the amplification reaction mixture and to the temperature cycling conditions used during the reaction.

"Anti-microbial" activity of an agent or composition refers to the ability to inhibit growth of one or more microorganisms. For example, the anti-microbial compositions described herein inhibit the growth of or kill bacterial, algal, fungal, protozoan, and viral genera and species thereof. It is well known to one of skill in the art of antibiotics development that an agent that causes inhibition of growth can also be lethal to the microorganism (bacteriocidal, for example in the case of a microorganism that is a bacterium).

"Bioactive molecule" refers to a nucleic acid, ribonucleic acid, polypeptide, glycopolypeptide, mucopolysaccharide, lipoprotein, lipopolysaccharide, carbohydrate, enzyme or co-enzyme, hormone, chemokine, lymphokine, or similar compound, that involves, regulates, or is the rate-limiting compound in a biosynthetic reaction or metabolic or reproductive process in a microorganism or tissue. Such bioactive molecules are common therapeutic drug targets, and include for example and without limitation, interferon, TNF, v-Ras, c-Ras, reverse transcriptase, g-coupled protein receptors (GPCR's), FcγR's, FcεR's, nicotinicoid receptors (nicotinic receptor, GABA_A and GABAc receptors, glycine receptors, 5-HT₃ receptors and some glutamate activated anionic channels), ATP-gated channels (also referred to as the P2X purinoceptors), glutamate activated cationic channels (NMDA receptors, AMPA receptors, Kainate receptors, etc.), hemagglutinin (HA), receptor-tyrosine kinases (RTK's) such as EGF, PDGF, NGF and insulin receptor tyrosine kinases, SH2 -domain proteins, PLC-γ, c-Ras-associated GTPase activating protein (RasGAP), phosphatidylinositol-3-kinase (PI-3K) and protein phosphatase 1C (PTP1C), as well as intracellular protein tyrosine kinases (PTK's), such as the Src family of tyrosine kinases, glutamate activated cationic channels (NMDA receptors, AMPA receptors, Kainate receptors, etc.), protein-tyrosine phosphatases Examples of receptor tyrosine phosphatases include: receptor tyrosine phosphatase rho, protein tyrosine phosphatase receptor J, receptor-type tyrosine phosphatase D30, protein tyrosine phosphatase receptor type C polypeptide associated protein, protein tyrosine phosphatase receptor-type T, receptor tyrosine phosphatase gamma, leukocyte-associated Ig-like receptor ID isoform, LAIR- ID, LAIR-1C, MAP kinases, neuraminadase (NA), proteases, polymerases, serine/threonine kinases, second messengers, transcription factors, and other such important metabolic building blocks or regulators. Virtually any bioactive molecule can be monitored with the present invention. "Broad spectrum" anti-microbial activity refers to the ability to inhibit growth of organisms that are relatively unrelated. For example, ability of an agent to inhibit growth of both a Gram positive and a Gram negative bacterial species is considered a broad spectrum activity, as is the ability to inhibit growth of different microorganisms, such as a bacteria and a fungus. "Hybridization" refers to the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. Hybridization can occur between fully (exactly) complementary nucleic acid strands or between "substantially complementary" nucleic acid strands that contain minor regions of mismatch. Conditions under which only fully complementary nucleic acid strands will hybridize are referred to as "stringent hybridization conditions" or "sequence-specific hybridization conditions". Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions. Those skilled in the art of nucleic acid technology can determine duplex stability empirically following the guidance provided by the art (see, e.g., Sambrook et al, Molecular Cloning— A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1989), incorporated herein by reference).

"Nested" and "nested primers" refers to at least two nucleic acid oligonucleotide sequences where at least one first primer sequence (the internal sequence) comprises a part of the other primer (the external sequence), to constitute a nested primer set. Nested primer PCR generally involves a pair of nested primer sets, (for example an upstream nested primer set and a downstream nested primer set) and is used, for example but without limitation, to increase yields of the desired amplification target where there is little starting material to use as a template, or where the sample is contaminated with other nucleic acid material that can provide an undesirable false priming template (see, Sambrook et al., (1989) for a further description of nested primer design and use).

"Nucleic acid" refers to generic to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to polyribonucleotides (containing D-ribose), and to any other type of polynucleotide which is an N-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine base. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA including tRNA. The terms "nucleic acid primer" and "oligonucleotide" refer to primers, probes, and oligomer fragments to be amplified or detected. There is no intended distinction in length between the terms "nucleic acid primer" and "oligonucleotide", and these terms will be used interchangeably.

"Phenotypic characterization" or "detecting the phenotype" refers to a determination of the physical properties of a bioactive molecule, for example a drug resistant phenotype, a drug sensitive phenotype, a change in the kinetics of the bioactive molecule or binding affinity for a particular ligand or therapeutic agent, a change in an epitope, catalytic site or other structural change to a bioactive molecule, loss or gain of function, and any such qualitative or quantitative experiment or diagnostic used to analyze these properties. The phenotype thus refers to observable physical or biochemical characteristics of a bioactive molecule or traits of an organism that expresses the bioactive molecule based. on, for example, genetic and environmental influences. "Primer" refers to an oligonucleotide capable of acting as a point of initiation of DNA synthesis under conditions in which synthesis of a primer extension product complementary to a nucleic acid strand is induced, i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. A primer is preferably a single-stranded oligodeoxyribonucleotide. The appropriate length of a primer depends on the intended use of the primer but typically ranges from 10 to 50 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template. A primer need not reflect the exact sequence of the template nucleic acid, but must be sufficiently complementary to hybridize with the template. Primers can incorporate additional features which allow for the detection or immobilization of the primer but do not alter the basic property of the primer, that of acting as a point of initiation of DNA synthesis. For example, primers may contain an additional nucleic acid sequence at the 5' end which does not hybridize to the target nucleic acid, but which facilitates cloning of the amplified product. The region of the primer, which is sufficiently complementary to the template to hybridize, is referred to herein as the hybridizing region.

An oligonucleotide primer or probe is "specific" for a target sequence if the number of mismatches present between the oligonucleotide and the target sequence is less than the number of mismatches present between the oligonucleotide and non-target sequences.

Hybridization conditions between primers and template sequences for PCR can be chosen under which stable duplexes are formed only if the number of mismatches present is no more than the number of mismatches present between the oligonucleotide and the target sequence. Under such conditions, the target-specific oligonucleotide can form a stable duplex only with a target sequence. The use of target-specific primers under suitably stringent amplification conditions enables the specific amplification of those target sequences, which contain the target primer binding sites. Similarly, the use of target-specific probes under suitably stringent hybridization conditions enables the detection of a specific target sequence.

"Target region" and "target nucleic acid" refers to a region of a nucleic acid, which is to be amplified, detected, or otherwise analyzed. The sequence to which a primer or probe hybridizes can be referred to as a "target."

"Thermostable DNA polymerase" refers to an enzyme that is relatively stable to heat and catalyzes the polymerization of nucleoside triphosphates to form primer extension products that are complementary to one of the nucleic acid strands of the target sequence. The enzyme initiates synthesis at the 3' end of the primer and proceeds in the direction toward the 5' end of the template until synthesis terminates. Purified thermostable DNA polymerases are commercially available from Perkin-Elmer, (Norwalk, CT).

An "upstream" primer refers to a primer whose extension product is a subsequence of the coding strand; a "downstream" primer refers to a primer whose extension product is a subsequence of the complementary non-coding strand. A primer used for reverse transcription, referred to as an "RT primer", hybridizes to the coding strand and is thus a downstream primer. Conventional techniques of molecular biology and nucleic acid chemistry, which are within the skill of the art, are fully explained in the literature. See, for example, Sambrook et al, 1989, Molecular Cloning -A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Nucleic Acid Hybridization (B. D. Hames and S. J. Higgins. eds., 1984); and a series, Methods in Enzymology (Academic Press, Inc.), all of which are incorporated herein by reference. All patents, patent applications, and publications mentioned herein, both supra and infra, are incorporated herein by reference in their entireties.

DETAILED DESCRIPTION OF THE DRA WINGS

Figure 1 illustrates the inhibition of wild-type DNA gyrase activity by fluoroquinolones. Moxifloxacin and gatifloxacin were added to the gyrase assay in the final concentration of 0, 150, 200, 250, 300, 350, 400 and 450 μg/mL, respectively. Inhibition (%) of DNA gyrase activity was plotted versus drug concentration. Inhibition steadily rises until about 400μg/mL.

Figure 2 illustrates a comparison of moxifloxacin-mediated inhibition of wild-type DNA gyrase activity and mutant DNA gyrase activity. Moxifloxacin was added to the gyrase assay in the final concentration of 0, 150, 200, 250, 300, 350, 400, 450 and 500 μg/ml respectively. Inhibition (%) of DNA gyrase activity was plotted versus drug concentration. S- WT: wild-type DNA gyrase; SMI : mutant DNA gyrase containing mutation S81F associated with drug resistance; SM2: mutant DNA gyrase containing mutation E85K associated with drug resistance. 400μg/mL of antibiotic inhibits the wild type DNA gyrase almost completely, while the same concentration inhibits the two mutants by only about 60 and 70%.

Figure 3 illustrates a comparison of gatifloxacin-mediated inhibition of wild-type DNA gyrase activity and mutant gyrase activity. Gatifloxacin was added to the DNA gyrase assay in the final concentration of 0, 150, 200, 250, 300, 400, 500, 600, 700 and 800 μg/ml respectively. Inhibition (%) of DNA gyrase activity was plotted versus drug concentration. S- WT: wild-type gyrase; SMI: mutant DNA gyrase containing mutation S81F associated with drug resistance; SM2: mutant gyrase containing mutation E85K associated with drug resistance. 500μg/mL of antibiotic inhibits the wild type DNA gyrase almost completely, while the same concentration inhibits the two mutants by only about 40 and 60%. Figure 4 illustrates the Reverse Transcriptase Assay, and the colorimetric quantitative determination of the HIV reverse transcriptase acitivity by measuring the ability of the enzyme to freshly synthesize DNA template, starting from the RNA template/primer hybrid poly (A) x oligo (dT) containing digoxigenin- and biotin-labeled nucleotides. The detection of the synthesized DNA template with the incorporated modified nucleotide is used as a parameter for RT activity following a sandwich ELISA protocol methodology. The absorbance of the sample is directly associated to the level of reverse transcriptase activity.

Figure 5 illustrates the measurement of reverse transcriptase activity at different Nevirapine concentrations to determine the inhibitory effect of the drug on enzymatic activity. RT's from patients E and C have mutations which cause resistance to this drug.

Figure 6 illustrates the inhibition of HIV wild-type reverse transcriptase activity measured at various Delavirdine concentrations. RT's from patients E and C have mutations which cause resistance to this drug.

DETAILED DESCRIPTION The present invention provides phenotypic testing assays and methods for evaluating the suitability of a chemotherapeutic regimen for a patient afflicted with one or more disease states. The invention has applications in many types of disease states, but preferred diseases particularly suited to the assays and methods disclosed herein are viral infections, bacterial infections, fungal infections, autoimmune disorders, genetic disorders and cancers, where a bioactive molecule displaying phenotypable activity is implicated in, or known to be present in the disease state. Preferably, the bioactive molecule is a direct target for a chemotherapeutic agent. Thus, a direct correlation can be made between the molecule's phenotype and a agent's clinical efficacy. However, the invention also has application in assays where the bioactive molecule demonstrating a phenotype capable of characterization is not the direct drug target, but instead lies downstream in a metabolic pathway from the drug target, i.e., in an enzyme cascade or cycle. It is desirable but not necessary that the phenotypable bioactive molecule be involved in a rate-limiting reaction, or be unique to the particular infective microorganism, or expressed in quantifiably different levels in disease tissues compared to healthy tissues as detectable by, for example, quantitative RT-PCR, so as to provide supplementary data to clinicians. PCR amplification is sensitive enough to amplify even low-level transcripts expressed weakly or transiently in a tissue such as a cancer tissue, or in slow replicating viruses or microorganisms. A subject is diagnosed as having a microbial infection by inspection of a bodily tissue, e.g., epidermal and mucosal tissue, including such tissue present in surfaces of oral, buccal, anal, and vaginal cavities. Diagnosis of infection is made according to criteria known to one of skill in the medical arts, including but not limited to, areas of inflammation or unusual patches with respect to color, dryness, exfoliation, exudation, purulence, streaks, or damage to integrity of surface. Conditions exemplary of those treated by the compositions and methods herein, such as abscess, meningitis, cutaneous anthrax, septic arthritis, emphysema, impetigo, cellulitis, pneumonia, sinus infection and tubercular disease are accompanied by elevated temperature. Diagnosis can be confirmed using standard ELISA- based kits, and by culture, and by traditional stains and microscopic examination of direct samples, or of organisms cultured from an inoculum from the subject. The preferred method of confirming diagnosis is isolation and identification of a disease-specific polynucleotide or polypeptide from an individual as described herein. Diagnosis often reveals the presence of one or more disease states in a patient, for example, patients that become severely immunocompromised because of underlying diseases such as leukemia or acquired immunodeficiency syndrome or patients who undergo cancer chemotherapy or organ transplantation, are particularly susceptible to opportunistic fungal infections. The invention is particularly suited to detecting multiple bioactive molecules from the etiological agent of one or more disease states in a single assay, for example, by using multiple primer sets in a single PCR amplification.

Amplification

The polymerase chain reaction (PCR) amplification process is well known in the art and described in U.S. Pat. Nos. 4,683,195; 4,683,202; and 4,965,188, incorporated herein by reference. Commercial vendors, such as Perkin Elmer (Norwalk, CT), market PCR reagents and publish PCR protocols. For ease of understanding, the advantages provided by the present invention, a summary of PCR is provided.

In each cycle of a PCR amplification, a double-stranded target sequence is denatured, primers are annealed to each strand of the denatured target, and the primers are extended by the action of a DNA polymerase. The process is repeated typically at least 7 and up to 35 times, but this will vary depending on the desired experimental conditions. The two primers anneal to opposite ends of the target nucleic acid sequence and in orientations such that the extension product of each primer is a complementary copy of the target sequence and, when separated from its complement, can hybridize to the other primer. Each cycle, if it were 100% efficient, would result in a doubling of the number of target sequences present.

Either DNA or RNA target sequences can be amplified by PCR. In the case of an RNA target, such as in the amplification of HBV nucleic acid as described herein, the first step consists of the synthesis of a DNA copy (cDNA) of the target sequence. The reverse transcription can be carried out as a separate step, or preferably in a combined reverse transcription-polymerase chain reaction (RT-PCR), a modification of the polymerase chain reaction for amplifying RNA. The RT-PCR amplification of RNA is well known in the art and described in U.S. Pat. Nos. 5,322,770 and 5,310,652; Myers and Gelfand, Biochemistry 30(31): 7661-7666 (1991); Young et al, J. Clin. Microbiol 31(4): 882-886 (1993); and Young et al, J. Clin. Microbiol 33(3): 654-657 (1995); each incorporated herein by reference.

Various sample preparation methods suitable for RT-PCR have been described in the literature. For example, techniques for extracting ribonucleic acids from biological samples are described in Rotbart et al, in PCR Technology (Erlich ed., Stockton Press, N.Y. (1989)) and Han et al, Biochemistry 2: 1617-1625 (1987), both incorporated herein by reference. The particular method used is not a critical part of the present invention. One of skill in the art can optimize reaction conditions for use with the known sample preparation methods. Due to the enormous amplification possible with the PCR process, low levels of DNA contamination from samples with high DNA levels, positive control templates, or from previous amplifications can result in PCR products, even in the absence of purposefully added template DNA. Laboratory equipment and techniques which will minimize cross contamination are discussed in Kwok and Higuchi, Nature, 339: 237-238 (1989), and Kwok and Orrego, in: Innis et al, eds., PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc., San Diego, Calif. (1990), which are incorporated herein by reference. Enzymatic methods to reduce the problem of contamination of a PCR by the amplified nucleic acid from previous reactions are described in PCT patent publication No. US 91/05210, U.S. Pat. No. 5,418,149, and U.S. Pat. No. 5,035,996, each incorporated herein by reference. Amplification reaction mixtures are typically assembled at room temperature, well below the temperature needed to insure primer hybridization specificity. Non-specific amplification may result because at room temperature the primers may bind non-specifically to other, only partially complementary nucleic acid sequences, and initiate the synthesis of undesired nucleic acid sequences. These newly synthesized, undesired sequences can compete with the desired target sequence during the amplification reaction and can significantly decrease the amplification efficiency of the desired sequence. Non-specific amplification can be reduced using a "hot-start" wherein primer extension is prevented until the temperature is raised sufficiently to provide the necessary hybridization specificity.

In one hot-start method, one or more reagents are withheld from the reaction mixture until the temperature is raised sufficiently to provide the necessary hybridization specificity. Hot-start methods which use a heat labile material, such as wax, to separate or sequester reaction components are described in U.S. Pat. No. 5,411,876 and Chou et al, Nucl. Acids Res., 20(7): 1717-1723 (1992), both incorporated herein by reference. In another hot-start method, a reversibly inactivated DNA polymerase is used which does not catalyze primer extension until activated by a high temperature incubation prior to, or as the first step of, the amplification. Non-specific amplification also can be reduced by enzymatically degrading extension products formed prior to the initial high-temperature step of the amplification, as described in U.S. Pat. No. 5,418,149, which is incorporated herein by reference.

While the above discussion has focused on PCR amplification of nucleic acids, other such amplification methods exist. For example, ligase chain reaction and isothermic amplification methods such as rolling-circle amplification methods. These are appropriate for amplifying a nucleic acid as described herein. Primers

Oligonucleotide primers can be prepared by any suitable method, including, for example, cloning and restriction of appropriate sequences and direct chemical synthesis by a method such as the phosphotriester method of Narang et al, 1979, Meth. Enzymol. 68: 90-99; the phosphodiester method of Brown et al, 1979, Meth. Enzyme. 68: 109-151; the diethylphosphoramidite method of Beaucage et a/., 1981, Tetrahedron Lett. 22: 1859-1862; and the solid support method of U.S. Pat. No. 4,458,066, each incorporated herein by reference. Methods for synthesizing labeled oligonucleotides are described in Agrawal and Zamecnik, 1990, Nucl. Acids. Res. 18(18): 5419-5423; MacMillan and Verdine, 1990, J Org. Chem. 55: 5931-5933; Pieles et al, 1989, Nucl Acids. Res. 17(22): 8967-8978; Roget et al, 1989, Nucl Acids. Res. 17(19): 7643-7651 ; and Tesler et al, 1989, J. Am. Chem. Soc. I l l: 6966-6976, each incorporated herein by reference. A review of synthesis methods is provided 1990, Bioconjugate Chemistry 1(3): 165-187, incorporated herein by reference. Table 1 illustrates a nested primer set of the present invention, used to amplify the viral gene encoding HBV polymerase. One or more secondary nucleic acid sequences may be added to the nucleic acid sequence encoding the bioactive molecule by PCR during the amplification steps depending on the experimental strategy, for example, these secondary nucleic acid sequences include His tags, HA or FLAG epitopes or other immunological based purification tags, GST, streptaviden or MBP proteins, or other polypeptides that facilitate purification. Methods of purification of recombinant proteins are well described, and such methods applicable to the invention include metal chelate chromatography, affinity chromatography, size exclusion chromatography, anion exchange chromatography, and cation exchange chromatography. These purification techniques can also be employed with such chromatography systems as a gas chromatograph, HPLC or FPLC. The secondary nucleic acid sequences may comprise sequences encoding regulatory elements that modulate transcription or translation of the gene in the amplified nucleic acid, for example but not limited to, by adding a promoter such as ADH, T7, RSV, or CMV promoter, or by adding a Kozak sequence, or stem-loop termination sequences. Other reporter genes or domains may be used to create fusion proteins with the polypeptide of interest, for example, a GFP fusion protein or β-galactosidase fusion protein. The invention also contemplates that multiple primer sets can be used to amplify one or more bioactive targets from a single reaction. The use of secondary nucleic acid sequences provides a particular advantage of the present invention where it is desirable that the nucleic acid sequences encoding the bioactive molecule are to be purified or cloned directly from a single PCR reaction that also generates the protein for the phenotypic assay.

Table 1: List of Sequences

In vitro Transcription and Translation

Assays and methods of the present invention comprise transcribing the amplified cDNA encoding the bioactive molecule, and translating the resultant RNA into the desired protein in an in vitro transcription/translation system. It is preferred that a coupled transcription/translation system is used that can use linear DNA, i.e., PCR-amplified DNA, as a starting material. Since the PCR-amplified nucleic acids are used directly as templates for protein expression, it eliminates plasmid-based cloning procedures for protein expression and cell culture (see, Li et al, Biochem. Cell Biol, 11: 119-126 (1999), Kim et al, Virus Gene, 19: 123-130 (1999), Qadri et al, J. Biol. Chem., 274: 31359-31365 (1999), Xiong et al, Hepatology, 28: 1669-1673 (1998), Seifer et al, J. Virol, 72: 2765-2776 (1998), Lee et al, Biochem. Biophys. Res. Comm., 223: 401-407 (1997), Landford et al, J. Virol, 69: 4431-4439 (1995), Tavis et al, Proc. NatlAcad. Sci. 90: 4107-4111 (1993), and U.S. Pat. Nos. 5,655,563; 5,552,302; 5,492,817; 5,324,637; 4,966,964, all incorporated herein by reference). Commercially available systems are the TNT® SP6 Coupled Reticulocyte Lysate System, TNT® T7 Coupled Reticulocyte Lysate System, TNT® T3 Coupled Reticulocyte Lysate System, TNT® T7/T3 Coupled Reticulocyte Lysate System, TNT® T7/SP6 Coupled Reticulocyte Lysate System, and the TNT® T7 Quick for PCR Coupled Reticulocyte Lysate System by Promega. An E. coli lysate system has also been used (Roche Molecular Biochemicals, Indianapolis, IN). Other coupled transcription/ translation systems are known to those skilled in the art, and are useful with the invention described herein. These other systems are considered to be within the scope of this invention. Without being limited to theory, it is preferred that the coupled transcription/translation system use lysate from mammalian cells or eukaryotic cells so as to insure correct post-translational modification of the bioactive molecule, i.e., RNA processing or protein processing such as glycosylation. In a currently preferred embodiment, the coupled transcription/translation system does not require initial purification of the polymerase chain reaction amplification product, and protein expression can proceed directly from the amplification step. Generally, about 1-500 pMols of the amplified nucleic acid template is sufficient for the translation reaction, yielding approximately 0.1-100 μMols of protein.

Phenotype Assays The bioactive molecules are studied for changes in their phenotype by, for example, changes assessing the bioactivity of a viral polypeptide or a domain thereof, and its effects in a nucleotide incorporation assay in the presence and absence of one or more antiviral agents. One such assay is described in Example 1, and measures the ability of a viral polymerase to catalyze the incorporation of fluorescent-labeled nucleotides into nascent DNA in the presence of a concentration range of an anti-viral agent. Other assays and methods are useful to the present invention, such as assays determining enzyme structure and function, as well as target/ligand binding and dissociation kinetics include radioligand binding assays, protein co-immunoprecipitation, sandwiched ELISA, fluorescence resonance emission tomography (FRET), surface plasmon resonance (SPR), mass spectroscopy including GC-MS, nuclear magnetic resonance including 2-D NMR, and x-ray diffusion crystallography.

Radioligand binding assays can be used to derive and compare equilibrium binding constants (K_D) across concentration ranges of 1 pM to 10,000 μM, and work with concentrations of protein from as little as 10 pMol. The value of K_D for a protein and its ligand is related to the IC₅₀, (or the inhibitor concentration displaying 50% inhibition) and can be considered its general equivalent. The change in drug susceptibility can be calculated by comparing the IC5₀ of the patient sample against the IC₅₀ for the wild-type standard. As little as a 1-5% change in relative affinity between the K_D values of the wild-type and mutant proteins can be detected by radioligand binding assays. Any change in K_D or IC₅₀ is significant, but a 5% to 10% change in relative affinity indicates a clear decrease in clinical efficacy for a therapeutic agent, while a 50% change indicates a substantial decrease in efficacy, and a 100% change indicates effective loss of binding and effective loss for therapeutic potential. SPR systems provide assays for monitoring in real time the binding and dissociation of a ligand and its target. These devices can be used to derive and compare equilibrium binding constants (K_D) across concentration ranges of 0.1 pM to 10,000 μM, and work with concentrations of protein from as little as 1 pMol. The change in drug susceptibility can be calculated by comparing the IC₅₀ of the patient sample against the IC₅o for the wild-type standard. As little as a 1% change in relative affinity between the K_D values of the wild-type and mutant proteins can be detected by SPR. Any change in K_D or IC₅₀ is significant, but a 5% to 10% change in relative affinity indicates a clear decrease in clinical efficacy for a therapeutic agent, while a 50% change indicates a substantial decrease in efficacy, and a 100% change indicates effective loss of binding and effective loss for therapeutic potential. Commercially available SPR systems include the BIAlite and BIAcore devices sold by Biacore AB, the IAsys™ device sold by Affinity Sensors Limited (UK), and the BIOS-1 device sold by Artificial Sensor Instruments (Zurich, Switzerland). Displacement or dissociation of, for example, a ligand or drug molecule from a bioactive molecule affixed to the sensor surfaces of such devices causes a relative decrease in mass, which is readily detectable. SPR works best when the net change in mass is large and thus easy to detect. For example, where the drug is a low molecular weight compound, such as a steroid or a peptide, the analogue may be conjugated to a high molecular weight substance so as to create a higher molecular weight difference between the drug and the bioactive peptide. High molecular weight substances suitable for conjugation include proteins such as ovalbumin or bovine serum albumin (BSA), or other entities such as lipids and the like. It is to be noted that these substances are not conventional labels such as enzymes, radiolabels, fluorescent or chemiluminescent tags, redox labels or coloured particles and the like, but serve merely to create a disparity in molecular weight between the drug and its target. Alternatively, where the therapeutic agent is a peptide, the molecular weight of the peptide may be increased relative to the bioactive molecule, by using the peptide as part of a fusion protein.

Conveniently the peptide may be fused to the N-terminal or, more preferably, the C-terminal of a polypeptide. Methods for the construction of DNA sequences encoding such fusion proteins are well known to those skilled in the art. Mass spectroscopy also provides, for example, a means for determining polypeptide composition, weight, and the presence or absence of candidate binding partners (drugs). Such devices useful for studing the properties of bioactive molecules include, for example, fast atomic bombardment mass spectrometry (see, e.g., Koster et al, Biomedical Environ. Mass Spec. 14:111-116 (1987)); plasma desorption mass spectrometry; electrospray/ionspray (see, e.g., Fenn et α/, J. Phys. Chem. 88:4451-59 (1984), PCT Appln. No. WO 90/14148, Smith et al, Anal. Chem. 62:882-89(1990)); and matrix-assisted laser desorptionlionization (Hillenkamp, et al, "Matrix Assisted UV-LaserDesorption/Ionization:A New Approach to Mass Spectrometry of Large Biomolecules," Biological Mass Spectrometry (Burlingame and McCloskey, eds.), Elsevier Science Publishers, Amsterdam, pp. 49-60, 1990); Huth-Fehre et al, "Matrix Assisted Laser Desorption Mass Spectrometry of Oligodeoxythymidylic Acids," Rapid Communications in Mass Spectrometry, 6:209-13 (1992)).

The assays and methods of the present invention have application in all areas of anti-microbial therapy, such as anti-bacterial therapy, anti-viral therapy and anti-fungal therapy.

Anti-bacterial substances for use in anti-infective chemotherapy comprise β-lactam antibiotics (e.g., penicillins, cephalosporins, carbapenems, and monobactams), glycopeptides (e.g. vancomycin and teichoplanin) aminoglycoside antibiotics (e.g., kanamycin, gentamycin and amikacin) cephem antibiotics (e.g., cefixime, cefaclor), macrolide antibiotics (e.g., erythromycin), tetracycline antibiotics (e.g., tetracycline, minocycline, streptomycin), quinolone antibiotics, lincosamide antibiotics, trimethoprim, sulfonamides, imipenem, isoniazid, rifampin, rifabutin, rifapentine, pyrazinamide, ethambutol, bismuth salts including bismuth acetate, bismuth citrate, and the like, metronidazole, miconazole, kasugamycin, and quinolone compounds such as ofloxacin, lomefloxacin and ciprofloxacin. These compounds are currently preferred anti-bacterial agents, but new compounds are being developed, which are suitable for use with the assays and methods of the present invention.

Anti-fungal compounds used in anti-infective chemotherapy comprise rapamycin or a rapalog, including e.g. amphotericin B or analogs or derivatives thereof (including 14(s)- hydroxyamphotericin B methyl ester, the hydrazide of amphotericin B with l-amino-4- methylpiperazine, and other derivatives) or other polyene macrolide antibiotics, including, e.g., nystatin, candicidin, pimaricin and natamycin; flucytosine; griseofulvin; echinocandins or aureobasidins, induing naturally occurring and semi-synthetic analogs; dihydrobenzo[a]napthacenequinones; nucleoside peptide antifungals including the polyoxins and nikkomycins; allylamines such as naftifine and other squalene epoxidease inhibitors; and azoles, imidazoles and triazoles such as, e.g., clotrimazole, miconazole, ketoconazole, econazole, butoconazole, oxiconazole, terconazole, itraconazole or fluconazole and the like. These compounds are currently preferred anti-fungal agents, but new compounds are being developed, which are suitable for use with the assays and methods of the present invention. For additional conventional anti-fungal agents and new agents under development, see e.g., Turner and Rodriguez, 1996, Recent Advances in the Medicinal Chemistry of Anti-fungal Agents, Current Pharmaceutical Design, 2, 209-224.

Anti-viral agents used in anti-infective chemotherapy that are suitable for use with the present invention comprise lamivudine, pencyclovir, famcyclovir, adefovir, loviride, aphidicolin, tivirapine, entecavir, clevudine, carbovir, cidofovir, foscarnet, gangcyclovir (GCV), zidovudine (AZT), didanosine (ddl), stavudine (d4T), nevirapine (NVP), delavirdine (DLV), efavirenz (EFN), saquinavir (SQV), indinavir (IDV), ritonavir (RTV), nelfinavir (NFV), abacavir (ABC), amprenavir (AMP), alpha-interferon, beta-2',3'-dideoxycytidine (ddC), (±)-2-amino-l,9,dihydro-9-[(l,3,4)-3-hydroxy-4-(hydroxymethyl)cyclopentyl]- 6H-purine-6-one (2'-CDG), 2'-deoxy-3'thiacytidine (3TC), and 2',3'-dideoxy-5-fluoro- 3'-thiacytidine (FTC). These compounds are currently preferred anti-viral agents, but new compounds are being developed, which are suitable for use with the assays and methods of the present invention. Chemotherapeutic agents used in anti-infective chemotherapy that are suitable for use with the present invention comprise uracil mustard, chlormethine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, pipobroman, triethylenemelamine, triethylenethiophosphoramine, busulfan, carmustine, lomustine, streptozocin, dacarbazine, temozolomide, methotrexate, 5-fluorouracil, floxuridine, cytarabine, 6-mercaptopurine, 6- thioguanine, fludarabine phosphate, pentostatine, gemcitabine, vinblastine, vincristine, vindesine, bleomycin, dactinomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, paclitaxel, mithramycin, deoxycoformycin, mitomycin-C, L-asparaginase, interferons, etoposide, teniposide, 17-ethinylestradiol, 17α-ethinylestradiol, 17β-ethinylestradiol, diethylstilbestrol, testosterone, prednisone, fluoxymesterone, dromostanolone propionate, testolactone, megestrolacetate, tamoxifen, methylprednisolone, methyltestosterone, prednisolone, triamcinolone, chlorotrianisene, hydroxyprogesterone, aminoglutethimide, estramustine, medroxyprogesteroneacetate, leuprolide, flutamide, toremifene, goserelin, cisplatin, carboplatin, hydroxyurea, amsacrine, procarbazine, mitotane, mitoxantrone, levamisole, navelbene, CPT-11, anastrazole, letrazole, capecitabine, reloxafine, droloxafine, gemcitabine, paclitaxel, and hexamethylmelamine. These compounds are currently preferred anti-cancer agents, but new compounds are being developed, which are suitable for use with the assays and methods of the present invention. These agents are generally used in the present invention across a concentration range of 0.01-100 times the known IC₅o value of the agent and the bioactive molecule. More or less of the agent can be added, for example, to expand the data points defining the inhibition curve, or to define a broad range or dosages where the IC₅₀ value is unknown. The present invention provides an in vitro assay, and the experimental dosage range can be different from dose ranges when these compounds are administered to humans. For example, in vitro a 100- fold increase in drug dosage may be sufficient to eliminate bioactivity of the target compound, but such an extreme dose change would not be permitted in human administration. Human dosages for these compounds are given in the Physician 's Desk Reference (2001) incoφorated herein by reference, and a physician or one similarly skilled in the art is capable of viewing experimental data and determining clinical suitability or application. As such, the present invention provides for phenotypic assays and methods of predicting and monitoring a patient's chemotherapy regimen for the above drugs, and for evaluating the potential of newly developed drugs to treat the patient's affliction.

The present invention comprises assays and methods capable of generating sufficient quantities of the desired bioactive molecule for phenotypic characterization in a rapid manner, for example, 24 hours, 48 hours, or approximately one week. Through PCR, the target sequence can be amplified in a matter of hours. Using the coupled transcription/translation systems described, protein expression and purification is effectuated in a day. Using the assays described herein, an analysis of the effects of the drug on the functional properties of its target is derived within about 24 to 48 hours. This provides a rapid means of evaluating the drug's potential in chemotherapeutic regimens. Examples of additional bioactive molecules appropriate for the present assays and methods disclosed herein as shown in Table 2. Table 2. Drug Resistance and Bioactive Molecules

The invention is further defined by reference to the following examples, which are not meant to limit the scope of the present invention. It will be apparent to those skilled in the art that many modifications, both to the materials and methods, may be practiced without departing from the puφose and interest of the invention. EXAMPLES

EXAMPLE 1. Bacterial Resistance to Quinolone Compounds

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia and accounts for approximately two-thirds of cases of bacteremic pneumonia. Streptococcus pneumoniae is a Gram-positive, catalase negative coccus, and occurs in pairs or short chains. There are about 85 capsular types. Streptococcal classification methods include hemolytic patterns (beta, alpha or gamma), serologic (Lancefield groups A-H, K-V; for beta-hemolytic strains only), and biochemical properties. Recently, Tettelin and coworkers (Science, 2001 , 293 :498-506) described the complete genotype of a virulent isolate of Streptococcus pneumoniae.

Each year, S. pneumoniae infections cause 100,000-135,000 hospitalizations for pneumonia, 6 million cases of otitis media, and over 60,000 cases of invasive disease, including 3300 cases of meningitis. Death occurs in 14% of hospitalized adults with invasive disease. Neurologic sequelae and/or learning disabilities can occur in meningitis patients, transmission is person to person. Persons at higher risk for infection are the elderly, children under 2 years old, blacks, American Indians and Alaska Natives, children who attend group day care centers, and persons with underlying medical conditions including HIV infection and sickle-cell disease. Most Streptococcus pneumoniae infections used to be cured with beta-lactam antibiotics. However, Emergence of β-lactam resistance in the United States continues. Prevalence of strains resistant to multiple classes of drugs is increasing. Resistance to second stage antibiotics, including quinolones, is a growing concern.

Quinolones, e.g., fluoroquinolones, are broad-spectrum and effective antibiotics for the treatment of bacterial infections. Quinolones are effective, e.g., in the treatment of selected community-acquired and nosocomial infections because they are bactericidal and exhibit concentration-dependent killing. They are usually administered orally, but some can be given intravenously for treatment of serious infections.

The targets of quinolone activity are the bacterial DNA gyrase and topoisomerase IV, enzymes essential for DNA replication and transcription and which alter DNA topology through a transient double-stranded DNA break. DNA gyrase is composed of GyrA and

GyrB subunits, which are encoded by gyrA and gyrB genes, respectively. Topoisomerase IV includes ParC and ParE subunits, which are encoded by parC and parE genes, respectively. Mutations in the quinolone resistance-determining region (QRDR), primarily the gyrA gene or the parC gene, are associated with quinolone resistance. Mutations in the QRDR of gyrB gene or parE gene are also believed to play a role in quinolone resistance, albeit to a lesser extent. DNA gyrase appears to be the primary quinolone target for Gram-negative bacteria, while topoisomerase IV appears to be the preferential target in gram-positive organisms. Mutations in DNA gyrase and/or topoisomerase IV genes are frequently encountered in quinolone-resistant mutants of Streptococcus pneumoniae and Staphylococcus aureus, for example, fluoroquinolone-resistant cultures of Streptococcus pneumoniae isolated from patients who were treated for pneumonia with levofloxacin contained mutations in both parC (DNA topoisomerase IV) and gyrA (DNA gyrase), known to confer fluoroquinolone resistance (see, Urban C, et al, J Infect Dis. 2001 Sep 15;184(6):794-8; Schmitz FJ, et al, Antimicrob Agents Chemother. 2000 Nov;44(l l):3229-31; Ince D, et al, Antimicrob Agents Chemother. 2000 Dec;44(12):3344-50; Pan XS, et al, Antimicrob Agents Chemother. 2001 Nov;45(l 1):3140-7; Richardson DC, et al, Antimicrob Agents Chemother. 2001 Jun;45(6):1911-4; Roychoudhury S, et al, Antimicrob Agents Chemother. 2001 Apr;45(4):l 115-20; and Barnard FM, et al, Antimicrob Agents Chemother. 2001 Jul;45(7): 1994-2000).

Early quinolones, such as nalidixic acid, had poor biodistribution and had limited activity. Early quinolones were used primarily for Gram-negative urinary tract infections. The next generation of quinolones, the fluoroquinolones (i.e., ciprofloxacin, ofloxacin, norfloxacin, lomefloxacin, and enoxacin), were more readily absorbed and displayed better activity against Gram-negative bacteria. Newer fluoroquinolones (i.e., levofloxacin, sparfloxacin, trovafloxacin, and grepafloxacin) are broad-spectrum agents with enhanced activity against many Gram-negative and gram-positive organisms. In the United States, nine fluoroquinolones are approved for human use. Norfloxacin was the first fluoroquinolone approved for human use (1986), followed by ciprofloxacin (1987), ofloxacin (1990), enoxacin (1991), lomefloxacin (1992), levofloxacin (1996), trovafloxacin (1997), gatifloxacin (1999), and moxifloxacin (1999). There are many fluoroquinolones on the market for several reasons. As a class, the newer fluoroquinolones possess many characteristics that make them useful antibiotics including: broad spectrum activity against Gram-negative and gram-positive organisms, good oral absoφtion and tissue penetration, relatively long half-lives that allow lower daily dosing, predictable drug interactions, and a relatively low incidence of serious side effects. However, not all fluoroquinolones show all of these characteristics. In addition, some fluoroquinolones continue to be expensive alternatives to other regimens.

Antibiotic resistance limits drug selection for treatment of many infections. Organisms that are resistant to quinolones often are resistant to other classes of antibiotics. Quinolones are frequently prescribed before lab test results are known. Prompt reporting of resistance reduces the risk of complications of illnesses caused by inadvertently treating resistant organisms with ineffective agents. Reporting susceptibilities to various quinolones provides the information necessary to choose an appropriate therapy that will minimize the selection of mutations leading to resistance. Resistance to quinolones has been reported in a variety of important bacterial pathogens, including Escherichia coli, Klebsiella pneumoniae, and other enteric organisms; Pseudomonas aeruginosa; Chlamydia trachomatis and Mycoplasma pneumoniae; Campylobacter jejuni; Burkholderia cepacia; Stenotrophomonas maltophilia; Neisseria gonorrhoeae; Staphylococcus aureus (especially oxacillin-resistant strains); Enterococcus faecium; and Streptococcus pneumoniae. In 2001, Weigal and coworkers described some of the complexities of Streptococcus pneumoniae resistance to quinolones (Antimicrob Agents Chemother 2001 Dec;45(12):3517-23).

Resistance to quinolones occurs through genetic mutations encoding these enzymes, and by porin and efflux mutations. The enzyme mutations alter the target region where the drug binds to the enzyme; the drug exhibits reduced affinity for the target and becomes ineffective. Mutations that result in alterations of the outer membrane porin proteins of Gram- negative organisms lead to decreased permeability of the drug through the outer membrane so less drug reaches the target enzyme. Mutations that enhance the organism's efflux capability increase the amount of drug pumped out of the cell. The enzyme target site, porin, and efflux mutations may result from the selective pressure of exposure of the organism to antimicrobial agents during therapy and may cause treatment failure.

There are different levels of fluoroquinolone resistance. The number and type of mutations affecting critical sites determine the level of resistance. Organisms may have alterations in more than one enzyme target site and, in Gram-negative organisms, may contain more than one porin change. Many resistant organisms have multiple enzyme target site, porin, and efflux mutations, producing high-level resistance to quinolones. In contrast, organisms with decreased susceptibility produced only by porin changes usually have lower minimum inhibitory concentrations (MICs). An isolate can be resistant to one quinolone and susceptible to another. The fluoroquinolone susceptibility profile for each clinical isolate is determined by the number and location of mutational changes in specific enzyme target sites, porin proteins, and efflux mechanisms. The effect of each mutation in an isolate is not equivalent for all fluoroquinolones, due to variations of the chemical structures among this class of agents. So an organism with one or more mutations may have resistant to one quinolone but have intermediate or be susceptible sizes to another quinolone.

AMPLIFICATION OF DNA GYRASE GENES

Fluroquinolone resistant Streptococcus pneumoniae was isolated from lung cultures of patients diagnosed with bronchial pneumonia. The bacterial nucleic acid was extracted from the samples by alkaline lysis. Primers for PCR designed to amplify DNA gyrase and the amplification conditions generally set forth in Pan et al, and Barnard et al, supra, and as detailed below.

Briefly, genomic DNA was extracted from S. pneumoniae patient isolates with the DNeasy Tissue Kit (Qiagen, Valencia, CA). Polymerase chain reaction (PCR) methods were used to amplify wild-type DNA gyrase, and mutant DNA gyrase sequences containing mutations associated with drug resistance. Two sets of primers were prepared: one for the coupled reticulocyte lysate system, and a second set for the E. coli lysate expression system. For the coupled reticulocyte lysate system, the gyrA PCR used primers SG3 (SEQ ID NO:l) and SG4 (SEQ ID NO:2), For the coupled reticulocyte lysate system, the gyrB PCR utilized primers GB8 (SEQ ID NO:3) and GB3 (SEQ ID NO:4). The amplifications produced a 2.54- kilobase gyrA template, and a 2.02-kilobase gyrB DNA template. Both templates contained a T7 RNA polymerase promoter sequence for transcribing the DNA templates, a Kozak consensus sequence for efficiently translating the RNA, and a specific S. pneumoniae DNA gyrase sequence from the patient isolates.

For the E. coli lysate expression system, the gyrA PCR primers were GA1 (SEQ ID NO:5) and SG2 (SEQ ID NO:6), and the gyrB PCR primers were GB7 (SEQ ID NO:7) and GB3 (SEQ ID NO:8). The resulting PCR-generated 2.55-kb gyrA and 2.03-kb gyrB DNA templates contained a lacUV5 or tac supercoiling-sensitive promoter sequence for transcription of the DNA templates, a ribosomal binding site (RBS) located upstream of the AUG start codon, and a specific S. pneumoniae DNA gyrase sequence from the patient isolates. The reaction mixture in a 50 ul volume for both PCR steps contained 10 mM Tris- HC1, PH 8.3, 50 mM KC1, 1.5 mM MgCl₂, 0.2 mM of each dNTP, 20 pM of each primer, and 1.25 units of Taq DNA polymerase (Perkin Elmer). PCR conditions for both gyrA and gyrB were 94°C for 5 min and then 40 cycles of 94°C for 30 sec, 55°C for 1 min, 72°C for 3 min 30 sec, followed by a final 5 min of incubation at 72°C.

EXPRESSION OF DNA GYRASE PROTEIN

In the present Example, the PCR-generated DNA templates were directly transcribed and translated in vitro into S. pneumoniae GyrA and GyrB proteins. DNA templates produced using SEQ ID NO:l through 4 were expressed in a coupled reticulocyte lysate system, TNT T7 Quick for PCR DNA (Promega, Madison, WI). DNA templates produced using SEQ ID NO:5 through 8 were expressed in a coupled E. coli lysate system, E. coli S30 Extract System for Linear Templates (Promega, Madison, WI). A 100 kDa protein, corresponding to the DNA gyrase A protein, was produced from this eukaryotic expression system. The protein was purified according to the method of Brown PO, et al, Proc Natl AcadSci USA 1979 Dec;76(12):6110-9. The size and integrity of the protein was confirmed by Western Blot. In another embodiment, similar methods are used to detect mutant DNA gyrase B subunit of Streptococcus pneumonia (Munoz et al, J Bacteriol 1995 Jul;177(14):4166-70). In another embodiment, similar methods are used to detect mutations in the parC and parE genes of Streptococcus pneumoniae DNA topoisomerase IV as well as to evaluate the effect of quinolones on the activity of the expressed proteins (Pan et al, J Bacteriol 1996 Jul; 178(14): 4060-9). In another embodiment, Streptococcus pneumoniae gyrA and gyrB genes are cloned into pET plasm id vectors using an inducible T7 promoter, in order to express the subunits separately in E. coli. Soluble 97-kiloDalton GyrA and 72-kilodalton GyrB proteins having polyhistidine tags at their respective C-terminal and N-terminal ends are purified by nickel chelate column chromatography, and with undectable host E. coli topoisomerase activity. Equimolar amounts of the gyrase subunits reconstituted ATP-dependent DNA supercoiling with comparable activity to gyrase of E. coli and Staphylococcus aureus. S. pneumoniae topoisomerase IV ParC and ParE subunits are similarly expressed in E. coli, purified as 93- and 73-kiloDalton proteins, and cause ATP-dependent DNA relaxation and DNA decatenation activities (Pan et al, Antimicrob Agents Chemother 1999 May; 43(5): 1129-36). In another embodiment, topoisomerase IV and DNA gyrase are purified from

Streptococcus pneumoniae and tested the purified enzymes with quinolones (Morrissey et al, J Antimicrob Chemother 2000 Apr;45 Suppl 1:101-6; Morrissey et al, Antimicrob Agents Chemother 1999 Nov;43(l l):2579-85). In yet another embodiment, mutations in the quinolone resistance determining region (QRDR), within gyrA and parC are detected by the methods of the present invention. Based on the Escherichia coli co-ordinates, the hotspots result in decreased susceptibility to quinolones are at serine 83 and aspartate 87 of gyrA, and at serine 79 and aspartate 83 for parC (Piddock, Drugs 1999;58 Suppl 2: 11-8). In yet another embodiment, the methods of the present invention are used to detect the amino acid substitutions in ParC conferring low-level resistance included Phe, Tyr, and Ala for Ser-79; Asn, Ala, Gly, Tyr, and Val for Asp-83; Asn for Asp-78; and Pro for Ala-115. Isolates with intermediate and high resistance included substitutions of Phe and Tyr for Ser-79 or Asn and Ala for Asp-83 in ParC and an additional substitution in GyrA which included either Glu-85- Lys (Gly) or Ser-81-Phe (Tyr). Glu-85-Lys was found exclusively in isolates with high resistance (Bast et al., Antimicrob Agents Chemother 2000 Nov;44(l l):3049-54). In yet another embodiment of the method of the present invention, DNA gyrase and topoisomerase enzyme subunits are cloned into bacteria, the subunits combined to form active enzyme, and measuring the inhibitory effect of quinolones on the active enzymes. Fernandez-Moreira et al., Microb Drug Resist 2000 Winter;6(4):259-67). In yet another embodiment, parC (Ser- 79— >Tyr) and gyrA (Ser-81~>Phe or Tyr) mutations, especially in combination, are detected by the methods of the present invention (Jones et al, Antimicrob Agents Chemother 2000 Feb;44(2):462-6). In yet another embosiment, bacterial gyrase gyrA and topoisomerase IV parC mutants encoding respective Ser81Phe and Ser79Phe mutations are detected by the methods of the present invention (Pan et al, Antimicrob Agents Chemother 2001 Nov;45(l l):3140-7).

FUNCTIONAL ASSA Y FOR DNA GYRASE PROTEIN

The functional activity of the purified mutant DNA gyrase A protein obtained from the fluoroquinolone resistant Streptococcus pneumoniae was compared to wild-type DNA gyrase A protein in supercoiling inhibition assays and DNA cleavage assays by the genaral methods of Pan et al, and Barnard et al, supra, and as detailed below.

A protein in supercoiling inhibition assays and DNA cleavage assays using a commercially available kit (TopoGEN, Columbus, OH). DNA gyrase activity was measured by first combining 20μL deionized water, 2μL 10X reaction buffer (IX = 35mM Tris HC1, pH 7.5, 24mM KC1, 4 mM MgCl₂, 1.4 mM ATP, 5 mM dithiotheitol, 1.8 mM spermadine, 1 mM EDTA), 0.1-0.2μg kinetoplast DNA (KDNA) and l-4μL of sample. These test mixtures were incubated for 10-60 minutes at 37°C. At the end of the incubation period, DNA gyrase activity was terminated by adding lOμL stop buffer/gel load buffer (0.5M EDTA, bromophenol blue in 50% glycerol), and 25-50 μg/mL proteinase K to the mixtures and incubating for the mixtures for 15 minutes at 56°C. Test samples were then extracted with 20μL chloroform :isoamyl alcohol (24: 1 ratio), briefly vortex, and centrifuge for a minute. KDNA markers and 20μL of the aqueous phase (blue) from each of the centrifuged test samples was transferred to the appropriate sample well of a 1% agarose gel and electrophorese at 50-150 volts until the dye front traveled about 6 cm. DNA bands were visualized by standard DNA visualization technique know in the art. Approximately five DNA bands were resolved in the test samples. Catenated KDNA appeared closest to the origin, followed by decatenated KDNA (open circular DNA), linear DNA, decatenated KDNA (supercoiled DNA) and decatenated KDNA (Relaxed DNA). Gyrase activity produced a clear increase in decatenated KDNA products that are supercoiled or open circular DNA. Band intensities were measured with a densitometer, and the relative gyrase activity in test samples was and compared.

The activities of the expressed DNA gyrases (wild type, and both types of mutants), were evaluated in the presence of, e.g., moxifloxacin and gatifloxacin. Moxifloxacin was added to the TopoGEN assay in the final concentration of 0, 150, 200, 250, 300, 350, 400, 450 and 500 ug/ml respectively. Gatifloxacin was added to the TopoGEN assay in the final concentration of 0, 150, 200, 250, 300, 400, 500, 600, 700 and 800 ug/ml respectively.

To determine the drug inhibition profiles of mutant DNA gyrase containing mutations associated with drug resistance, drug inhibition of the mutant DNA gyrase was tested in parallel with wild-type DNA gyrase. As displayed in Figure 2 and Figure 3, the same IC₅o for wild-type DNA gyrase had only minimal inhibition effect on mutant DNA gyrase.

INTERPRETA TION OF PHENOTYPE: DRUG SUSCEPTIBILITY

The significance of different drug inhibition profiles between wild-type DNA gyrase and mutant DNA gyrase, as measured by the IC₅₀S of fluoroquinolones, was used to determine the phenotypic drug resistance. The fold change in drug susceptibility or fold resistance value can be calculated by dividing the IC₅₀ for a patient or unknown DNA gyrase by the IC₅0 for the wild-type DNA gyrase. In Figure 2 and Figure 3, the mutant DNA gyrase proteins displayed a two-fold increase in IC₅₀ comparing to wild-type DNA gyrase. This corresponds to a drug resistant phenotype in mutants. EXAMPLE 2. Human Immunodeficiency Virus (HIV)

Acquired immune deficiency syndrome (AIDS) is a fatal human disease, generally considered to be one of the more serious diseases to ever affect humankind. Globally, the numbers of human immunodeficiency virus (HIV) infected individuals and of AIDS cases increase relentlessly and efforts to curb the course of the pandemic, some believe, are of limited effectiveness. Two types of HIV are now recognized: HIV-1 and HIV-2. By December 31, 1994, a total of 1,025,073 AIDS cases had been reported to the World Health Organization. This is only a portion of the total cases, and WHO estimates that as of late 1994, allowing for under diagnosis, underreporting and delays in reporting, and based on the estimated number of HIV infections, there have been over 4.5 million cumulative AIDS cases worldwide (Mertens et al, (1995) AIDS 9 (Suppl A), S259-S272). Since HIV began its spread in North America, Europe and sub-Saharan Africa, over 19.5 million men, women and children are estimated to have been infected. One of the distinguishing features of the AIDS pandemic has been its global spread within the last 20 years, with about 190 countries reporting AIDS cases today. The projections of HIV infection worldwide by the WHO are staggering. The projected cumulative total of adult AIDS cases by the year 2000 is nearly 10 million. By the year 2000, the cumulative number of HIV-related deaths in adults is predicted to rise to more than 8 million from the current total of around 3 million. HIV-1 and HIV-2 are enveloped retroviruses with a diploid genome having two identical RNA molecules. The molecular organization of HIV is (5') U3-R-U5-gag-pol-env-U3-R-U5 (3'). The U3, R, and U5 sequences form the long terminal repeats (LTR) which are the regulatory elements that promote the expression of the viral genes and sometimes nearby cellular genes in infected hosts. The internal regions of the viral RNA code for the structural proteins: gag (p55, pi 7, p24 and p7 core proteins), pol (plO protease, p66 and p51 reverse transcriptase and p32 integrase) and env (gpl20 and gp41 envelope glycoproteins) Gag codes for a polyprotein precursor that is cleaved by a viral protease into three or four structural proteins; pol codes for reverse transcriptase (RT) and the viral protease and integrase; env codes for the transmembrane and outer glycoprotein of the virus. The gag and pol genes are expressed as a genomic RNA, while the env gene is expressed as a spliced subgenomic RNA. In addition to the env gene, there are other HIV genes produced by spliced subgenomic RNAs that contribute to the replication and biologic activities of the virus. These genes include: tat which encodes a protein that activates the expression of viral and some cellular genes; rev which encodes a protein that promotes the expression of unspliced or single-spliced viral mRNAs; nef which encodes a myristylated protein that appears to modulate viral production under certain conditions; vz/which encodes a protein that affects the ability of virus particles to infect target cells but does not appear to affect viral expression or transmission by cell-to-cell contact; vpr which encodes a virion- associated protein; and vpu which encodes a protein that appears to promote the extracellular release of viral particles.

No disease better exemplifies the problem of viral drug resistance than AIDS. Drug resistant HIV isolates have been identified for nucleoside and non-nucleoside reverse transcriptase inhibitors and for protease inhibitors. The emergence of HIV isolates resistant to AZT is not suφrising since AZT and other reverse transcriptase inhibitors only reduce virus replication by about 90%. High rates of virus replication in the presence of the selective pressure of drug treatment provide ideal conditions for the emergence of drug-resistant mutants. Patients at later stages of infection who have higher levels of virus replication develop resistant virus with AZT treatment more quickly than those at early stages of infection (Richman et al, (1990) JAIDS 3, 743-6). The initial description of the emergence of resistance to AZT identified progressive and stepwise reductions in drug susceptibility (Larder et al, (1989) Science 243, 1731-1734). This was explained by the recognition of multiple mutations in the gene for reverse transcriptase that contributed to reduced susceptibility (Larder et al, (1989) Science 246, 1155- 1158). These mutations had an additive or even synergistic contribution to the phenotype of reduced susceptibility (Kellam et al, (1992) Proc. Natl. Acad. Sci. 89, 1934-1938). The cumulative acquisition of such mutations resulted in progressive decreases in susceptibility. Similar effects have been seen with non-nucleoside reverse transcriptase inhibitors (Nunberg et al, (1991) J Virol 65, 4887-4892; Sardanna et al, (1992) JBiol Chem 267, 17526-17530). Studies of protease inhibitors have found that the selection of HIV strains with reduced drug susceptibility occurs within weeks (Ho et al, (1994) J Virol 68, 2016-2020; Kaplan et al, (1994) Proc. Natl. Acad. Sci. 91, 5597-5601). While recent studies have shown protease inhibitors to be more powerful than reverse transcriptase inhibitors, nevertheless resistance has developed (Condra et al, Id. and Report 3rd Conference on Retroviruses and Opportunistic Infections, March 1996). Subtherapeutic drug levels, whether caused by reduced dosing, drug interactions, malabsoφtion or reduced bioavailability due to other factors, or self-imposed drug holidays, all permit increased viral replication and increased opportunity for mutation and resistance. The selective pressure of drug treatment permits the outgrowth of preexisting mutants. With continuing viral replication in the absence of completely suppressive anti-viral drug activity, the cumulative acquisition of multiple mutations can occur over time, as has been described for AZT and protease inhibitors of HIV. Indeed viral mutants multiply resistant to different drugs have been observed (Larder et al, (1989) Science 243, 1731-1734; Larder et al, (1989) Science 246, 1155-1158; Condra et al, (1995) Nature 374, 569-71). With the inevitable emergence of resistance in many viral infections, as with HIV for example, strategies must be designed to optimize treatment in the face of resistant virus populations. Ascertaining the contribution of drug resistance to drug failure is a difficult problem because patients who are more likely to develop drug resistance are more likely to have other confounding factors that will predispose them to a poor prognosis (Richman (1994) AIDS Res Hum Retroviruses 10, 901-905). In addition, patients contain mixtures of viruses with different susceptibilities.

In the present Example, HIV reverse transcriptase (RT) genetic information (RNA) was extracted and amplified via RT-PCR and nested PCR. A transcription promoter (T7) and a translation initiation sequence (Kozak) was introduced by specially designed PCR primers.

The amplified RT sequence was expressed for RT protein in an in vitro system (Promega).

The expressed RT showed strong activity and when inhibitors (nevirapine and delavirdine) were introduced in the detection system, its activity was effectively inhibited as expected in our initial design. Using this method of the present invention, HIV positive patients with different genotypes and the drug inhibition results matched well with their respective genotypes.

ISOLA TIONAND AMPLIFICA TION OF THE HIV PROTEINS A phenotypic assay for assessment of drug susceptibility of HIV Type 1 isolates to reverse transcriptase (RT) inhibitors has been developed. This method provides the physician with information as to whether to continue with the existing chemotherapeutic regimen or to alter the therapy. Viral load monitoring is becoming a routine aspect of HIV care. However, viral load number alone cannot be used as a basis for deciding which drugs to use alone or in combination. Combination therapy is becoming increasingly the chemotherapeutic regimen of choice. When a person using a combination of drugs begins to experience drug failure, it is impossible to know with certainty, which of the drugs in the combination is no longer active. One cannot simply replace all of the drugs, because of the limited number of drugs currently available. Furthermore, if one replaces an entire chemotherapeutic regimen, one may discard one or more drugs that are active for that particular patient. Also, it is possible for viruses that display resistance to a particular inhibitor to also display varying degrees of cross-resistance to other inhibitors. Ideally, therefore, every time a person has a viral load test and a viral load increase is detected, the drug sensitivity/resistance assay of the present invention should also be carried out. Until effective curative therapy is developed, management of HIV disease will require such testing.

The sequence of HIV-1 (isolate HXB2, reference genome, 9718 bp) was obtained from the National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health via the ENTREZ Document Retrieval System (Genbank name: HIVHXB2CG, Genbank Accesion No: 0/3455< NCBI Seq.ID No: 327742. Primer sets are developed, which are designed to amplify the gene of interest. In the case where the sequence to be reverse transcribed is that coding for reverse transcriptase or reverse transcriptase and protease, the downstream primer is preferably a combination of OUT 3

(downstream) and RVP 5 (upstream), the OUT 3 primer comprising 5 '-CAT TGC TCT CCA ATT ACT GTG ATA TTT CTC ATG-3' (SEQ ID NO: 10) and RVP 5 comprising sequence 5'-GGG AAG ATC TGG CCT CCT ACA AGG G-3' (SEQ ID NO:30) using the PCR conditions as described in Maschera, B., et al. Journal of Virology, 69, 5431-5436. The desired sequence from the pol and RT genes are isolated from a sample of a biological material obtained from the patient whose phenotypic drug sensitivity is being determined. A wide variety of biological materials can be used for the isolation of the desired sequence. The biological material can be selected from plasma, serum or a cell-free body fluid selected from semen and vaginal fluid. Plasma is particularly preferred and is particularly advantageous. When a biological material such as plasma is used in the isolation of the desired sequence, a minimal volume of plasma can be used, typically about 50-500 μl, more particularly of the order of 200 μl. Alternatively, the biological material can be whole blood to which an RNA stabilizer has been added. In a still further embodiment, the biological material can be a solid tissue material selected from brain tissue or lymph nodal tissue, or other tissue obtained by biopsy. Viral RNA is conveniently isolated in accordance with the invention by methods known per se, for example the method of Boom, R. et al, Journal of Clinical Microbiology, 28:3, 495-503 (1990); in the case of plasma, serum and cell-free body fluids, one can also use the QIAamp viral RNA kit marketed by the Qiagen group of companies.

Reverse transcription can be carried out with a commercial kit such as the GeneAmp Reverse Transcriptase Kit marketed by Perkin Elmer. The desired region of the patient pol gene is preferably reverse transcribed using a specific downstream primer. In a particularly preferred embodiment a patient's HIV RT gene and HIV protease gene are reverse transcribed using the HIV-1 specific OUT 3 primer and a genetically engineered reverse transcriptase lacking RNase H activity, such that the total RNA to be transcribed is converted to cDNA without being degraded. Such a genetically engineered reverse transcriptase, the Expand™ reverse transcriptase, can be obtained from Boehringer Mannheim GmbH. Expand reverse transcriptase is a RNA directed DNA polymerase. The enzyme is a genetically engineered version of the Moloney Murine Leukemia Virus reverse transcriptase (M-MuLV-RT). Point mutation within the RNase H sequence reduces the RNase H activity to below the detectable level. Using this genetically engineered reverse transcriptase enables one to obtain higher amounts of full length cDNA transcripts. Following reverse transcription the transcribed DNA is amplified using the technique of PCR, and preferably the product of reverse transcription is amplified using a nested PCR technique. Preferably, in the case where the region of interest is the RT region, a nested PCR technique is used using inner and outer primers as described by Kellam, P. and Larder, B. A., Antimicrobial Agents and Chemotherapy, 38:1, 23-30 (1994).

HIV Viral RNA's were isolated from Wild-Type HB2 Master Seed and HIV positive patens using Qiagen (Valencia, CA) QIAmp Viral RNA Extraction kit (Cat. No. 52904). Nested PCR was performed to amplify a specific region of the genome that codes for the reverse transcriptase (RT) enzyme. First step polymerase chain reaction (PCR) was performed using primers SU Sensel (SEQ ID NO:9) and SU_Antil (SEQ ID NO:10). Second step nested PCR was performed using primers HIV_Sense5 (SEQ ID NO:l 1) and SU_Anti3 (SEQ ID NO: 12). The reaction mixture in a 50 μl volume for first step PCR contains 2X Reaction Mix (0.4 nM dNTP, 2.4 nM MgSO₄), RT/Platinum Taq Mix, 10 pM/μl of each primer, and RNAsin (40 U/μl). Second step PCR reaction mixture, also in a 50 μl volume, contains 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl₂, 0.2 mM of each dNTP, 10 pM/μl of each primer, and 1.25 units of Taq DNA polymerase (Perkin-Elmer, Boston, MA). PCR was performed in a GeneAmp PCR System 9700 (GeneAmp is a registered trademark of Applied Biosystems, Foster City, CA) with the set condition for the first step at 50°C for 30 minutes, 94°C for 2 minutes, 25 cycles of 94°C for 30 seconds, 55°C for 45 seconds, 72°C for 3 minutes, follow by a final 5 minutes hold at 72°C. For the second step PCR, the same parameters applies with the exception of a 30 cycles reaction instead of 25 cycles. The resulting 1856 bp (1.86-kb) PCR-generated DNA templates contain a T7 RNA polymerase promoter sequence for initiating transcription, a Kozak consensus sequence for translation of mRNA, and a specific HIV RT complementary binding sequence for HIV-1 virus.

EXPRESSION OF THE HIV PROTEINS The PCR-generated DNA templates were directly transcribed and translated in vitro into HIV reverse transcriptase using a coupled reticulocyte lysate system, TNT T7 Quick for PCR DNA (Promega, Madison, WI). A 60 kilodalton protein, corresponding to the full-length HIV reverse transcriptase, was observed through Western blot containing an incoφorated biotinylated lysine from the eukaryotic expression system.

FUNCTIONAL ASSA Y FOR THE HIV PROTEINS

A sensitive Reverse Transcriptase Assay (Roche Molecular Biochemicals, Indianapolis, IN) was used to determine reverse transcriptase activity in the expressed HIV RT proteins. As shown in Figure 5, functional HIV reverse transcriptase activity was demonstrated for HIV Wild-Type HB2.

Drug inhibition of the expressed HIV RT

To investigate drug inhibition effects on the reverse transcriptase activity, Nevirapine and Delavirdine were tested over different concentration ranges (40 pM to 80 μM) using the Reverse Transcriptase Assay. In the presence of the drugs, reverse transcriptase demonstrated a significant drop in OD readings, which directly correlates with the enzymatic inhibition of RT activities, as shown in Figure 5 and Figure 6.

INTERPRETA TION OF PHENOTYPE: DR UG SUSCEPTIBILITY

The relative difference in IC50 value between the patient derived protein and the wild- type protein indicates a potential difference in the effectiveness of the anti-viral agent. For example, in the presence of nevirapine or delavirdine, it demonstrated that reverse transcriptase activities was inhibited at different concentration levels. An inverse trend was observed, as drug concentrations increased RT activities significantly decreased. The 50% inhibition concentration (IC₅o) of the drugs were determined and compared to wild type HIV virus in Figure 5 and Figure 6.

EXAMPLE 3. Hepatitis C Virus (HCV)

Hepatitis C virus (HCV) infection occurs throughout the world and, prior to its identification, represented the major cause of transfusion-associated hepatitis. The seroprevalence of anti-HCV in blood donors from around the world has been shown to vary between 0.02% and 1.23%. HCV is also a common cause of hepatitis in individuals exposed to blood products. There have been an estimated 150,000 new cases of HCV infection each year in the United States alone during the past decade (Alter 1993, Infect. Agents Dis. 2, 155-166; Houghton 1996, in Fields Virology, 3rd Edition, pp. 1035-1058).

The hepatitis C virus (HCV) is a member of the flaviviridae family of viruses, which are positive stranded, non-segmented, RNA viruses with a lipid envelope. Other members of the family are the pestiviruses (e.g., bovine viral diarrheal virus, or BVDV, and classical swine fever virus, or CSFV), and flaviviruses (e.g., yellow fever virus and Dengue virus). See Rice, 1996 in Fields Virology, 3rd Edition, pp. 931-959. Molecular dissection of HCV replication and hence understanding the functions of its encoded proteins, while greatly advanced by the isolation of the virus and sequencing of the viral genome, has been hampered by the lack of an efficient cell culture system for production of native or recombinant HCV from molecular clones. However, low-level replication has been observed in several cell lines infected with virus from HCV-infected humans or chimpanzees, or transfected with RNA derived from cDNA clones of HCV. HCV replicates in infected cells in the cytoplasm, in close association with the endoplasmic reticulum. Incoming positive sense RNA is released and translation is initiated via an internal initiation mechanism (Wang et al, 1993, J. Virol. 67, 3338-3344; Tsukiyama-Kohara et al, 1992, J. Virol. 66, 1476-1483). Internal initiation is directed by a cis-acting RNA element at the 5' end of the genome; some reports have suggested that full activity of this internal ribosome entry site, or IRES, is seen with the first 700 nucleotides, which spans the 5' untranslated region (UTR) and the first 123 amino acids of the open reading frame (ORF) (Lu and Wimmer, PNAS 93, 1412, 1996). All of the protein products of HCV are produced by proteolytic cleavage of a large (3010-3030 amino acids, depending on the isolate) polyprotein, carried out by one of three proteases: the host signal peptidase, the viral self-cleaving metalloproteinase, NS2, or the viral serine protease NS3/4A. The combined action of these enzymes produces the structural proteins (C, El and E2) and non-structural (NS2, NS3, NS4A, NS4B, NS5A, and NS5B) proteins which are required for replication and packaging of viral genomic RNA. NS5B is the viral RNA-dependent RNA polymerase (RDRP) that is responsible for the conversion of the input genomic RNA into a negative stranded copy (complimentary RNA, or cRNA); the cRNA then serves as a template for transcription by NS5B of more positive sense genomic/messenger RNA. Several institutions and laboratories are attempting to identify and develop anti-HCV drugs. Currently, the only effective therapy against HCV is alpha-interferon, which can control the amount of virus in the liver and blood (viral load) in only a small proportion of infected patients (Houghton 1996, in Fields Virology, 3rd Edition, pp. 1035-1058). However, given the availability of the molecular structure of the HCV serine protease, NS3/4A (Love et al, 1996, Cell 87, 331-342; Kim et al, 1996, Cell 87, 343-355), and success using protease inhibitors in the treatment of HIV-1 infection, there should soon be alternatives available. In addition to HCV protease inhibitors, other inhibitors that might specifically interfere with HCV replication could target virus specific activities such as internal initiation directed by the IRES, RDRP activity encoded by NS5B, or RNA helicase activity encoded by NS3. As a result of a high error rate of their RDRPs, RNA viruses are particularly able to adapt to many new growth conditions. Most polymerases in this class have an estimated error rate of 1 in 10,000 nucleotides copied. With a genome size of approximately 9.5 kb, at least one nucleotide position in the genome of HCV is likely to sustain a mutation every time the genome is copied. It is therefore likely for drug resistance to develop during chronic exposure to an anti-viral agent. As in the case of HIV, a rapid and convenient assay for drug resistant HCV would greatly improve the likelihood of successful antiviral therapy, given a selection of drugs and non-overlapping patterns of drug resistant genotypes. Resistance-associated mutations can sometimes be identified rapidly by growing the virus in cell culture in the presence of the drug, an approach used with considerable success for HIV-1. To date, however, a convenient cell culture system for HCV is lacking. Therefore, it is not possible to determine the precise nature of genetic changes that confer drug resistance in vitro. Thus, in the absence of a list of known resistance-associated mutations, the preferred resistance assay is one that relies on a phenotypic readout rather than a genotypic one. The HCV genome encodes a single polyprotein of 3033 amino acids (9416 bp); cleavage of the polyprotein results in mature, non-structural proteins NS1, NS2a, NS2b, NS3, NS4a, NS4b, and NS5, where NS5 refers to the RNA-dependent RNA polymerase (RdRp). Also, HCV5B refers to the RNA-dependent RNA polymerase (RdRp). Popular targets for anti-HCV therapy include the host signal peptidase, the viral self-cleaving metalloproteinase, NS2, or the viral serine protease NS3/4A. The combined action of these enzymes produces the structural proteins (C, El and E2) and non-structural (NS2, NS3, NS4A, NS4B, NS5A, and NS5B) proteins which are required for replication and packaging of viral genomic RNA. NS5B is the viral RNA-dependent RNA polymerase (RDRP) that is responsible for the conversion of the input genomic RNA into a negative stranded copy. The RNA polymerase, a 65 KDa non-structural protein, catalyzes the initial formation of a (-) RNA strand from the (+) stranded RNA template, and the subsequent generation of progeny (+) strand RNA.

According to the methods of the present invention, the HCV bioactive molecule NS5B is amplifed in vitro and expressed in vitro. The NS5B protein encoded by the amplified nucleic acid sequence is a functioning RNA-dependent RNA polymerase (RdRp), that can be assayed for polymerase activity in the presence and absence of compounds either known to inhibit polymerase activity or compounds under discovery for such properties. Resistance phenotypes are detected by measuring a change in the RNA-dependent RNA polymerase activity of the patient derived recombinant NS5B protein in the presence and absence of the inhibitory compound.

AMPLIFICA TION OF THE HCVNS5B GENE

Patient blood samples yielded patient derived hepatitis C virus. The sequence of wild-type HCV, isolate: JPUT971017, reference genome hepatitis C virus, 1773 bp) was obtained from the National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health via the ENTREZ Document Retrieval System (Genbank Accession No: 9757541 (see also, Murakami,K., et al, Arch. Virol. 146 (4), 729- 741 (2001) and Kato N, et al, Proc. Natl. Acad. Sci USA, 87:9524 (1990), hereby incoφorated by reference. Primer sets are developed, designed to amplify the NS5B RNA- dependent RNA polymerase gene, encoded at bases 7668 to 9440. Examples of such primer sets and PCR amplification conditions for the NS5B gene are given in Ding J, et al, Chin MedJ (Engl) Feb;l 11(2):128-31 (1998) and Holland PV et al, J Clin Microbiol, Oct;34(10):2372-8(1996) hereby incoφorated by reference.

In one embodiment, the first-step PCR used primers were 5 '-GAG TCG TTC GAT GTC CTA CAC ATG GAC-3' (for amplifying from the 5' end; SEQ ID NO: 13) and 5'-GAT GTA GTC ACC GGT TGG GGA GCA GGT AGA T-3' (for amplifying the 3' end; SEQ ID NO: 14). Such sequences for the amplification of the HCV RNA-dependent RNA polymerase within the primers are based on conserved areas, and the product covers the entire polymerase product (NS5b) as published, starting with the first amino acid serine after the primer-provided ATG codon, and ending with the stop codon. The PCR product can include, e.g., the following components in the 5 'PCR primer for in vitro expression in the reticulocyte lysate:

N(6,10)-T7 Promoter-N(2,6)- Kozak-AUG-N( 17,22) (SEQ ID NO:15); wherein N(6,10) is 6 to 10 nucleotides; N(2,6) is 2 to 6 nucleotides; and N( 17,22) is 17 to 22 nucleotides. For T7 promoter, there is a choice of primers, e.g., as follows:

New T7 (1) 5'-GTAATACGACTCACTATAGGGC-3' (SEQ ID NO:31)

Old T7 (1) 5'-TAATACGACTCACTATAGG-3' (SEQ ID NO:32)

A consensus sequence for initiation of translation in vertebrates (also c...»ed Kozak sequence), e.g., is: 5'- (GCC)_n GCCRCCATGG-3' (SEQ ID NO:33); wherein "n" is 1 to 3 and R is a purine (A or G). (Kozak, Nucleic Acids Res., 1987, 26; 15(20):8125-48).

In one embodiment, the primers for the nested, 2^nd PCR amplification were 5 '-GAG TCG TTA ATA CGA CTC ACT ATA TAA GCC GCC ACC ATG TCG ATG TCC TAC ACA TGG AC-3' (5', nested primer; T7 promoter is underlined, Kozak sequence and start codon are double underlined; SEQ ID NO: 16) and 5'-GAT GTA GTC ACC GGT TGG GGA GCA GGT AGA T -3' (3 ', same primer as in first reaction; SEQ ID NO: 17). In one embodiment, the reaction mixture in a 50 μl volume for both PCR steps contained 10 mM Tris-HCL, pH 8.3, 50 mM KCL, 1.5 mM MgCl₂, 0.2 mM of each dNTP, 20 pM of each primer, and 1.25 U of Taq DNA polymerase (Perkin Elmer). PCR conditions for both steps were 94°C for 5 minutes, and then 35 cycles of: 94°C/ 30 sec, 55°C/ 1 min., 72°C/ 3.5 min., followed by a 5 minute extension at 72°C. The resulting PCR generated DNA templates contained a T7 RNA polymerase promoter sequence for transcribing the DNA, a Kozak consensus sequence for efficiently translating the RNA, and the specific HBV DNA polymerase sequences from the patient specimens In another embodiment, the six N-terminal amino acids of the CAT gene are included in the primer for the 2^nd PCR, e.g., 5 '-GAG TCG TTA ATA CGA CTC ACT ATA TAA GCC GCC ACC ATG AAC TAT ACA AAA TTT GAT TCG ATG TCC TAC ACA TGG AC-3' (CAT-5' for 2^nd PCR amplification; SEQ ID NO: 18) and 5'- GATGTAGTCACCGTTGGGGAGCAGGTAGAT-3' (3', SEQ ID NO: 19) or SEQ ID NO: 14. All primers contain seven random nucleotides for the attachment of the Taq polymerase/reverse transcriptase

In another embodiment, U replaces T in the PCR primers , which is also successful in related applications for viral proteins, e.g., 5'-GAG UCG UUC GAU GUC CUA CAC AUG AC-3' (1CPU5; SEQ ID NO:20); 5'-GAU GUA GUC ACC GUU GGG GAG CAG GUA GAU-3' (1CPU3; SEQ ID NO:21); 5'-GAG UCG UUA AUA CGA CUC ACU AUA UAA GCC GCC ACC AUG UCG AUG UCC UAC ACA UGG AC-3' (2CPU5; SEQ ID NO:22); 5'-GAG UCG UUA AUA CGA CUC ACU AUA UAA GCC GCC ACC AUG AAC UAU ACA AAA UUU GAU UCG AUG UCC UAC ACA UGG AC-3' (2CPUCAT5; SEQ ID NO:23). In cases where T in the primers is replaced with U, T is replaced with U in the degenerate primers as well.

In yet another embodiment, degenerate PCR primers are derived based on the comparison of 6 subclasses of HCV polymerase, e.g., 5 '-GAG TCG TTC HAT GTC ITA CJC KTG GAC-3' (SEQ ID NO:24); 5'-GAT GTA GLL ACC GMN LGG GGA GOA GMJ AGA T-3' (SEQ ID NO:25); and for the second PCR step, 5'-GAG TCG TTA ATA CGA CTC ACT ATA TAA GCC GCC ACC ATG TCH ATG TCI TAC JCK TGG AC-3 ' (2^nd; SEQ ID NO:26); 5 '-GAG TCG TTA ATA CGA CTC ACT ATA TAA GCC GCC ACC ATG AAC TAT ACA AAA TTT GAT TCH ATG TCI TACJ CKT GGA C-3' (CAT-3' 2^nd; SEQ ID NO:27), wherein H = G or C or A or T; I = C or A; J = A or T; K = A or C or G; L = T or C; M = G or A; N = T or G; and O = C or G. Accession numbers for sequences used for the primer design include Z97730,

D90208, M58335, AF009606, AB016785, AB030907, AF046866, Y11604, Y13184, D84262, D01221, D00944, M84754, D14853. In yet another embodiment, HCV5B polymerase gene was amplified by PCR using commercial reagents, e.g., QIA p Viral RNA MiniKit 250 Test (Qiagen Cat. No. 51106), absolute alcohol (Mullinchrodt Cat. No. 7019), RNAse free water (US Biochemicals Cat. No.

70783), dNTP solution (dATP(USB# 14244), dCTP(USB# 14279), dGTP(USB#14314), dTTP(USB#22324); 250 ul each to 9 ml of H₂O, Mix well and aliquot), RNAsin (Promega

Cat. No. N2515), reverse transcriptase M-MulV (Roche Molecular Cat. No. 1062603),

TaqDNA polymerase (Roche Molecular Diagnostics Cat. No.1147633), TNT transcription/translation system (Promega). Primers used for PCR amplification of the

HCV5B polymerase gene were, e.g., 5'- CGCGCACTAGTTATCATCGGTTGGGGAGCAGGTA (CV-2; SEQ ID NO: 34); 5'-

TCGGATCCTAATACGACTCACTATAGGGTCCGCCACCATGTCAATGTCYTAYACN

TGGA-3' (pCVla; SEQ ID NO:35); 5'-

TCGGATCCTAATACGACTCACTATAGGGCCGCCACCATGGCAATGTCYTAYACNT

GGA-3' (pCVlb; SEQ ID NO:36); 5'- CGCGC ACTAGTTATC AGCGGGGTCGGGC ACGAAACAGGCT-3 ' (C V-3 ; SEQ ID

NO:37); and 5'-GCGATTCGGATCCTAATACGACTCACTATA-3' (CV-6; SEQ ID

NO:38).

Briefly, RNA was extracted from patient specimens. RNA extraction techniques are well known in the art. Patient specimen (1 ml) for each extraction was equilibrated to room temperature. AVE buffer was warmed to 60 degrees Celsius in a heat block. AVL buffer (3920ul) containing Carrier RNA was added to 980 ul of patient specimen in a 15 ml tube. The mixture was incubated for 10 minutes at room temperature and then 3920 ul of absolute ethyl alcohol was added to the tube. This extraction mixture was vortexed for 10 seconds and then 700 μl of the mixture was carefully applied to an QIAamp spin column in a 2-ml collection tube. The QIAamp spin column containing the mixture was then centrifliged at 6000g (8200 φm) for 1 min. The filtrate was discarded. The remaining extraction mixture was applied to the QIAamp spin column and centrifuged as before. Discard the filtrate. The spin column was transferred to a clean collection tube and 500 μl Buffer AW was carefully pipetted on the column. The spin column was then centrifuged at 6000g for 1 min and the filtrate discarded. The spin column was again transferred to a clean collection tube, 500 μl Buffer AW was carefully pipetted on the column. The spin column was then centrifuged at 13,000 RPM (full speed) for 5 min and the filtrate discarded. The spin column was transferred to a clean 1.5 ml microcentrifuge tube and 50 ul Buffer AVE (at 60 degrees Celsius) was pipetted onto the column. The column was then incubated at room temperature for 1 min and then centrifuged at 6000g for 1 min to release the RNA. The RNA samples were stored frozen at -20 degrees Celsius until use.

RT-PCR and PCR was performed to amplify HCV5B using reverse transcription RT Master Mix containing, e.g., 4 ul x N reactions dNTP 100 uM each; lul x N reactions 10 RT buffer; 0.2 ul x N reactions rRNAsin; 0.2 ul x N reactions RT enzyme and 2 ul x N reactions Primer CV-2 (10 pmol/ul). The RT Master Mix (7.4 ul) was aliquoted into each PCR tube and either 7.4 ul of patient RNA sample, or H₂O was added to the RT Master Mix for each reaction. Samples were heated to 42 degrees Celsius for 30 min and then heated to 99 degrees Celsius for 15 min prior to cooling ad storage at 4 degrees Celsius.

Reagents for HCV5B First-step PCR Master Mix for N reactions contained, e.g., 4 ul x N reactions lOx Buffer; 2 ul x N reactions pCVla or pCVlb primer (10 pmol/ul); 3 ul x N reactions MgCl₂ (25 mM); 30.75 ul x N reactions ddH₂O; and 0.25 ul x N reactions Taq poly (5 u/ul). After reverse transcription, 40 ul of the above mixture was pipetted into each RT- PCR tube and amplified using the following program: 20 cycles of 2 min at 94 degrees

Celsius; 30 sec at 94 degrees Celsius; 30 sec at 52 degrees Celsius; and 72 degrees Celsius. The samples were then incubated at 72 degrees Celsius for 7 min and then cooled to 4 degrees Celsius as needed.

Reagents for HCV5B second-step PCR Master Mix for N reactions contained, e.g., 5 ul x N reactions; lOx Buffer; 4 ul x N reactions dNTP; 3 ul x N reactions MgCl₂; 2 ul x N reactions CV3 (10 pmol/ul); 2 ul x N reactions CV6 (10 pmol/ul); 33.75 ul x N reactions H O; and 0.25 ul x N reactions Taq pol (5 u/ul). HCV Second-step Master mix (50 ul) was pipetted into a new PCR tube and 2.5 ul of the HCV First-step PCR reaction products were added to the mix. This mixture was then amplified in a Second-Step PCR amplification using the following program: 30 cycles of 2 min at 94 degrees Celsius; 30 sec at 94 degrees

Celsius; 30 sec at 56 Celsius; and 1 min at 72 degrees Celsius. Sample was then incubated at 72 degrees Celsius for 7 min and then cooled to 4 degrees Celsius as needed. Amplification of HCV5B was visually confirmed by first resolving the reaction products on a 1% agarose gel and then staining the reaction products by standard techniques. In another embodiment, the present invention relates generally to amplification of genes from patient samples using isothermal conditions, expression of amplified gene in in vitro systems, and function analysis of genes in high throughput and multiplexing fashions. These methods provide sensitivity, accuracy, and complexity in gene amplification, expression, and function analysis. It also provides a unique system to study drug resistance for future anti-HCV chemotherapy.

In a broad aspect, the present invention is directed to a method for isothermal amplification of viral genes from patient samples to give high copy number of genes. During isothermal amplification, sequences of transcription and translation signals are engineered to incoφorated into the upstream of viral genes. Subsequently, equal copies of amplified genes are expressed in an in vitro transcription and translation system consisting of reticulocyte lysate and T7 polymerase. Expression of amplified genes in such system will yield high level of posttranslational modified proteins for function analysis. Direct transcription and translation using amplification products in such system eliminates the need for time consuming cloning steps. A gene product or gene products from the expression system is/are directly analyzed for their functions in a 96-well or 384-well format using SPA or FRET or luminescence assay systems.

A further advantage of the present invention is analysis of interaction of multiple genes product. This is especially important in HCV drug resistance studies. Because coφoration among multiple HCV non-structure protein is required for HCV replication, drug targeting one function could result in multiple mutations in other genes. The effect of multiple mutations in different genes on resistance to a particular drug could not be determined by analyzing only the function of the affected gene. The following references are incoφorated herein in their entireties: Alter et al, (1999)

N. Engl J. Med. 341, 556-562; El-Serag and Mason, (1999) N. Engl J. Med. 340, 745-750; McHutchison and Poynard, (1999) Semin. Liver Dis. 19, 57-65; Lohrnann et al, (1999) Science 285, 110-113; Farci et al, (1992) Science 258, 135-140; Farci et al, (2000) Science 288, 339-344.

EXPRESSION OF THE HCV PROTEINS

The PCR-generated DΝA template were directly transcribed and translated in vitro into HCV ΝS5B protein using a coupled reticulocyte lysate system, TNT T7 Quick for PCR DNA (Promega, Madison, WI). Size and integrity of HCV NS5B was confirmed by Western Blot. In one embodiment, transcription and translation of HCV5B polymerase was obtained using the TNT system. Briefly, transcription and translation was performed using 7 ul PCR product (PCR purified or no purification) in a 50 ul reaction according to the protocol provided by the manufacture. In one embodiment, HCV5B polymerase activity was measured using 3 to 6 ul TNT product in HCV polymerase assay as described below.

FUNCTIONAL ASSA Y FOR THE HCV PROTEINS An RNA polymerase assay, designed to measure the ability of the enzyme to incoφorate modified nucleotides into freshly synthesized RNA, is used to characterize the ability of several anti-viral agents to inhibit the NS5B polymerase. The detection of synthesized RNA provides the parameter for viral RNA-dependent RNA polymerase (RDRP) * activity, and follows the methods of Zhong W., et al, J Virol Feb;74(4):2017-22 (2000); Lohmann et al. J Viral Hepat May;7(3): 167-74 (2000); Ferrari E, et al, J Virol

Feb;73(2): 1649-54 (1999); Ishii K, et al, Hepatology Apτ;29(4): 1227-35 (1999); Behrens SE, et al, EMBOJ Jan 2;15(l):12-22 (1996); Zhong W J, et αl, Virol Oct;74(19):9134-43 (2000); and Oh JW, et αl., JBiol Chem Jun 9;275(23): 17710-7 (2000) incorporated by reference. In one embodiment, the detection of synthesized RNA as a parameter for viral

RNA-dependent RNA polymerase (RDRP) activity, follows a sandwich ELISA protocol. The absorbence of the samples is directly correlated to the level of RNA polymerase activity in the sample. The NS5B protein is used in inhibition assays with one or more of the following compounds: viral inhibitors such as AZT, ddl (didanosine/Videx®, ddC (zalcitabine), 3TC (lamivudine), d4T (stavudine), ribavirin triphosphates, non-nucleoside RT inhibitors such as delavirdine (U 9051125 (BMAP)/Rescriptor®, loviride (alpha-APA), nevirapine (Bl-RG-587/Viramune® and tivirapine (8-Cl-TIBO(R86183), gliotoxin), and protease inhibitors such as saquinavir, indinavir and ritonavir. These inhibitors are added to protein samples in a nucleoside incoφoration assay or protease activity assay as described across a concentration range of 1.0 pM to 10,000 μM thereby generating an ICso value as described for the wild-type and patient-derived proteins (see, Zhong W., Ishii K., and Lohmann V., supra).

In another embodiment, assays for the RNA-dependent RNA polymerase are performed as previously described (Jong- Won et al, J. Virology 73 (9):7694-7702; 1999). A common drug for the treatment of HCV currently on the market is Ribavirin (Rebetol, Schering-Plough Corporation), used in combination therapies with IFN-a. The active metabolite of Ribavirin in vivo is a triphosphorylated form. During RNA synthesis, Ribavirin is used as a substrate for the RNA-dependent RNA polymerase of HCV by acting as a guanosine pseudobase (1,2,4-triazole 3-carboxamide), pairing equivalently with cytidine and uridine.

After amplification of HCV5B from clinical specimen, a polymerase assay/primer extension assay is performed using the following symmetric primer/template set as previously developed (Maag et al, J Biol Chem. 276 (49):46094-8, 2001): 5'- GCAUGGGCCC (SEQ ID NO:28) and CCCGGGUACG-5' (SEQ ID NO:29).

In yet another embodiment, poly(C) is used as a template, with and without a 15-20 nucleotide- oligo(G) primer in parallele assays (Amersham Biosciences) (Jong- Won et al, J Virol. 73 (9):7694-7702; 1999). Ribavirin triphosphate as a test drug is purchased from

Moravek Biochemicals. These assays also include a mutant derivative of HCV polymerase, where the hydrophobic C-terminal end consisting of 21 amino acids have been deleted. This assay is utilized for drug screening including nucleoside-based drugs such as Ribavirin.

In another embodiment, HCV polymerase activity is assayed using commercially available reagents, e.g., PolyACGU RNA : 5'-

AAAAACGUCGUCGUCGUCGUCGUCGUCGUCGUCGUCGUCGUCGUCUCCCCCCC CCCCCCC-3' (SEQ ID NO:39); *BiotinPolyG: 5'-GGGGGGGGGGGG-3' (SEQ ID NO:40) from Qiagen oligo (if SPA assay is not intended for use, Biotin can be omitted); NTP (Amersham); RNasin from (Promega; N2515); ³H-UTP (Amersham; TRK289-250 uCi); lOx Buffer (store in -20 degrees Celsius; 200 mM Tris-HCL (pH 8.0) containing 15 mM MnCl₂, 1 M ammonium acetate, and 10 mM DTT).

The measurement of HCV polymerase was performed as described below. Briefly, RNA: Oligo solution (1 ug/ul:100pmol/ul) was prepared by mixing PolyACGU RNA and BiotinPolyG according to the above ratio. This solution was then heated at 70 degrees Celsius for 3 min, gradually cooled to room temperature and then stored at -20 degrees Celsius until use. Master Mixture was prepared by mixing, e.g., 5ul x 2N reactions lOxBuffer; 5ul x 2N reactions 2.5 mM each GTP/ATP/CTP; 5ul x 2N reactions 0.1 mM UTP; 5ul x 2N reactions RNA/oligo solution; lul x 2N reactions Rnasin; 19ul x 2N reactions H₂O; and 5ul x 2N reactions ³H-UTP. The assay was performed by adding the following reagents to each well of a 96-well microtiter plate: 5 ul of TNT expressed HCV polymerase or TNT No template/translation mixture or H₂O. To each well 45 ul of Master Mixture was added, the plate sealed and then incubated at 37 degrees Celsius for 2 hrs. Reaction products were purified using a Qiagen removal kit and resuspend in 50 ul of TE. Alternatively, the polymerase reaction solutions were tranferred onto a DE51 filter paper using Skatron instrument. The sample was washed 3-times with PBS using the Skatron instrument and then allowed to air-dry for 2 hrs. Sample transferred into scintillation vials, add fluid, and radioactivity quantfied by standard techniques.

INTERPRETA TION OF PHENOTYPE: DRUG SUSCEPTIBILITY

By analysing a series of nucleosidic and non-nucleosidic compounds for their effect on RNA dependent RNA polymerase (RdRp) activity, the change in drug susceptibility is calculated by comparing the IC₅₀ of the patient sample by the IC₅₀ for the wild-type standard. As little as a l%-5% change in relative affinity between the IC₅₀ values of the wild-type and mutant proteins can be detected by this assay. Any change in IC₅₀ is significant, but a 5-10% change in relative affinity indicates a clear decrease in clinical efficacy for a therapeutic agent, while a 50% change indicates a substantial decrease in efficacy suggesting the use of the compound should be discontinued, and a 100% change indicates effectively a complete loss of therapeutic potential. The change in affinity indicates a drug resistant phenotype that is used to determine future chemotherapy regimens.

EXAMPLE 4. Chronic Myelogenous Leukemia Tyrosine Kinases Chronic Myelogenous Leukemia (CML) is a clonal myeloproliferative disorder defined by the BCR ABL gene and its gene product, a tyrosine kinase involved in cell division and apoptosis. Kinases regulate many different cell proliferation, differentiation, and signaling processes by adding phosphate groups to proteins. The high energy phosphate which drives activation is generally transferred from adenosine triphosphate molecules (ATP) to a particular protein by protein kinases and removed from that protein by protein phosphatases. Phosphorylation occurs in response to extracellular signals (hormones, neurotransmitters, growth and differentiation factors, etc), cell cycle checkpoints, and environmental or nutritional stresses and is roughly analogous to turning on a molecular switch. Human ABL tyrosine kinase can be regulated by a cellular inhibitor. Phosphotyrosine cannot be detected on normal human ABL protein-tyrosine kinases, but activated oncogenic forms of the human ABL protein are phosphorylated on tyrosine in vivo. Activation of ABL can occur by substitution of the ABL first exon with breakpoint cluster region (BCR) sequences or by deletion of the noncatalytic SH3 (src homology region 3) domain. An alternative mode for the activation of the ABL kinases is hyperexpression at greater than 500- fold over endogenous levels. This is not a consequence of transphosphorylation of the hyperexpressed ABL molecules. ABL proteins translated in vitro lack phosphotyrosine, but tyrosine kinase activity is uncovered after immunoprecipitation and removal of lysate components. The rates of dephosphorylation of ABL and BCR/ABL fusion protein by phosphotyrosine-specific phosphatases are approximately the same. Thus, inhibition of ABL activity is reversible a cellular component interacts noncovalently with ABL to inhibit its autophosphorylation.

The molecular basis of CML has been shown to be the translocation event between chromosomes 22 and 9 (known as the Philadelphia chromosome) resulting in BCR/ABL gene fusion. The protein encoded by this chimeric gene is a constitutively activated tyrosine kinase that alters multiple signal transduction pathways inducing malignant transformation. The chromosomal translocation is believed to be the common oncogenetic mechanism for various "causes" which may include viral infection and chemicals in addition to ionizing radiation. In the US, CML accounts for 20% (approximately 5000) of all leukemia affecting adults. It typically affects middle-aged individuals. Although uncommon, the disease also occurs in younger individuals. Until recently, treatment options for patients with CML consisted of hydroxyurea, interferon-based therapies or stem cell transplantation. Treatment decisions were generally based on the age of the patient and the phase of the disease. Recently, several new therapies have been developed that may change the natural history of CML and patient prognosis. In particular rationally designed drug STI-571 (Gleevec, imatinib mesylat; Novartis), an oral BCR/ABL kinase inhibitor, is capable of blocking proliferation and inducing apoptosis in CML cell lines. STI-571 (Gleevec, imatinib mesylat; Novartis) was approved by the Food and Drug Administration in May 2001 for the treatment of CML that is refractory to interferon therapy. But the BCR ABL kinase inhibitor STI-571 is limited in its application because of development of drug resistance with conventional cancer drugs. High frequency of mutations clustered within the ATP-binding region of BCR/ABL are known. In six of nine patients, resistance was associated with a single amino acid substitution in a threonine residue of the BCR/ABL kinase domain known to form a critical hydrogen bond with the drug. Certain mutations may respond to higher doses of STI-571, whereas other mutations may require switching to other therapeutic compounds.

There exists a need for a fast assay for screening STI-571 and other potential compounds on proteins generated from patients displaying resistance to their current therapeutic agent and strategy. The method of the present invention is a platform technique for drug resistance screening of CML to current and future therapeutic agents including STI- 571 and to tailor custom drugs for the patients on a very short turnaround time.

Given the speed by which a gene can be cloned from peripheral blood, expressed and assayed for its activity in vitro, the assay not only permits quantification of the minimum dosage of STI-571 required for its effectiveness but also allows for screening by other compounds without jeopardizing the patients and their quality of life. The method of the present invention can be operated by reference laboratories or as a product to serve clinicians and also by pharmaceutical companies to shorten their drug development process for particular but common mutations found in CML.

AMPLIFICATION AND EXPRESSION OF BIOACTIVE MOLECULES

Protein kinases and protein phosphatases are selected depending on the experimental design or clinical determination. Amplification and expression is effectuated by the methods described. Patient blood samples are extracted to yield patient derived BCR/ABL kinase gene as generally described by Branford and coworkers (Blood, 2002, 99:3472-5) the content of which is incoφorated herein by reference in its entirety. Briefly, the BCR/ABL kinase gene is obtained as a cDNA from total RNA isolated from peripheral blood of CML infected patients. Primers are designed for the addition of RNA polymerase promoter sequence to the primers for subsequent amplification of the BCR/ABL kinase gene by polymerase chain reaction. Promoter carrying-DNA templates for the BCR/ABL kinase gene are then introduced into a cell free transcription/translation system (commercially available) with subsequent generation of RNA transcripts and the final BCR ABL kinase protein product. Either eukaryotic or prokaryotic in vitro transcription and/or translation systems are used to derive the BCR/ABL kinase protein. Amplification and expression is also effectuated by the methods described. PHENOTYPIC ASSA YS

Protein kinases and protein phosphatases are extensively studied molecules. Simple and efficient testing methods for determining kinase, e.g., or phosphatase activity can be purchased from Promega, such as the SigmaTECT® Protein Kinase Assay, and the Non- Radioactive Phosphatase Assay System. Numerous peptide substrates for measuring kinase activity are also described in the scientific literature, such as Kemp, BE, et al, JBiol Chem 252, 4888 (1977); Casinelle, JE, et al, Meth. Enzymol, 200 115 (1991) incoφorated herein by reference. Phenotypic information is thus used in the drug discovery process to find compounds that can modulate the phenotype of these proteins. These assays provide methods for determining the phenotype of the protein kinase and protein phosphatase. Phenotypic information is thus used in the drug discovery process to find compounds that can modulate the phenotype of these proteins. In one embodiment, BCR/ABL kinase activity is measured using available drug(s) on the market at different concentrations in order to determine drug resistance/sensitivity for individual patients. Inhibitors of protein kinases include, but are not limited to, angiogenesis inhibitors, pyrazole derivatives, cyclin-C variants, aminothiazole compounds, quinazoline compounds, benzinidazole compounds, polypeptides and antibodies, pyramidine derivatives, substituted 2-anilopyramidines, and bicyclic heteroaromatic compounds (see, U.S. Pat. Nos.: 6,265,403, 6,316,466, 6,306,648, 6.262,096, 6,313,129, 6,162,804, 6,096,308, 6,194,186, 6,235,741, 6,235,746, 6,207,669, and 6,043,045, the entirety of these patents are hereby incoφorated by reference).

Indeed, there is a high frequency of point mutations clustered within the adenosine triphosphate-binding region of BCR/ABL in patients with chronic myeloid leukemia or Ph- positive acute lymphoblastic leukemia who develop imatinib (STI571) resistance (Branford et al., Blood 2002 May 1 ;99(9):3472-5). Point mutations were found in the adenosine triphosphate (ATP) binding region of BCR/ABL in 12 of 18 patients with chronic myeloid leukemia (CML) or Ph-positive acute lymphoblastic leukemia (Ph(+) ALL) and imatinib resistance (defined as loss of established hematologic response), but they were found in only 1 of 10 patients with CML with imatinib refractoriness (failure to achieve cytogenetic response). In 10 of 10 patients for whom samples were available, the mutation was not detected before the initiation of imatinib therapy. Three mutations (T3151, Y253H, and F317L present in 3, 1, and 1 patients, respectively) have a predicted role in abrogating imatinib binding to BCR/ABL, whereas 3 other mutations (E255K, G250E, and M351T, present in 4, 2, and 2 patients, respectively) do not. Thus we confirm a high frequency of mutations clustered within the ATP-binding region of BCR/ABL in resistant patients. Screening may allow intervention before relapse by identifying emerging mutations with defined impacts on imatinib binding. Certain mutations may respond to higher doses of imatinib, whereas other mutations may mandate switching to another therapeutic strategy. (Blood. 2002;99:3472-3475).

INTERPRETA TION OF PHENOTYPE: DRUG SUSCEPTIBILITY

IC₅₀ values for a candidate drug for the wild-type kinase protein is typically reported in the 0.5 nM-1 μM range. IC₅₀ values for the mutant proteins ranges from 0.5 nM-1 mM, while, the drug caused a near complete inhibition of the mutant kinase proteins. The mutant strains can be regarded as candidate drug-sensitive. If less than a 2-fold differnce in the IC₅₀ value between the wild-type kinase and mutant kinase results suggest to one skilled in the art that a significant resistance to has not yet developed in the mutant kinase protein, and that anti-CML inhibition can still be achieved within pharmacologically acceptable dose ranges of the candidate drug. Thus, a physician or clinician is able to elect a course of chemotherapy against CML

EXAMPLE 5. Functional Assay for the HBV Proteins

In another embodiment, HBV polymerase is assayed using commercially available reagents, e.g., 5'-

AAAAAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG GGGGGGGTATAGTGAGTCGTATTAGG-3' (BVTemp; SEQ ID NO:41) and 5'- CCTAATACGACTCACTATAG-3' (*BiotinBVprimer; SEQ ID NO:42) from Qiagen oligo (if SPA assay is not intended for use, Biotin can be omitted); dNTP (Amersham); ³H-dUTP (Amersham); 3x Buffer (50 mM Tris-HCL (pH 7.8) containing 319 mM KCl and 33 mM MgCl₂). Master Mixture was prepared by mixing, e.g., lOul x 2N reactions 3xBuffer; 3ul x 2N reactions 5 mM dCTP; 3ul x 2N reactions 0.1 mM dTTP; 3ul x 2N reaction DNA/oligo; 2ul x 2N reactions H₂O; 3ul x 2N reactions lOmM DTT; and 3ul x 2N reactions ³H-dUTP wherein N is the number of reactions. The measurement of HBV polymerase was performed as described below. Briefly,

DNA:Oligo solution (10pmol/ul:50pmol/ul) was prepared by mixing BVTemp and BiotinBVprimer according to the above ratio. This mixture was then heated at 95 degrees Celsius for 3 min, gradually cooled to room temperature and then stored at -20 degrees Celsius until use.

The assay was performed by adding the following reagents to each well of a 96-well microtiter plate: 6 ul of TNT expressed HBV polymerase or TNT No template/translation mixture or H₂O. To each well 54 ul of Master Mixture was added, the plate sealed and then incubated at 37 degrees Celsius for 2 hrs. Reaction products were purified using a Qiagen removal kit and resuspend in 50 ul of TE. Alternatively, the polymerase reaction solutions were tranferred onto a DE51 filter paper using Skatron instrument. The sample was washed 3-times with PBS using the Skatron instrument and then allowed to air-dry for 2 hrs. Sample transferred into scintillation vials, add fluid, and radioactivity quantfied by standard techniques.

EQUIVALENTS

From the foregoing detailed description of the specific embodiments of the invention, it should be apparent that a unique procedure to express and assay a biomolecule for a clinically relevant phenotype has been described resulting in improved patient therapies and the drug discovery process. Although particular embodiments have been disclosed herein in detail, this has been done by way of example for puφoses of illustration only, and is not intended to be limiting with respect to the scope of the appended claims which follows. In particular, it is contemplated by the inventor that substitutions, alterations, and modifications may be made to the invention without departing from the spirit and scope of the invention as defined by the claims. For instance, the choice of bioactive molecule for assay, or the choice of chemotherapeutic agent, or the choice of appropriate patient therapy based on the assay is believed to be matter of routine for a person of ordinary skill in the art with knowledge of the embodiments described herein.

Claims

CLAIMS WE CLAIM

1. A method for producing and evaluating a bacterial bioactive molecule comprising the steps of: a) providing an amplified nucleic acid sequence comprising the bacterial bioactive molecule; b) expressing the bacterial bioactive molecule encoded by the nucleic acid sequence obtained in step (a), wherein the expressed bacterial bioactive molecule has a detectable phenotype; c) contacting the bacterial bioactive molecule obtained in step (b) with a test compound; and d) detecting the phenotype of the bacterial bioactive molecule in the presence or absence of the test compound contacted in step (c); wherein detecting a change in the phenotype of the bacterial bioactive molecule indicates sentitivity or resistance to the test compound, or change in affinity toward the test compound.

2. The method of claim 1, wherein the bacterial bioactive molecule is a protein further comprising a streptococcus protein, a staphylococcus protein, an enterococus protein, a neisseria protein, a salmonella protein, a mycobacteria protein, a bacillus protein, a mycoplasma protein, a chlamydia protein, a francisella protein, a pasturella protein, a brucella protein, a pseudomonas protein, a listeria protein, a clostridium protein, a yersinia protein, a vibrio protein, a shigella protein, an escherichia protein, or an enterobacteriaceae protein.

3. The method of claim 1, wherein the bioactive molecule is selected from the group consisting of: DNA gyrase subunit A; DNA gyrase subunit B; topoisomerase IV subunit A; and topoisomerase IV subunit B, or combination thereof.

4. The method of claim 1, wherein the amplified nucleic acid is amplified by contacting a nucleic acid sequence encoding the bacterial bioactive molecule with one or more nucleic acid primer sequences, and performing nucleic acid amplification thereon.

5. The method of claim 4, wherein the nucleic acid primer sequences are selected from the group consisting of: SEQ ID NO:l, SEQ ID NO:2; SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:7; and SEQ ID NO:8, or degenerate variants thereof.

6. The method of claim 1, wherein the nucleic acid sequence encoding the bacterial bioactive molecule further comprises deoxyribonucleic acid or ribonucleic acid.

7. The method of claim 1, wherein the nucleic acid sequence encoding a bacterial bioactive molecule further comprises transfer RNA or polyA+ RNA.

8. The method of claim 1, wherein the bacterial bioactive molecule encoded by the nucleic acid is expressed in a cell-free eukaryotic cell lysate translation system.

9. The method of claim 1, wherein the bacterial bioactive molecule encoded by the nucleic acid is expressed in a cell-free prokaryotic cell lysate translation system.

10. The method of claim 9, wherein the bacterial bioactive molecule encoded by the amplified nucleic acid sequence is expressed in a cell-free reticulocyte lysate translation system.

11. The method of claim 10, wherein the bacterial bioactive molecule encoded by the amplified nucleic acid sequence is expressed in a cell-free reticulocyte lysate coupled transcription/translation system.

12. The method of claim 1 , wherein the nucleic acid sequence that encodes the bacterial bioactive molecule further comprises a second nucleic acid sequence operably linked to the bacterial bioactive molecule.

13. The method of claim 12, wherein the second nucleic acid sequence comprises a purification motif.

14. The method of claim 12, wherein the second nucleic acid sequence encodes a gene product or fragment thereof comprising a purification motif.

15. The method of claim 1, wherein the bacterial bioactive molecule is contacted with a compound selected from the group consisting of: an anti-viral compound, an anti-bacterial compound, an anti-fungal compound, an anti-cancer compound, an immunosuppressive compound, a hormone, a cytokine, a lymphokine, a chemokine, an enzyme, a polypeptide, a polynucleotide, and a nucleoside analogue.

16. The method of claim 1, wherein detecting the phenotype of the bacterial bioactive molecule further comprises assaying the enzymatic activity of the bacterial bioactive molecule.

17. The method of claim 16, wherein assaying the enzymatic activity of the bacterial bioactive molecule further comprises assaying the bacterial bioactive molecule for a resistance phenotype to the compound.

18. The method of claim 1 , wherein detecting the phenotype of the bacterial bioactive molecule further comprises assaying the affinity of the bacterial bioactive molecule for the compound.

19. The method of claim 18, wherein assaying the affinity of the bacterial bioactive molecule for the compound further comprises assaying the bacterial bioactive molecule for a resistance phenotype to the compound.

20. The method of claim 1, wherein detecting the phenotype of the bacterial bioactive molecule further comprises assaying the structure of the bacterial bioactive molecule.

21. The method of claim 20, wherein assaying the structure of the bacterial bioactive molecule comprises predicting a resistance phenotype to the compound.

22. A method for producing and evaluating a viral bioactive molecule comprising the steps of: a) providing an amplified nucleic acid sequence comprising the viral bioactive molecule; b) expressing the viral bioactive molecule encoded by the nucleic acid sequence obtained in step (a), wherein the expressed viral bioactive molecule has a detectable phenotype; c) contacting the viral bioactive molecule obtained in step (b) with a test compound; and d) detecting the phenotype of the viral bioactive molecule in the presence or absence of the test compound contacted in step (c); wherein detecting a change in the phenotype of the viral bioactive molecule indicates sensitivity or resistance to the test compound, or change in affinity toward the test compound.

23. The method of claim 22, wherein the viral bioactive molecule is a protein further comprising a retrovirus protein, a heφesvirus protein, a hantavirus protein, a hepatitis virus protein, an influenza protein, a myxovirus protein, a paramyxovirus protein, a picornavirus protein, a adenovirus protein, a poxvirus protein, a flavivirus protein, a parvovirus protein, a erythrovirus protein, or a coronavirus protein.

24. The method of claim 22, wherein the viral bioactive molecule is selected from the group consisting of: reverse transcriptase; protease; DNA-dependent RNA polymerase; and RNA-dependent RNA polymerase.

25. The method of claim 22, wherein the amplified nucleic acid is amplified by contacting a nucleic acid sequence encoding the viral bioactive molecule with one or more nucleic acid primer sequences, and performing nucleic acid amplification thereon.

26. The method of claim 25, wherein the nucleic acid primer sequences are selected from the group consisting of: SEQ ID NO:9, SEQ ID NO: 10; SEQ HO NO: 11 ; SEQ ID NO: 12; SEQ ID NO:13; SEQ ID NO:14; SEQ ID NO:15; SEQ ID NO:16; SEQ ID NO: 17; SEQ ID NO:18; SEQ ID NO:19; SEQ ID NO:20; SEQ ID NO:21; SEQ ID NO:22; SEQ ID NO:23; SEQ ID NO:24; SEQ ID NO:25; SEQ ID NO:26; SEQ ID NO:27; SEQ ID NO:28; SEQ ID NO:29; SEQ ID NO:30; SEQ ID NO:31; SEQ ID NO:32; SEQ ID NO:33; SEQ ID NO:34; SEQ ID NO:35; SEQ ID NO:36; SEQ ID NO:37; SEQ ID NO:38; SEQ ID NO:39; SEQ ID NO:40; SEQ ID NO:41; and SEQ ID NO: 42, or degenerate variants thereof.

27. The method of claim 22, wherein the nucleic acid sequence encoding the viral bioactive molecule further comprises deoxyribonucleic acid or ribonucleic acid.

28. The method of claim 22, wherein the nucleic acid sequence encoding a viral bioactive molecule further comprises transfer RNA or polyA+ RNA.

29. The method of claim 22, wherein the viral bioactive molecule encoded by the nucleic acid is expressed in a cell-free eukaryotic cell lysate translation system.

30. The method of claim 22, wherein the viral bioactive molecule encoded by the nucleic acid is expressed in a cell-free prokaryotic cell lysate translation system.

31. The method of claim 30, wherein the viral bioactive molecule encoded by the amplified nucleic acid sequence is expressed in a cell-free reticulocyte lysate translation system.

32. The method of claim 31, wherein the viral bioactive molecule encoded by the amplified nucleic acid sequence is expressed in a cell-free reticulocyte lysate coupled transcription/translation system.

33. The method of claim 22, wherein the nucleic acid sequence that encodes the viral bioactive molecule further comprises a second nucleic acid sequence operably linked to the viral bioactive molecule.

34. The method of claim 33, wherein the second nucleic acid sequence comprises a purification motif.

35. The method of claim 34, wherein the second nucleic acid sequence encodes a gene product or fragment thereof comprising a purification motif.

36. The method of claim 22, wherein the viral bioactive molecule is contacted with a compound selected from the group consisting of: an anti-viral compound, an anti-bacterial compound, an anti-fungal compound, an anti-cancer compound, an immunosuppressive compound, a hormone, a cytokine, a lymphokine, a chemokine, an enzyme, a polypeptide, a polynucleotide, and a nucleoside analogue.

37. The method of claim 22, wherein detecting the phenotype of the viral bioactive molecule further comprises assaying the enzymatic activity of the viral bioactive molecule.

38. The method of claim 37, wherein assaying the enzymatic activity of the viral bioactive molecule further comprises assaying the viral bioactive molecule for a resistance phenotype to the compound.

39. The method of claim 22, wherein detecting the phenotype of the viral bioactive molecule further comprises assaying the affinity of the viral bioactive molecule for the compound.

40. The method of claim 39, wherein assaying the affinity of the viral bioactive molecule for the compound further comprises assaying the viral bioactive molecule for a resistance phenotype to the compound.

41. The method of claim 22, wherein detecting the phenotype of the viral bioactive molecule further comprises assaying the structure of the viral bioactive molecule.

42. The method of claim 22, wherein assaying the structure of the viral bioactive molecule comprises predicting a resistance phenotype to the compound.

43. A method for producing and evaluating a kinase comprising the steps of: a) providing an amplified nucleic acid sequence comprising the kinase; b) expressing the kinase encoded by the nucleic acid sequence obtained in step (a), wherein the expressed kinase has a detectable phenotype; c) contacting the kinase obtained in step (b) with a test compound; and d) detecting the phenotype of the kinase in the presence or absence of the test compound contacted in step (c); wherein detecting a change in the phenotype further comprises detecting the phosphorylation activity of the kinase toward a substrate.

44. The method of claim 43, wherein the kinase phosphorylates the substrate on at least a serine residue, a threonine residue, or a tyrosine residue.

45. The method of claim 43, wherein the kinase is selected from the group consisting of: a bacterial kinase, a viral kinase, a mammalian kinase, and a human kinase.

46. The method of claim 45, wherein the viral kinase is a v-Abl protein tyrosine kinase.

47. The method of claim 45, wherein the mammalian kinase is ABL or BCR/ABL kinase.