JPWO2019230654A1 - Antiviral treatment for flavivirus infection - Google Patents

Abstract

Provided are methods related to flavivirus infection in mammals (including humans) and their effects on nucleolar morphology in biological cells as potential targets for treatment of flavivirus-related diseases. The present invention relates to an antiflavivirus pharmaceutical composition, which comprises, as an active ingredient, a substance that affects the morphology of nucleoli in biological cells, which is obtained by the method of the present invention.

Description

The present invention generally relates to the treatment of flavivirus infections and flavivirus-related diseases in mammals, especially humans. The present invention is specifically used as a target for novel therapeutic protocols for the treatment and / or prevention of infections and diseases caused by flaviviruses, and for the identification and development of substances with novel antiflavivirus activity. Provide a screening method that can be performed.

Flaviviridae The genus Flaviviridae is a Japanese encephalitis virus (JEV) that causes infectious diseases such as Japanese encephalitis, dengue fever, dengue hemorrhagic fever, and Zika fever, which are a public health problem all over the world. It contains a lot of pathogens such as dengue virus (DENV) and Zika virus (ZIKV).
Flavivirus viruses are predominantly arthropod viruses and often cause significant morbidity and mortality in mammals and birds (Non-Patent Document 1). JEV is distributed in the south and southeastern regions of Asia and is a zoonotic infection between pigs or birds and mosquitoes (Non-Patent Documents 1 and 2).

Flaviviridae Flaviviridae has more than 70 viruses, most of which are mediated by hematophage arthropods. Mosquito-borne flaviviruses include Japanese encephalitis virus (JEV), dengue virus (DENV), Zika virus (ZIKV), West Nile virus (WNV), and yellow fever virus (YFV). , Tick-mediated encephalitis virus (TBEV) and the like (Non-Patent Document 3). In addition, 14 species of flavivirus of unknown carrier have been reported.

Flaviviridae is composed of an enveloped virus having a + strand RNA genome having a total length of about 11 kb, has a cap structure at the 5'end, and does not have a poly A structure at the 3'end (Non-Patent Document 4). There is a single reading frame on this genome, and the polyprotein translated from the genome is cleaved by the host and viral proteases at the same time as and after the translation, and the core, precursor membrane (prM) and envelope (E) proteins 3 It yields one structural protein and seven non-structural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5 (Non-Patent Document 5).

No specific treatment for flavivirus infection has been approved to date. However, as the function and structure of flavivirus proteins have been clarified in recent years, the development of many specific inhibitors is underway. Since NS3 has protease activity and helicase activity, both of which are essential for viral replication, protease activity inhibitors (Non-Patent Documents 6 and 7) and helicase activity inhibitors (Non-Patent Documents 8 and 9) have been developed. ing. Similarly, an inhibitor of NS5 methyltrasferase activity (Non-Patent Documents 10 and 11) and an NS5 RNA-dependent RNA polymerase inhibitor (Non-Patent Documents 12 and 13) have also been found to be effective. More recently, in E-protein, which is one of the structural proteins, a structural pocket that can be a target of antiviral drugs has been discovered (Non-Patent Document 14), and a drug that inhibits the structural change of E-protein during infection is searched for. (Non-Patent Documents 15 and 16).

In addition to the specific antiviral drugs described above, commonly used antiviral drugs have also been studied. Since IFN is an antiviral drug approved by the US FDA, its effect on flavivirus infections is also being investigated. In clinical studies using humans or monkeys, a certain effect was observed against St. Louis encephalitis virus infection (Non-Patent Document 17), but against dengue virus (DENV) and Japanese encephalitis virus (JEV) infections. Has not been found to have a significant effect so far (Non-Patent Documents 18 and 19). Ribavirin, which is a purine nucleoside analog, also has a wide range of antiviral activity, and various viruses have been studied (Non-Patent Document 20). In vitro studies of flavivirus have also been observed to have an effect of suppressing viral replication due to GTP depletion due to inhibition of inosin monophosphate dehydrogenase (Non-Patent Document 21). However, no significant effect was observed in clinical trials for JEV infection in humans (Non-Patent Document 23). Recently, it has been reported that a nucleoside analog ETAL similar to ribavirin suppresses flavivirus replication such as DENV (Non-Patent Document 24), and future studies are expected.

In addition, antiviral drugs using new technologies such as RNAi that degrades target RNA (Non-Patent Documents 25 and 26) and morpholino-oligo (PMO) that inhibits translation (Non-Patent Documents 27 and 28) are also being studied. , A certain antiviral effect has been observed in animal models. Furthermore, by binding siRNA to JEV to a rabies virus-derived peptide (Non-Patent Document 29) and binding siRNA to DENV to a peptide that specifically binds to a dendritic cell ligand (Non-Patent Document 30), respectively. We have succeeded in specifically incorporating it into the central nervous system and dendritic cells. These technologies are expected to be applied because they can be applied only to specific organs / cells in which the target virus is infected and proliferated, and side reactions can be reduced.
As described above, although the expected therapeutic results have been obtained, the current situation is that there is no definitive therapeutic agent as a countermeasure against flavivirus infection.

For example, pan-caspase inhibitors, cyclin-dependent kinase (CDK) inhibitors, category B anthelmintics or proteasome inhibitors are comprehensively described as compounds having an inhibitory effect on Zika virus infection, which is a type of flavivirus ( Patent Document 1, Non-Patent Document 31). Here, we have only confirmed the phenomenon of suppressing the growth of Zika virus, and it is unknown whether it acts on virus infection, replication, packaging, or budding.

WO2018 / 017426A1 Gazette

Burke, D.S., and T.P. Monath. 2001. Flaviviruses, p. 1043-1125 Solomon, T., et al. J. Virol. 77: 3091-3098 Gubler DJ, et al. Flaviviruses. In: Fields virology (Fifth edition). Knipe DM, Howley PM (Ed), Lippincott-Raven, Philadelphia, PA, 1153-252, 2007 Wengler G, et al. Virology. 89: 423-37, 1978 Lindenbach BD, et al., The Viruses and Their Replication. In: Fields virology (Fifth edition). Knipe DM, Howley PM (Ed), Lippincott-Raven, Philadelphia, PA, 1102-53, 2007 Stoermer MJ, et al. J. Med. Chem. 51: 5714-21, 2008 Yang CC, et al. Antimicrob. Agents. Chemother. 55: 229-38, 2011 Zhang N, et al. J. Med. Chem. 46: 4149-64, 2003 Borowski P, et al. Eur. J. Biochem. 270: 1645-53, 2003 Luzhkov VB, et al. Med. Chem. 15: 7795-802, 2007 Lim SP, et al. J. Biol. Chem. 286: 6233-40, 2011 Yin Z, et al. Proc. Natl. Acad. Sci. U.S.A. 106: 20435-9, 2009 Niyomrattanakit P, et al. J. Virol. 84: 5678-86, 2010 Modis Y, et al. Proc. Natl. Acad. Sci. U.S.A. 100: 6986-91, 2003 Wang QY, et al. Antimicrob. Agents. Chemother. 53: 1823-31, 2009 Zhou Z, et al. ACS. Chem. Biol. 3: 765-75, 2008 Rahal JJ, et al. J. Infect. Dis. 190: 1084-7, 2004 Ajariyakhajorn C, et al. Antimicrob. Agents. Chemother. 49: 4508-14, 2005 Solomon T, et al. Lancet. 361: 821-6, 2003 De Clercq E. Med. Res. Rev. 29: 611-45, 2009 Graci JD, et al. Rev. Med. Virol. 16: 37-48, 2006 Crance JM, et al. Antiviral. Res. 58: 73-9, 2003 Kumar R, et al. India. Clin. Infect. Dis. 48: 400-6, 2009 McDowell M, et al. Antiviral. Res. 87: 78-80, 2010 Pacca CC, et al. Virus. Genes. 38: 224-31, 2009 Kumar P, et al. PLoS. Med. 3: e96, 2006 Deas TS, et al. Antimicrob. Agents. Chemother. 51: 2470-82, 2007 Stein DA, et al. J. Antimicrob. Chemother. 62: 555-65, 2008 Kumar P, et al. Nature. 448: 39-43, 2007 Subramanya S, et al. J. Virol. 84: 2490-501, 2010 Xu M, et al. Nat. Med. 1101-1107, Vol. 22, Num. 10, 2016

Flaviviridae Flaviviridae is a host / amplifiered animal owned by mammals and birds other than humans, and is transmitted by mosquitoes or mites. Since it is difficult to completely eliminate contact with infected mosquitoes or infected mites in human life, it is impossible to completely eliminate flavivirus infection. Therefore, the present inventors sought and studied antiviral treatment against flavivirus infection, and obtained surprising findings that inhibit viral replication.

We happened to find that certain pharmacologically active compounds affect the morphology of nucleoli in biological cells, which in some way inhibits viral replication. The present invention has been completed.

That is, the present invention includes the following aspects.
<Antiviral pharmaceutical composition>
[1]
An antiflavivirus pharmaceutical composition comprising a substance that affects the morphology of nucleoli in biological cells.
[2]
The anti-flavivirus pharmaceutical composition according to [1], which comprises a substance that affects the morphology of nucleoli in biological cells as an active ingredient having anti-flavivirus activity.
[3]
The pharmaceutical composition according to [1] or [2], wherein the substance that affects the morphology of the nucleolus in biological cells is a substance that causes morphological abnormalities of the nucleolus.
[4]
The pharmaceutical composition according to any one of [1] to [3], wherein the substance affecting the morphology of the nucleolus in the biological cell also involves a change in the localization of the core protein of the virus in the biological cell.
[5]
The pharmaceutical composition according to any one of [1] to [4], wherein a substance that affects the morphology of nucleoli in biological cells causes viral replication inhibition.

[6]
Regarding anti-flavivirus activity, the drug according to any one of [1] to [5], wherein the flavivirus is an anti-flavivirus activity selected from Japanese encephalitis virus, dengue virus, Zika virus, West Nile virus, and yellow fever virus. Composition.
[7]
Substances that affect the morphology of nucleoli in biological cells are substances that have CDK inhibitory activity, rRNA transcription inhibitory activity, DNA topoisomerase inhibitory activity, or GSK-3 inhibitory activity. The pharmaceutical composition according to any one of [1] to [6].
[8]
Substances with CDK inhibitory activity are 2-cyanoethylartellopaulone, 5-amino-3-((4- (aminosulfonyl) phenyl) amino) -N- (2,6-difluorophenyl) -1H-1, 2,4-Triazole-1-Carbothioamide, (4- (2-amino-4-methylthiazole-5-yl) pyrimidin-2-yl)-(3-nitrophenyl) amine, P276-00, A-674563 , SU9516, SNS-032 (BMS-387032), dynasicrib, flavopyridol, AT7519, flavopyridol hydrochloride, AT7519 HCl, AZD5438, R547, and kerpaulone, the pharmaceutical composition according to [7].
[9]
Substances with CDK inhibitory activity are 2-cyanoethylartellopaulone, 5-amino-3-((4- (aminosulfonyl) phenyl) amino) -N- (2,6-difluorophenyl) -1H-1, Selected from 2,4-triazol-1-carbothioamide, and (4- (2-amino-4-methylthiazole-5-yl) pyrimidin-2-yl)-(3-nitrophenyl) amine, [ 8] The pharmaceutical composition according to the above.

[10]
The pharmaceutical composition according to [7], wherein the substance having rRNA transcription inhibitory activity is selected from actinomycin D, doxorubicin, and aclarubicin.
[11]
The pharmaceutical composition according to [6], wherein the substance having DNA topoisomerase inhibitory activity is selected from doxorubicin, acralubicin, ellipticin, idarubicin, idarubicin hydrochloride, epirubicin hydrochloride, mitoxantrone hydrochloride, and daunorubicin hydrochloride.
[12]
The pharmaceutical composition according to [11], wherein the substance having DNA topoisomerase inhibitory activity is selected from doxorubicin, aclarubicin, and ellipticin.
[13]
The pharmaceutical composition according to [7], wherein the substance having GSK-3 inhibitory activity is 1-Azaken Paulon.

<Screening method>
[14]
Methods for screening substances with anti-flavivirus activity, including the following steps:
(A) Biological cells are contacted in vitro with candidate compounds of substances with antiflavivirus activity.
(B) Investigate whether the candidate compound affects the morphology of the nucleolus in the biological cell.
(C) A method for identifying the candidate compound as a substance having antiflavivirus activity if it has an influence.
[15]
[14] The method according to [14], wherein in step (c), the effect of the candidate compound is morphological abnormalities of the nucleolus in biological cells.
[16]
[14] or [15], wherein morphological abnormalities of the nucleolus in biological cells are discriminated by changes in the formation and / or localization of proteins or nucleic acids localized in the nucleolus.

[17]
A change in the formation and / or localization of a nucleolus-localized protein is a change compared to the effect of a control compound on a nucleolus-localized protein, the candidate compound relative to the nucleolus morphology. , The method according to [16], which is determined to have an effect.
[18]
The protein localized in the nucleolus in biological cells is one or more proteins selected from necrophosmine, nucleolin, fibrillarin, RNA polymerase I and flavivirus core proteins, [14. ] To [17].
[19]
Biological cells were established from mosquitoes such as eukaryotic cell lines including humans such as liver-derived Huh7 cells, primary cultured cells, primate-derived cell lines such as monkey kidney-derived Vero cells, and C6 / 36 cells. The method according to any one of [14] to [18], which is a cell.

The present invention discloses compounds effective for the prevention and treatment of flavivirus infections, and further provides a screening method that provides a novel mechanism of action, infection prevention, inhibitory efficacy and pharmaceutically usefulness for a target.
In particular, although there are licensed vaccines for humans against JEV, YFV, and TBEV infections, thousands to tens of thousands or more of each year are still reported worldwide. Since it is difficult for flavivirus to be carried and amplified by animals other than humans and to completely eliminate contact with infected mosquitoes or infected mites, the development of specific therapeutic methods and vaccines is an important issue.
According to the present invention, a new therapeutic agent for antiflavivirus can be prepared, and a new therapeutic substance can be provided.

It is an alternative drawing to a photograph showing the localization of flavivirus core protein (also known as C protein or capsid protein) in biological cells. FIG. 1 (A) shows cells in which Japanese encephalitis virus core protein: JEV core, dengue virus core protein: DENV core :, Zika virus core protein: ZIKV core, and West Nile virus core protein: WNV core are transiently expressed. Shows localization. FIG. 1B shows the intracellular localization of various flavivirus core proteins when microinjected into the cytoplasm of cells. FIG. 1 (C) shows the localization in the cytoplasm, cell nucleus (genomic DNA) and nucleolus when the Japanese encephalitis virus core protein is microinjected into the cytoplasm of the cell. It is a photograph instead of the graph which shows the result of the screening method of the substance | substance having anti-flavivirus activity which uses the intracellular localization change of the Japanese encephalitis virus core protein as an index, and the drawing which shows the intracellular localization. FIG. 2A is a graph obtained by measuring the amount of core protein present in the cell nucleus. FIG. 2B shows the nuclear localization of the Japanese encephalitis virus core protein when treated with DMSO (control) and three CDK inhibitors.

Cdk1 / 2 Inhibitor III (5-Amino-3-((4- (Aminosulfonyl) Phenyl) Amino) -N- (2,6-Difluorophenyl) -1H-1,2,4-Triazole-1-Carbo It is a photograph instead of a drawing showing how thioamide) changes the morphology of nucleoli in cells. FIG. 3 (A) shows that Cdk1 / 2 inhibitor III treatment causes nucleolar morphological abnormalities as compared to DMSO treatment. FIG. 3 (B) shows the localization in the cytoplasm, cell nucleus (genomic DNA) and nucleolus when the Japanese encephalitis virus core protein is microinjected into the cytoplasm of cells treated with 2-cyanoethyl asteropaulone. It is a graph which shows that the identified CDK inhibitor suppresses the replication of Japanese encephalitis virus at a specific concentration, but does not kill biological cells. It is a photograph instead of a drawing which shows the morphological change of a nucleolus by a substance having an rRNA transcription inhibitory activity. Fluorescent images of DMSO (control) and three rRNA transcription inhibitors are shown. FIG. 6 (A) is a photograph in place of the drawing showing the morphological change of the nucleolus caused by the substance 1-Azakenporon having GSK-3 inhibitory activity. FIG. 6B is a graph showing the suppression of growth of Japanese encephalitis virus, Denguiurus, and Zika virus by 1-Azaken Paulon. Substances having DNA topoisomerase inhibitory activity: Ellipticin, idarubicin, idarubicin hydrochloride, epirubicin hydrochloride, mitoxantrone hydrochloride and daunorubicin hydrochloride show morphological changes of the nucleus pulposus.

<Screening method>
The present invention comprises, as one embodiment, a method of screening a substance having antiflavivirus activity, which comprises the following steps:
(A) Biological cells are contacted in vitro with candidate compounds of substances with antiflavivirus activity.
(B) Investigate whether the candidate compound affects the morphology of the nucleolus in the biological cell.
(C) Provided is a method for identifying the candidate compound as a substance having antiflavivirus activity if it has an influence. Hereinafter, a specific description will be given.

The "substance having anti-flavivirus activity" and "candidate compound thereof" used in the present specification will be described.
The term "flaviviridae" means a virus of the Flaviviridae family, which is composed of enveloped viruses having a plus-strand RNA as a genome, and includes more than 70 currently known viruses. For example, mosquito-borne flaviviruses include Japanese encephalitis virus (JEV), dengue virus (DENV), Zika virus (ZIKV), West Nile virus (WNV), yellow fever virus (YFV), St. Louis encephalitis virus (SLEV), and Khun. There are dengue virus (KUN), Murray Valley encephalitis (MVEV), etc., and examples of tick-borne flavivirus include tick-mediated encephalitis virus (TBEV) (Gubler DJ, Kuno G, Markoff L: Flaviviruses. In: Fields virology (Fifth edition). Knipe DM, Howley PM (Ed), Lippincott-Raven, Philadelphia, PA, 1153-252, 20071). In addition, 14 species of flavivirus of unknown carrier have been reported.

"Flavivirus" is typically Japanese encephalitis virus (JEV), dengue virus (DENV), Zika virus (ZIKV), Westnile virus (WNV), and more typically Japanese encephalitis virus (JEV) dengue virus (DENV). , Zika virus (ZIKV).
JEV spreads to dead-end hosts, including humans, by biting by JEV-infected mosquitoes, causing high-mortality central nervous system infections (Burke, DS, and TP Monath. 2001. Flaviviruses, p. 1043- 1125. In DM Knipe, PM Howley, DE Griffin, RA Lamb, MA Martin, B. Roizman, and SE Straus (ed.), Fields virology, 4th ed., Vol. 1. Lippincott Williams & Wilkins, Philadelphia, Pa) .. JEV has a positive-strand RNA genome approximately 11 kb long, which is capped at the 5'end but lacks 3'end modification by polyadenylation (Lindenbach, BD, and CM). Rice. 2001. Flaviviridae: The viruses and their replication, p. 991-1041. In DM Knipe, PM Howley, DE Griffin, RA Lamb, MA Martin, B. Roizman, and SE Straus (ed.). Fields virology, 4th ed., vol. 1. Lippincott Williams & Wilkins, Philadelphia, Pa.). Genomic RNA encodes a single large open reading frame, and polyproteins translated from the genome are cleaved simultaneously and after translation by host and viral proteases of the core, precursor membrane (prM) and envelope (E) proteins. It yields three structural proteins and seven nonstructural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5 (Sumiyoshi, H., et al. Virology 161: 497-510). The core protein of JEV (also known as C protein or capsid protein) has little amino acid homology with other flaviviridae, for example, only 25% homology with flavivirus encephalitis virus (TBEV), while The hydrophobic profile, number of basic amino acid residues and secondary structure are very similar (Dokland, T., et al. Structure 12: 1157-1163 .; Jones, CT, et al. J. Virol). . 77: 7143-7149 .; Ma, L., et al. Proc. Natl. Acad. Sci. USA 101: 3414-3419). Flavivirus core proteins commonly contain two hydrophobic sequences at the center and at the carboxyl terminus, with the carboxyl terminus hydrophobic region serving as the prM signal sequence. The signal anchor sequence is cleaved by the viral protease NS2B-3, which is required for the subsequent release of the prM amino terminus by the host signal peptidase (Lobigs, M., and E. Lee. 2004. J. Virol. 78: 178-186; Stocks, CE, and M. Lobigs. 1998. J. Virol. 72: 2141-2149; Yamshchikov, VF, and RW Compans. 1994. J. Virol. 68: 5765-5771). Mature core proteins released from the endoplasmic reticulum (ER) membrane are thought to bind to genomic RNA via amino-terminal and carboxyl-terminal basic amino acid clusters to form nucleocapsids (Khromykh, AA, and EG Westaway. 1996. Kunjin. Arch. Virol. 141: 685-699). The central hydrophobic region of the core protein may be associated with the ER membrane, which is thought to facilitate the assembly of the nucleocapsid with the two membrane proteins prM and E and germinate into the ER lumen as a virion. (Markoff, L., B. Falgout, and A. Chang. 1997. Virology 233: 105-117). Removal of the central hydrophobic region of the TBEV core protein increases the production of subviral particles consisting of (pr) M and E proteins but lacking the core protein and genomic RNA (Kofler, RM, FX Heinz, and CW Mandl. 2002. J. Virol. 76: 3534-3543 .; Kofler, RM, et al. 2003. J. Virol. 77: 443-451.).

The term "anti-flavivirus" or "anti-flavivirus activity" in the present invention reduces, inhibits, blocks or prevents flavivirus replication, cell invasion and / or cell flavivirus infection, resulting in flavivirus. It means any effect that suppresses or inhibits the life cycle of a virus and eliminates or reduces the virus activity.

The "substance having anti-flavivirus activity" or "active ingredient having anti-flavivirus activity" in the present invention refers to a substance capable of treating or preventing a subject suffering from or infected with flavivirus by eliminating or reducing flavivirus. means. The terms "affected by flavivirus" or "infected with flavivirus" are used in connection with a subject and mean infected by flavivirus and having a flavivirus-related disease. "Flavivirus-related disease" means any disease or disorder known or suspected to be associated with and / or directly or indirectly caused by flavivirus. The main symptoms of flavivirus-related diseases are fever, headache, myalgia, and arthralgia, especially severe hemorrhagic fever caused by dengue virus, encephalitis caused by Zika virus, Japanese encephalitis virus, Westnile virus, and tick-borne encephalitis virus. Includes, but is not limited to, small head disease caused by Zika virus.

The term "candidate compound" in the present invention refers to any natural or non-natural molecule, such as a biological polymer such as a nucleic acid, polypeptide or protein, an organic or inorganic molecule, or an organism to test for activity of interest. It means an extract prepared from a scientific material such as a cell or tissue of a bacterium, fungus, plant or animal (including especially mammals and humans). In the screening method of the present invention, candidate compounds are evaluated for their ability to have a given antiflavivirus activity. Not limited, but refers to natural and non-natural compound libraries, medicinal plant extracts, peptides, antibodies, nucleic acid turbulence rallies, etc. owned by universities, companies, etc.

The "biological cell" used in the screening method of the present invention refers to a substantially homologous cell population, preferably at least about 80%, more preferably at least about 100% of the cells in the population of the same cell type. be. Examples of cell types include, but are not limited to, platelets, lymphocytes, T cells, B cells, natural killer cells, endothelial cells, tumor cells, epithelial cells, granulocytes, monocytes, mast cells, nerve cells and the like. Preferred include eukaryotic-derived cultured cell lines and primary cultured cells, including mammalian animals, such as human liver-derived Huh7 cells and monkey kidney-derived Vero cells, and mosquito-established cells such as C6 / 36 cells. Any cell that can observe nucleoli can be a target. As will be described later, one aspect of the screening method of the present invention includes a first step of confirming morphological abnormalities of nucleoli and a second step of confirming viral replication. The "biological cells" used in the first stage are all cells in which nucleoli can be observed, and the "biological cells" used in the second stage are preferably virus-sensitive cells, more preferably. Are flavivirus-sensitive cells.

"Virus-sensitive cell" means any cell that can be infected with a virus, including but not limited to brain cells, primary cells, dendritic cells, placenta cells, endometrial cells, lymph node cells, lymphocyte-like cells. Includes (B and T cells), peripheral blood mononuclear cells, skin cells, Langerhans cells, and monospheres / macrophages.

The cells used in the screening method of the present invention may be prepared by techniques well known in the art, eg, cells may be obtained by blood sampling from a patient or healthy person or by biopsy, or by an immune and microbial supplier, eg. It may be purchased from the American Type Culture Collection, Manassas, VA.

The cells used in the present invention can be cultured according to standard cell culture techniques. For example, cells are grown in a suitable container in an incubator containing humidified 95% air-5% CO ₂ in a sterile environment at 37 ° C. The container may contain agitated or standing medium. Various cell cultures may be used, including media containing unclear biofluids (eg, fetal bovine serum) and fully established media, such as 293 SFM serum-free medium (Invitrogen Corp., Carlsbad, CA). )including. Cell culture techniques are well known in the art and established protocols are available for culturing a variety of cell types (eg, RI Freshney, "Culture of Animal Cells: A Manual of Basic Technique", See 2nd Edition, 1987, Alan R. Liss, Inc.).

In certain embodiments, the screening method of the present invention is performed using cells contained in multiple wells of a multi-well assay plate. Such assay plates include, for example, commercial products from Strategene Corp. (La Jolla, CA) and Corning Inc. (Acton, MA), including, for example, 48-well, 96-well, 384-well, and 1536-well plates. ..

"Contact in vitro" means, for example, adding a candidate compound of a substance having antiflavivirus activity adjusted to a predetermined concentration to cells contained in a plurality of wells of a multi-well assay plate. The candidate compound is then examined for a given "anti-flavivirus activity".

"Predetermined antiflavivirus activity" is
(B) Investigate whether the candidate compound affects the morphology of the nucleolus in the biological cell.
(C) If the candidate compound has an influence, it is identified as a substance having antiflavivirus activity. Specifically, in step (c), the effect of the candidate compound is a morphological abnormality of the nucleolus in biological cells.

The method for determining the predetermined anti-flavivirus activity in the candidate compound is based on the following first findings by the present inventors. The present inventors sought antiviral treatment for flavivirus infection, studied diligently, and initially sought another target, but the target of the event that inhibits viral replication is not the essence, and the nucleus in biological cells. I happened to discover that the nucleolus is related.

The nucleoli present in the nucleus of biological cells are eukaryotic-specific structures that can be clearly observed with an optical microscope and are mainly responsible for ribosome biosynthesis. The main components are ribosomal DNA (rDNA), ribosomal RNA (rRNA), ribosomal proteins, etc., and proteomics analysis of constituent proteins using proteomics techniques is progressing (Anderson et al., Nature volume 433: 77-83). ). From the observation with an electron microscope, the structure of the nucleolus is divided into three regions according to the difference in electron density. The fiber center (FC) with the lowest electron density exists in the center, and the dense fibrillar component (DFC) with the highest electron density surrounds the fiber center (FC). In addition, there is a granular component (GC) with the second highest electron density around FC and DFC. The nucleolus exists as a clear intranuclear structure in the interphase, but in the mitotic phase, the structure collapses and reshapes in the early G1 phase when the activity of ribosome biogenesis is restored, depending on the cell cycle. To change its structure. In addition, there are 1-6 nucleoli in the nucleus, but the number is not clearly defined because the nucleoli fuse with each other after the cells enter interphase.

That is, we happened to find that certain pharmacologically active compounds affect the morphology of nucleoli in biological cells, which in some way inhibits viral replication. I found it.
As part of the viral replication function of flavivirus, the core protein, which is one of the constituent proteins, utilizes the nucleolus function of the host cell, which is considered to be essential for viral replication. In the present invention, although not bound by a specific theory, it is considered that the morphological abnormality of the nucleolus adversely affects the functioning of the core protein. The nucleolus is the transcription site of ribosomal RNA (rRNA) and the synthesis site of ribosomal RNA, and under normal conditions, the core protein is localized in the nucleolus and is involved in the protein synthesis of the host. For example, normal nucleoli are presumed to relatively enhance viral protein translation by promoting viral protein synthesis or suppressing host cell protein synthesis. The effect of certain substances on nucleolus morphology found in the present invention is believed to be due to the effect of reducing or destroying this normal nucleolus function.

Specifically, in the screening method of the present invention, predetermined antiflavivirus activity, i.e., nucleolar morphological abnormalities in biological cells, is the presence and / or locality of proteins or nucleic acids localized in the nucleolus. It is determined by the change in existence.
Changes in the presence and / or localization of proteins or nucleic acids localized in the nucleolus replace the changes in the formation state of the nucleolus itself that are found in comparison to the effects of control compounds. The presence and / or change in localization of proteins or nucleic acids localized in the nucleolus causes the nucleolus to change from a large mass to many small oil droplets, or the tiny particles are dispersed and invisible. On the contrary, it is determined by the mass of the nucleolus becoming a larger mass. If there is such a change compared to the effect of the control compound on the protein localized in the nucleolus, it is determined that the candidate compound has an effect on the morphology of the nucleolus.

Here, the "protein localized in the nucleolus in a biological cell" means a protein inherent in the nucleolus or a protein that specifically binds to the nucleolus. Proteins inherent in the nucleus body include nucleophosmin (also known as NPM, NPM1, B23, NO38, Numatrin), nucleolin (also known as C23, NCL), fibrillarin (also known as FBL) and RNA. Polymer type I (RNA polymerase 1, also known as Pol1) is mentioned, and examples of proteins that specifically bind to nuclear bodies include flaviviruses such as Japanese encephalitis virus and hepatitis C virus, and core proteins of coronavirus. Other names include, but are not limited to, capsid proteins (Rawlinson and Moseley, 2015. Cellular Microbiology; Salvetti and Greco, 2014. Biochemica et Biophysica Acta).
Necrophosmine is a protein that binds to ribonucleic acid (RNA) located in the outermost granular element (GC) region of the nucleolus structure. Nucleolin is a protein that is mainly localized in the high-density fibrous element (DFC) of the nucleolus and is involved in the transcription of ribosomal deoxyribonucleic acid (rDNA). Fibrillarin is a protein that is localized in the fibrous element (FC) and high-density fibrous element (DFC) of the nucleolus and binds to RNA to function in the processing and modification of rRNA precursors. RNA polymerase I is one of the enzymes (RNA polymerase) that catalyzes the reaction (transcription) of reading the base sequence of the template strand (single strand) of DNA and synthesizing complementary RNA. RNA polymerase I is present in the nucleolus and synthesizes rRNA precursors.

Changes in the presence and / or localization of proteins that specifically bind to these nuclei include, for example, anti-necrophosmine antibody (anti-NPM1 antibody) (ab10530, Abcam, UK), anti-nucleolin antibody (anti-NCL antibody). Immunofluorescent antibody method using (A300-710A, Bethyl Laboratories, TX), anti-fibrillarin antibody (GTX24566, GeneTex, CA), anti-RNA polymerase I antibody (anti-POLI antibody) (13635-1-AP, Proteintech, IL) Can be observed by. In addition, these proteins bind nucleic acids encoding these proteins to nucleic acids encoding fluorescent substances such as green fluorescent protein (GFP), and transfer the bound nucleic acids into cells, or fuse endogenous proteins and fluorescent substances. It can be observed by a fluorescent imaging method by microinjecting the recombinant protein into cells.

"Nucleic acid localized in the nucleolus in a biological cell" means a nucleic acid inherent in the nucleolus or a nucleic acid that specifically binds to the nucleolus. Nucleic acids contained in the nucleolus include ribosomal deoxyribonucleic acids (also known as ribosomal DNA or rDNA). rDNA is a repeating sequence consisting of 43 kb (coding region 13.7 kb, non-coding region 29.3 kb) as one unit. In humans, it is a short of chromosomes 13, 14, 15, 21, 21, and 22. DNA that exists in the nuclear short arm of the arm-shaped chromosome.
Changes in the presence and / or localization of these rDNA can be observed by the FISH (Fluonecsence In Situ Hybridization) method. The FISH method is a method in which, for example, a specific gene sequence of rDNA is hybridized with a target gene using an oligonucleotide probe labeled with a fluorescent substance or the like and detected with a fluorescence microscope.

It has been known that flavivirus core proteins can represent nucleoli morphology by visualizing the localization of nucleoli in biological cells (Tsuda et al., 2006 Microbiol. Immunol., 50, 225-234). It is based on this finding that the flavivirus core protein is used in the present invention to determine the effect on the morphology of the nucleolus.
The core protein of flavivirus is expressed intracellularly with a gene transfer reagent such as lipofectamine (ThermoFisher), or a recombinant protein purified from Escherichia coli or insect cells is microinjected using a glass needle to form a biological cell. Inject into the cytoplasm and observe its localization. The core protein of flavivirus is a plasmid in which a DNA encoding the core protein is introduced into Escherichia coli or baculovirus, and in the case of Escherichia coli, it infects the cells in the cells, and in the case of baculovirus, it infects sf9 insect cells in the insect cells. The protein expressed by disrupting bacterial cells and insect cells and the tag protein such as antibody and glutathione-S-transferase are adsorbed and purified with Sepharose beads cross-linked with the specific binding protein. Can be manufactured.
Changes in the localization of flavivirus core proteins include, for example, immunofluorescence antibody methods using anti-Flag antibodies against core proteins fused with anti-flavivirus antibodies and Flag tags, and fusion proteins fused with fluorescent proteins such as GFP. The cells expressing or introducing the protein can be observed with a fluorescent microscope, a confocal microscope, a super-resolution microscope, an electron microscope, or the like.

Thus, in the screening method of the present invention, the protein localized in the nucleolus in biological cells is selected from necrophosmine, nucleolin, fibrillarin, RNA polymerase I and the core protein of flavivirus. Included are the methods of the invention, which are one or more proteins. The use of two or more proteins localized in the nucleolus is preferred from the standpoint of certainty of the candidate compound.

In certain embodiments, the methods of the invention
(1) Conditions sufficient to bring a biological cell into in vitro contact with a candidate compound of a substance having antiflavivirus activity so that the candidate compound affects the morphology of the nucleolus in the biological cell. And in vitro for hours,
(2) Investigate whether the candidate compound affects the morphology of the nucleolus in the biological cell.
(3) The influential candidate compound is identified as a substance having antiflavivirus activity. Candidate compounds that affect the morphology of nucleoli in said biological cells are identified as potential antiflavivirus drugs.

The present invention also, in a preferred embodiment,
(1) Conditions sufficient to bring a biological cell into in vitro contact with a candidate compound of a substance having antiflavivirus activity so that the candidate compound affects the morphology of the nucleolus in the biological cell. And in vitro for hours,
(2) Investigate whether the candidate compound affects the morphology of the nucleolus in the biological cell.
(3) The influencing candidate compounds were selected, and (4) the selected candidate compounds were examined for changes in the localization of the virus core protein in biological cells.
(5) If the localization of the core protein changes along with the effect on the morphology of the nucleolus, it is identified as a substance having antiflavivirus activity.

The screening method in the present invention leads to the discovery and development of antiflavivirus drugs that exert their effects by affecting the morphology of nucleoli in biological cells. These drugs may be potentially useful in the treatment and / or prevention of flavivirus infections and / or flavivirus-related diseases and conditions. The present invention includes any of the compounds identified as substances having anti-flavivirus activity by the screening method of the present invention.

The effects on nucleolar morphology in biological cells found by us can be used as targets for the identification, design and development of new antiflavivirus drugs. Substances that affect the morphology of nuclei in biological cells useful as anti-flavivirus drugs belong to a wide variety of molecular families, including but not limited to organic compounds (eg, small molecules, saccharides, steroids, etc.). , Monoclonal or polyclonal antibodies (eg, antibodies that bind to the nuclear translocation of flavivirus core proteins), peptides, polypeptides, nucleic acid molecules (eg, antisense compounds, ribozymes, triple helix molecules, SELEX RNA, etc.).

Screening of libraries according to the methods of the invention provides compounds with desired but unoptimized biological activity, commonly referred to as "hit" or "lead" compounds. The next step in developing a useful drug candidate usually involves an analysis of the relationship between the chemical structure of the hit compound and its biological or pharmacological activity. Molecular structure and biological activity can be associated by observing the results of overall structural modifications for a given biological indicator. The structure-activity relationship information available from the first screening can then be used to generate a small compound library, which is then screened for compounds with higher affinity. The process of performing synthetic modifications of biologically active compounds to meet the steric electronic, physicochemical, pharmacokinetic and toxicological factors required for clinical utility is lead optimization. Candidate compounds identified by the screening method of the invention, called, can also be applied early in read optimization. Drug candidates that have been chemically modified and improved by lead optimization can be included in the present invention to the extent appropriate. The appropriate range is a range that can be understood by those skilled in the art that a drug candidate compound that affects the morphology of the nucleolus of biological cells in the present invention has a certain range of chemical structures and exhibits similar activity.

The screening methods described herein can be kits. For example, the biological cells disclosed herein can be packaged in various containers such as vials, tubes, microtiter well plates, bottles, and other reagents can be included in separate containers for kitting. This includes a positive control sample or compound, a negative control sample or compound, a buffer solution, a cell culture solution, a specific detection probe, and the like, and can be used as a kit as a whole.

<Anti-flavivirus pharmaceutical composition>
In another aspect, the invention is an antiflavivirus pharmaceutical composition comprising a substance that affects the morphology of the nucleolus in a biological cell, preferably a substance that affects the morphology of the nucleolus in a biological cell. As an active ingredient having anti-flavivirus activity, an anti-flavivirus pharmaceutical composition, specifically, an anti-flavivirus pharmaceutical composition containing a substance that causes morphological abnormalities of the nucleolus, preferably the morphology of the nucleolus. Provided is an anti-flavivirus pharmaceutical composition containing a substance causing an abnormality as an active ingredient having anti-flavivirus activity. Hereinafter, a specific description will be given.
The term "flavivirus" has the above meaning, and the terms "anti-flavivirus" or "anti-flavivirus activity" are used interchangeably, with flavivirus replication, cell invasion and / or cell flavi. It means any effect that reduces, inhibits, blocks or prevents viral infections, resulting in suppression, inhibition of the flavivirus life cycle and elimination or reduction of viral activity.

Therefore, the "anti-flavivirus pharmaceutical composition" means a pharmaceutical composition capable of treating or preventing a subject suffering from or infected with flavivirus by eliminating or reducing flavivirus. The terms "affected by flavivirus" or "infected with flavivirus" are used in connection with a subject and mean infected by flavivirus and having a flavivirus-related disease. The term "flavivirus infection" can refer to the introduction of flavivirus genetic information into target cells (eg, by fusion of the target cell membrane with flavivirus or flavivirus envelope glycoprotein positive cells). "Flavivirus-related disease" refers to any disease or disorder associated with flavivirus and / or known or suspected to be directly or indirectly caused. The main symptoms of flavivirus-related diseases are fever, headache, myalgia, and arthralgia, especially severe hemorrhagic fever caused by dengue virus, encephalitis caused by Zika virus, Japanese encephalitis virus, Westnile virus, and tick-borne encephalitis virus, and Zika. Includes, but is not limited to, viral encephalgia. Regarding anti-flavivirus activity, specifically, flavivirus is an anti-flavivirus activity selected from Japanese encephalitis virus, dengue virus, Zika virus, West Nile virus, and yellow fever virus.

"Treatment" as used herein means (1) delaying or preventing the onset of a disease or condition (eg, flavivirus infection or flavivirus-related disease); (2) progression, exacerbation, or exacerbation of symptoms of the disease or condition. It means slowing down or stopping the exacerbation; (3) providing relief of the symptoms of the disease or condition; or (4) a method or process aimed at curing the disease or condition. Treatment may be given as a prophylactic measure before the onset of the disease or condition, or treatment may be given after the onset of the disease.

The term "prevents, inhibits or blocks flavivirus infection" refers to the amount of flavivirus genetic information introduced into susceptible cells or populations of susceptible cells when using substances with anti-flavivirus activity. Means to reduce compared to the amount that would be introduced in the absence.

As used herein, a "pharmaceutical composition" comprises an effective amount of at least one substance having antiflavivirus activity and at least one pharmaceutically acceptable carrier or excipient. As used herein, the term "effective amount" is sufficient to satisfy its intended purpose, eg, a desired biological or pharmacological response in a cell, tissue, system, or subject. Means any amount. For example, in certain embodiments of the invention, an object is to have antiflavivirus activity, to prevent flavivirus infection, to prevent the development of flavivirus-related diseases, to the progression of symptoms of flavivirus-related diseases, It means slowing down, reducing or stopping exacerbations or exacerbations, providing remission of the symptoms of the disease, and / or curing flavivirus-related diseases.

"Pharmaceutically acceptable carrier or excipient" refers to a carrier medium that does not interfere with the effectiveness of the biological activity of the active ingredient and is not excessively toxic to the host at the concentration at which it is administered. .. The term includes solvents, dispersion media, coating agents, antibacterial and antifungal agents, isotonic agents, and adsorption retarders. The use of such media and drugs for pharmaceutically active substances is well known in the art.

In the present invention, the "substance that affects the morphology of the nucleolus in a biological cell" refers to the nucleolus, which is the place of transcription of ribosomal RNA (rRNA) and the synthesis of ribosomal RNA in the biological cell of the present invention. It means a substance that affects and changes its morphology, and specifically, a substance that causes morphological abnormalities of nucleoli. As described above, nucleolar morphological abnormalities in biological cells are determined by the formation and / or changes in localization of proteins localized in the nucleolus in the present invention. Preferably, these substances are sorted by the screening method of the present invention.

In the present invention, a substance that affects the morphology of nucleoli in biological cells, in one embodiment, exerts antiflavivirus activity by inhibiting viral replication. In the present invention, preferably, a pharmaceutical composition in which viral replication inhibition involves a change in the localization of a virus core protein in biological cells. This is because viral replication inhibition, which ultimately exhibits antiflavivirus activity, involves localization of the flavivirus core protein.

Specific "substances that affect the morphology of nuclear bodies in biological cells" are substances with cyclin-dependent kinase (CDK) inhibitory activity, substances with rRNA transcription inhibitory activity, and DNA topoisomerase. It is selected from a substance having an inhibitory activity or a substance having a glycogen synthase kinase-3 (GSK-3) inhibitory activity.

"CDK" in a substance having CDK inhibitory activity means a phosphorylating enzyme that has activity only after binding to a cyclin in a group of kinases that control the cell cycle, such as CDK1 (or cdc2), CDK2, CDK4, and CDK6. Each is activated at different points in the cell cycle. Cyclin is a protein that translocates the cell cycle in eukaryotic cells, and cyclins A, B, D, and E are involved in the rotation of the cell cycle. Cyclin A mainly binds to CDK1 and CDK2 to form a complex and controls the end of the DNA synthesis phase. Cyclin B primarily binds to CDK2 to form a complex and control its progression to mitosis. Cyclin D mainly binds to CDK4 and CDK6 to form a complex and controls the transition between the DNA synthesis preparatory phase / DNA synthesis phase. Cyclin E mainly binds to CDK2 to form a complex and control the transition to the DNA synthesis phase. Substances having CDK inhibitory activity usually show an action of inhibiting CDK activity and suppressing cell proliferation, and many of them have been developed as anticancer agents by utilizing this action, and among them, CDK4 / 6 Inhibitor Ibrance (generic name: palbociclib, Pfizer Japan Inc.) is available. In the present invention, substances that inhibit CDK1, CDK2, and CDK9 are preferable.

More specifically, the substances having CDK inhibitory activity are 2-cyanoethyl alvocidibolone, 5-amino-3-((4- (aminosulfonyl) phenyl) amino) -N- (2,6-difluorophenyl). ) -1H-1,2,4-triazole-1-carbothioamide, (4- (2-amino-4-methylthiazole-5-yl) pyrimidin-2-yl)-(3-nitrophenyl) amine, P276 -00, A-674563, SU9516, SNS-032 (BMS-387032), Dynacyclib (Dinaciclib, SCH727965), Flavopilidol (Alvocidib), AT7519, Flavopilidol HCl (Flavopiridol HCl), P276- Selected from 00, AT7519 HCl, AZD5438, R547, and Kenpaullone. Substances with preferred CDK inhibitory activity are 2-cyanoethylartellopaulone, 5-amino-3-((4- (aminosulfonyl) phenyl) amino) -N- (2,6-difluorophenyl) -1H-1. , 2,4-Triazole-1-Carbothioamide, (4- (2-amino-4-methylthiazole-5-yl) pyrimidin-2-yl)-(3-nitrophenyl) amine, P276-00, A- Selected from 674563 and SU9516. Substances with more preferred CDK inhibitory activity are 2-cyanoethylartellopaulone, 5-amino-3-((4- (aminosulfonyl) phenyl) amino) -N- (2,6-difluorophenyl) -1H- Selected from 1,2,4-triazole-1-carbothioamide, and (4- (2-amino-4-methylthiazole-5-yl) pyrimidin-2-yl)-(3-nitrophenyl) amine ..

Specifically, 2-cyanoethylartellopaulon: 3- (6-oxo-9-nitro-5,6,7,12-tetrahydroindro [3,2-d] [1] benzazepin-2-yl) Propion Nitrile (Kunick, C., et al. 2005. ChemBioChem. 6, 541-549.)

5-Amino-3-((4- (aminosulfonyl) phenyl) amino) -N- (2,6-difluorophenyl) -1H-1,2,4-triazole-1-carbothioamide (Lin, R., et al. 2005.J. Med. Chem. 48, 4208-4211.)

(4- (2-Amino-4-methylthiazole-5-yl) pyrimidin-2-yl)-(3-nitrophenyl) amine (Kontopidis, G., et al. 2006. Chem. Biol. 13, 201. )

SNS-032 (BMS-387032): Chen R, et al. 2009. Blood, 113 (19), 4637-45; Ali MA, et al., 2007. Neoplasia, 9 (5), 370-81; Conroy A , et al. 2009, Cancer Chemother Pharmacol, 64 (4), 723-32; Walsby E, et al. 2011. Leukemia, 25 (3), 411-9.

Dynasicrib (Parry D, et al. 2010. Mol Cancer Ther. 9 (8), 2344-2453; Guzi TJ, et al., 2011. Mol Cancer Ther., 10 (4), 591-602; Abdullah C, et al. 2011. Cell Cycle., 10 (6), 977-988; Fu W, et al., 2011. Mol Cancer Ther., 10 (6), 1018-1027)

Fravopyridor (Arbosideb) (Kim KS, et al. 2000. J Med Chem, 43 (22), 4126-4134; Lu H, et al. 2005. J Med Chem, 48 (3), 737-743; Montagnoli A, et al. 2008. Nat Chem Biol, 4 (6), 357-365; Carlson BA, et al. 1996. Cancer Res, 56 (13), 2973-2978)

AT7519: (Squires MS, et al. 2009. Mol Cancer Ther, 8 (2), 324-332; Santo L, et al. 2010. Oncogene, 29 (16), 2325-2336)

Flavopyridol Hydrochloric Acid (Senderowicz AM, 2002. Oncologist, 7 Suppl 3: 12-9; Carlson BA, et al, 1996. Cancer Res, 56 (13), 2973-2978; Parker BW, et al, 1998. Blood, 91 (2), 458-465; Drees M, et al, 1997. Clin Cancer Res, 3 (2), 273-279)

P276-00: (Joshi KS, et al. 2007. Mol Cancer Ther, 6 (3), 918-925; Joshi KS, et al. 2007. Mol Cancer Ther, 6 (3), 926-934)

AT7519 HCl: (Squires MS, et al. 2009. Mol Cancer Ther, 8 (2), 324-332; Santo L, et al. 2010. Oncogene, 29 (16), 2325-2336)

AZD5438: (Byth KF, et al. 2009. Mol Cancer Ther. 8 (7), 1856-1866)

A-674563: (Luo Y, et al, 2005. Mol Cancer Ther, 4 (6), 977-986; Zhu QS, et al, 2008. Cancer Res, 68 (8), 2895-2903; Tatsuya Okuzumi, et al, 2010. Mol Biosyst, 6 (8), 1389)

R547: (Rodriguez A, et al. 2006. Mol Cancer Ther, 5 (11), 2644-2658; Chu XJ, et al. 2006. J Med Chem, 49 (22), 6549-6560; Berkofsky-Fessler W, et al. 2009. Mol Cancer Ther, 8 (9), 2517-25)

Kemporoon (Zaharevitz et al. 1999. Cancer Res. 59 (11): 2566-2569; Adam COLE, et al. 2004. Biochem. J. 377 (1): 249-255; Leclerc S, et al. 2001. J Biol Chem. 276 (1): 251-260)

SU9516: (Lane ME, et al. 2001. Cancer Res. 61 (16), 6170-6177; Gao N, et al. 2006. Mol Pharmacol. 70 (2), 645-655; Uchiyama H, et al. 2010 .Cancer Sci. 101 (3), 728-734; Leontovich AA, et al. 2013. Oncol Rep. 29 (5), 1785-1788)

RRNA transcription means a reaction in which a transcription initiation complex containing RNA polymerase I is formed on the promoter of rDNA encoding ribosomal RNA (rRNA), and rRNA is synthesized. A substance having rRNA transcription inhibitory activity usually suppresses or inhibits transcription of rRNA such as RNA polymerase I, and as a result, exhibits an action of inhibiting rRNA synthesis. A substance having rRNA transcription inhibitory activity is typically selected from among Actinomycin D, Doxorubicin, and Aclarubicin, which are detailed below. Treatment with actinomycin D is known to induce nucleolar collapse (Scheer et al., 1975. 65: 163-179).

Actinomycin D: Inhibition of rRNA transcriptional activity by actinomycin D results in nucleolar segregation in which DFC and GC form cap-like structures around the nucleolus (Scheer et al., 1975. 65: 163-179). (Waksman SA et al., 1940. Proc. Soc. Exp. Biol. Med. 45, 609-614; Goldberg IH et al., 1962. Science. 136, 315-316; Sobell HM et al., 1985. Proc . Natl. Acad. Sci. USA. 82, 5328-5331)

Doxorubicin (Arcamone F., et al, 1969. Tetrahedron Lett. 13, 1007-1010; Taatjes DJ, et al, 1996. J. Med. Chem. 39, 4135-4138; Zeman SM, et al, 1998. Proc. Natl. Acad. Sci. USA. 95, 11561-11565)

Aclarubicin (Isoe T., et al., 1992. Biochim. Biophys. Acta. 1117, 131-135; Figueiredo-Pereira ME, et al., 1996. J. Biol. Chem. 271, 16455-16459; Natale RB, et al., 1993. Cancer Chemother. Pharmacol. 31, 485-488,)

DNA topoisomerase is an enzyme that temporarily cleaves one or both of double-stranded DNA and binds the cut point again. It is roughly classified into two types (type I and type II), and type I cleaves only one of the double strands of DNA and then recombines the cleaved DNA. Type II breaks the double strand and recombines. As a result, the DNA topoisomerase eliminates the twist and strain of the helical structure of DNA during replication. Substances that inhibit the activity of DNA topoisomerases usually inhibit the action of cutting and reconnecting DNA, and also form crosslinks between DNA to inhibit DNA replication. Substances with DNA topoisomerase inhibitory activity are typically doxorubicin, and Aclarubicin, Ellipticine, Idarubicin, Idarubicin HCl, epirubicin hydrochloride, as detailed below. It is selected from (Epirubicin HCl), Mitoxantrone HCl, and Daunorubicin HCl. A substance having a preferred DNA topoisomerase inhibitory activity is ellipticin.

Doxorubicin (same as above);
Aclarubicin (same as above);

Ellipticin (Stiborova M, et al. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2006 Jul; 150 (1): 13-23.)

Idarubicin

Idarubicin hydrochloride (Orlandi P, et al. J Chemother. 2005, 17 (6), 663-667.)

Epirubicin hydrochloride (Ozkan A, et al. Pol J Pharmacol, 2004, 56 (4), 435-444.)

Mitoxantrone hydrochloride (Nieciecka D., et al. Electrochimica Acta, 2015, 165, 430-442])

Daunorubicin hydrochloride (Fu Y, et al. Thromb Haemost, 2010, 104 (6), 1235-1241.)

GSK-3 was identified as a serine-threonine protein kinase that phosphorylates and inactivates glycogen synthase. In humans, it is classified into two isoforms, α and β, and is known to be involved not only in glycogen metabolism but also in many cell function controls. The substance that inhibits the activity of GSK-3 is typically 1-Azakenpaullone.

1-Azaken Paulon (Kunick C, et al. Bioorg Med Chem Lett. 2004, 14 (2), 413-416.)

As described above, the "substances that affect the morphology of nucleoli in biological cells" in the present invention include various known biology such as CDK inhibition, rRNA transcription inhibition, DNA topoisomerase inhibition, and GSK-3 inhibition. It has topoisomerase and has various chemical structures as described above. All compounds with different known activities and different chemical structures have the common action of "affecting the morphology of nucleoli in biological cells", thereby inhibiting flavivirus replication. Has been proven. That is, all compounds having a common action of "affecting the morphology of nucleoli in biological cells" inhibit flavivirus viral replication and have anti-flavivirus activity. It is proof of that. Although not bound by a specific theory, flavivirus utilizes the nucleolus function of the host cell as part of the viral replication function, and the morphological abnormality in the nucleolus first discovered in the present invention is It is thought that it adversely affects the functioning of core proteins and reduces or destroys normal nucleolar functions that promote the synthesis of virus-derived proteins.

Generally, a substance or composition having anti-flavivirus activity of the present invention is administered in an effective amount, that is, an amount sufficient to satisfy an intended purpose. The exact amount of anti-flaviviral activity substance or pharmaceutical composition administered will be the age, gender, weight and overall health of the subject being treated, the desired biological or medical response, among the subjects. It varies depending on (eg, prevention of flavivirus infection or treatment of flavivirus-related brain disease). In many embodiments, the effective amount is an amount that affects the morphology of the nucleolus in biological cells, inhibiting or preventing flavivirus from replicating in susceptible cells of the subject, thereby causing flavivirus infection. The amount to treat or prevent.

Substances and compositions having antiflavivirus activity of the present invention may be used in various therapeutic or prophylactic methods. In particular, the invention provides a method for treating or preventing a flavivirus-related disease or condition in a subject, which gives the subject an effective amount that affects the morphology of the nuclei of the biological cells of the invention. Including the administration of a substance having anti-flavivirus activity of the present invention or a composition thereof, which inhibits the flavivirus from invading or infecting the cells of a subject, thereby relieving a brain disease or medical condition in the subject. Can result in prevention or treatment.

The present invention, in a particular embodiment, administers a substance or composition having the antiflavivirus activity of the present invention alone. In another aspect, the substance or composition having antiflavivirus activity of the present invention is administered in combination with at least one additional therapeutic agent. The substance or composition having antiflavivirus activity of the present invention can be administered before, simultaneously with, and / or after the therapeutic drug is administered.

Therapeutic agents that can be administered in combination with substances or compositions with anti-flavivirus activity of the invention may have beneficial effects in the treatment, management or prevention of flavivirus infections or flavivirus-related diseases or conditions. It can be selected from a wide variety of biologically active compounds known in the art. Such drugs include, among other things, antiviral drugs, interferon (eg, interferon alpha, pegylated interferon alpha), antiflavivirus (monoclonal or polyclonal) antibodies, RNA polymerase inhibitors, protease inhibitors, IRES inhibitors, Includes helicase inhibitors, antisense compounds, ribozymes, and any combination thereof.

The substance having anti-flavivirus activity of the present invention is optionally formulated with one or more suitable pharmaceutically acceptable carriers or excipients for subjects who require it at the desired dose. It can be administered by any suitable route. Various delivery systems are known and can be used to administer substances with antiflavivirus activity of the invention, such as tablets, capsules, injections, encapsulants in liposomes, powders, etc. Includes microcapsules and the like. Methods of administration include transdermal, intradermal, intramuscular, intraperitoneal, intralesional, intravenous, subcutaneous, intranasal, lung, epidural, intraocular and oral routes. Administration can be systemic or topical.

Administration of a substance or composition having anti-flavivirus activity of the present invention can be such that the delivered amount is effective for the intended purpose. The route of administration, formulation, and dosage determine the desired therapeutic effect, the severity of the flavivirus infection or flavivirus-related condition to be treated (if already present), the presence of any other infection, the age and gender of the patient. , Body weight, and overall health and efficacy of the substance or composition with anti-flavivirus activity used, bioavailability and in vivo half-life, use (or unused) of combination therapy and other clinical factors Can depend on it. These factors can be easily determined by the attending physician during the course of treatment. Further information will be gained regarding appropriate dose levels and treatment times as tests are performed using substances with the antiflavivirus activity of the present invention.

The treatment of the present invention can consist of a single dose or multiple doses. Thus, administration of a substance having anti-flavivirus activity of the present invention, or a composition thereof, is constant or regular over a specific period of time, and at specific intervals, for example, once for several hours, once a day, for a week. It can be once, once a month (eg, time release form). Alternatively, the delivery can be a continuous delivery over a period of time, eg, an intravenous delivery.

In general, the amount of antiflavivirus-active substance administered is preferably from about 1 ng / kg to about 100 mg / kg of the subject's body weight, eg, about 100 ng / kg to about 50 mg / kg of the subject's body weight; or It can range from about 1 μg / kg to about 10 mg / kg of the subject's body weight.

Hereinafter, the present invention will be described in more detail with reference to Reference Examples and Examples, but it should be noted that these do not limit the scope of the present invention and are merely examples.

Reference Example 1: Nucleolus localization of flavivirus core protein The flavivirus core protein was expressed in cells and its localization was investigated.
Reference Example 1-1: Construction of transient cultured cell expression plasmid The core protein cDNA of Japanese encephalitis virus (JEV), dengue virus (DENV), and Zika virus (ZIKV) was distributed by the National Institute of Infectious Diseases. I received it. The West Nile virus (WNV) core protein cDNA was contract-synthesized by Integrated DNA Technologies (IDT, Inc., Illinois). Each core protein cDNA was amplified by PCR reaction using the following primers, and each amplified cDNA was obtained from the EcoRI of the pCAGGS vector containing Flag-tag (Miyazaki et al., (1989) Gene. 79: 269-77). In-Fusion HD Cloning Kit (Takara Bio Inc. Japan) was used to incorporate it into the site, and pCAGGS / flag-JEVcore, pCAGGS / flag-DENVcore, pCAGGS / flag-ZIKAcore and pCAGGS / flag-WNVcore were constructed.

JEV core:
Fw GCTGTACAAGCTCGAGATGACTAAAAAACCAGGAGG (SEQ ID NO: 1)
Rv ACAGGTTTTCCTCGAGTCTTTTGTTTTGCTTTCTGC (SEQ ID NO: 2)

DENV core:
Fw GCTGTACAAGCTCGAGATGAATAACCAACGGAAAAA (SEQ ID NO: 3)
Rv ACAGGTTTTCCTCGAGTCTGCGTCTCCTATTCAAGA (SEQ ID NO: 4)

ZIKV core:
Fw GCTGTACAAGCTCGAGATGAAAAACCCAAAGAAGAA (SEQ ID NO: 5)
Rv ACAGGTTTTCCTCGAGACGTCTCTTCCTCTCTTTCC (SEQ ID NO: 6)

WNV core:
Fw GCTGTACAAGCTCGAGATGTCTAAGAAACCAGGAGG (SEQ ID NO: 7)
Rv ACAGGTTTTCCTCGAGTCTTTTCTTTTGTTTTGAGC (SEQ ID NO: 8)

Reference Example 1-2: Transient cultured cell expression Hepatocellular carcinoma Huh7 cells (distributed from National Institute of Infectious Diseases) are in Dalveco-modified Eagle's medium (including 10% fetal bovine serum, 100 μg / mL penicillin, 100 μg). In / mL streptomycin), the cells were cultured at 37 ° C. under 5% CO2. 1 x 10 ⁵ Huh7 cells were seeded in a 35 mm dish (IWAKI, Japan) containing a 15 mm round microcover glass (Matsunami, Japan), cultured for 24 hours, and then pCAGGS / flag-JEVcore, pCAGGS / flag- DENVcore, pCAGGS / flag-ZIKAcore, and pCAGGS / flag-WNVcore were introduced using TransIT-LT1 Transfection Reagent (Mirus Bio LLC, WI). After 24 hours, cells were fixed with 4% paraformaldehyde and then treated with 0.5% Triton-X100 for 5 minutes. After incubating with 1000-fold diluted anti-Flag-tag antibody (SIGMA) for 60 minutes, washing with PBS, 2000-fold diluted anti-mouse secondary antibody (invitrogen) was added, and the mixture was incubated for 60 minutes. After washing with PBS, it was observed with a fluorescence microscope (olympus). The obtained results are shown in FIG. 1 (A). Cell nuclei were stained with DAPI (4', 6-diamidino-2-phenylindole dihydrochloride, DOJINDO, Japan, final concentration 0.2 μg / mL). Flag (upper) shows the intracellular localization of the examined core proteins (JEV core, DENV core, ZIKV core, WNV core). It can be seen that all proteins are localized in the cytoplasm and in the nucleus (nucleolus). DAPI (bottom) shows genomic DNA (cell nucleus).

Reference Example 1-3: Intracellular localization of baculovirus-derived core protein Similar to Reference Example 1-1, the core protein cDNAs of JEV, DENV, ZIKV and WNV are amplified by PCR, and AcGFP (Clontech) is added to the N-terminus. Baculovirus expression vector pFastBac1 (Thermo Fisher Scientific Inc, MA) in the form of a fusion of FLAG-One-STrEP (FOS) tag (Kouwaki T, et al. (2016) Journal of virology 90: 3530-3542) at the C-terminus. ) EcoRI site using In-Fusion HD Cloning Kit (Takara Bio Inc., Japan), pFastBac1 / AcGFP-JEVcore-FOS, pFastBac1 / AcGFP-DENVcore-FOS, pFastBac1 / AcGFP-ZIKAcore-FOS and pFastBac1 / AcGFP-WNVcore-FOS was constructed.

Transforming and accepting Escherichia coli (DH10 Bac (Thermo Fisher Scientific Inc)), baculovirus expression plasmid pFastBac1 / AcGFP-JEVcore-FOS, pFastBac1 / AcGFP-DENVcore-FOS, pFastBac1 / AcGFP-ZIKAcore-FOS and pFastBac1 / AcGFP- Transformed using WNVcore-FOS. 0.1 M isopropyl-β-D-thiogalactopyranoside (IPTG) and 25 mg / mL 5-bromo-4-chloro-3-indrill β-D- on a 2 × YT agar medium containing kanamycin, gentamicin, and tetracycline. 100 ul of galactopyranoside (X-Gal) was applied, and DH10 Bac transformed with the above plasmid for expressing baculovirus was sprinkled and cultured at 37 ° C. for 3 days. After culturing the colonies, plasmid DNA was extracted and gene-introduced into Sf9 insect cells (Thermo Fisher Scientific Inc) using the X-treme GENE 9 DNA transfection reagent (Roche Applied Science, Germany). After culturing at 27 ° C for 4 days, Sf9 insect cells were collected from 24 sheets of 10 cm petridish, and 12 mL cytolysis buffer (20 mM Tris-HCl (pH 7.4), 135 mM NaCl, 1% Triton X-100, Suspended in 10% glycerin). After centrifuging the cell suspension, 300 uL Strep-Tactin Sepharose was added to the supernatant and incubated at 4 ° C for 12 hours. Strep-Tactin Sepharose was washed with buffer W (100 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA) and then 2.4 mL buffer E (100 mM Tris-HCl (pH 8.0), pH 8.0), 150. The protein was eluted with mM NaCl, 1 mM EDTA, 2.5 mM desthiobiotin).

Each of the AcGFP fusion core proteins purified from baculovirus was microinjected into the cytoplasm of Huh7 cells together with the injection marker mouse IgG (Santa Cruz Biotechnology, Texas, USA) and incubated for 30 minutes. Mouse IgG was detected with Alexa Fluor594 anti-mouse secondary antibody (Thermo Fisher Scientific Inc.). The obtained results are shown in FIG. 1 (B). The Injection marker (bottom) indicates the intracellular localization of mouse IgG. Mouse IgG injected into the cytoplasm remains in the cytoplasm because it cannot translocate into the nucleus. From this, it can be seen that the sample is accurately driven into the cytoplasm and that the nuclear envelope is not physically destroyed by microinjection. GFP (upper) is the activity in which core proteins (GFP-JEV core, GFP-DENV core, GFP-ZIKV core, GFP-WNV core) microinjected into mouse IgG and cytoplasm are localized in the nucleus (nucleolus). Indicates that there is.

Reference Example 1-4: Proof of nuclear translocation activity and nucleolar localization activity of JEV core protein purified from baculovirus
The AcGFP-JEV core was mixed with an anti-mouse secondary antibody (Alexa Fluor Plus 555, Thermo Fisher Scientific Inc.), which is an injection marker, and microinjected into the cytoplasm of Huh7 cells. After incubation for 30 minutes, cells were fixed and immunofluorescent antibody method using anti-necrophosmine antibody (anti-NPM1 antibody) (ab10530, Abcam, UK) was performed. The secondary antibody used was an anti-mouse secondary antibody (Alexa Fluor 645, Thermo Fisher Scientific Inc.), and the genomic DNA (cell nucleus) was stained with DAPI.
The obtained results are shown in FIG. 1 (C). In the figure, the injection marker indicates that the fluorescence of the injection marker Alexa Fluor Plus 555 mouse IgG is present in the cytoplasm. This indicates that the injection marker remains in the cytoplasm where it was injected and does not translocate to the nucleus. JEV core indicates that the JEV core protein microinjected into the cytoplasm together with Alexa Fluor Plus 555 mouse IgG co-localizes with the nucleolar marker NPM1. This indicates that the JEV core protein has the activity of translocating to the nucleus and localizing to the nucleolus. NPM1 and DAPI indicate the presence of nucleoli and genomic DNA (cell nuclei), respectively.

Example 1
Screening of substances with anti-flavivirus activity using the intracellular localization change of JEV core as an index
A substance having antiflavivirus activity was screened using the GFP fluorescence (green) area present in the cell nucleus showing the intracellular localization change of the JEV core as an index.
Example 1-1: Preparation of stable expression cell line of JEV core protein Similar to Reference Example 1-1, the JEVcore gene cDNA amplified by PCR reaction is subjected to the lentiviral vector pLV- containing superfolder GFP-11 (sfGFP11). In-Fusion HD Cloning Kit (Takara Bio Inc.) was used to integrate into the EcoRI site of CAG (Okada Y, et al. (2007) Nat. Biotechnol 25: 233-237), and a stable expression cell line preparation plasmid pLV- A CAG / sfGFP-JEV core was constructed. The sfGFP1-10-SV40NLS gene cDNA is contract-synthesized by Integrated DNA Technologies (IDT, Inc., Illinois), and the lentiviral vector pFUGW (Addgene, plasmid # 14883) is combined with the neomycin resistance gene under the IRES (ribosome entry site inside mRNA) sequence. ) Incorporated into the EcoRI site using the In-Fusion HD Cloning Kit (Takara Bio Inc.) to construct the plasmid pFUGW / sfGFP1-10-SV40NLS.

The pLV-CAG / sfGFP-JEVcore cDNA and pFUGW / sfGFP1-10-SV40NLS cDNA were then introduced into Huh7 cells using TransIT-LT1 transfection reagent (Mirus Bio LLC) and 1 mg / mL G418 solution (nacalai tesque). ) Was added to selectively obtain introduced cells. In order to trace colonies, G418-resistant Huh7 was seeded at a low cell density, and single colonies with GFP fluorescence were collected under a fluorescence microscope to prepare a stable expression cell line of JEV core protein.

Example 1-2: Screening of a substance having anti-flavivirus activity 1 x 10 ⁴ sfGFP-JEVcore stable-expressing Huh7 cells prepared in Example 1-1 were seeded on a 96-well microplate (Greiner bio-one). After culturing in a 5% CO ₂ incubator at 37 ° C for 24 hours, standard inhibitor kit 3 ver1.5 (Table 1: Kinase inhibitor kit, Ministry of Education, Culture, Sports, Science and Technology's new academic area research "Characteristics of cancer research field, etc." Support activities based on this "Chemical therapy basic support activities (https://scads.jfcr.or.jp/kit/kit.html)) were added to the medium to a final concentration of 1 μM for another 24 hours. It was cultured.
After culturing, the cells were washed with PBS and then incubated with 3.7% formalin solution for 15 minutes to fix the cells, and genomic DNA (cell nuclei) was stained with (DOJINDO, Japan, final concentration 0.2 μg / mL). The plate was subjected to a high-throughput cell function search system CV7000S (Yokogawa Electric Co., Ltd.), and three fluorescence photographs were taken for each well to analyze the fluorescence intensity and intracellular localization of GFP.

The obtained results are shown in FIG. 2 (A). FIG. 2 (A) measures the GFP fluorescence (green) area existing in the cell nucleus using DAPI staining as an index, and graphs the average area of dots (green fluorescence) per cell (per nucleus). be. The horizontal axis shows the wells, and the vertical axis shows the average area of GFP fluorescence. The arrows indicate three CDK inhibitors (2-cyanoethyl Alsterpaullone (2-cyanoethl), Cdk1 / 2 inhibitor III (5-amino-3-((4- (aminosulfonyl) phenyl) amino)-). N- (2,6-difluorophenyl) -1H-1,2,4-triazole-1-carbothioamide), Cdk2 / 9 inhibitor ((4- (2-amino-4-methylthiazole-5-yl)) Wells to which pyrimidine-2-yl)-(3-nitrophenyl) amine)) have been administered are shown, indicating that the fluorescent area actually decreases.

FIG. 2B shows a fluorescence image when DMSO (control) and the above three CDK inhibitors are treated. It can be seen that during DMSO treatment, the sfGFP-JEV core is localized in the nucleoli that are clearly present in the nucleus. On the other hand, in the CDK inhibitor-treated cells, the fluorescence of the sfGFP-JEV core appears as small dots (dots). It can also be seen that the number of dots and the fluorescence brightness are different for each CDK inhibitor.

The details of the three CDK inhibitors are shown below.
2-Cyanoethyl asteropaulone: 3- (6-oxo-9-nitro-5,6,7,12-tetrahydroindro [3,2-d] [1] benzazepin-2-yl) propionnitrile ( Kunick, C., et al. 2005. ChemBioChem. 6, 541-549.)
Cdk1 / 2 Inhibitor III: 5-Amino-3-((4- (aminosulfonyl) phenyl) amino) -N- (2,6-difluorophenyl) -1H-1,2,4-triazole-1- Carbothioamide (Lin, R., et al. 2005. J. Med. Chem. 48, 4208-4211.)
Cdk2 / 9 inhibitor: (4- (2-amino-4-methylthiazole-5-yl) pyrimidine-2-yl)-(3-nitrophenyl) amine (Kontopidis, G., et al. 2006. Chem . Biol. 13, 201.)

Example 1-3: JEV core protein of nucleolar localization sfGFP-JEVcore was prepared in screening embodiments of CDK inhibitors to alter 1-1 stably expressing Huh7 cells 1 x 10 ⁵ pieces of 15 mm round micro After culturing a 35 mm dish (IWAKI, Japan) containing a cover glass (Matsunami, Japan) for 24 hours, a CDK inhibitor (Selleck Customized Library of 30 compounds: Cherry Pick Library (96- Well) -L2000-Z237098-100uL (Selleck.co.jp, Japan, Table 2)) was added, and the cells were further cultured for 24 hours.

After culturing, the cells were fixed with 4% paraformaldehyde and observed with a fluorescence microscope (olympus). Table 2 shows CDK inhibitors with altered nucleolar localization of sfGFP-JEVcore.
After culturing 1 x 10 ⁵ Huh7 cells in a 35 mm dish (IWAKI, Japan) containing a 15 mm round microcover glass (Matsunami, Japan) for 24 hours, pCAGGS / flag- prepared in Reference Example 1-1 JEVcore was introduced using TransIT-LT1 Transfection Reagent (Mirus Bio LLC, WI), and 24 hours later, a CDK inhibitor (Selleck Customized Library of 30 compounds (Selleck.co.jp, Japan) was used to reach a final concentration of 1 μM. , Table 2)) and further cultured for 24 hours. After culturing, cells were fixed and stained by the immunoassay method performed in Reference Example 1-2. Table 2 shows CDK inhibitors with altered nucleolar localization of JEV core (Flag-core).

表２中、「+」は阻害物質における各ＣＤＫに対する特異性を表し、「+」の数が多いほど、特異性と効果が高いことを意味する。表２から分かるとおり、調べたＣＤＫ阻害物質は複数のＣＤＫに対して効果を有している。

In Table 2, "+" represents the specificity of the inhibitor for each CDK, and the larger the number of "+", the higher the specificity and effect. As can be seen from Table 2, the investigated CDK inhibitors have an effect on a plurality of CDKs.

Example 2
Morphological changes of the nucleolus due to Cdk1 / 2 inhibitor III In Example 1, three CDK inhibitors, 2-cyanoethyl asteropoulone, Cdk1 / 2 inhibitor III and Cdk2 / 9 inhibitors actually have fluorescent areas. Was shown to be smaller.
The cell used is an sfGFP-JEVcore stable expression cell line in which the core protein is already present in the nucleus (nucleolus), and here, a CDK inhibitor is added to this cell line later. .. The following experiments were conducted to investigate how the localization of core proteins is changed.
Example 2-1: Abnormal nucleolus morphology due to Cdk1 / 2 inhibitor III treatment
Huh7 cells were cultured for 24 hours in the presence of Cdk1 / 2 inhibitor III at a final concentration of 1 μM, and then immunofluorescent antibody with anti-NPM1 antibody was applied. The secondary antibody used was an anti-mouse secondary antibody (Alexa Fluor 645), and the genomic DNA (cell nucleus) was stained with DAPI. The obtained results are shown in FIG. 3 (A).
DMSO treatment (1st image from the upper left, NPM1 staining (using x40 objective lens) and 2nd image from the upper left, NPM1 staining (strongly enlarged view), control) and Cdk1 / 2 inhibitor III treatment (3 from the upper left) Comparing the NPM1 staining (using x40 objective lens) in the first figure and the NPM1 staining (strongly enlarged view) in the upper left, and the inhibitor treatment), the localization of NPM1 is large and clear in the nucleus in the control. In contrast to the localized nucleoli, it can be seen that it is present in the entire nucleoplasm and small structures in the inhibitor treatment. Distinguishing of nucleoplasm can be seen from genomic DNA staining by DAPI (lower figure 4 shows the same cells as NPM1 staining in the upper row). Since NPM1 is a nucleolus-specific marker protein, it can be said that small structures in the nucleus are nucleoli. From the above, it was found that the treatment with Cdk1 / 2 inhibitor III caused morphological abnormalities of the nucleolus.

Example 2-2: Abnormal nucleolus morphology due to 2-cyanoethyl alsteropoulone treatment
2 x 10 ⁴ Huh7 cells were seeded on a 12-well plate containing a 15 mm round microcover glass (Matsunami) and cultured for 24 hours in a _{5% CO 2 incubator at 37 ° C.} After culturing, 2-cyanoethyl asteropaul (standard inhibitor kit 3 ver1.5 (kinase inhibitor kit)) was added to the medium so that the final concentration was 1 μM, and the cells were cultured for 24 hours. AcGFP-JEV core recombinant protein (final concentration 100 ug / mL) purified from baculovirus is an injection marker. Goat anti-mouse IgG (H + L) high cross-adsorbed secondary antibody Alexa Fluor Plus 555 (Thermo Fisher Scientific) It was mixed with Inc. (final concentration 100 ug / mL) and microinjected into the cytoplasm of Huh7 using a glass needle. After culturing in a 5% CO ₂ incubator at 37 ° C. for 30 minutes, the cells were fixed by incubating with 3.7% formalin solution for 15 minutes. After washing the cells with PBS, DAPI solution (final concentration 0.2 ug / mL) was added and incubated at room temperature for 20 minutes to stain genomic DNA (cell nuclei). The cells were observed using a confocal microscope TCS SP8 (Leica).

The obtained results are shown in FIG. 3 (B). In the figure, the injection marker indicates that the fluorescence of the injection marker Alexa Fluor Plus 555 mouse IgG is present in the cytoplasm. This indicates that the injection marker remains in the cytoplasm where it was injected. The JEV core indicates that AcGFP-JEVcore is present in the nucleus and is localized in a small structure different from the normal nucleolus. This indicates that the JEV core protein is microinjected into the cytoplasm together with Alexa Fluor Plus 555 mouse IgG, so that 2-cyanoethyl asteropaulone treatment does not inhibit the nuclear translocation of AcGFP-JEV core. On the other hand, it can be seen that the JEV core protein present in the nucleus is localized in a small nucleolus that is different from the usual one. This indicates that 2-cyanoethylalsteropoulone treatment causes nucleolar morphology, and that JEV core proteins translocate to the nucleus and localize to nucleoli showing abnormal morphology. There is. DAPI stains genomic DNA (cell nuclei). merge is a combination of injection marker, JEV core, and DAPI images.

Example 3
Inhibition of JEV replication by identified CDK inhibitors
3 x 10 ⁴ Huh7 cells were seeded in 24-well plates and cultured for 24 hours in a _{5% CO 2 incubator at 37 ° C.} Then, JEV (AT31 strain) was infected with cells at a multiplicity of infection (Moi) = 1 for 2 hours. JEV-infected Huh7 cells were washed with PBS and cultured for 24 hours in a medium containing three CDK inhibitors Cdk1 / 2 inhibitor III, Cdk2 / 9 inhibitor and 2-cyanoethyl asteropaulone. Infectious titers and cell viability were analyzed by focus forming assay and CellTiter-Glo® Luminescent Cell Viability Assay kit (Promega Corporation, WI), respectively.

The focus forming assay was performed by the following method. First, the culture supernatant of JEV-infected Huh7 cells was collected and diluted 10-fold with PBS. The day before the assay, 5 x 10 ⁴ Vero cells (Mori Y., et al. (2005) Journal of virology 79: 3448-3458) were seeded in a 24-well plate, and a 10-fold diluted culture supernatant sample was used. After adding 100 μl / well amount, the cells were cultured for 2 hours. Cells are washed with PBS, added with Dulbecco's modified Eagle's medium containing 1% methylcellulose (including 10% fetal bovine serum, 100 μg / mL penicillin, 100 μg / mL streptomycin), cultured for another 2 days, and fixed with 4% paraformaldehyde. did. Fixatives were treated with 0.5% Triton-X100 for 5 minutes and incubated with 2000-fold diluted anti-NS3 mouse antibody (Mori Y., et al. (2005) Journal of virology 79: 3448-3458) for 30 minutes. After washing with PBS, a 500-fold diluted biotin-crosslinked anti-mouse secondary antibody (Vector Laboratories, USA) was added, and the mixture was incubated for 30 minutes. After washing with PBS, add Strept ABC Peroxidase Kit (nacalai tesque, Japan) for 30 minutes, then add Vector VIP Peroxidase Substrate (Vector Laboratories, CA) for 10 minutes, and finally wash and dry the cells. The number of focus was measured.

The obtained results are shown in FIG. JEV-infected Huh7 cells were incubated with a CDK inhibitor at the timings (a) and (b) shown in FIG. 4 (A) for 24 hours. The cell viability 48 hours after infection is shown in (B), and the infectious titer is shown in (C). It can be seen that treatment with a CDK inhibitor does not affect cell survival but suppresses viral replication.

Example 4
Morphological changes of nucleoli due to substances with rRNA transcription inhibitory activity To investigate whether the nucleolus localization of Japanese encephalitis virus core protein in biological cells is changed by treatment with rRNA transcription inhibitors, Experiment was carried out.
The cells used were the sfGFP-JEVcore stable expression Huh7 cell line prepared in Example 1-1, and 1 x 10 ⁴ cells were seeded on a 96-well microplate (Greiner bio-one) at 37 ° C. After culturing in a 5% CO ₂ incubator for 24 hours, the rRNA transcription inhibitors actinomycin D, doxorubicin and acralubicin were added to a final concentration of 1 μM, and the cells were further cultured for 24 hours.
After culturing, the cells were washed with PBS and then incubated with 3.7% formalin solution for 15 minutes to fix the cells, and genomic DNA (cell nuclei) was stained with (DOJINDO, Japan, final concentration 0.2 μg / mL). The plate was subjected to a high-throughput cell function search system CV7000S (Yokogawa Electric Co., Ltd.), and three fluorescence photographs were taken for each well to analyze the fluorescence intensity and intracellular localization of GFP.

The obtained results are shown in FIG. Fluorescent images of DMSO (control) and the above three rRNA transcription inhibitors are shown. It can be seen that during DMSO treatment, the sfGFP-JEV core is localized in the nucleoli that are clearly present in the nucleus. On the other hand, the fluorescence of the rRNA transcription inhibitors actinomycin D, doxorubicin and aclarubicin all appear to be small dots (dots) in the fluorescence of the sfGFP-JEV core.

Example 5
Inhibition of flavivirus growth by substances with GSK-3 inhibitory activity Anti-flavi, a low molecular weight compound obtained from the GSK-3 inhibitor library (https://www.selleck.co.jp/GSK-3.html) The screening was carried out substantially according to the method of Example 1 except that it was used as a candidate substance having viral activity.
The obtained results are shown in FIG. 6 (A). This revealed that 1-Azakenpaulon suppresses the GFP fluorescence intensity.

Next, the growth suppression of Japanese encephalitis virus, Denguiurus, and Zika virus by the identified 1-Azaken Paulon was investigated.
3 x 10 ⁴ Huh7 cells were seeded in 24-well plates and cultured for 24 hours in a _{5% CO 2 incubator at 37 ° C.} Then, Japanese encephalitis virus (JEV, AT31 strain), dengue virus (DENV, H241 strain), and Zika virus (ZIKV, MR766 strain) were infected with cells at multiplicity of infection (Moi) = 1 for 2 hours. Infected Huh7 cells were washed with PBS and cultured in medium containing 1-Azakenporon (final concentration 1 μM) for 24 hours. Infectious titers were analyzed by focus forming assay (see Example 3).

The obtained results are shown in FIG. 6 (B). Virus-infected Huh7 cells were incubated with 1-Azaken Paulon for 24 hours. Shows the infectious titer 24 hours after infection. Treatment with 1-Azaken Paulon shows that the growth of the virus is suppressed.
Example 6
Further screening of substances with anti-flavivirus activity
Except for the use of low molecular weight compounds obtained from LOPAC1280 (distributed from the Graduate School of Pharmaceutical Sciences, Kyoto University) and the FDA-approved Drug Library (distributed from the Graduate School of Pharmaceutical Sciences, Osaka University) as candidate substances with anti-flavivirus activity. , The screening was carried out substantially according to the method of Example 1.
From this, it was found that substances having DNA topoisomerase inhibitory activity: ellipticin, idarubicin, idarubicin hydrochloride, epirubicin hydrochloride, mitoxantrone hydrochloride and daunorubicin hydrochloride suppress GFP fluorescence intensity.

Next, it was investigated whether the nucleolus morphology was changed by the identified substance having DNA topoisomerase inhibitory activity, and more specifically, the nucleolus localization of the Japanese encephalitis virus core protein in biological cells was changed.
The cells used were the sfGFP-JEVcore stable expression Huh7 cell line prepared in Example 1-1, and 1 x 10 ⁴ cells were seeded on a 96-well microplate (Greiner bio-one) at 37 ° C. After culturing in a 5% CO ₂ incubator for 24 hours, add ellipticin, idarubicin, idarubicin hydrochloride, epirubicin hydrochloride, mitoxantrone hydrochloride and daunorubicin hydrochloride to a final concentration of 1 μM. , Further cultured for 24 hours.
After culturing, the cells were washed with PBS and then incubated with 3.7% formalin solution for 15 minutes to fix the cells, and genomic DNA (cell nuclei) was stained with (DOJINDO, Japan, final concentration 0.2 μg / mL). The plate was subjected to a high-throughput cell function search system CV7000S (Yokogawa Electric Co., Ltd.), and three fluorescence photographs were taken for each well to analyze the fluorescence intensity and intracellular localization of GFP.

The obtained results are shown in FIG. The fluorescence image when DMSO (control) and the said DNA topoisomerase inhibitor were treated is shown. It can be seen that during DMSO treatment, the sfGFP-JEV core is localized in the nucleoli that are clearly present in the nucleus. On the other hand, ellipticin, idarubicin, idarubicin hydrochloride, epirubicin hydrochloride, mitoxantrone hydrochloride, and daunorubicin hydrochloride all have small points (dots) or disappearance of fluorescence in the sfGFP-JEV core and are dispersed in the nucleus. Exists.

The habitat of transmitted mosquitoes has changed due to global warming and the development of means of transportation, and the distribution of flavivirus may change in the future. Just as the West Nile virus first invaded the United States in 1999, many people were infected, and when the virus invades a new area, it is likely to cause a large number of casualties. Therefore, further development of therapeutic means for flavivirus is desired not only in Japan but also in other countries around the world. Although there are human-approved vaccines for Japanese encephalitis virus, yellow fever virus, and flavivirus-mediated encephalitis virus infection, thousands to tens of thousands of cases are reported worldwide each year. The screening method of the present invention provides new knowledge of the replication mechanism and the immune response / avoidance mechanism, and leads to the development of a new antiviral drug.

Claims (19)

An antiflavivirus pharmaceutical composition comprising a substance that affects the morphology of nucleoli in biological cells. The anti-flavivirus pharmaceutical composition according to claim 1, wherein a substance that affects the morphology of nucleoli in biological cells is contained as an active ingredient having anti-flavivirus activity. The pharmaceutical composition according to claim 1 or 2, wherein the substance that affects the morphology of the nucleolus in biological cells is a substance that causes morphological abnormalities of the nucleolus. The pharmaceutical composition according to any one of claims 1 to 3, wherein the substance that affects the morphology of the nucleolus in the biological cell is also accompanied by a change in the localization of the core protein of the virus in the biological cell. The pharmaceutical composition according to any one of claims 1 to 4, wherein a substance that affects the morphology of nucleoli in biological cells causes viral replication inhibition. The pharmaceutical composition according to any one of claims 1 to 5, wherein the flavivirus is an antiflavivirus activity selected from Japanese encephalitis virus, dengue virus, Zika virus, West Nile virus, and yellow fever virus. .. Substances that affect the morphology of nucleoli in biological cells are substances that have CDK inhibitory activity, rRNA transcription inhibitory activity, DNA topoisomerase inhibitory activity, or GSK-3 inhibitory activity. The pharmaceutical composition according to any one of claims 1 to 6. Substances with CDK inhibitory activity are 2-cyanoethylartellopaulone, 5-amino-3-((4- (aminosulfonyl) phenyl) amino) -N- (2,6-difluorophenyl) -1H-1, 2,4-Triazole-1-carbothioamide, (4- (2-amino-4-methylthiazole-5-yl) pyrimidin-2-yl)-(3-nitrophenyl) amine, P276-00, A-674563 , SU9516, SNS-032 (BMS-387032), dynasicrib, flavopyridol, AT7519, flavopyridol hydrochloride, AT7519 HCl, AZD5438, R547, and chempaulone, the pharmaceutical composition according to claim 7. Substances with CDK inhibitory activity are 2-cyanoethylartellopaulone, 5-amino-3-((4- (aminosulfonyl) phenyl) amino) -N- (2,6-difluorophenyl) -1H-1, Selected from 2,4-triazol-1-carbothioamide, and (4- (2-amino-4-methylthiazole-5-yl) pyrimidin-2-yl)-(3-nitrophenyl) amine, claimed Item 8. The pharmaceutical composition according to Item 8. The pharmaceutical composition according to claim 7, wherein the substance having rRNA transcription inhibitory activity is selected from actinomycin D, doxorubicin, and aclarubicin. The pharmaceutical composition according to claim 7, wherein the substance having DNA topoisomerase inhibitory activity is selected from doxorubicin, acralubicin, ellipticin, idarubicin, idarubicin hydrochloride, epirubicin hydrochloride, mitoxantrone hydrochloride, and daunorubicin hydrochloride. The pharmaceutical composition according to claim 11, wherein the substance having a DNA topoisomerase inhibitory activity is selected from doxorubicin, aclarubicin, and ellipticin. The pharmaceutical composition according to claim 7, wherein the substance having GSK-3 inhibitory activity is 1-Azakenporon. Methods for screening substances with anti-flavivirus activity, including the following steps:
(A) Biological cells are contacted in vitro with candidate compounds of substances with antiflavivirus activity.
(B) Investigate whether the candidate compound affects the morphology of the nucleolus in the biological cell.
(C) A method for identifying the candidate compound as a substance having antiflavivirus activity if it has an influence. 14. The method of claim 14, wherein in step (c), the effect of the candidate compound is nucleolar morphological abnormalities in biological cells. The method of claim 14 or 15, wherein morphological abnormalities of the nucleolus in biological cells are discriminated by the formation and / or changes in localization of proteins or nucleic acids localized in the nucleolus. A change in the formation and / or localization of a protein localized in the nucleolus is a change compared to the effect of a control compound on the protein localized in the nucleolus, wherein the candidate compound is relative to the morphology of the nucleolus. The method according to claim 16, wherein the method is determined to have an influence. Claim that the protein localized in the nucleolus in biological cells is one or more proteins selected from necrophosmine, nucleolin, fibrillarin, RNA polymerase I and flavivirus core proteins. The method according to any one of 14 to 17. Biological cells were established from mosquitoes such as eukaryotic cell lines including humans such as liver-derived Huh7 cells, primary cultured cells, primate-derived cell lines such as monkey kidney-derived Vero cells, and C6 / 36 cells. The method according to any one of claims 14 to 18, wherein the cell is a cell.

Images