WO2022210644A1 - Drug for treating wide range of viral infections, including sars-cov-2 - Google Patents

Abstract

The present disclosure provides virus suppression by a nucleolus-modifying agent. One aspect of the present disclosure provides an antivirus agent effective against a corona virus, the agent having a nucleolus-modifying agent as an active ingredient. According to one embodiment, the coronavirus includes a virus selected from the group consisting of HCoV-HKU1, HCoV-OC43, SARS-CoV, MERS-CoV, and SARS-CoV-2. According to one embodiment, the nucleolus-modifying agent contains a flavopiridol compound, AT7519, P276-00, or a CDK1/2 inhibitor III.

Description

A therapeutic agent for a wide range of viral infections, including SARS-CoV-2

The present disclosure relates to suppression of viruses such as coronaviruses using nucleolar denaturing agents.

　Infectious diseases caused by viruses such as severe acute respiratory syndrome (SARS) coronavirus and Middle East respiratory syndrome-related coronavirus are still difficult to deal with even today. In fact, the SARS-CoV-2 pandemic that started in 2019 still has no end in sight.

Patent Document 1 discloses the prevention of coronavirus infections with vaccines, but drugs such as low-molecular-weight compounds for treating or preventing viral infections are desired.

WO2018/160977

The present inventors have found that viruses such as SARS-CoV-2 can be suppressed by nucleolar denaturing agents. Based on this finding, the present disclosure provides an antiviral agent containing a nucleolus-altering agent as an active ingredient, a method for treating or preventing viral infections using the nucleolus-altering agent, and the like.

Accordingly, the present invention provides:
(Item 1)
An antiviral agent against coronavirus, containing a nucleolus-denaturing agent as an active ingredient.
(Item 2)
The antiviral agent of any of the preceding items, wherein the coronavirus comprises a virus selected from the group consisting of HCoV-HKU1, HCoV-OC43, SARS-CoV, MERS-CoV, and SARS-CoV-2.
(Item 3)
The antiviral agent of any of the preceding items, wherein said coronavirus comprises SARS-CoV-2.
(Item 4)
The antiviral agent according to any one of the above items, wherein the nucleolar modifying agent has CDK inhibitory activity.
(Item 5)
The antiviral agent according to any one of the above items, wherein the nucleolar modifying agent has inhibitory activity against at least one CDK selected from the group consisting of CDK1, CDK2, CDK4 and CDK9.
(Item 6)
The antiviral agent of any of the preceding items, wherein said nucleolar modifying agent comprises a flavopiridol compound, AT7519, P276-00 or CDK1/2 inhibitor III.
(Item 7)
The antiviral agent of any of the preceding items, wherein the nucleolar modifying agent comprises a flavopiridol compound.
(Item 8)
An antiviral agent according to any of the items above for the treatment of infection by said coronavirus.
(Item 9)
The antiviral agent of any of the preceding items, characterized in that it is administered to a subject diagnosed as being infected with said coronavirus.
(Item 10)
The antiviral agent of any of the items above, for administration to humans.
(Item 11)
The antiviral agent of any of the preceding items, which is administered at a dose of about 0.1-10 mg/kg body weight of said nucleolar modifying agent.

In the present invention, it is intended that one or more of the features described above may be provided in further combinations in addition to the explicit combinations. Still further embodiments and advantages of the present invention will be appreciated by those skilled in the art upon reading and understanding the following detailed description, if necessary.

The present disclosure provides novel antiviral agents. The provision of novel antiviral agents will make it possible to deal with viral infections in various situations.

Figure 3 shows the antiviral effect of CDK1/2 inhibitor III against SARS-CoV-2 infection in Huh7 cells. The horizontal axis indicates Control, Inf, Post and Throughput in order from the left (see Example 1 for the treatment conditions for each). (A) shows the results of measuring the amount of viral RNA. The vertical axis represents the relative value of the amount of viral RNA in each sample when the average value of the control (Control) is set to 1. (B) shows the measurement results of virus titer (PFU/mL). The vertical axis represents the virus titer in each sample. Figure 3 shows the antiviral effect of each CDK inhibitor (flavopyridol, AT7519, P276-00, CDK1/2 inhibitor III) against SARS-CoV-2 infection in Huh7-ACE2 cells. The vertical axis represents the amount of viral RNA in the culture supernatant under each condition relative to the control treatment condition (100%) without drug. The horizontal axis represents the drug concentration (nM) tested. Figure 3 shows the antiviral effect of each CDK inhibitor (flavopyridol, AT7519, P276-00, CDK1/2 inhibitor III) against SARS-CoV-2 infection in VeroE6/TMPRSS2 cells. The vertical axis represents the amount of viral RNA in the culture supernatant under each condition relative to the control treatment condition (100%) without drug. The horizontal axis represents the drug concentration (nM) tested. Figure 2 shows antiviral effects of flavopiridol and remdesivir against SARS-CoV-2 infection in Huh7-ACE2 cells. The vertical axis represents the amount of viral RNA in the culture supernatant under each condition relative to the control treatment condition (100%) without drug. The horizontal axis represents the drug concentration (nM) tested. The calculated _EC50 concentrations are also shown. Figure 2 shows antiviral effects of flavopiridol and remdesivir against SARS-CoV-2 infection in VeroE6/TMPRSS2 cells. The vertical axis represents the amount of viral RNA in the culture supernatant under each condition relative to the control treatment condition (100%) without drug. The horizontal axis represents the drug concentration (nM) tested. The calculated _EC50 concentrations are also shown. Fig. 2 shows morphological changes in nucleoli due to flavopiridol treatment. Shown are microscopic images of mCherry-NPM1 stably expressing Huh7 cells at each time point of treatment in the presence of flavopiridol at a final concentration of 1 μM for 120 minutes followed by treatment in drug-free medium for 180 minutes. Arrows indicate nucleoli where mCherry-NPM1 is localized. Figure 2 shows contact timing differences in the antiviral effect of flavopiridol against SARS-CoV-2 infection in Vero/TMPRSS2 cells. The vertical axis represents the amount of viral RNA in the culture supernatant under each condition relative to the control treatment condition (100%) without drug. The horizontal axis represents the flavopiridol concentration (nM) tested. Figure 3 shows the antiviral effect of flavopiridol against Zika virus and Dengue virus infection in Huh7 cells. The vertical axis represents the amount of viral RNA in the culture supernatant under each condition relative to the control treatment condition (100%) without drug. The horizontal axis represents the drug concentration (nM) tested. Figure 3 shows the antiviral effect of flavopiridol against SARS-CoV-2 infection of the Omicron strain in Huh7-ACE2-TMPRSS2 cells. The vertical axis represents the amount of viral RNA in the culture supernatant under each condition relative to the control treatment condition (100%) without drug. The horizontal axis represents the drug concentration (nM) tested. The calculated _EC50 concentrations are also shown.

The present disclosure will be described below while showing the best mode. It should be understood that throughout this specification, expressions in the singular also include the concept of the plural unless specifically stated otherwise. Thus, articles in the singular (eg, “a,” “an,” “the,” etc. in the English language) should be understood to include their plural forms as well, unless otherwise stated. Also, it should be understood that the terms used in this specification have the meanings commonly used in the relevant field unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present specification (including definitions) will control.

Definitions of terms and/or basic technical contents particularly used in this specification are explained below as appropriate.

As used herein, "suppression" of a virus means reducing the growth rate of the virus, reducing the virus, and/or inactivating the virus. Suppression of virus can be detected by a decrease or no increase in the amount of viral protein or nucleic acid in a cell or sample. As used herein, "antiviral agent" refers to an agent capable of suppressing a target virus.

As used herein, the term "inhibition" of a target protein means a decrease in the function or amount of the target protein by any means, and the term "inhibitor" of the target protein means a decrease in the function or amount of the target protein by any means. It means a drug that lowers. For example, inhibitors target proteins through reduction or inactivation of the nucleic acid encoding the target protein, degradation of the target protein, inhibition of target protein function (loss of kinase activity, inhibition of binding to binding proteins, etc.), etc. It may reduce the function or quantity of the protein.

As used herein, the term "nucleolus modifying agent" refers to an agent that causes abnormal nucleolus morphology. Nucleolar morphology abnormalities can be determined by changes in the presence and/or localization of nucleolus-localized proteins (necrofosmin, nucleolin, fibrillarin, RNA polymerase I, virus-derived proteins, etc.) or nucleic acids. Specifically, a compound is brought into contact with Huh7 cells at a concentration of 1 μM for 2 hours, and the protein localized in the nucleolus is labeled or stained for microscopic observation. Later, when the nucleolus changes from a large clump into many small droplets or disperses and becomes invisible, or conversely, when the nucleolus clump becomes a significantly larger clump It is determined that the corpuscle is denatured, and the compound is determined as a "nucleolus denaturing agent".

As used herein, "cyclin-dependent kinase" (which may be abbreviated herein as CDK) is used in its general sense in the field of molecular biology, belongs to the family of protein kinases, and generally controls the cell cycle. Refers to proteins that play a regulatory role. CDKs are also known to be involved in transcription regulation, mRNA processing, neuronal cell differentiation, and the like. CDKs are classified as serine/threonine kinases, and the consensus sequence for the substrate phosphorylation site is [S/T*]PX[K/R] (where S/T* is the serine or threonine to be phosphorylated, P is proline, X is any amino acid, K is lysine, R is arginine). Representative CDK proteins include those shown in the table below.

As used herein, the term "CDK inhibitor" refers to an agent that inhibits at least one of the CDK subtypes.

In this specification, unless otherwise specified, references to a molecule (e.g., protein, nucleic acid) refer to a molecule that performs a function similar to, but not to the same extent as, the molecule's biological function. It is understood that reference is also made to variants (eg, variants having modifications in the amino acid sequence). For example, the human CDK1 protein includes not only a protein (isoform 1) having the amino acid sequence represented by NCBI Accession No. NP_001777, but also a conjugate of this protein and a labeling molecule (such as a fluorescent label), NCBI Accession Variants having the amino acid sequence represented by the number NP — 203698 (isoform 2), variants including mutations such as point mutations, and the like can be included. Such variants include fragments of the original molecule, sequences of the original molecule aligned across amino acid or nucleic acid sequences of the same size, or aligned by computer homology programs known in the art. Molecules that are at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identical when compared to . Variants can include molecules with altered amino acids (eg, altered by disulfide bond formation, glycosylation, lipidation, acetylation, or phosphorylation) or altered nucleotides (eg, altered by methylation).

As used herein, the amino acid or nucleotide at the "corresponding position" has the same effect in a certain polypeptide molecule or polynucleotide molecule as the amino acid or nucleotide at a given position in the polypeptide or polynucleotide used as a reference for comparison. or an amino acid or nucleotide predicted to have. For example, one of ordinary skill in the art can align between the original molecule and its variants and set appropriate thresholds to identify corresponding positions.

As used herein, "treatment" refers to reducing the severity of a disease or disorder in a subject having such disease or disorder, and "cure" refers to the disease or disorder no longer occurring. It means that if you have it, you will not be diagnosed. Preliminary diagnosis and appropriate treatment are called "companion therapy", and the diagnostic agent for that purpose is sometimes called "companion diagnostic agent".

As used herein, "prevention" refers to preventing a disease or disorder from becoming such a condition before it becomes such a condition.

As used herein, "diagnosis" refers to identifying various parameters related to a condition (eg, disease, disorder) in a subject and determining the current status or future of such condition. For example, when diagnosing that a subject is infected with a virus, a viral component (a nucleic acid, protein, etc. characteristic of the virus of interest) is detected in the subject or in a sample obtained from the subject, and detected It is possible to diagnose whether the virus is infected based on the presence or absence or the amount detected.

As used herein, the term "pharmaceutical ingredient" means any ingredient that can constitute a drug, for example, an active ingredient (which itself exhibits medicinal efficacy), an additive ingredient (which itself is not expected to have medicinal efficacy), However, components expected to play a certain role (for example, excipients, lubricants, surfactants, etc.) when included as a pharmaceutical can be exemplified. A pharmaceutical ingredient may be a single substance or a combination of multiple substances or agents. Any combination, such as a combination of an active ingredient and an additive ingredient, a combination of an adjuvant and an active ingredient, etc., may also be included.

As used herein, "active ingredient" refers to an ingredient that exerts an intended medicinal effect, and may be a single ingredient or multiple ingredients.

As used herein, the term "additive ingredient" refers to any ingredient that is not expected to have medicinal efficacy but plays a certain role when included as a medicine. Examples include pharmaceutically acceptable carriers, stabilizers, ( Auxiliary) Adjuvants, solubility improvers, solubilizers, diluents, excipients, buffers, binders, diluents, flavoring agents, and lubricants.

As used herein, "drug", "agent" or "agent" (both equivalent to agents in English) are broadly used interchangeably and are used to describe any agent capable of achieving its intended purpose. It may be matter or other elements (eg, energy such as light, radiation, heat, electricity, etc.). Such substances include, for example, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (including DNA such as cDNA and genomic DNA, RNA such as mRNA), poly Saccharides, oligosaccharides, lipids, organic small molecules (e.g., hormones, ligands, signaling substances, organic small molecules, molecules synthesized by combinatorial chemistry, small molecules that can be used as pharmaceuticals (e.g., small molecule ligands, etc.), etc.) , these complex molecules and mixtures thereof. A medicament may consist of an active ingredient or may be in the form of a formulation prepared by combining the active ingredient with another ingredient.

Any compound described herein may be provided in the form of a pharmaceutically acceptable salt thereof, unless otherwise stated, for example hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, acetic acid, oxalic acid , salts formed with free carboxyl groups such as those derived from tartaric acid, salts formed with free amine groups such as those derived from isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, and the like, and It can be a salt formed with sodium, potassium, ammonium, calcium, and ferric hydroxide. Also, any compound described herein may be provided as any crystal form, any solvate.

As used herein, the term “flavopyridol compound” refers to flavopiridol (2-(2-chlorophenyl)-5,7-dihydroxy-8-[(3S,4R)-3-hydroxy-1-methyl-4- piperidinyl]-4H-1-benzopyran-4-one), derivatives thereof, and salts thereof. Exemplary ranges of derivatives are described elsewhere herein. The salt is, for example, a salt with hydrochloric acid, but is not particularly limited. Flavopiridol is known to inhibit CDK1, 2, 4, 6, 9, etc., and is used as an anticancer agent.

As used herein, the term "label" refers to an entity (eg, substance, energy, electromagnetic waves, etc.) that distinguishes a target molecule or substance from others. Examples of such labeling methods include RI (radioisotope) method, fluorescence method, biotin method, chemiluminescence method and the like. When a plurality of target proteins (for example, importins, nuclear localization proteins) or factors or means for capturing them are labeled by a fluorescence method, they are labeled with fluorescent substances having mutually different fluorescence emission maximum wavelengths. The difference in fluorescence emission maximum wavelength is preferably 10 nm or more. Fluorescent agents include Alexa ^™ Fluor, although any label that does not affect function can be used. Alexa ^™ Fluor is a water-soluble fluorescent dye obtained by modifying coumarin, rhodamine, fluorescein, cyanine, etc., and is a series that supports a wide range of fluorescent wavelengths. stable, bright, and insensitive to pH. Combinations of fluorescent dyes having a fluorescence maximum wavelength of 10 nm or more include a combination of Alexa ^™ 555 and Alexa ^™ 633, a combination of Alexa ^™ 488 and Alexa ^™ 555, and the like. Other fluorescent labels include cyanine dyes (eg, Cy3, Cy5, etc. of the CyDye ^TM series), rhodamine 6G reagent, N-acetoxy-N2-acetylaminofluorene (AAF), AAIF (an iodine derivative of AAF), and the like. In the present disclosure, such labels can be utilized to modify the subject of interest so that it can be detected by the detection means used. Such modifications are known in the art, and those skilled in the art can carry out such methods as appropriate depending on the label and the intended subject.

As used herein, the term "kit" refers to a unit that provides parts (eg, inhibitors, instructions, etc.) that should be provided, usually divided into two or more compartments. This kit form is preferred when the purpose is to provide a composition that should not be provided in a mixed form for reasons such as stability, and is preferably used in a mixed form immediately before use. Such kits are advantageously provided with instructions or instructions, preferably describing how to use the parts provided or how to handle the reagents. In the present specification, when the kit is used as a reagent kit, the kit usually includes an instruction sheet describing how to use the inhibitor and the like.

As used herein, the term "instructions" describes instructions for a physician or other user on how to use the present disclosure. The instructions contain language that instructs administration of the drug and the like of the present disclosure. The instructions may also include language that indicates the mode of administration. This instruction is prepared in accordance with the format prescribed by the regulatory authority of the country in which this disclosure is implemented (for example, the Ministry of Health, Labor and Welfare in Japan, the Food and Drug Administration (FDA) in the United States, etc.) and is approved by the regulatory authority. It is stated that it has received Instructions are so-called package inserts, which are usually provided in paper form, but are not limited to that, for example, in the form of electronic media (e.g., homepages provided on the Internet, e-mail). can also be provided.

The term "about" refers to the indicated value plus or minus 10%. "About" when used for temperature refers to the indicated temperature plus or minus 5°C and "about" when used for pH refers to the indicated pH plus or minus 0.5.

(preferred embodiment)
Preferred embodiments of the present disclosure are described below. The embodiments provided below are provided for a better understanding of the disclosure, and it is understood that the scope of the disclosure should not be limited to the following description. Therefore, it is clear that a person skilled in the art can make appropriate modifications within the scope of the present disclosure in light of the description in this specification. It is also understood that the following embodiments can be used singly or in combination.

In one aspect, the present disclosure provides suppression of a virus of interest by a nucleolar modifying agent. Any means for accomplishing this are contemplated within the scope of this disclosure. For example, without explicit description, a description of a method of using a certain nucleolus-modifying agent may refer to a composition comprising the same nucleolus-modifying agent, the use of the same nucleolus-modifying agent, and the method for use in the same method. Embodiments reflecting other means are also contemplated, such as the same nucleolar modifiers of . In another example, the disclosure provides a method of identifying a nucleolar modifying agent for suppressing a virus, wherein the nucleolar modifying agent described in such embodiments is used for suppressing the same virus. and in the manufacture of compositions (such as medicaments) for the same use.

(Suppression of virus by nucleolus denaturant)
In one aspect, the present disclosure provides viral suppression with nucleolar modifying agents. In one embodiment, it includes treatment of viral infections. In one embodiment, viral suppression includes prevention of viral infection.

In one embodiment, the virus to be inhibited is of the coronavirus subfamily. In one embodiment, the virus to be inhibited is a virus of the genera Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and/or Deltacoronavirus.

The Alphacoronavirus genus includes Alphacoronavirus 1, Feline coronavirus, Canine coronavirus, Human coronavirus 229E, Human coronavirus NL63, Miniopterus bat coronavirus 1, Miniopterus bat coronavirus HKU8, Swine epidemic diarrhea virus, Rhinolophus bat Included are coronavirus HKU2, Scotophilus bat coronavirus 512, infectious gastroenteritis coronavirus.

The Betacoronavirus genus includes betacoronavirus 1, bovine coronavirus, China Rattus coronavirus HKU24, human coronavirus HKU1, mouse coronavirus, mouse hepatitis virus, severe acute respiratory syndrome (SARS) coronavirus, SARS-associated coronavirus , severe acute respiratory syndrome coronavirus 2, bat SARS-like coronavirus WIV1, Hedgehog coronavirus 1, Middle East respiratory syndrome-associated coronavirus, Pipistrellus bat coronavirus HKU5, Tylonycteris bat coronavirus HKU4, Rousettus bat coronavirus GCCDC1, Rousettus bat Includes coronavirus HKU9, bat Hp-betacoronavirus Zhejiang2013.

The gammacoronavirus genus includes Beluga whale coronavirus SW1 and avian coronavirus. The deltacoronavirus genus includes Wigeon coronavirus HKU20, Bulbul coronavirus HKU11, coronavirus HKU15, Munia coronavirus HKU13, White-eye coronavirus HKU16, Night heron coronavirus HKU19, Common moorhen coronavirus HKU21.

In a preferred embodiment, the virus to be suppressed can be a coronavirus belonging to the genus Betacoronavirus, such as HCoV-HKU1, HCoV-OC43, SARS-CoV, MERS-CoV and SARS-CoV-2. Coronaviruses exist as enveloped RNA viruses. Its diameter is about 80-120 nm and its genetic material is the largest of all RNA viruses. SARS-CoV-2 has a single positive strand RNA in its genome, 16 nonstructural proteins (nsp1-16), 4 structural proteins (spike (S), envelope (E), membrane (M), nucleus capsid (N)), and accessory proteins (ORF3a, ORF3b, ORF6, ORF7a, ORF7b, ORF8, ORF9b, ORF9c, ORF10, etc.).

As coronaviruses that infect humans, there are four types of human coronaviruses, 229E, OC43, NL63, and HKU-1, which cause colds, and severe acute respiratory syndrome (SARS) that occurred in 2002 causing severe pneumonia. ) coronavirus, the Middle East Respiratory Syndrome (MERS) coronavirus that occurred in 2012, and the so-called novel coronavirus (2019-nCoV, SARS-CoV-2) that occurred in 2019. SARS-CoV-2 is subdivided into alpha strains (B.1.1.7 strain), beta strains (B.1.351 strains), gamma strains (P.1 strains), and delta strains (B.1.617.2 strains). , Omicron strain (B.1.1.529 strain), etc. are known, but all of them are subject to suppression of the present disclosure. The SARS-CoV-2 gene is highly homologous to the SARS coronavirus gene (about 80%), and uses a receptor (ACE1 or ACE2) similar to the SARS coronavirus to adsorb and enter human cells. A recent study reported that It has also been reported that different subtypes of ACE1 or ACE2 have different infectivity. Clinical symptoms of SARS-CoV-2 are said to progress from influenza-like symptoms such as headache, high fever, malaise, and cough to pneumonia with dyspnea as a chief complaint in severe cases. SARS-CoV-2 is highly contagious, currently infecting more than 40 million people worldwide and causing more than 1 million deaths. INDUSTRIAL APPLICABILITY The present disclosure has a remarkable effect in that it can suppress SARS-CoV-2.

In one embodiment, the virus to be inhibited is a Flaviviridae virus. In one embodiment, the virus to be inhibited is a Flaviviridae virus. In one embodiment, the virus to be inhibited is Japanese encephalitis virus, West Nile virus, tick-borne encephalitis virus, dengue virus, yellow fever virus, Zika virus, hepatitis C virus, human respiratory syncytial virus or chikungunya virus. In a specific embodiment, the virus to be inhibited is dengue virus, which can be inhibited particularly well by flavopiridol compounds. Accordingly, the present invention may also provide compositions comprising flavidol compounds for the prevention and/or treatment of dengue virus infection.

In one embodiment, the nucleolar modifying agent for viral suppression is a CDK inhibitor, rRNA transcription inhibitor, DNA topoisomerase inhibitor, or GSK-3 inhibitor. In one embodiment, the nucleolar modifying agent for viral suppression is a CDK inhibitor. In one embodiment, the CDK inhibitor for viral suppression is one of CDK1, CDK2, CDK3, CDK4, CDK5, CDK6, CDK7, CDK8, CDK9, CDK10, CDK11A, CDK11B, CDK12, and CDK13 or Block multiple. In one embodiment, the CDK inhibitor for viral suppression inhibits one or more of CDK1, CDK2, CDK4, CDK6, CDK7 and CDK9.

For example, CDK inhibitory activity and/or selectivity can be determined by testing candidate drugs in ATP (eg, about 25 μM) competition assays for each CDK subtype. This ATP competition assay can be performed, for example, under the conditions described in Kim KS et al., J Med Chem, 2000, 43(22), 4126-4134. For example, inhibition of that CDK subtype can be determined by an ATP competition assay if the _IC50 is below about 1 μM, about 10 μM or about 100 μM. For example, flavopiridol (also known as Albocidib) has been reported to be able to inhibit CDK1, 2, 4, 6 and 9 with an _IC50 of 20-100 nM (Montagnoli A et al., Nat Chem Biol. 2008, 4(6):357-65. and Sedlacek HH. Crit Rev Oncol Hematol. 2001, 38(2):139-70.).

Specific examples of CDK inhibitors for viral suppression include flavopiridol, AT7519, P276-00, 2-cyanoethylalsteropaullone, 5-amino-3-((4-(aminosulfonyl)phenyl)amino)- N-(2,6-difluorophenyl)-1H-1,2,4-triazole-1-carbothioamide (CDK1/2 inhibitor III), (4-(2-amino-4-methylthiazol-5-yl ) pyrimidin-2-yl)-(3-nitrophenyl)amine (CDK2/9 inhibitor), P276-00, A-674563, SU9516, SNS-032, dinaciclib, AZD5438, R547, Kenpaulone and the like.

Specific examples of rRNA transcription inhibitors for virus suppression include actinomycin D, doxorubicin, and aclarubicin.

Specific examples of DNA topoisomerase inhibitors for virus suppression are doxorubicin, aclarubicin, ellipticin, idarubicin, epirubicin, mitoxantrone, daunorubicin, and the like.

Specific examples of GSK-3 inhibitors for virus suppression include 1-azakenpaullone.

In one embodiment, the nucleolar modifying agent for viral suppression comprises the flavopiridol compound, AT7519, P276-00 or CDK1/2 inhibitor III. CDK1/2 inhibitor III, flavopiridol, AT7519, P276-00 have the following structures, respectively.

In a preferred embodiment, the nucleolar modifying agent for viral suppression comprises a flavopiridol compound. Flavopiridol compounds include flavopiridol, or derivatives thereof (including salts thereof). In one embodiment, the flavopiridol derivative has one or more (e.g., 1, 2, 3, 4, 5) of hydrogen atoms, hydroxyl groups and chlorine atoms in flavopiridol. is independently a hydrogen atom, a halogen (fluorine, chlorine, bromine, iodine) atom, a hydroxyl group, a thiol group, an amino group, a cyano group, a C _1-8 linear or branched alkyl, alkenyl or alkynyl group (which may contain a 3- to 6-membered carbocyclic ring), or a 5- to 7-membered heterocyclic ring (containing 1-3 heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur, the other members being carbon, which may or may not be an aromatic ring), or substituted with oxygen to form a carbonyl group; Here, one or more (e.g., 1, 2, 3, 4, 5) of the hydrogen atoms in the substituent A may be further replaced with a substituent A, Or two hydrogen atoms may be replaced by oxygen to form a carbonyl group.

In one embodiment, the flavopiridol derivative has the formula (I)

is a compound having a flavopiridol skeleton, wherein
R ¹ and R ² are independently a hydrogen atom, a phenyl group or a 5- to 7-membered aromatic heterocyclic ring (containing 1-3 heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur, and other members is carbon) and
R ³ , R ⁴ and R ⁵ are independently a hydrogen atom, a hydroxyl group, a thiol group, an amino group, a C _1-3 linear or branched alkyl group,
n is an integer of 1-3. In one embodiment, the flavopiridol derivative is one or more (e.g., 1, 2, 3, 4, 5) of the hydrogen atoms and hydroxyl groups in the compound of formula (I) can be a compound in which is replaced as well as the replacement of one or more of the hydrogen atoms, hydroxyl groups and chlorine atoms in the flavopiridol. In one embodiment, the flavopiridol derivative is flavopiridol or a prodrug of any of the above flavopiridol derivatives. Such prodrugs include compounds in which the hydroxyl group of flavopiridol or any of the above flavopiridol derivatives is modified to an ester group (eg C _1-6 ) or an ether group (eg C _1-6 ). .

In one embodiment, derivatives of known nucleolar-altering agents (e.g., flavopiridol) are screened and the screened compounds are used for viral suppression as described herein (e.g., incorporated into antiviral agents). You may Such screens include those that test for abnormal nucleolar morphology, those that test CDK inhibition ability, and those that test virus suppression ability. In one embodiment, the present disclosure provides a method for producing an antiviral agent, comprising mixing an active ingredient identified by the screening method of the present disclosure with a pharmaceutically acceptable excipient.

In one embodiment, a screen to test the ability of a derivative of a nucleolar modifying agent (e.g., flavopiridol) to inhibit CDKs is performed by performing an ATP competition assay (described above) of the candidate derivative for each CDK subtype to determine IC ₅₀ can be determined and derivatives can be selected based on some reference value (about 1 μM, about 10 μM or about 100 μM) or based on the CDK subtype inhibition profile obtained compared to the derivative's parent compound.

In one embodiment, a screen testing the ability of derivatives of nucleolar modifying agents (e.g., flavopiridol) to suppress viruses is performed on Huh7-ACE2 cells or VeroE6/VeroE6 cells, as described in the Examples herein. 1×10 ⁴ TMPRSS2 cells were seeded in a 96-well microplate, and the candidate derivative was added to the medium at a predetermined final concentration (eg, 1,000 nM, 500 nM, 250 nM, 125 nM, 62.5 nM, 31.3 nM). , 37 ° C., 5% CO ₂ after 24 hours of culture in an incubator, SARS-CoV-2 / Hu / DP / Kng / 19-020 was inoculated to Moi = 0.1, 37 ° C., 5% CO ₂ incubator for 2 hours, after washing the cells, the medium supplemented with the candidate derivative at the same concentration as above was added to the cells, cultured at 37 °C, 5% CO ₂ incubator for 96 hours, and then Based on relative values relative to no drug control treatment conditions (100%) falling below a predetermined value (e.g., 10%, 5%, 2%, 1%, etc.) when viral RNA copy number was measured Derivatives thereof can be selected.

Cells that can be used in the screening of the present disclosure using cells include epithelial cells, platelets, lymphocytes, T cells, B cells, natural killer cells, endothelial cells, tumor cells, granulocytes, monocytes, mast cells, nerve cells, etc. is mentioned. More specific examples include cultured cell lines and primary cultured cells derived from eukaryotes including mammals, such as human liver-derived Huh7 cells and monkey kidney-derived Vero cells. The cells used can be cultured according to standard cell culture techniques. For example, cells can be grown in a sterile environment at 37° C. in an incubator containing humidified 95% air-5% CO ₂ in a suitable container. A variety of cell culture media can be used, including media that are not fully defined biological fluids (such as fetal bovine serum), and fully defined media such as 293SFM serum-free medium (Invitrogen Corp., Carlsbad, Calif.). ) can be used. Cell culture techniques are well known in the art, and those skilled in the art can appropriately set culture conditions suitable for the selected cells.

An active ingredient identified by the screening method of the present disclosure can be a lead compound for further development and screening of similar compounds. One skilled in the art can modify the lead compound to design and/or generate peripheral compounds with similar structure and/or function. The design and/or production of peripheral compounds may refer to structure-activity relationship information, random derivatization of lead compounds, chemical synthesis or biological transformation by microorganisms or enzymes. There may be. Surrounding compounds may be subjected to any screening (eg, screening based on physicochemical properties, pharmacokinetics, toxicity of compounds). Peripheral compounds may be further subjected to screening methods of the present disclosure. For example, when a lead compound is obtained by the cell-free screening method of the present disclosure, an active ingredient suitable for virus suppression of the present disclosure can be obtained by screening peripheral compounds for cell permeability.

(Composition)
In one aspect, the present disclosure treats or prevents infection with the virus described herein, including a nucleolar-modifying agent described herein (e.g., an active ingredient having nucleolus-modifying ability). Provide a composition (antiviral agent) for The nucleolus modifying agent may contain a known compound as an active ingredient, or may contain a derivative of a known compound (eg, the flavopiridol derivative described herein). Antiviral agents may be prepared using active ingredients identified by the screening methods described herein.

The active ingredients of the present disclosure may be combined with other active ingredients or used alone. Such other active ingredients include interferons (interferon alpha, pegylated interferon alpha, etc.), known antiviral agents, RNA polymerase inhibitors, protease inhibitors, IRES inhibitors, helicase inhibitors, antisense compounds, ribozymes, etc. are mentioned.

(dosage form, etc.)
Compositions described herein may be provided in various forms. Examples of the form of the composition include, but are not limited to, tablets, capsules, powders, granules, liquids, suspensions, injections, patches, poultices and the like. In one embodiment, compositions of the disclosure comprise a pharmaceutically acceptable carrier or excipient. Such carriers can be sterile liquids such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, including but not limited to peanut oil, soybean oil, minerals. Oil, sesame oil, etc. are included. Water is a preferred carrier when the drug is administered orally. Saline and aqueous dextrose are preferred carriers when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions are preferably employed as liquid carriers for injectable solutions. Suitable excipients include light silicic anhydride, microcrystalline cellulose, mannitol, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, chloride. Sodium, skimmed milk powder, glycerol, propylene, glycol, water, ethanol, carmellose calcium, carmellose sodium, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylacetal diethylaminoacetate, polyvinylpyrrolidone, gelatin, medium chain fatty acid triglyceride, polyoxyethylene hardening Castor oil 60, sucrose, carboxymethyl cellulose, corn starch, inorganic salts and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The composition can also be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can also include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. Examples of suitable carriers include E. W. Martin, Remington's Pharmaceutical Sciences (Mark Publishing Company, Easton, USA). In addition to these, for example, surfactants, excipients, coloring agents, flavoring agents, preservatives, stabilizers, buffering agents, suspending agents, tonicity agents, binders, disintegrants, lubricants, fluidity Accelerators, flavoring agents and the like may also be included.

(Use applications)
The nucleolarogenic and/or antiviral agents described herein can be used to treat or prevent infection with the viruses described herein. In preferred embodiments, the nucleolar modifying and/or antiviral agents of the present disclosure may be used to treat or cure viral infections. As shown in the Examples, viral suppression effects were observed, particularly by treatment with nucleolar modifying agents and/or antiviral agents described herein after viral infection, and treatment of viral infections was observed. It has been shown to be possible. The therapeutic effect of viral infection and the preventive effect of viral infection do not necessarily match.

In one embodiment, a nucleolar modifying agent and/or antiviral agent described herein is administered to a subject diagnosed as being infected with a virus described herein. Diagnosing viral infection includes diagnosing that there is a risk of viral infection. Since there are false positives etc. in the diagnosis depending on the detection method, another diagnosis may be made based on a certain diagnosis result, but a certain detection method suggests that there is a risk that a certain subject is infected with the virus If so, the subject can be a subject that is effectively treated with the nucleolar modifying and/or antiviral agents of the present disclosure. In one embodiment, the subject (or sample obtained from the subject) is subject to a detection method, such as when the subject has been in close contact with a person infected with the virus, or is subject to detection. Viral infection can be diagnosed even when the results are usually negative. A subject once diagnosed as being infected with a virus continues to be administered a nucleolar modifying agent and/or an antiviral agent described herein even after being no longer diagnosed as being infected with a virus. good too. The nucleolarogenic and/or antiviral agents described herein can be administered to subjects with viral infections of any severity.

Detection methods for diagnosing whether a subject is infected with a virus are known or can be easily performed by those skilled in the art. Detection methods using complementary nucleic acids or antibodies to capture viral proteins, detection methods using antibodies to capture proteins characteristic of viruses, and the like, but are not particularly limited. Criteria for diagnosis based on detection results can be appropriately set by those skilled in the art.

When applying the active ingredient or composition of the present disclosure to a subject, the subject is not particularly limited, and mammals (e.g., humans, mice, rats, hamsters, rabbits, cats, dogs, cows, sheep, pigs, monkeys) etc.), birds, reptiles, amphibians, arthropods, fish, and the like.

Amounts of the compositions and/or active ingredients of the present disclosure may vary depending on the nature of the disorder or condition to be treated or prevented, but can be determined by one skilled in the art using standard clinical techniques based on the description herein. In vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulations can also vary with route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the attending physician and each patient's circumstances. The dose, dosing interval and dosing method may be appropriately selected depending on the patient's age, body weight, symptoms and the like.

In one embodiment, in the viral suppression of the present disclosure, the active ingredient is about 0.0001-10 mg/kg body weight, such as about 0.0001 mg/kg body weight, about 0.0002 mg/kg body weight, about 0.0005 mg/kg body weight, about 0.0005 mg/kg body weight, kg body weight, about 0.001 mg/kg body weight, about 0.002 mg/kg body weight, about 0.005 mg/kg body weight, about 0.01 mg/kg body weight, about 0.02 mg/kg body weight, about 0.05 mg/kg body weight , about 0.1 mg/kg body weight, about 0.2 mg/kg body weight, about 0.5 mg/kg body weight, about 1 mg/kg body weight, or about 10 mg/kg body weight, or any two of these values. to the subject. In one embodiment, in the virus suppression of the present disclosure, the active ingredient is about 0.001-100 mg, such as about 0.001 mg, about 0.002 mg, about 0.005 mg, about 0.01 mg, about 0.02 mg. , about 0.05 mg, about 0.1 mg, about 0.2 mg, about 0.5 mg, about 1 mg, about 2 mg, about 5 mg, about 10 mg, or about 100 mg, or any two of these values. can be administered to a subject. In one embodiment, the above doses are daily doses, but may also be single doses. One dose may be administered in a single dose or in multiple divided doses. In one embodiment, in the viral suppression of the present disclosure, the nucleolar modifying agent is administered within a few hours (e.g., 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 8 hours, 10 hours, or 12 hours). (eg, 70% or more, 80% or more, 90% or more, etc.).

In one embodiment, in the viral suppression of the present disclosure, the active ingredient may be administered in one dose once, twice or three times per 1, 2, 3, 4, 5, 6 or 7 days. As shown in the Examples with flavopiridol, the nucleolus-altering agent (or dose of nucleolus-altering agent) used in the viral suppression of the present disclosure temporarily reduced the nucleolus. Since the nucleolus can be revived in as little as several hours even as a , about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 18 hours, about 24 hours, and the like. For example, in viral suppression of the present disclosure, nucleolar modifying agents can be administered once, twice, or three times per day. In embodiments in which the nucleolar modifying agent is administered multiple times, the dose of the active ingredient may vary between administrations, e.g. Double dose, single dose, 1/2 dose, 1/3 dose, 1/4 dose, etc. can be set. In one embodiment, the period until the next administration and the dose at the next administration can be adjusted as appropriate, based on the progress after administration. The compositions described herein may contain a suitable amount (eg, one dose) of active ingredient, taking into consideration the dose and mode of administration.

The administration route of the active ingredient or composition described herein is preferably effective in treating or preventing viral infection, such as oral, intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal. It may be intranasal, intranasal, epidural, or the like. It can also be used in an inhaler or nebulizer with an aerosolizing agent if desired, and can be co-administered with other medications. Administration can be systemic or local.

The composition of the present disclosure can be provided as a kit. In one embodiment, the disclosure provides a pharmaceutical pack or kit comprising one or more containers filled with one or more ingredients that can be added to the compositions of the disclosure. Manufacture, use or sale for human administration by a governmental agency, optionally associated with such container, as prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products. It is also possible to indicate information indicating the authorization of

Procedures for formulating the composition of the present disclosure as a pharmaceutical or the like are known in the art, and are described, for example, in the Japanese Pharmacopoeia, the United States Pharmacopoeia, and the Pharmacopoeias of other countries. Accordingly, those of ordinary skill in the art, given the description herein, will be able to determine embodiments such as amounts to be used without undue experimentation.

In this specification, "or" is used when "at least one or more" of the items listed in the sentence can be adopted. The same applies to "or". When we say "within a range" of "two values" herein, the range includes the two values themselves.

References such as scientific literature, patents, and patent applications cited in this specification are hereby incorporated by reference in their entirety to the same extent as if each was specifically described.

In the above, the present disclosure has been described by showing preferred embodiments for easy understanding. While the present disclosure will now be described based on the examples, the foregoing description and the following examples are provided for illustrative purposes only and not for the purpose of limiting the present disclosure. Accordingly, the scope of the present disclosure is not limited to the embodiments or examples specifically described herein, but only by the claims.

The reagents specifically used the products described in the examples, but equivalent products from other manufacturers (Sigma-Aldrich, Fujifilm Wako Pure Chemical, Nacalai, R&D Systems, USCN Life Science INC, etc.) can be substituted. be.

(Example 1: Suppression of coronavirus by nucleolus denaturant)
We tested whether CDK inhibitors show a suppressive effect against coronavirus.

Specifically, hepatocellular carcinoma Huh7 cells (provided by the National Institute of Infectious Diseases) cultured overnight in Dulbecco's modified Eagle's medium (10% fetal bovine serum, 100 μg/mL penicillin, 100 μg/mL streptomycin added) Coronavirus strain SARS-CoV-2/Hu/DP/Kng/19-020 (provided by Kanagawa Institute of Public Health) was inoculated at a multiplicity of infection (Moi) of 0.1. After culturing for 2 hours, cells were washed once with Dulbecco's modified Eagle's medium (supplemented with 2% fetal bovine serum, 100 μg/mL penicillin, and 100 μg/mL streptomycin), replaced with drug-free medium, and cultured for 22 hours. (Inf) Dulbecco's modified Eagle's medium (2% bovine fetal serum, 100 μg/mL penicillin, and 100 μg/mL streptomycin) and cultured at 37° C., 5% CO ₂ for 22 hours to obtain cells and culture supernatant (Post). In addition, cells and culture supernatant were obtained in the same manner except that drug treatment was started at the same time as virus infection (Throughout). The control group (Control) was cultured in Dulbecco's modified Eagle's medium (containing 2% fetal bovine serum, 100 µg/mL penicillin and 100 µg/mL streptomycin) supplemented with the same concentration of DMSO as in the drug-treated group.

The amount of viral RNA and viral titer were measured using the obtained cells and culture supernatant.

　The amount of viral RNA was measured as follows. Cells were suspended in Isogen II (Nippon Gene, Japan) and RNA was extracted. The extracted RNA was subjected to reverse transcription real-time PCR method. One Step TB Green (registered trademark) PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio, Shiga) was used for the PCR reaction, and 027-SYBR-F (AGCCTCTTCTCGTTCCTCATCAC: SEQ ID NO: 1) and 027-SYBR were used as primers. -R (CCGCCATTGCCAGCCATTC: SEQ ID NO: 2) was used. As an endogenous control, primers for GAPDH (TGTAGTTGAGGTCAATGAAGGG: SEQ ID NO: 3) and (ACATCGCTCAGACACCATG: SEQ ID NO: 4) were used. The PCR conditions were as follows: initial reaction at 42° C. for 5 minutes, 95° C. for 10 seconds, followed by 40 cycles of reaction at 95° C. for 5 seconds and 60° C. for 34 seconds.

Viral titer (PFU/mL) was measured as follows. 8×10 ⁴ Vero-TMPRSS2 cells were seeded in a 24-well plate, serially diluted virus solutions were added 24 hours later, and cultured at 37° C. for 2 hours. After that, the medium was removed, a medium supplemented with 1% methylcellulose (Sigma, USA) was added, and the cells were cultured for 3 days. Then, the cells were fixed with 10% formalin (Muto Kagaku, Tokyo) and stained with Giemsa stain (Muto Kagaku, Tokyo). Plaques were counted and virus titers were determined.

The results are shown in Figure 1. Suppression of coronavirus was observed with treatment with nucleolar modifying agents in both Post and Throughhout conditions.

(Example 2: Comparison of viral inhibitory effects between nucleolar modifiers)
Multiple nucleolar modifiers were tested for coronavirus inhibitory effect.

We created Huh7 cells stably expressing ACE2 (Huh7-ACE2). Human ACE2 was expressed in Huh7 using a lentiviral vector expressing human ACE2 and puromycin, cultured for 5 days in the presence of 1 μg/mL puromycin (Nacalai Tesque, Kyoto), and surviving cells were treated with Huh7-. ACE2.

Huh7-ACE2 cells or VeroE6/TMPRSS2 cells (obtained from JCRB cell bank, National Institute of Medical Innovation, Health and Nutrition) 1×10 ⁴ cells were seeded in a 96-well microplate (Corning, USA), final concentration 1,000 nM, 500 nM , 250 nM, 125 nM, 62.5 nM, 31.3 nM of each nucleolus modifying agent (flavopyridol, AT7519, P276-00, or CDK1/2 inhibitor III, all known as CDK inhibitors) was added to the medium (Selleck, USA). After culturing for 24 hours in a 37°C, 5% CO ₂ incubator, the coronavirus strain SARS-CoV-2/Hu/DP/Kng/19-020 was inoculated at Moi = 0.1, 37°C, 5% Cultured for 2 hours in a % _CO2 incubator. After washing the cells, a medium supplemented with each CDK inhibitor at the same concentration as above was added to the cells. Viral RNA copy number in the culture supernatant was measured after culturing the cells for 96 h at 37° C., 5% CO ₂ incubator.

　The amount of viral RNA was measured as follows. 5 μl of virus-containing culture supernatant was added to 5 μl of 2x RNA lysis buffer (2% Triton (registered trademark) X-100, 50 mM KCl, 100 mM Tris-HCl [pH 7.4], 40% glycerol, 0.4 U/μl SUPERase- It was inactivated by mixing with IN RNase Inhibitor (Invitrogen, USA)). The mixture was diluted 10-fold with RNase-free water and 2.5 μl of this was subjected to the reverse transcription real-time PCR method. One Step TB Green (registered trademark) PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio, Shiga) was used for the PCR reaction, and 027-SYBR-F (AGCCTCTTCTCGTTCCTCATCAC: SEQ ID NO: 1) and 027-SYBR were used as primers. -R (CCGCCATTGCCAGCCATTC: SEQ ID NO: 2) was used. The PCR conditions were as follows: initial reaction at 42° C. for 5 minutes, 95° C. for 10 seconds, followed by 40 cycles of reaction at 95° C. for 5 seconds and 60° C. for 34 seconds.

The results are shown in Figures 2 and 3. Among the nucleolar modifiers, flavopiridol in particular showed good coronavirus inhibitory effect in both cell lines.

(Example 3: effective amount of flavopiridol)
Flavopiridol and remdesivir (reported to have the ability to suppress coronavirus) were tested for effective doses for suppressing coronavirus.

As in Example 2, Huh7-ACE2 cells or VeroE6/TMPRSS2 cells were infected with SARS-CoV-2/Hu/DP/Kng/19-020 simultaneously with various concentrations of flavopiridol or remdesivir (Selleck, USA). ) and cultured for 24 hours, the viral RNA copy number in the culture supernatant was measured.

The results are shown in FIGS. 4 and 5. FIG. In Huh7-ACE2 cells, the EC ₅₀ for flavopiridol and remdesivir were calculated to be 11.88 nM and 165.6 nM, respectively. In VeroE6/TMPRSS2 cells, the EC50 for flavopiridol and remdesivir were calculated to be 60.96 nM and 2339 _nM , respectively. Compared to remdesivir, flavopiridol was shown to be able to suppress coronavirus at lower doses.

(Example 3A: Effect on different coronavirus strains)
We tested the efficacy of flavopiridol against different coronavirus strains.

In the same manner as in Example 3, for Huh7-ACE2-TMPRSS2 cells (cells in which TMPRSS2 was continuously expressed in Huh7-ACE2 cells with a lentiviral vector), coronavirus Omicron strain hCoV-19/Japan/TY38-873/2021 ( Treatment with various concentrations of flavopiridol was started at the same time as the infection of the virus (provided by the National Institute of Infectious Diseases), and after culturing for 24 hours, the viral RNA copy number in the culture supernatant was measured.

The results are shown in FIG. In Huh7-ACE2-TMPRSS2 cells, the EC50 of flavopiridol was calculated to be 103.9 _nM . Flavopiridol was shown to be able to suppress various strains of coronavirus at low doses.

(Example 4: Effect of nucleolus modifier on nucleolus)
Changes in the nucleolus caused by treatment with a nucleolus-denaturing agent were observed over time.

A Huh7 cell line stably expressing mCherry-fused nucleophosmin (mCherry-NPM1) was generated.

After treating the cells with flavopiridol (final concentration of 1 μM) for 120 minutes, the cells were replaced with drug-free medium and treated for an additional 180 minutes. DMSO (1000-fold dilution) was treated as a negative control. Cell Voyager CV7000S (Yokogawa Electric, Tokyo) was used for image acquisition, and the dynamics of mCherry-NPM1 was observed at 10-minute intervals.

The results are shown in Figure 6. It was observed that nucleoli were transformed into small tufts by the drug treatment, but that nucleoli were formed again by replacing the medium with a drug-free medium. From this finding, it is expected that treatment with a nucleolar-altering agent causes reversible morphological changes in the nucleolus and is highly safe.

(Example 5: Effect of timing of contact with nucleolus modifier)
Cells were tested for changes in inhibitory effect on coronavirus depending on the timing of contact with flavopiridol.

Approximately 10,000 Vero/TMPRSS2 cells (obtained from JCRB cell bank, National Institute of Health and Nutrition) were seeded in 96-well plates and added to Dulbecco's modified Eagle's medium (10% fetal bovine serum, 100 μg/mL penicillin, 100 μg/mL streptomycin) was cultured overnight. Each treatment was then performed according to the table below. Virus inoculation was performed by adding SARS-CoV-2/Hu/DP/Kng/19-020 to each well at Moi=0.1.

Pre, Inf and Post treatments are indicated below, respectively.
Pre-treatment: Vero/TMPRSS2 cells were added flavopiridol (final concentrations; 1000 nM, 500 nM, 250 nM, 125 nM, 62.5 nM, or 31.3 nM) or control DMSO prior to virus inoculation and Incubated for 1 hour.
Inf treatment: At the same time as virus inoculation, flavopiridol (final concentrations; 1000 nM, 500 nM, 250 nM, 125 nM, 62.5 nM, or 31.3 nM) or control DMSO was added to Vero/TMPRSS2 cells and treated at 37°C for 2 cultured for hours.
- Post treatment: Vero/TMPRSS2 cells were inoculated with virus and cultured at 37°C for 2 hours. After washing the cells, media supplemented with flavopiridol (final concentration; 1000 nM, 500 nM, 250 nM, 125 nM, 62.5 nM, or 31.3 nM) or DMSO as a control was added to the cells and incubated at 37° C., 5% CO ₂ . It was cultured in an incubator for 24 hours.

　After that, 5 μL of the culture supernatant was obtained, and as shown in Example 2, the viral RNA copy number in the culture supernatant was measured.

The results are shown in Figure 7. Throughhout and Post treatment conditions showed higher viral suppression effects than Pre+Inf and Inf treatments. From this, it was found that flavopiridol is particularly effective against cells after virus infection.

(Example 6: Flavivirus suppression by nucleolus denaturant)
Dengue and Zika virus growth in Huh7 cells in the presence of flavopiridol was tested.

3×10 ⁴ cells were seeded in 24-well plates and cultured for 24 h in the presence of flavopiridol at final concentrations of 20 nM, 100 nM, 200 nM or 1000 nM in a 37° C. 5% CO ₂ incubator. Cells were then infected with DENV (H241 strain), ZIKV (MR766-NIID strain) at a multiplicity of infection (Moi)=1 for 2 hours. After that, the amount of virus in the culture supernatant was measured by the following procedure: 5×10 ⁴ Vero cells were seeded in a 24-well plate and cultured in a 37° C. 5% CO ₂ incubator for 24 hours. To this, 100 μL of each 10-fold diluted solution of the above culture supernatant was added for infection. After 2 hours, the medium was changed to Dulbecco's modified Eagle's medium containing 1% methylcellulose and cultured for 48 hours. Cells were fixed with 4% paraformaldehyde and incubated with PBS containing 0.5% Triton X-100 for 15 minutes. After that, the medium was replaced with a medium containing anti-dengue virus mouse antibody or anti-Zika virus mouse antibody and incubated for 30 minutes. Cells were washed with PBS and incubated with medium containing biotin-crosslinked anti-mouse secondary antibody for 30 minutes. After washing with PBS, Strept ABC Peroxidase Kit was added and incubated for 30 minutes, Vector VIP Peroxidase Substrate was subsequently added and incubated for 10 minutes. Finally, cells were washed and dried, and the number of foci was counted.

The results are shown in Figure 8. Flavopiridol inhibited all flaviviruses at low concentrations, but inhibited dengue virus particularly well.

(Note)
While the present disclosure has been illustrated using the preferred embodiments thereof, it is understood that the present disclosure is to be construed in scope only by the claims. It is understood that the patents, patent applications and publications cited herein are hereby incorporated by reference for their contents as if the contents themselves were specifically set forth herein. understood.

The present disclosure provides novel antiviral agents, and may provide treatment and prevention of viral infections in novel aspects.

SEQ ID NO: 1: Fw primer
AGCCTCTTCTCGTTCCTCATCAC
SEQ ID NO: 2: rV primer
CCGCCATTGCCAGCCATTC
SEQ ID NO: 3: Primer for GAPDH
TGTAGTTGAGGTCAATGAAGGG
SEQ ID NO: 4: Primer for GAPDH
ACATCGCTCAGACACCATG

Claims (11)

1. An antiviral agent against coronavirus that contains a nucleolus denaturing agent as an active ingredient.
2. The antiviral agent according to claim 1, wherein the coronavirus comprises a virus selected from the group consisting of HCoV-HKU1, HCoV-OC43, SARS-CoV, MERS-CoV, and SARS-CoV-2.
3. The antiviral agent according to claim 2, wherein the coronavirus includes SARS-CoV-2.
4. The antiviral agent according to any one of claims 1 to 3, wherein the nucleolar modifying agent has CDK inhibitory activity.
5. The antiviral agent according to claim 4, wherein the nucleolar modifying agent has inhibitory activity against at least one CDK selected from the group consisting of CDK1, CDK2, CDK4 and CDK9.
6. The antiviral agent according to any one of claims 1 to 5, wherein the nucleolar modifying agent comprises a flavopiridol compound, AT7519, P276-00 or CDK1/2 inhibitor III.
7. The antiviral agent according to claim 6, wherein the nucleolar modifying agent contains a flavopiridol compound.
8. The antiviral agent according to any one of claims 1 to 7, for treatment of infectious diseases caused by the coronavirus.
9. The antiviral agent according to any one of claims 1 to 8, characterized in that it is administered to a subject diagnosed as being infected with the coronavirus.
10. The antiviral agent according to any one of claims 1 to 9, which is for administration to humans.
11. The antiviral agent according to any one of claims 1 to 10, which is administered at a dose of about 0.1 to 10 mg/kg body weight of said nucleolar modifying agent.

Images