WO2003077643A2

WO2003077643A2 - Methods for increasing the oil content in plants by reducing the content of one or more storage proteins

Info

Publication number: WO2003077643A2
Application number: PCT/EP2003/002733
Authority: WO
Inventors: Jörg BAUER
Original assignee: Basf Plant Science Gmbh
Priority date: 2002-03-20
Filing date: 2003-03-17
Publication date: 2003-09-25
Also published as: AU2003209737A1; AU2003209737A8; WO2003077643A3; DE10212893A9; DE10212893A1

Abstract

The invention relates to methods for increasing the oil content in plants by reducing the content of storage proteins by one or more. The invention also relates to the use of plants having a reduced content of storage proteins for producing foodstuffs, feedstuffs, seeds, pharmaceutics or fine chemicals, particularly for producing oils.

Description

Process for increasing the oil content in plants

description

The invention relates to methods for increasing the oil content in plants by reducing one or more storage proteins. The invention further relates to the use of plants with a reduced storage protein content for the production of food, animal feed, seeds, pharmaceuticals or fine chemicals, in particular for the production of oils.

Increasing the oil content in plants and especially in plant seeds is of great interest for classic as well as modern plant breeding and especially plant biotechnology. Due to the increasing consumption of vegetable oils for food and industrial applications, options for increasing or modifying vegetable oils are increasingly the subject of current research (e.g. Töpfer et al. (1995) Science 268: 681-686). The main goal is to increase the fatty acid content in seed oils.

The fatty acids obtainable from vegetable oils are also of particular interest. They are used, for example, as raw materials for plasticizers, lubricants, surfactants, cosmetics etc. or are used as valuable raw materials in the food and feed industry. For example, the provision of rapeseed oils with fatty acids of medium chain length is of particular interest, since these are particularly sought after in the manufacture of surfactants.

Through the targeted modulation of plant metabolic pathways by means of genetic engineering processes, plant metabolism can be advantageously changed in a way that would be difficult or impossible to achieve with traditional breeding methods. For example, unusual fatty acids, for example certain polyunsaturated fatty acids, are only synthesized in certain plants or ^■ not at all in plants and can therefore only be produced in transgenic plants by expression of the corresponding enzyme (e.g. Millar et al. (2000) Trends Plant Sei 5 : 95-101).

Lipids are synthesized from fatty acids and their synthesis can be divided into two sub-mechanisms, a quasi "prokaryotic" and a quasi "eukaryotic"'(Browse et al. (1986) Biochemical J 235: 25-31; Ohlrogge & Browse (1995) Plant Cell 7: 957-970). The prokaryotic mechanism is in the Plastids located and comprises the biosynthesis of free fatty acids are exported to the cytosol where they are received as ⁱ 'ettsäureacyl CoA esters in the eukaryotic mechanism and -stert having glycerol-3-phosphate to phosphatidic acid (PA) comparable. PA is the starting point for the synthesis of leutral and polar lipids. The neutral lipids are synthesized using the Kennedy route (Voelker (1996) Genetic Engineering ed .: Setlow 18: 111-113; Shankline & Cahoon (1998) -nnu Rev Plant Physiol Plant Mol Biol 49: 611-649; Frentzen ( 1998) jipids 100: 161-166).

Barnen are particularly dependent on storing energy and basic building blocks, e.g. to ensure later germination. Storage takes place in the form of storage lipids, storage proteins or starch (storage carbohydrate). Depending on the plant, the relationships between the three storage molecules vary. Rapeseed varieties contain an average of around 48% storage lipids, 19% starch and 21% storage proteins, while soybean contains 22% lipids, 12% starch and 37% proteins (each based on dry matter) (Biochemistry & Molecular Biology of the Plant ed. Buchanan, Gruissem, Jones 2000, American Society of Plant Physiologists). The storage molecules are accumulated during the embryo development of the semen.

Storage proteins (as a result also SP) in the embryo are used to store carbon, nitrogen and sulfur, which are required for the rapid heterotrophic growth when seeds or pollen germinate. They usually have no enzymatic activity. These proteins are only synthesized in the embryo during seed development. SP accumulate in protein storage vacuoles (PSV) of differentiated cells in the embryo or endosperm. As a further form, they can also be present as protein bodies associated with the endoplasmic reticulum (ER) (Her an & Larkins (1999) Plant Gell 11: 601-613). All storage proteins are originally synthesized on the rough ER (Bollini & Chrispeels (1979) Planta 146: 487-501). They can remain in the ER or can be transported to other compartments in the cell via the Golgi apparatus. In the ER, the storage proteins are processed and folded correctly, as well as their oligomerization (Vitale & Denecke (1999) Plant Gell 11: 615-628). Storage proteins in seeds have historically been classified based on their different solubilities. Proteins were extracted sequentially from the seeds using various solvents. Water-soluble proteins were referred to as albumins. Proteins that are soluble in a saline solution were called globulins, and proteins that were in an ethanol-water Mixtures that are soluble were called prolamines. Gluteline, the last group, can only be extracted by treatment with dilute acids (Biochemistry &. Molecular Biology of the Plant ed. Buchanan, Gruissem, Jones 2000, American Society of Plant Physiologists). Prolamines only occur specifically in the endosperm of grasses (Poaceae), where they are the main storage proteins (exceptions are rice and oats, where glutelin-like and globulins predominate). In contrast, globulins dominate in dicotyledons.

A total of four large gene families for storage proteins can be assigned based on their sequences: 2S-albumins (similar to napin), 7S-globulins (similar to phaseolin), HS / 12S-globulins (similar to legumin / cruciferin) and the zein prolamines.

2S albumins are widely used in seeds of dicotyledons, including important commercial plant families such as Fabaceae (e.g. soybean), Brassicaceae (e.g. rapeseed), Euphorbiaceae (e.g. castor bean) or Asteraceae (e.g. sunflower). 2S albumins are compact globular proteins with conserved cysteine residues that often form heterodimers.

7S globulins are in trimeric form and contain no cysteine residues. After their synthesis, like the 2S albumins, they are split into smaller fragments and glycosylated. Despite differences in the size of the polypeptides, the different 7S globulins are highly conserved and presumably, like the 2S albumins, are based on a common precursor protein. The 7S globulins are only present in small amounts in monocots. In dicotyledons their proportion is smaller and smaller compared to the HS / 12S globulins.

In addition to the 2S albumins, HS / 12S globulins represent the main fraction of the storage proteins in dicotyledons. The high similarity of the different HS globulins from different plant genera in turn suggests a common precursor protein in evolution.

All storage molecules in seeds are formed directly or indirectly from carbohydrate precursors. Sucrose is the primary source of carbon and energy which is transported from the leaves to the developing seeds. For example, sucrose is converted to glucose-6-phosphate and pyruvate, which is transported into the plastids and used there for the synthesis of acetyl-CoA, which is the starting product for the synthesis of the fatty acids. It is not known in detail how the balance between the individual storage molecules is regulated in the individual plants. The reduction of lipid synthesis leads to an increase in the storage proteins (O'Hara et al. (2000) Trans Biochem Soc 613-615).

EP-A 0 591 530 describes the reduction in the expression of a storage protein in seeds, in particular the storage protein glutelin in rice, with the aim of optimizing the usability of rice in fermentation processes for producing alcoholic beverages. Proteins as such are a hindrance in these processes. An effect of the reduction on the content of other herbal ingredients is not described.

WO 87/47731 describes the reduction of one or more storage proteins in the seed of soybeans by means of antisense technology. A method is also described in which, in addition to the storage protein, the expression of a gene of fatty acid biosynthesis (microsomal Δ-12 desaturase [Fad 2-1] genes) is reduced. In example 2 (p.25 / Z.4-9) this is done by cosuppression. The result is transgenic so bean plants with a reduced content of a storage protein and a content of oleic acid in the total amount of fatty acids, which is relatively higher in relation to other fatty acids than in non-transgenic soybean plants. The change in the fatty acid profile is due to the suppression of the Fad2-1 gene and not the storage protein. No change in the total content of fatty acids is described.

WO 97/35023 describes storage proteins and methods for increasing the content of certain amino acids in plants by expressing said storage proteins. A description of the effects on other plant metabolites is not disclosed. WO 97/41239 describes similar methods based on sulfur-rich storage proteins.

WO 98/26064 describes methods for reducing one or more storage proteins, preferably in maize. Plants with an increased or changed content of amino acids or starch are also described. An impact on the oil content is not described.

WO 99/15004 describes the modification of the content of metabolites in the food organs of plants by expression of sulfur-rich proteins with more than 10% sulfur-containing amino acids, in particular the sunflower seed albumin (SSA; sunflower seed albumin). The expression in lupine an increase in the oil content (Example 1; p.28 / Z.4-5, 17). Conversely, the expression of the same gene in pea (Pisu sativum) causes a decrease (Example 2; p.32 / Z.21).

EP-A 0 620 281 describes a change in the lipid composition (fatty acid pattern) in oilseed rape by reducing the expression of a storage protein (napin) by means of antisense technology. Example 6 (S.ll / Z.12-15) describes that only the ratio of the individual fatty acids changed so that the content of oleic acid decreased and the content of linoleic and linolenic acid increased. It is explicitly indicated that the total fatty acid content remained unchanged. Corresponding data are also disclosed in the corresponding publication by the inventors (Kohno-Murase J et al. (1994) Plant Mol Biol 26 (4): 1115-1124). WO 01/81604 describes transgenic plants which contain a cytosolic acetyl-CoA carboxylase Express (ACCase).

It was therefore the task of providing alternative methods for increasing the oil content in plants.

This object is achieved by the present invention. A first object of the invention comprises a method for increasing the total oil content in plant organisms, characterized in that subsequent work steps are included

a) reducing the amount of protein of one or more storage proteins in a plant organism or a tissue, organ, part or cell of said plant organism and

b) Selection of plant organisms in which - in contrast to or compared to the parent organism - the total oil content in said plant organism or in a tissue, organ, part or cell of said plant organism is increased.

The method according to the invention can in principle be applied to all types of plants. Preferred for those in which a storage protein is naturally expressed. The sequences from other plants which are homologous to the storage protein sequences disclosed in the context of this invention can easily be found, for example, by searching the database or by screening gene banks. "Plant organism or cells derived therefrom" generally means any cell, tissue, part or reproductive material (such as seeds or fruits) of an organism which is capable of photosynthesis. Included in the scope of the invention are all genera and species of higher and lower plants in the plant kingdom. Annual, perennial, monocot and dicot plants are preferred. Included are mature plants, seeds, shoots and seedlings, as well as parts derived from them, propagation material (for example tubers, seeds or fruits) and cultures, for example row or callus cultures. Mature plants mean plants at any stage of development beyond the seedling. Seedling means a young, immature plant at an early stage of development.

"Plant" in the context of the invention means all genera and species of higher and lower plants in the plant kingdom. Included under the term are the mature plants, seeds, sprouts and seedlings, as well as parts derived therefrom, propagation material, plant organs, tissues, protoplasts, callus and other cultures, for example cell cultures, and all other types of groupings of plant cells into functional or structural units , Mature plants mean plants at any stage of development beyond the seedling. Seedling means a young, immature plant at an early stage of development. "Plant" includes all annual and perennial, monocotyledonous and dicotyledonous plants and includes, by way of example but not by way of limitation, those of the genera Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solarium, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Hesisocallis, Nesis gonium, panieum, pennisetum, ranunculus, senecio, salpiglossis, cucu is, browaalia, glycine, pisum, phaseolus, lolium, oryza, zea, avena, hordeum, seeale, triticum, sorghum, picea and populus.

Plants from the following plant families are preferred: Amarantheae, Asteraceae, Brassicaceae, Carophyllaceae, Chenopodiaceae, Compositae, Cruciferae, Cucurbitaceae, Labiatae, Leguminosae, Papilionoideae, Liliaceae, Linaceae, Malvaceae, Rosaceaeaeae, Rosaceaeaeae, Rosaceaeaeae, Rosaceaeaeae Tetragoniacea, Theaceae, Umbelliferae. Preferred monocotyledonous plants are selected in particular from the monocotyledonous crop plants, such as, for example, the family of the Gramineae such as rice, corn, wheat or other types of cereals such as barley, millet, rye, triticale or oats as well as sugar cane and all types of grass.

The invention is very particularly preferably applied from dicotyledonous plant organisms. Preferred dicotyledonous plants are in particular selected from the dicotyledonous crop plants, such as, for example

- Asteraceae such as sunflower, tagetes or calendula and others,

- Compositae, especially the genus Lactuca, especially the species sativa (salad) and others,

- Cruciferae, especially the genus Brassica, especially the species napus (rape), campestris (turnip), oleracea cv Tastie (cabbage), oleracea cv Snowball Y (cauliflower) and oleracea cv

Emperor (broccoli) and other types of cabbage; and the genus Arabidopsis, especially the species thaliana as well as cress or canola and others,

- Cucurbitaceae such as melon, pumpkin or zucchini and others,

- Leguminosae, especially the genus Glycine, especially the type ax (soybean), soybean as well as alfalfa, peas, beans or peanuts and others

Rubiaceae, preferably of the subclass Lamiidae such as Coffea arabica or Coffea liberica (coffee bush) and others,

- Solanaceae especially the genus Lycopersicon, especially the species esculentum (tomato) and the genus Solanum, especially the species tüberosum (potato) and melongena (eggplant) as well as tobacco or peppers and others,

Sterculiaceae, preferably of the subclass Dilleniidae such as Theobroma cacao (cocoa bush) and others,

Theaceae, preferably of the subclass Dilleniidae, such as, for example, Camellia sinensis or Thea sinensis (tea bush) and others, - Umbelliferae, especially the genus Daucus (especially the species carota (carrot)) and Apium (especially the species graveolens dulce (Seiarie)) and others; and the genus Capsicum, especially the species annu (pepper) and others,

as well as flax, soybeans, cotton, hemp, flax, cucumber, spinach, carrot, sugar beet and the various types of trees, nuts and wines, in particular banana and kiwi.

Also included are ornamental plants, useful or ornamental trees, flowers, cut flowers, shrubs or lawn. Examples include, but are not limited to, angiosperms, bryophytes such as hepaticae (liverwort) and musci (moss), pteridophytes such as ferns, horsetail and lycopods; Gymnosperms such as conifers, cycads, ginkgo and gnetals, the families of rosaceae such as rose, ericaceae such as rhododendrons and azaleas, euphorbiaceae such as poinsettias and croton, caryophyllaceae such as cloves, solanaceae such as petunias, Gesneriaceae such as the Usamalsamineaeaid as the Usambaramineae , Iridaceae like gladiolus, iris, freesia and crocus, Compositae like marigold, Geraniaceae like geranium, Liliaceae like the dragon tree, Moraceae like Ficus, Araceae like Philodendron and others.

Plant organisms in the sense of the invention are further photosynthetically active capable organisms, such as algae, cyanobacteria and mosses. Preferred algae are green algae, such as, for example, algae of the genus Hae atococcus, Phaedactylum tricornatum, Volvox or Dunaliella. Synechocyεtis is particularly preferred.

Most preferred are plants which are suitable for oil production, such as, for example, arabidopsis, rapeseed, sunflower, sesame, safflower, olive tree, soybean, corn, wheat or various types of nuts, such as, for example, walnut almond. Among these, the dicot plants, in particular rapeseed, soybeans and sunflower, are particularly preferred.

"Oils" includes neutral and / or polar lipids and mixtures thereof. Examples listed but not restrictive are those listed in Table 1. Tab. Plant lipid classes

Neutral lipids preferably means triacylglycerides. Both the neutral and the polar lipids can contain a wide range of different fatty acids. The fatty acids listed in Table 2 should be mentioned as examples, but not by way of limitation.

Tab. 2: Overview of different fatty acids (selection) ¹ chain length: number of double bonds * not naturally occurring in plants

Oils preferably means seed oils.

"Oil content" means the sum of all oils as defined above, preferably the sum of the triacylglycerides. "Increasing" the oil content means increasing the content of oils in a plant or a part, tissue or organ thereof, preferably in the seed organs of the plant. The oil content is at least 5%, preferably at least 10%, particularly preferably at least 15%, very particularly preferably at least 20%, most preferably at least 25, in comparison to a starting plant which is not subjected to the process according to the invention but is otherwise unchanged, under otherwise identical general conditions % elevated. Framework conditions means all conditions relevant to the germination, cultivation or growth of the plant such as soil, climate or light conditions, fertilization, irrigation, plant protection measures etc.

"Storage protein" generally means a protein which has at least one of the following essential properties:

a) Storage proteins are essentially only expressed in the embryo during seed development. "Essentially" means that at least 50%, preferably at least 70%, very particularly preferably at least in the said stage

90%, most preferably at least 95% of the total expression takes place over the life of a plant.

b) Storage proteins are broken down again during seed germination. The degradation during germination is at least 20%, preferably at least 50%, very particularly preferably at least 80%.

c) Storage proteins make up a significant proportion of the total protein content of the non-germinating seed. The storage protein in the non-germinating seed of the wild-type plant preferably makes up more than 5% by weight of the total protein, particularly preferably at least 10% by weight), very particularly preferably at least 20% by weight, most preferably at least 30% by weight .-%.

Storage proteins preferably have 2 or all of the above-mentioned essential properties a), b) or c).

Storage proteins can be divided into subgroups according to other characteristic properties, such as their sedimentation coefficient or their solubility in different solutions (water, saline, alcohol). The determination of the sedimentation coefficient can be carried out in the manner familiar to the person skilled in the art by means of ultracentrifugation (for example described in Correia JJ (2000) Methods in Enzymology 321: 81-100). The storage protein is preferably selected from the classes of 2S-albumin (similar to napin), 7S-globulin (similar to phaseolin), HS / 12S-globulin (similar to legumin / cruciferin) or zein-prolamine.

Particularly preferred 2S albumins include

a) 2S albumins from Arabidopsis, very particularly preferably the 2S albumins with SEQ ID NO: 2, 4, 6 or 8, most preferably the proteins encoded by the nucleic acids according to SEQ ID NO: 1, 3, 5 or 7 .

b) 2S albumins from species of the genus Brasεica, such as, for example, Brassica napus, Brassica nigra, Brassica juncea, Brassica oleracea or Sinapis alba, very particularly preferably the 2S albumins with SEQ ID NO: 32, 34, 36, 38, 40 , 46 or 48, most preferably the proteins encoded by the nucleic acids according to SEQ ID NO: 31, 33, 35, 37, 39, 45 or 47,

c) 2S albumins from soybeans, very particularly preferably the 2S albumins with SEQ ID NO: 42 or 44, most preferably the proteins encoded by the nucleic acids according to SEQ ID NO: 41 or 43,

d) 2S albumins from sunflower (Helianthus annus), very particularly preferably the 2S albumins with SEQ ID NO: 50 or 52, most preferably the proteins encoded by the nucleic acids according to SEQ ID NO: 49 or 51,

as well as the corresponding homologues and functional equivalents to a) or b) or c) or d) from identical or other plant species, in particular rapeseed) sunflower, flax, sesame, safflower, olive tree, soya or various types of nut. In addition to the essential properties mentioned above, functional equivalents are preferably distinguished by characteristic properties such as a 2S sedimentation coefficient and / or by solubility in water.

In a further preferred embodiment, functional equivalents of the 2S-albumins have a homology of at least 60%, preferably at least 80%, very particularly preferably at least 90%, most preferably at least 95% to one of the protein sequences with SEQ ID NO: 2, 4 , 6, 8, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50 or 52 where the homology preferably extends over a length of at least 30 amino acids, preferably at least 50 amino acids, particularly preferably over 100 amino acids most preferably extends over the entire length of the respective proteins, and have the same essential properties of a storage protein and - preferably - the characteristic properties of a 2S storage protein.

Further preferred functional equivalents contain in the nucleic acid sequences coding for them at least one, preferably two, particularly preferably 3, most preferably all of the sequence motifs selected from in each case one of the following groups I, II, III or IV:

Group I:

1.5 '-TTCCTCGTCTGCGCA-3' (SEQ ID NO 53)

2.5 '-TCCTCACCAACGCTTCC-3' (SEQ ID NO 54)

3.5 '-CACCTAAGAGCTTGCCAG-3' (SEQ ID NO 55)

4.5 '-GTTTGCCCCACCTTGA-3' (SEQ ID NO 56)

Group II

5 '-ATGGCGAACAAGCTCTTCCTCG-3' (SEQ ID NO 57) 5 '-GCCTTCTTCTTCCTTCTCACCAA-3' (SEQ ID NO 58) 5 '-CCAAAATGTAGGAAGGAGTTTCA-3' (SEQ ID NO 59) 5 '-CTTTGCACTTGAQ 60) 5 '-GCAAGTTAGCGTTTGTCCCTTCCAG-3' (SEQ ID NO 61) 5 '-GTCCCTTCCAGAAGACCATGCCTGG-3' (SEQ ID NO 62)

Group III:

1.5 '-CACATCATGGAGAAGATCCAAG-3' (SEQ ID NO 63)

2.5 '-AGAAGAAGGACACATGCAGAAGTGCTGCA-3' (SEQ ID NO 64)

3.5'-ATGCCAGTGCAAAGCGCT-3 '(SEQ ID NO 65)

4.5 'AGATCATCACTGGTGAATGGTGATCGTGTA-3' (SEQ ID NO 66)

5.5 '-GGCAATGGAAGCACTTAGAGTGTGCTTTGTG-3 (SEQ ID NO 67)

Group IV:

1.5 '-GACGAGAACCCGATCTCCG-3' (SEQ ID NO 68)

2.5 '-TGAACCAGTGTCGCATGTTCCTCCAGCA-3' (SEQ ID NO 69)

3.5 '-CTCCAGCAGTGTTGTCAAGAGCT-3' (SEQ ID NO 70)

4. 5 '-CAGTGCCAATGTGAGGCGGTGAAGCAGGTG-3 ^■ (SEQ ID NO 71)

5.5 '-GGCTCAGATTCTCCCTAACGTA-3' (SEQ ID NO 72)

6.5 '-TGCAACCTTCAATCAAGACGATG-3' (SEQ ID NO 73) The functional equivalents in their nucleic acid sequences particularly preferably have at least one of the following sequence motifs selected from a specific one of the following groups V, VI, VII or VIII:

Group V:

1.5-ATGGCDAACAAGYTSTTCCTCGTCTGCGCRACTYTCGCYCTSTGYTTCMTCCTCACCAA CGCTTCCTRTCTAYCGCACYGTYGTYGARTTCGAMGAAGATGACGCCASYAACCCCRTRGG YCCAADA-3 '(SEQ ID NO: 74)

2.5 'AAGGAGTTTCAGMAAKMMCARCACCTAAGAGCTTGCCAG-3' (SEQ ID NO: 75)

3. 5 '-TCCAGMAGTGCTGCARCGAGCTTCGCCARGAAGAGCCAGWTTGYGTTTGCCCCACCTT

GARACAAGCTGCCARGGCMGTTAGRYTCCAGGGACARCA-3 '(SEQ ID NO: 76)

4. 5 '-CAGGAAAATTTACMAGDCAGCYAAGYACTTGCCYAACRTTTGCRAVATCCMGCAAGTT

G-3 '(SEQ ID NO: 77)

Group VI:

1.5'-AGCCGTATCTACCAGACYGCTACGCACTTACCTARAGTTTGCAACATYMSGCAAGTTA GCGTTTGTCCCTTCCAGAAGACCATGCCTGGRCCCTCC-3 '(SEQ ID NO: 78)

2. 5 'ACCAGGAAGAGCCMCTTTGCGTTTGCCCAACCTTGAAAGGAGCATCCAAAGCSGTTAA

ACA-3 '(SEQ ID NO: 79)

3.5 '-CAGCCGGCCCATTTRGGATYCCAAAATGTAGGAAGGAGTTTCARCAAGCACAACACCT

-3 '(SEQ ID NO: 80)

Group VII:

1.5 'ATCGCCCACACYTGCWGCGCCTCCAAATGGCA-3' (SEQ ID NO: 81) 2.5 'GAAATGAGCGAGCTGARAAGCCCCAWATGCCAGTGCAAAGCGCT-3'

(SEQ ID NO: 82)

Group VIII:

1.5 'ATCACCACCACCATCGAMGACGAGAACCCGATCTCCG-3' (SEQ ID NO: 83)

2.5 '-TACAGGGACAAAGGYTGAACCAGTGTCGCATGTTCCTCCAGCA-3'

(SEQ ID NO: 84)

3.5 '-CAAAACATCGAAGGRCAGTGCCAATGTGAGGCGGTGAAGCAGGTG-3'

(SEQ ID NO: 85)

4.5 '-CAACAGTTGAAGCAGARGGCTCAGATTCTCCCTAACGTATGCAACCTTCAAT-3'

(SEQ ID NO: 86)

Particularly preferred 7S globulins include those from Arabidopsis or soybeans, very particularly preferably the proteins with SEQ ID NO: 155 or 157, most preferably the proteins encoded by the nucleic acids according to SEQ ID NO: 154 or 156. In addition to the essential properties mentioned above, functional equivalents are preferably characterized by characteristic ones Properties such as a 7S sedimentation coefficient and / or by solubility in saline. As a further characteristic property, 7S globulins cannot contain any cysteine residues.

In a further preferred embodiment, functional equivalents of the 7S globulins have a homology of at least 60%, preferably at least 80%, very particularly preferably at least 90%, most preferably at least 95% to one of the protein sequences with SEQ ID NO: 155 or 157 wherein the homology preferably extends over a length of at least 30 amino acids, preferably at least 50 amino acids, particularly preferably over 100 amino acids, most preferably over the entire length of the respective proteins, and have the same essential properties of a storage protein and - preferably - the characteristic properties of a 7S storage protein.

Particularly preferred HS / 12S globulins preferably comprise 11S globulins from rapeseed, soybeans and Arabidopsis in particular

a) HS globulins from rapeseed with SEQ ID NO: 10, 12, 14, 16 or 18, most preferably the proteins encoded by the nucleic acids according to SEQ ID NO: 9, 11, 13, 15 or 17,

b) the HS globulins from soya with SEQ ID NO: 20, 22, 24, 26 or 28, most preferably the proteins encoded by the nucleic acids according to SEQ ID NO: 19, 21, 23, 25 or 27,

c) the HS globulins from Arabidopsis thaliana with SEQ ID NO: 112, 114, 116, 118, 120 or 122 most preferably those encoded by the nucleic acids according to SEQ ID NO: 111, 113, 115, 117, 119 or 121 proteins,

as well as the corresponding homologues and functional equivalents from other plant species, in particular rapeseed, sunflower, flax, sesame, safflower, olive tree, soybean or various types of nuts, such as the sunflower IIS storage protein (SEQ ID NO: 30), in particular the one by Nucleic acid sequence according to SEQ ID NO: 29 encoded protein. In addition to the above-mentioned essential properties, functional equivalents are preferably distinguished by characteristic properties such as an IIS or 12S sedimentation coefficient and / or by solubility in saline solution (PBS; phosphate-buffered saline solution) and / or poor solubility in water. IS

In a further preferred embodiment, functional equivalents of the IIS or 12S albumins have a homology of at least 60%, preferably at least 80%, very particularly preferably at least 90%, most preferably at least 95% to one of the protein sequences with SEQ ID NO: 10 , 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 112, 114, 116, 118, 120 or 122 where the homology is particularly preferred over a length of at least 30 amino acids, preferably at least 50 amino acids preferably over 100 amino acids, most preferably over the entire length of the respective proteins, and have the same essential properties of a storage protein and - preferably - the characteristic properties of an 11S or 12S storage protein.

The Arabidopsis thaliana 12S cruciferin storage protein (ATCRU3) according to SEQ ID NO: 112 and its homologues from other plant species, such as, for example, rapeseed, soybean or sunflower, are particularly preferred, these preferably having a homology of at least 65%, preferably at least 80%, entirely particularly preferably have at least 90%, most preferably at least 95% of one of the protein sequences with SEQ ID NO: 112.

Further preferred functional equivalents of the rapeseed 11S / 12S storage proteins contain at least one, preferably two, particularly preferably 3 of the sequence motifs selected from group IX or selected from group X in the nucleic acid sequences coding for them:

Group IX:

1.5 '-GAGGCTGGTCGCATCGA-3' (SEQ ID NO: 87)

2.5 '-TTCCGTGATATGCACCAGAA-3' (SEQ ID NO: 88)

3.5 '-TGGTTAACGACAACGGTGA-3' (SEQ ID NO: 89)

Group X:

1.5 '-GAGGCTGGTCGGGTCGA-3' (SEQ ID NO: 90)

2.5 '-TTCCGTGACATGCACCAGAA-3' (SEQ ID NO: 91)

3.5 '-TGGTGAACGACAACGGacA-3' (SEQ ID NO: 92)

The functional equivalents of the rapeseed HS storage proteins particularly preferably have a sequence motif with the SEQ ID NO: 93 in their nucleic acid sequences:

5 '-CARGGBTTCCGTGAYATGCACCAGAARGTVGARCA-3' (SEQ ID NO: 93) Further preferred functional equivalents of the soybean 11S / 12S storage proteins contain at least one, preferably two, particularly preferably 3, most preferably 4, 5 or 6 of the sequence motifs selected from the group XI or selected from the group in the nucleic acid sequences coding for them XII:

Group XI:

1.5 '-ATTGAGACATGGAACCCTAA-3' (SEQ ID NO: 94)

2.5 '-TGGATGTACAACAATGAAGA-3' (SEQ ID NO: 95)

3.5 '-CACTCCTGTTGTTGCCGTTTCT-3' (SEQ ID NO: 96)

4.5'-ATTCTATCTTGCTGGGAACCAAGA-3 '(SEQ ID NO: 97)

5.5 '-GCCATTGTGACAGTGAAAGGAGGTCT-3' (SEQ ID NO: 98)

6.5 '-AGGGAATGCAGTGTTCGACGGTGAGC-3' (SEQ ID NO: 99)

Group XII:

1.5 '-AAACATGGAACTCTCAACAC-3' (SEQ ID NO 100)

2.5 '-TGGACCTATAACACTGGCGA-3' (SEQ ID NO 101)

3.5 'TGAACCAGTTGTTGCCATCAGT-3' (SEQ ID NO 102)

4.5 '-ATTTTACCTTGCTGGGAACCCAGA-3' (SEQ ID NO 103)

5.5 '-GGTGAGAGAGTGTTTGATGGAGAGCT-3' (SEQ ID NO 104)

Further preferred functional equivalents of the Arabidopsis thaliana HS / 12S storage proteins contain in the nucleic acid sequences coding for them at least one, preferably two, particularly preferably 3, most preferably 4, 5 or 6 of the sequence motifs selected from group XIII:

Group XIII:

1.5 '-AACGAGTGCCAGCTCGA-3' (SEQ ID NO 123)

2.5 '-TTCCGTGACATGCACCAG-3' (SEQ ID NO 124)

3.5 '-CAGAACCAGCTTGACCGCA-3' (SEQ ID NO 125)

4.5 'TAGCCGGAAACAACCCACAAGG-3' (SEQ ID NO 126)

5.5 'AACCTCGATGACCCGTC-3' (SEQ ID NO 127)

6.5 '-TGCTGACGTGTACAAGCCA-3' (SEQ ID NO 128)

The functional equivalents of the Arabidopsis HS / 12S storage proteins particularly preferably have a sequence motif with the SEQ ID NO: 129 in their nucleic acid sequences:

5 '-GACATGCACCAGAARKTRGA-3' (SEQ ID NO: 129)

Particularly preferred zein prolamines preferably include those from monocotyledonous plants, in particular maize, raisins, oats, barley or wheat. Corn is particularly preferred Zein prolamines described by SEQ ID NO: 159, 161 ,. 163 or 165 - in particular the protein encoded by SEQ ID NO 158, 160, 162 or 164 -, the rice prolamin according to SEQ ID NO: 167 - in particular the protein encoded by SEQ ID NO 166 -, the oat prolamine according to SEQ ID NO: 169 - in particular the protein encoded by SEQ ID NO 168, the barley prolamine according to SEQ ID NO: 171 and / or 172 - in particular the protein encoded by SEQ ID NO: 170 - and the wheat prolamine according to SEQ ID NO: 174 - in particular the protein encoded by SEQ ID NO 173. Functional equivalents are preferably characterized by solubility in 70% ethanolic solution and poor solubility in water or saline.

In a further preferred embodiment, functional equivalents of the zein prolamines have a homology of at least 60%, preferably at least 80%, very particularly preferably ^' at least 90%, most preferably at least 95% to one of the protein sequences with SEQ ID NO: 159, 161, 163, 165, 167, 169, 171, 172 or 174 where the homology preferably extends over a length of at least 30 amino acids, preferably at least 50 amino acids, particularly preferably over 100 amino acids, most preferably over the entire length of the respective proteins, and have the same essential properties of a storage protein and - preferably - the characteristic properties of a zein prolamine.

The individual letters in the sequences mentioned have the following meaning familiar to the person skilled in the art:

Functional equivalents mean, in particular, natural or artificial mutations of the above-mentioned storage proteins as well as homologous polypeptides from other plants which have the same essential and — preferably — characteristic properties. Homologous polypeptides from preferred plants described above are preferred. The one in the frame In this invention, storage proteins disclosed homologous sequences from other plants - for example those whose genomic sequence is known in whole or in part, such as, for example, from Arabidopsis thaliana, Brassica napus, Nicotiana tabacum or Solanum tuberosum - can be found from databases by homology comparisons, for example by searching the database or screening genes -Banks - can easily be found using the exemplary storage protein sequences as a search sequence or probe.

Mutations include substitutions, additions, deletions, inversions, or insertions of one or more amino acid residues.

Homology between two nucleic acid sequences is understood to mean the identity of the nucleic acid sequence over the respective entire sequence length, which can be determined by comparison using the program algorithm GAP (Wisconsin Package Version 10.0, University of Wisconsin, Genetics Computer Group (GCG), Madison, USA; Altschul et al. (1997) Nucleic Acids Res. 25: 3389ff) using the following parameters:

Gap Weight: 50 Length Weight: 3

Average Match: 10 Average Mismatch: 0

By way of example, a sequence which has a homology of at least 80% based on nucleic acid with the sequence SEQ ID NO: 1 is understood to mean a sequence which, when compared with the sequence SEQ ID NO: 1 according to the above program algorithm with the above parameter set, has a homology of has at least 80%.

Homology between two polypeptides is understood to mean the identity of the amino acid sequence over the entire entire length of the sequence, which can be determined by comparison using the program algorithm GAP (Wisconsin Package Version 10.0, University of Wisconsin, Genetics Computer Group (GCG), Madison, USA) with the following parameters is calculated:

Gap Weight: 8 Length Weight: 2

Average Match: 2,912 Average Mismatch: -2, 003

By way of example, a sequence which has a homology of at least 80% on a protein basis with the sequence SEQ ID NO: 2 is understood to mean a sequence which, when compared with the sequence SEQ ID NO: 2 by the above program algorithm with the above parameter set ^'has a homology of at least 80%.

Functional equivalents also include those proteins which are encoded by nucleic acid sequences which, under standard conditions, have one of the sequences represented by SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 111, 113, 115, 117, 119, 121, 132, 154, 156, 158, 160, 162, 164, 166, 168, 170 or 173 described for a nucleic acid sequence coding for storage proteins, which hybridize to this complementary nucleic acid sequence or parts of the aforementioned and have the essential properties of a storage protein and - preferably - further characteristic properties.

"Standard hybridization conditions" is to be understood broadly and means stringent as well as less stringent hybridization conditions. Such hybridization conditions are described, inter alia, by Sambrook J, Fritsch EF, Maniatis T et al. , in Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57) or in Current Protocols in Molecular Biology, John Wiley S-Sons, N.Y. (1989), 6.3.1-6.3.6. described.

By way of example, the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with approximately 2X SSC at 50 ° C.) and those with high stringency (with approximately 0.2X SSC at 50 ° C., preferably at 65 ° C. C) (20X SSC: 0.3 M sodium citrate, 3 M NaCl, pH 7.0). Furthermore, the temperature during the washing step can be raised from low stringent conditions at room temperature, about -22 ° C, to more stringent conditions at about 65 ° C. Both parameters, salt concentration and temperature, can be varied simultaneously, one of the two parameters can also be kept constant and only the other can be varied. Denaturing agents such as formamide or SDS can also be used during hybridization. In the presence of 50% formamide, the hybridization is preferably carried out at 42 ° C. Some exemplary conditions for hybridization and washing step are given as a result:

(1) Hybridization conditions can be selected from the following conditions, for example:

a) 4X SSC at 65 ° C, b) 6X SSC at 45 ° C, c) 6X SSC, 100 μg / ml denatured, fragmented fish sperm DNA at 68 ° C, f) 50% formamide, 4X SSC at 42 ° C, h) 2X or 4X SSC at 50 ° C (weakly stringent condition), i ) 30 to 40% formamide, 2X or 4X SSC at 42 ° C (weakly stringent condition).

(2) Washing steps can be selected, for example, from the following conditions:

a) 0.015 M NaCl / 0.0015 M sodium citrate / 0.1% SDS at 50 ° C. b) 0.1X SSC at 65 ° C. c) 0.1X SSC, 0.5% SDS at 68 ° C. d) 0.1X SSC, 0.5% SDS, 50% formamide at 42 ° C. e) 0.2X SSC, 0.1% SDS at 42 ° C. f) 2X SSC at 65 ° C (weakly stringent condition).

The reduction in the expression of a storage protein can be implemented in a variety of ways.

“Amount of protein” means the amount of a storage protein polypeptide in an organism, a tissue, a cell or a cell compartment. The amount of protein preferably means the amount of a certain storage protein in the seed of a plant.

"Decreasing" the amount of protein means reducing the amount of a storage protein in an organism, a tissue, a cell or a cell compartment - for example by one of the methods described below - compared to the wild type of the same genus and species to which this method has not been applied , otherwise under the same general conditions (such as culture conditions, age of plants, etc.) Reduction preferably means the reduction in the amount of protein in the seed of a plant.

The reduction is at least 10%, preferably at least 10% or at least 20%, particularly preferably by at least 40% or 60%, very particularly preferably by at least 70% or 80%, most preferably by at least 90% or 95%. Methods for determining the amount of protein are known to the person skilled in the art. The micro-biuret method (Goa. J (1953) Scand J Clin Lab Invest 5: 218-222), the Folin-Ciocalteu method (Lowry OH et al. (1951) J Biol Chem 193: 265 -275) or the measurement of the adsorption of CBB G-250 (Bradford MM (1976) Analyt Biochem 72: 248-254). Preferably done reducing the storage protein (s) and / or increasing oil production in the seed of a plant.

In a further preferred embodiment, the amount of protein is reduced by more than one storage protein. The reduced storage proteins can belong to the same or different classes, such as 2S albumins, 7S globulins, 11S / 12S globulins or zein prolamines. Storage proteins from more than one of these classes are preferably reduced in their protein quantity at the same time. The storage proteins to be reduced can be highly homologous or less homologous to one another. At least two of the storage proteins reduced in their protein quantity preferably have a homology of less than 90%, preferably less than 70%, particularly preferably less than 60%, very particularly preferably less than 50%.

"Reduction" or "decrease" is to be interpreted broadly in connection with a storage protein (or the amount of a storage protein or the amount of RNA coding for it) and includes the partial or essentially complete prevention or blocking of the expression of a based on different semasiological mechanisms Storage protein in a plant or a part, tissue, organ, cells or seeds derived from it.

A reduction in the sense of the invention comprises the quantitative reduction of a storage protein up to an essentially complete absence of the storage protein (i.e. a lack of immunological detectability of the storage protein). The expression of a specific storage protein in a cell or an organism is preferably reduced by more than 50%, particularly preferably by more than 80%, very particularly preferably by more than 90%.

According to the invention, various strategies for reducing the expression of a storage protein are included. Those skilled in the art will recognize that a number of different methods are available to influence the expression of a storage protein in the desired manner. However, a reduction in the amount of storage protein can, for example, not be implemented restrictively using the following methods:

a) introduction of a double-stranded RNA nucleic acid sequence (as a result of "SP-dsRNA"), the double-stranded RNA sequence; includes subsequent elements i) at least one “sense” ribonucleotide sequence which is essentially identical to at least part of the “sense” RNA transcript of a storage protein nucleic acid sequence and

ii) "antisense" ribonucleotide sequences to be said

"sense" ribonucleotide sequences under i) are essentially complementary

or an expression cassette or cassettes which ensure SP-dsRNA expression;

b) introduction of a storage protein antisense RNA nucleic acid sequences or an expression cassette ensuring their expression, the storage protein antisense RNA nucleic acid sequence being essentially complementary to at least part of the “sense” RNA transcript of a storage protein nucleic acid sequence. These include methods in which the antisense RNA nucleic acid sequence is directed against a storage protein gene (that is to say genomic DNA sequences) or a storage protein gene transcript (that is to say RNA sequences). Α-Anomeric nucleic acid sequences are also included.

c) Introduction of a storage protein antisense nucleic acid sequences combined with a Ribozy or an expression cassette ensuring their expression

d) introduction of storage protein sense nucleic acid sequences for inducing a cosuppression or an expression cassette ensuring their expression and reducing expression via a cosuppression, the storage protein sense RNA nucleic acid sequence being essentially identical to at least part of the "sense" RNA transcript a storage protein nucleic acid sequence

f) Introduction of DNA-binding factors against storage protein genes or RNAs or an expression cassette ensuring their expression

g) introduction of viral nucleic acid sequences and expression constructs causing the degradation of RNA in the storage protein or an expression cassette ensuring their expression h) ^• Introduction of constructs for the induction of a homologous recombination on endogenous storage protein genes, for example for the generation of knockout mutants.

i) Introduction of mutations in endogenous storage protein genes to generate a loss of function (e.g. generation of stop codons, shifts in the reading frame, etc.)

Each of these methods can bring about a reduction in storage protein expression in the sense of the invention. A combined application is also conceivable. Other methods are known to the person skilled in the art and can include the hindrance or suppression of the processing of the storage protein, the transport of the storage protein or its mRNA, inhibition of ribsome attachment, inhibition of RNA splicing, induction of an enzyme which degrades storage protein RNA and / or inhibition translation elongation or termination.

The individual preferred methods are briefly described as a result:

a) Introduction of a double-stranded storage protein RNA nucleic acid sequence (SP-dsRNA)

The method of gene regulation using double-stranded RNA ("double-stranded RNA interference"; dsKNAi) has been described many times in animal and plant organisms (for example Matzke MA et al. (2000) Plant Mol Biol 43: 401-415; Fire A. et al (1998) Nature 391: 806-811; WO 99/32619; WO 99/53050; WO 00/68374; WO 00/44914; WO 00/44895; WO 00/49035; WO 00/63364). Reference is expressly made to the stated in the quotations described methods and ^'methods. Efficient gene suppression can also be shown with transient expression or after transient transformation, for example as a result of a biolistic transformation (Schweizer P et al. (2000) Plant J 2000 24: 895-903). dsRNAi methods are based on the phenomenon that the simultaneous introduction of complementary strand and counter strand of a gene transcript causes a highly efficient suppression of the expression of the corresponding gene. The phenotype caused is very similar to that of a corresponding knock-out mutant (Waterhouse PM et al. (1998) Proc Natl Acad Sei USA 95: 13959-64). The dεRNAi method has proven to be particularly efficient and advantageous in reducing the storage protein expression. As, inter alia, in WO _. 99/32619, dsRNAi approaches are clearly superior to classic antisense approaches.

Another object of the invention therefore relates to double-stranded RNA molecules (dsRNA molecules) which, when introduced into a plant (or a cell, tissue, organ or seed derived therefrom) bring about the reduction of a storage protein.

The double-stranded RNA molecule for reducing the expression of a storage protein is characterized in that it contains

a) at least one “sense” ribonucleotide sequence which is essentially identical to at least part of the “sense” RNA transcript of a storage protein nucleic acid sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 111, 113, 115, 117, 119, 121, 132, 154, 156, 158, 160, 162, 164, 166, 168, 170 or 173 and

b) “antisense” ribonucleotide sequences which are essentially — preferably completely — complementary to the “sense” ribonucleotide sequence under a).

“Essentially identical” means that the dsRNA sequence can also have insertions, deletions and individual point mutations compared to the target protein sequence and nevertheless bring about an efficient reduction in expression. The homology according to the above definition is preferably at least 65%, preferably at least 75%, very particularly preferably at least 90%, most preferably 95% between the "sense" ribonucleotide sequence of a dsRNA and at least part of the "sense" RNA transcript Storage protein nucleic acid sequence.

"Part of the" sense "RNA transcript of a storage protein nucleic acid sequence" means fragments of an RNA or mRNA transcribed from a nucleic acid sequence coding for a storage protein, preferably from a storage protein gene. The fragments preferably have a sequence length of at least 20 bases, preferably at least 50 bases, particularly preferably at least 100 bases, very particularly preferably at least 200 bases, most preferably at least 500 bases. The complete transcribed RNA or mRNA is also included.

“Essentially complementary” means that the “antisense” ribonucleotide sequence can also have insertions, deletions and individual point mutations in comparison to the complement of the “sense” ribonucleotide sequence. The homology is preferably at least 80%, preferably at least 90%, very particularly preferably at least 95%, most preferably 100% between the "antisense" ribonucleotide sequence and the complement of the

Alternatively, an "essentially identical" dsRNA can also be defined as a nucleic acid sequence which is capable of hybridizing with part of a storage protein gene transcript (eg in 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA at 50 ° C or 70 ° C for 12 to 16 h).

A 100% sequence identity between dsRNA and the storage protein gene transcript is not absolutely necessary in order to effect an efficient reduction in the storage protein expression. The method is therefore tolerant of sequence deviations, such as those resulting from genetic mutations, polymorphisms or evolutionary divergences. For example, with a single dsRNA generated from a certain storage protein sequence of an organism, it is possible to suppress the expression of further homologous storage proteins of the same organism or else to suppress the expression of storage proteins in other related species. For this purpose, the dsRNA preferably comprises sequence regions of storage protein gene transcripts, which correspond to conserved regions of the individual storage protein families. Said conserved areas can be derived from sequence comparisons (cf. FIGS. La-7d). Preferably, the “sense” ribonucleotide sequence of the dsRNA contains at least one of the sequence motifs selected from one of the groups of sequence motifs I, II, III, IV, V, VI, VII, VIII, IX, X, XI or XII defined above or the sequence motifs with SEQ ID NO: .93 or 129.

Double-stranded RNA molecules are most preferably described by the ribonucleic acid sequence according to SEQ ID NO: 106, 108 or 110. In a further preferred embodiment, the dsRNA contains a plurality of sequence sections which bring about simultaneous suppression of a plurality of storage proteins, preferably storage proteins from different classes, such as, for example, a 2S albumin, 7S globulin, HS / 12S globulin or the zein prolamine. For this purpose, the dsRNA preferably comprises

a) at least two “sense” ribonucleotide sequences, each of these “sense” ribonucleotide sequences being essentially identical to at least part of the “sense” RNA transcript of a storage protein nucleic acid sequence according to SEQ ID NO: 1, 3, 5 , 7, 9, 11, 13, 15, 17 ,. 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 111, 113, 115, 117, 119, 121, 132, 154, 156, 158, 160, 162, 164, 166, 168, 170 or 173 and at least two of the storage protein nucleic acid sequences, for the "sense" RNA transcript of which the "sense" ribonucleotide sequences are essentially identical, with one another have a homology of less than 90%, preferably less than 80%, very particularly preferably less than 60%, most preferably less than 50% over the entire length of their coding nucleotide sequence, and

b) “antisense” ribonucleotide sequences which are essentially — preferably completely — complementary to said “sense” ribonucleotide sequences under a).

As described above, the "sense" ribonucleotide sequences and "antisense" ribonucleotide sequences can be present as separate molecules or - preferably - as a single, self-complementary RNA molecule, in the latter case the two strands preferably via a connecting sequence ("linker "), which very particularly preferably represents an intron, are connected to one another.

Double-stranded RNA molecules are most preferably described by the ribonucleic acid sequence according to SEQ ID NO: 145 or 147.

Of course, in order to achieve the same purpose, several individual dsRNA molecules, each comprising one of the ribonucleotide sequence sections defined above, can also be introduced into the cell or the organism. The dsRNA can consist of one or more strands of polymerized ribonucleotides. There may also be modifications of both the sugar-phosphate structure and the nucleosides. For example, the phosphodiester bonds of natural RNA can be modified to include at least one nitrogen or sulfur heteroatom. Bases can be modified such that the activity is restricted by adenosine deaminase, for example. Such and other modifications are described below in the methods for stabilizing antisense RNA.

The dsRNA can be produced enzymatically or in whole or in part chemically and synthetically.

The double-stranded dsRNA structure can be formed from two complementary, separate RNA strands or - preferably - from a single, self-complementary RNA strand.

If the two separate RNA strands of the dsRNA are to be brought together in a cell or plant, this can be done in different ways:

a) transformation of the cell or plant with a vector which comprises both expression cassettes,

b) Co-transformation of the cell or plant with two vectors, one comprising the expression cassettes with the “sense” ribonucleotide sequence, the other the expression cassettes with the “antisense” ribonucleotide sequences,

c) Crossing of two plants, each of which was transformed with a vector, one comprising the expression cassettes with the “sense” ribonucleotide sequence, the other the expression cassettes with the “antisense” ribonucleotide sequence.

In the preferred embodiment, the dsRNA structure is formed by a single, self-complementary strand of RNA. "Sense" and "antisense" ribonucleotide sequences can be linked here by a connecting sequence ("linker") and, for example, form a hairpin structure. The connecting sequence is preferably an intron. The nucleic acid sequence coding for a dsRNA can contain further elements, such as, for example, transcription termination signals or polyadenylation signals.

The formation of the RNA duplex can be initiated either outside the cell or inside the cell. As in WO 99/53050, the dsRNA can also comprise a hairpin structure by connecting the “sense” and “antisense” strand by means of a “linker” (for example an intron). The self-complementary dsRNA structures are preferred because they only require the expression of a construct and always comprise the complementary strands in an equi-olar ratio.

The expression cassettes coding for the “antisense” or “sense” strand of a dsRNA or for the self-complementary strand of the dsRNA are preferably inserted into a vector and are stable using the methods described below (for example using selection markers) inserted into the genome of a plant to ensure permanent expression of the dsRNA.

The dsRNA can be introduced using an amount that allows at least one copy per cell. Higher quantities (e.g. at least 5, 10, 100, 500 or 1000 copies per cell) can possibly result in an efficient reduction.

The dsRNA can be synthesized either in vivo or in vitro. For this purpose, a DNA sequence coding for a dsRNA can be placed in an expression cassette under the control of at least one genetic control element (such as promoter, enhancer, silencer, splice donor or acceptor, polyadenylation signal). Correspondingly advantageous constructions are described below. A polyadenylation is not necessary, and there are no elements to initiate translation.

A dsRNA can be synthesized chemically or enzymatically. Cellular RNA polymerases or bacteriophage RNA polymerases (such as T3, T7 or SP6 RNA polymerase) can be used for this. Corresponding methods for in vitro expression of RNA are described (WO 97/32016; US 5,593,874; US 5,698,425, US 5,712,135, US 5,789,214, US 5,804,693). A dsRNA synthesized chemically or enzymatically in vitro can be extracted from the reaction mixture, for example by extraction, precipitation, electrophoresis, before being introduced into a cell, tissue or organism. Chromatography or combinations of these processes are wholly or partially purified. The dsRNA can be introduced directly into the cell or can also be applied extracellularly (for example in the interεtitial space).

However, the plant is preferably transformed stably with an expression construct that realizes the expression of the dεRNA. Corresponding methods are described below.

Introduction of a storage protein antisense nucleic acid sequence

Methods for the suppression of a certain protein by preventing the accumulation of its mRNA by the "antiseise" technology are often described — including in plants (Sheehy et al. (1988) Proc Natl Acad Sei USA 85: 8805-8809; US 4,801,340; Mol JN et al. (1990) FEBS Lett 268 (2): 427-430). The antiseic nucleic acid olecule hybridizes or binds with the cellular mRNA and / or genomic DNA coding for the storage protein target protein to be suppressed. This suppresses the transcription and / or translation of the target protein. Hybridization can occur in a conventional manner via the formation of a stable duplex or - in the case of genomic DNA - by binding of the antisense nucleic acid molecule with the duplex of the genomic DNA through specific interaction in the major groove of the DNA helix.

An antisense nucleic acid sequence suitable for reducing a storage protein contains an "antisense" RNA strand comprising at least one ribonucleotide sequence which is essentially complementary to at least part of the "sense" RNA transcript of a storage protein nucleic acid sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 3 ^' 5, 37, 39, 41, 43, 45, 47, 49, 51, 111, 113, 115, 117, 119, 121, 132, 154, 156, 158, 160, 162, 164, 166, 168, 170 or 173.

“Essentially complementary” means that the antisense RNA sequence can also have insertions, deletions and individual point mutations in comparison to the complement of the storage protein target sequence. The homology according to the above definition is preferably 75%, preferably at least 85%, very particularly preferably at least 95%, most preferably 98% between the "antisense" RNA molecule and the complement at least part of the "sense" RNA Transkripteε a storage protein nucleic acid sequence. The complement can be derived in accordance with the base pair rules of Watson and Crick in the manner familiar to the person skilled in the art from the corresponding sequences.

"Part of the" εense "RNA transcript of a storage protein nucleic acid sequence" means fragments of an RNA or mRNA transcribed from a nucleic acid coding for a storage protein, preferably from a storage protein gene. The fragments preferably have a sequence length of at least 20 bases, preferably at least 50 bases, particularly preferably at least 100 bases, very particularly preferably at least 200 bases, most preferably at least 500 bases. The complete transcribed RNA or mRNA is also included.

The antisense nucleic acid sequence can be complementary to the entire transcribed mRNA of said protein, be limited to the coding region or consist only of an oligonucleotide which is complementary to a part of the coding or non-coding sequence of the mRNA. For example, the oligonucleotide can be complementary to the region that comprises the start of translation for said protein. Antisense nucleic acid sequences can have a length of, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides, but can also be longer and at least 100, 200, 500, 1000, 2000 or 5000 nucleotides include. Antisense nucleic acid sequences can be expressed recombinantly or synthesized chemically or enzymatically using methods known to the person skilled in the art. Natural or modified nucleotides can be used in chemical synthesis.

In a further preferred embodiment, the expression of a storage protein can be inhibited by nucleotide sequences which are complementary to the regulatory region of a storage protein gene _. (eg a storage protein promoter and / or enhancer) and form triple-helical structures with the DNA double helix there, so that the transcription of the storage protein gene is reduced. Appropriate processes are described (Helene C

(1991) Anticancer Drug Res 6 (6): 569-84; Helene C et al.

(1992) Ann NY Acad Sei 660: 27-36; Mower LJ (1992) Bioassays 14 (12): 807-815). In a further embodiment, the antisense nucleic acid molecule can be an α-anomeric nucleic acid. Such α-anomeric nucleic acid molecules form specific double-stranded hybrids with complementary RNA in which - in contrast to the conventional β-nucleic acids - the two strands run parallel to one another (Gautier C et al. (1987) Nucleic Acids Res 15: 6625-6641) , The antisense nucleic acid olecule may also include 2'-O-methylribonucleotides (Inoue et al. (1987) Nucleic Acids Reε 15: 6131-6148) or chimeric RNA-DNA analogs (Inoue et al. (1987) FEBS Lett 215 : 327-330).

Introduction of a storage protein antiseise nucleic acid sequence combined with a ribozyme

The antisense strategy described above can advantageously be coupled with a ribozyme method. Catalytic RNA molecules or ribozymes can be adapted to any target RNA and cleave the phosphodiester framework at specific positions, whereby the target RNA is functionally deactivated (Tanner NK (1999) FEMS Microbiol Rev 23 (3): 257-275 ). The ribozyme is not itself modified thereby, but is able to analogously cleave further target RNA molecules, as a result of which the properties of an enzyme are obtained. The incorporation of ribozyme sequences into "antisense" RNAs gives these "antisense" RNAs this enzyme-like, RNA-cleaving property and thus increases their efficiency in inactivating the target RNA. The production and use of corresponding ribozyme "antiseise" RNA molecules is described, for example, by Haseloff et al. (1988) Nature 334: 585-591.

In this way, ribozymes (eg "Hammerhead"ribozymes; Haεelhoff and Gerlach (1988) Nature 334: 585-591) can be used to catalytically cleave the mRNA of an enzyme to be suppressed - eg storage protein - and to prevent translation. Ribozyme technology can increase the efficiency of an antiseise strategy. Methods for expressing ribozymes to reduce certain proteins are described in (EP 0 291 533, EP 0 321 201, EP 0 360 257). Ribozyme expression is also described in plant cells (Steinecke P et al. (1992) EMBO J 11 (4): 1525-1530; de Feyter R et al. (1996) Mol Gen Genet. 250 (3): 329- 338). Suitable target sequences and ribozymes can, for example, as described in "Steinecke P, Ribozymes, Methods in Cell Biology 50, Galbraith et al. Eds, Acade ic Press, Inc. (1995), pp. 449-460", by secondary structure calculations of ribozyme and target RNA and their interaction (Bayley CC et al. (1992) Plant Mol Biol 18 (2): 353-361; Lloyd AM and Davis RW et al. (1994) Mol Gen Genet 242 (6): 653-657). For example, derivatives of Tetrahymena L-19 IVS RNA can be constructed which have regions complementary to the mRNA of the storage protein to be suppressed (see also US Pat. No. 4,987,071 and US Pat. No. 5,116,742). Alternatively, such ribozymes can also be identified via a selection process from a library of diverse ribozymes (Bartel D and Szostak JW (1993) Science 261: 1411-1418).

Introduction of a storage protein sense nucleic acid sequence to induce co-suppression

The expression of a storage protein nucleic acid sequence - or a part thereof - in a sense orientation can lead to a co-suppression of the corresponding homologous, endogenous gene. The expression of εenεe RNA with homology to an endogenous gene can reduce or switch off the expression of the same, similar to what has been described for antiseenic approaches (Jorgenεen et al. (1996) Plant Mol Biol 31 (5): 957-973; Goring et al. (1991) Proc Natl Acad Sei USA 88: 1770-1774; Smith et al. (1990) Mol Gen Genet 224: 447-481; Napoli et al. (1990) Plant Cell 2: 279-289; Van der Krol et al. (1990) Plant Cell 2: 291-99). The introduced construct can represent the homologous gene to be reduced in whole or in part. The possibility of translation is not necessary. The application of this technology to plants is described, for example, by Napoli et al. (1990) The Plant Cell 2: 279-289 and in US 5,034,323.

A "sense" nucleic acid sequence suitable for reducing a storage protein contains a "sense" RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least a part of the "senεe" RNA transcript of a storage protein nucleic acid sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47 , 49, 51, 111, 113, 115, 117, 119, 121, 132, 154, 156, 158, 160, 162, 164, 166, 168, 170 or 173.

“Essentially identical” means that the sense RNA sequence can also have insertions, deletions and individual point mutations in comparison to the complement of the storage protein target sequence. The homology according to the above definition is preferably at least 65%, preferably at least 75%, very particularly preferably at least 90%, most preferably 95% between the “sense” RNA molecule and the “sense” RNA transcript of at least part of a storage protein nucleic acid sequence.

"Part of the" εenεe "RNA transcript of a storage protein nucleic acid sequence" means fragments of an RNA or mRNA transcribed from a nucleic acid sequence coding for a storage protein, preferably from a storage protein gene. The fragments preferably have a sequence length of at least 20 bases, preferably at least 50 bases, particularly preferably at least 100 bases, very particularly preferably at least 200 bases, most preferably at least 500 bases. The complete transcribed RNA or mRNA is also included.

Introduction of DNA-binding factors against storage protein genes or RNAs

A reduction of a storage protein gene expression ^"is also possible with specific DNA-binding factors, for example, by factors of the zinc finger transcription factors. These factors attach to the genomic sequence of the endogenous target gene, preferably in the regulatory areas, and bring about repression of the endogenous gene. The use of such a method enables the expression of an endogenous storage protein gene to be reduced without its sequence having to be genetically manipulated. Appropriate processes for the production of such factors are described (Dreier B et al. (2001) J Biol Chem 276 (31): 29466-78; Dreier B et al. (2000) J Mol Biol 303 (4): 489-502; Beerli RR et al. (2000) Proc Natl Acad Sei USA 97 (4 ^' ): 1495-1500; Beerli RR et al. (2000) J Biol Chem 275 (42): 32617-32627; Segal DJ and Barbas CF 3rd. ( 2000) Curr Opin Chem Biol 4 (1): 34-39; Kang JS and Kim JS (2000) J Biol Chem 275 (12): 8742-8748; Beerli RR et al. (1998) Proc Natl Acad Sei USA 95 ( 25): 14628-14633; Kim JS et al. (1997) Proc Natl Acad Sei USA 94 (8): 3616-3620; Klug A (1999) J Mol Biol 293 (2) .215-218; Tsai SY et al . (1998) Adv Drug Deliv Rev 30 (1-3): 23-31; Mapp AK et al. (2000) Proc Natl Acad Sei USA 97 (8): 3930-3935; Sharrockε AD et al. (1997) Int J Biochem Cell Biol 29 (12): 1371-1387; Zhang L et al. (2000) J Biol Chem 275 (43): 33850-33860).

These factors can be selected using any piece of a storage protein gene. This section is preferably located within the Storage proteins conserved sequence regions or in the region of the promoter region. For gene suppression, however, it can also be in the area of the coding exons or introns.

The DNA-binding factors can, for example, be directed against sequences which are conserved in various storage protein genes. The DNA-binding factor is preferably contained against a sequence motif selected from one of the groups of sequence motifs I, II, III, IV, V, VI, VII, VIII, IX, X, XI or XII or the sequence motifs with the SEQ ID defined above NO: 93 or 129 directed. Furthermore, sequences in the promoter area can also be used which occur with many storage proteins. To give examples of, but not by way of limitation, the following sequences:

i) 5 '-CATGCATG-3' (SEQ ID NO: 130)

ii) 5 '-GCCACYTC-3' (SEQ ID NO: 131)

Further suitable sections are available to the person skilled in the art by means of a database query from the gene bank or - starting from a storage protein cDNA, the gene of which is not present in the gene bank, by screening a genomic library for corresponding genomic clones.

The gene expression can also be suppressed by tailor-made, low molecular weight synthetic compounds, for example of the polyamide type (Dervan PB and Bürli RW (1999) Current Opinion in Chemical Biology 3: 688-693; Gottesfeld JM et al. (2000) Gene Expr 9 (1-2).-77-91). These oligomers consist of the building blocks 3- (dimethylamino) propylamine, N-methyl-3-hydroxypyrrole, N-methylimidazole and N-methylpyrrole and can be adapted to any piece of double-stranded DNA in such a way that they bind sequence-specifically into the major groove and block the expression of the gene sequences there. Corresponding methods are described (see, inter alia, Bremer RE et al. • (2001) Bioorg Med Chem. 9 (8): 2093-103; Ansari AZ et al. (2001) Chem Biol. 8 (6): 583-92; Gottesfeld JM et al. (2001) J Mol Biol 309 (3): 615-29; Wurtz NR et al. (2001) Org Lett 3 (8): 1201-3; Wang CC et al. (2001) Bioorg Med Chem 9 (3): 653-7; Urbach AR and Dervan PB (2001) Proc Natl Acad Sei USA 98 (8): 4343-8; Chiang SY et al. (2000) J Biol Chem 275 (32): 24246-54 ). g) Introduction of viral nucleic acid sequences and expression constructs causing the degradation of RNA in the storage protein

The storage protein expression can also be effectively achieved by induction of the specific storage protein RNA degradation by the plant with the aid of a viral expression system (amplicon) (Angell SM et al. (1999) Plant J 20 (3): 357-362). These systems - also known as "VIGS" (viral induced gene silencing) - introduce nucleic acid sequences with homology to the transcripts to be suppressed into the plant by means of viral vectors. The transcription is then switched off, presumably mediated by plant defense mechanisms against viruses. The underlying mechanisms are presumably similar to those of the effects brought about by double-stranded RNA. Appropriate techniques and processes are described (Ratcliff F et al. (2001) Plant J 25 (2): 237-45; Fagard M and Vaucheret H (2000) Plant Mol Biol 43 (2-3): 285-93; Anandalakεhmi R et al. (1998) Proc Natl Acad Sei USA 95 (22): 13079-84; Ruiz MT (1998) Plant Cell 10 (6): 937-46). Auεwahl for the corresponding sequences according to the same rules as for the determination of the "sense" RNA -Strangeε at doppelεträngiger or Coεuppreεε ^'ion (ε.o.) apply.

Appropriate systems for suppressing gene expression using viral expression systems are described, for example, in WO 99/15682 and WO 98/36083.

h) Introduction of constructs for inducing a homologous recombination on endogenous storage protein genes, for example for generating knockout mutants.

To produce a homologous recombinant organism with reduced storage protein activity, use is made, for example, of a nucleic acid construct which contains at least part of an endogenous storage protein gene, which is changed by deletion, addition or substitution of at least one nucleotide so that the functionality is reduced or completely eliminated becomes. The change can also affect the regulatory elements (e.g. the promoter) of the gene, so that the coding sequence remains unchanged, but expression (transcription and / or translation) is omitted and reduced.

In conventional homologous recombination, the changed region at its 5 'and 3' ends is flanked by further nucleic acid sequences, which must have a sufficient length to enable the recombination. The length is usually in a range from several hundred bases to several kilobases (Thomaε KR and Capecchi MR (1987) Cell 51: 503; Strepp et al. (1998) Proc Natl Acad Sei USA 95 (8): 4368-4373) , For the homologous recombination, the host organism - for example a plant - is transformed with the recombination construct using the methods described below, and successfully recombined clones are selected using, for example, an antibiotic or herbicide resistance.

Homologous recombination is a relatively rare event in higher eukaryotes, especially in plants. Random integrations into the host genome predominate. One possibility of removing the randomly integrated sequences and thus enriching cell clones with a correct homologous recombination is to use a sequence-specific recombination system as described in US Pat. No. 6,110,736, by means of which unspecific integrated sequences can be deleted again, which makes the selection successful via homologous recombination of integrated events facilitated. A large number of sequence-specific recombination systems can be used, examples being the Cre / lox system of bacteriophage Pl, the FLP / FRT system of yeast, the gin recombinase of Mu phage, the pin recombinase from E. coli and the R / RS system of the pSRI plasmid called. Preferred are bacteriophages Pl Cre / lox and the yeast FLP / FRT system. The FLP / FRT and cre / lox recombinase system has already been used in plant systems (Odell et al. (1990) Mol Gen Genet 223: 369-378)

Introduction of mutations in endogenous storage protein genes to produce a loss of function (e.g. generation of stop codons, shifts in the reading frame, etc.)

Other suitable methods for reducing the storage protein activity are the introduction of nonseen mutations into endogenous storage protein genes, for example by introducing RNA / DNA oligonucleotides into the plant (Zhu et al. (2000) Nat Biotechnol 18 (5): 555- 558) and the generation of knockout mutants with the aid of, for example, T-DNA mutagenesis (Koncz et al. (1992) Plant Mol Biol 20 (5): 963-976), ENU- (N-ethyl-N-nitrosourea) - Mutagenesis or homo-recombination (Hohn B and Puchta (1999) H Proc Natl Acad Sei USA 96: 8321-8323.). Point mutations can also be generated using DNA-RNA hybrids, also known as "chimeraplasty" (Cole-Strauss et al. (1999) Nucl Acidε Reε 27 (5): 1323-1330; K iec (1999) Gene therapy American Science 87 (3): 240-247).

The methods of dεRNAi, cosuppression using senεe RNA and "VIGS"("viruε induced gene silencing") are also referred to as "post-transcriptional gene silencing" (PTGS). PTGS methods are particularly advantageous because the requirements on the homology between the endogenous gene to be suppressed and the transgenically expressed εenεe or dsRNA nucleic acid sequence (or between the endogenous gene and its dominant-negative variant) are lower than, for example, in the case of a classic one antiseise approach. Corresponding homology criteria are mentioned in the description of the dRNAI method and are generally transferable for PTGS methods or dominant-negative approaches. Due to the high homology between the plant storage proteins (see Fig. La to 7d) can be expected using a specific storage protein nucleic acid sequences, the expression of homologous storage proteins in ^'the same or other species effectively suppress without dasε the Iεolierung, structure elucidation and Konεtruktion Corresponding suppression constructs for storage protein homologs occurring there would be absolutely necessary. This greatly simplifies the workload.

All substances and compounds which directly or indirectly reduce the amount of protein, RNA or gene activity of at least one storage protein, and thus directly or indirectly reduce the amount of protein in at least one storage protein, are consequently combined under the name "anti-SP" compounds , The term “anti-SP” compound explicitly includes the nucleic acid sequences, peptides, proteins or other factors used in the methods described above.

In the context of the invention, "introduction" includes all methods which are suitable for introducing or generating an "anti-SP" compound, directly or indirectly, into a plant or a cell, compartment, tissue, organ or seed thereof. Direct and indirect processes are included. The introduction can lead to a temporary (transient) presence of an “anti-SP” connection (for example a dsRNA) or else to a permanent (stable) one.

According to the different nature of the approaches described above, the "anti-SP" compound can perform its function directly (for example by insertion into an endogenous storage protein gene). The function can also be done indirectly after transcription into a RNA (for example in the case of antisense approaches) or after transcription and translation into a protein (for example in the case of binding factors). Both direct and indirect acting "anti-SP" compounds are included according to the invention.

Introducing includes, for example, methods such as transfection, transduction or transformation.

"Anti-SP" compounds thus also include, for example, recombinant expression constructs that express (ie transcribe and possibly translate), for example, a storage protein dsRNA or a storage protein "antisense" RNA - preferably in a plant or part, tissue, organ or Seeds of the same - condition.

In said expression constructs there is a nucleic acid molecule whose expression (transcription and possibly translation) generates an "anti-SP" connection, preferably in a functional link with at least one genetic control element (for example a promoter) which expresses in an organism, preferably in Plants, guaranteed. If the expression construct is to be introduced directly into the plant and the “anti-SP” compound (for example the storage protein dsRNA) is to be generated there in plantae, plant-specific genetic control elements (for example promoters) are preferred. However, the "anti-SP" compound can also be generated in other organisms or in vitro and then introduced into the plant. In this, all prokaryotic or eukaryotic genetic control elements (for example promoters) are preferred which allow expression in the organism chosen for the production.

A functional link is understood to mean, for example, the sequential arrangement of a promoter with the nucleic acid sequence to be expressed (for example an "anti-SP" compound) and possibly other regulatory elements such as a terminator such that each of the regulatory elements is its own Can perform function in the transgenic expression of the nucleic acid sequence, depending on the arrangement of the nucleic acid sequences, or anti-sense RNA. This does not necessarily require a direct link in the chemical sense. Genetic control sequences, such as, for example, enhancer sequences, can also perform their function on the target sequence from more distant positions or even from other DNA molecules. Arrangements are preferred in which the nucleic acid sequence to be expressed is positioned behind the sequence functioning as a promoter, so that both Sequences are covalently linked. Preferably, the distance between the promoter sequence and the nucleic acid sequence to be expressed is less than 200 base pairs, particularly preferably less than 100 base pairs, very particularly preferably less than 50 base pairs.

The production of a functional link as well as the production of an expression cassette can be realized using common recombination and cloning techniques, such as those in Maniatis T, Fritsch EF and Sambrook J

(1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor (NY), in Silhavy TJ, Berman ML and Enquist LW (1984) Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor (NY) , in Ausubel FM et al.

(1987) Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience and Gelvin et al. (1990) In: Plant Molecular ^" Bi'ology Manual. Other sequences can also be positioned between the two sequences, which, for example, have the function of a linker with specific restriction enzyme interfaces or a signal peptide. The insertion of sequences for the expression of The expression cassette, consisting of a linkage of promoter and nucleic acid sequence to be expressed, can preferably be integrated in a vector and inserted into a plant genome by, for example, transformation.

An expression cassette is, however, also to be understood as such constructions in which a promoter is placed behind an endogenous storage protein gene, for example by homologous recombination, and the expression of an antisense storage protein RNA causes the reduction of a storage protein according to the invention. Analogously, an "anti-SP" compound (for example a nucleic acid sequence coding for a storage protein dεRNA or a storage protein antisense RNA) can also be placed behind an endogenous promoter in such a way that the same effect occurs. Both approaches lead to expression cassettes in the sense of the invention.

Plant-specific promoters basically means any promoter which can control the expression of genes, in particular foreign genes, in plants or plant parts, cells, tissues or crops. The expression can, for example, be constitutive, inducible or development-dependent.

Preferred are: a) Constitutive promoters

“Constitutive” promoters mean those promoters which ensure expression in numerous, preferably all, tissues over a relatively long period of plant development, preferably at all times during plant development

(Benfey et al. (1989) EMBO J 8: 2195-2202). A plant promoter or a promoter derived from a plant virus is preferably used in particular. The promoter of the 35S transcript of the CaMV cauliflower mosaic virus is particularly preferred (Franck et al. (1980) Cell 21: 285-294; Odell et al. (1985) Nature 313: 810-812; Shewmaker et al. (1985) Virology 140: 281-288; Gardner et al. (1986) Plant Mol Biol 6: 221-228) or the 19S CaMV promoter (US 5,352,605; WO 84/02913; Benfey et al. (1989) EMBO J 8: 2195- 2202). Another suitable constitutive promoter is the "Rubisco small subunit (SSU)" promoter (US 4,962,028), the LeguminB promoter (GenBank Acc. No. X03677), the promoter of .Nopalinsynthase from Agrobacterium, the TR double promoter, the OCS (Octopin Synthase) promoter from Agrobacterium, the ubiquitin promoter (Holtorf S et al. (1995) Plant Mol Biol ^" 29: 637-649), the Ubiquitin 1 promoter (Christtensen et al. (1992) Plant Mol Biol 18 : 675-689; Bruce et al.

(1989) Proc Natl Acad Sei USA 86: 9692-9696), the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (US 5,683,439), the promoters of the vacuolar ATPase subunits or the promoter of a proline-rich protein from wheat

(WO 91/13991), as well as further promoters of genes, the connective expression of which in plants is known to the person skilled in the art.

b) tissue-specific promoters

Also preferred are promoters with specificities for seeds, such as, for example, the promoter of phaseoline (US 5,504,200; Bustos MM et al. (1989) Plant Cell 1 (9): 839-53), of 2S albumen gene (Joεeffεon LG et al. ( 1987) J Biol Chem 262: 12196-12201), deε Leguminε (Shirεat A et al. (1989) Mol Gen Genet 215 (2): 326-331), deε USP (unknown seed protein; Bäumiein H et al. (1991 ) Mol Gen Genet 22 ^' 5 (3): 459-67), the Napin gene (US 5,608,152; Stalberg K et al. (1996) L Planta 199: 515-519), the sucrose binding protein (WO 00/26388) or the Legumin B4 promoter (LeB4; Bäumlein H et al. (1991) Mol Gen Genet 225: 121-128; Baeumlein et al. (1992) Plant Journal 2 (2): 233-9; Fiedler ü et al. (1995) Biotechnology (NY) 13 (10): 1090f), the oleosin promoter from Arabidopsis (WO 98/45461), the Bce4 promoter from Brassica (WO 91/13980). Other suitable seed-specific promoters are those of Genes coding for "high molecular weight glutenin" (HMWG), gliadin, branching enzyme, ADP glucose pyrophosphatase (AGPase) or starch synthase. Also preferred are promoters that allow seed-specific expression in monocots such as corn, barley, wheat, rye, rice, etc. The promoter of the lpt2 or lptl gene (WO 95/15389, WO 95/23230) or the promoters described in WO 99/16890 (promoters of the hordein gene, the glutelin gene, the oryzine gene, etc.) can advantageously be used Prola in gene, the gliadin gene, the glutelin gene, the zein gene, the kasirin gene or the secalin gene).

c) Chemically inducible promoters

The expression cassettes can also contain a chemically inducible promoter (review article: Gatz et al.

(1997) A nu Rev Plant Physiol Plant Mol Biol 48: 89-108), by means of which the expression of the exogenous gene in the plant can be controlled at a specific point in time. Such promoters, e.g. the PRP1 promoter (Ward et al. (1993) Plant Mol Biol 22: 361-366), promoter inducible by salicylic acid (WO 95/19443), a promoter inducible by benzenesulfonamide (EP 0 388 186), one by tetracycline - inducible promoter (Gatz et al. (1992) Plant J 2: 397-404), a promoter inducible by abscisic acid

(EP 0 335 528) or a promoter inducible by ethanol or cyclo exanone (WO 93/21334) can also be used.

Constitutive and seed-specific promoters are particularly preferred.

Furthermore, other promoters can be functionally linked to the nucleic acid sequence to be expressed, which enable expression in other plant tissues or in other organisms, such as E. coli bacteria. In principle, all promoters described above can be used as plant promoters.

The nucleic acid sequences contained in the expression cassettes or vectors according to the invention can be functionally linked to further genetic control sequences in addition to a promoter. The term “genetic control sequences” is to be understood broadly and means all those sequences which have an influence on the occurrence or the function of the expression cassette according to the invention. Genetic control sequences modify, for example, the transcription and translation in prokaryotic or eukaryotic organisms. The expression cassettes according to the invention preferably comprise a plant-specific promoter 5 'upstream of the respective nucleic acid sequence to be expressed transgenically and a terminator sequence 3' downstream as an additional genetic control sequence, and optionally further customary regulatory elements, each functionally linked to the transgene nucleic acid sequence to be expressed.

Genetic control sequences also include further promoters, promoter elements or minimal promoters that can modify the expression-controlling properties. Genetic control sequences, for example, allow tissue-specific expression to additionally depend on certain stress factors. Corresponding elements are, for example, for water stress, absinic acid (Lam. E and Chua NH, J Biol Chem 1991; 266 (26): 17131-17135) and heat stress (Schoffl F et al. (1989) Mol Gen Genetics 217 (2 -3): 246-53).

Further advantageous control sequences are, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFa, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.

In principle, all natural promoters with their regulatory sequences such as those mentioned above can be used for the method according to the invention. In addition, synthetic promoters can also be used advantageously.

Genetic control sequences also include the 5'-untranslated regions, introns or non-coding 3 'regions of genes, such as the actin-1 intron, or the Adhl-S introns 1, 2 and 6 (general: The Maize Handbook, Chapter 116, Freeling and Walbot, Eds., Springer, New York (1994)). It has been shown that they can play a significant role in regulating gene expression. It has been shown that 5 'untranslated sequences can enhance the transient expression of heterologous genes. An example of translation enhancers is the 5 'leader sequence from the tobacco mosaic virus (Gallie et al. (1987) Nucl Acids Res 15: 8693-8711) and the like. They can also promote tissue specificity (Rouster J et al. (1998) Plant J 15: 435-440).

The expression cassette can advantageously contain one or more so-called "enhancer sequences" functionally linked to the promoter, which enable an increased transgenic expression of the nucleic acid sequence. At the 3 'end of the nucleic acid sequences to be expressed transgenically, additional adhesive sequences are inserted, such as further regulatory elements or terminators. One or more copies of the nucleic acid sequences to be expressed can be contained in the gene construct.

Polyadenylation signals suitable as control sequences are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular Gen 3 of T-DNA (octopine synthase) of the Ti plasmid pTiACHS (Gielen et al. (1984) EMBO J 3: 835 ff) or functional equivalents thereof. Examples of particularly suitable terminator sequences are the OCS (octopine synthase) terminator and the NOS (nopalin synthase) terminator.

Control sequences are further to be understood as those which enable homologous recombination or insertion into the genome of a host organism or which allow removal from the genome. In homologous recombination, for example, the coding sequence of a specific endogenous gene can be specifically exchanged for the coding sequence for a dsRNA. Methods such as cre / lox technology allow tissue-specific, possibly inducible removal of the expression cassette from the genome of the host organism (Sauer B (1998) Methods. 14 (4): 381-92). Here certain flanking sequences are added to the target gene (lox sequences), which later enable removal by means of the cre recombinase.

An expression cassette and the vectors derived from it can contain further functional elements. The term functional element is to be understood broadly and means all such elements which have an influence on the production, multiplication or function of the expression cassettes, vectors or transgenic organisms according to the invention. Examples include, but are not limited to:

a) Selection markers showing resistance to one

Metabolism inhibitor such as 2-deoxyglucose-6-phosphate (WO 98/45456), antibiotics or biocides, preferably herbicides, such as, for example, kanamycin, G 418, bleomycin, hygromycin, or phosphinotricin etc. Particularly preferred selection markers are those which confer resistance to herbicides. Examples include εeien: DNA sequences which encode phosphinothricin (PAT) and Glutaminsynthaεeinhibitoren inactivate (bar and pat genes), 5-Enolpyruvylεhikimat-3-phoεphatεynthaεegene (EPSP Synthaεegene), which confer resistance to glyphosate ^® (N- (phosphonomethyl) glycine) confer that for daε Glyphosat ^® degrading enzymes encoding the gox gene (glyphosate oxidoreductase), the deh gene (encoding a dehalogenase that inactivates dalapon), sulfonylurea and imidazolinone inactivating acetolactate synthases and bxn genes that code for bromoxynil-degrading nitrilase enzymes, as a gene against the antibiotic apectinomycin, the streptomycin phosphotransferase (SPT) gene, which confers resistance to streptomycin, the neomycin phosphotransferas (NPTII) gene, which confers resistance to canaminomine or geneticidin, the hygromycin phosphotransferase (HPT) gene , which mediates resistance to hygromycin, the acetolactate synthase (ALS) gene, which confers resistance to sulfonylurea herbicides (for example mutated ALS variants with, for example, the S4 and / or Hra mutation).

b) reporter genes which code for easily quantifiable proteins and which, by means of their own color or enzyme activity, ensure an evaluation of the transformation efficiency or of the expression location or time. Reporter proteins (Schenborn E, Groskreutz D. Mol Biotechnol. 1999; 13 (l): 29-44) such as "green fluorescence protein" (GFP) (Sheen et al. (1995) Plant Journal 8 (5): 777-784), the chloramphenicol transferase, a luciferase (Ow et al. (1986) Science 234: 856-859), the aequorin gene (Prasher et al. (1985) Biochem Biophyε Res Communun 126 ( 3): 1259-1268), the β-galactosidase, the β-glucuronidase is very particularly preferred (Jefferson et al. (1987) EMBO J 6: 3901-3907).

c) origins of replication, which ensure an increase in the expression cassettes or vectors according to the invention in, for example, E. coli. Examples include OR (origin of DNA replication), pBR322 ori or P15A ori (Sambrook et al.: Molecular Cloning. A Laboratory Manual, 2 ^d ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 ).

d) Elements which mediated for Agrobacterium plant transformation are _required, such Beiεpiel the right or left border of the T-DNA or the vir region.

For the selection of successfully homologously recombined or also transformed cells, it is generally necessary to additionally introduce a selectable marker which gives the successfully recombined cells resistance to a biocide (for example a herbicide), a metabolism inhibitor such as 2-deoxyglucose-6- gives phosphate (WO 98/45456) or an antibiotic. The selection marker permits the selection of the transformed cells from untransformed ones (McCormick et al. (1986) Plant Cell Reports 5: 81-84).

In addition, said transgenic expression cassette or expression vectors can contain nucleic acid sequences which do not lead to a reduction in at least one storage protein and whose transgene expression leads to an additional increase in fatty acid biosynthesis (as a result of proOIL). This additionally transgenically expressed proOIL nucleic acid sequence can be selected by way of example but not by way of limitation from nucleic acids coding for acetyl-CoA carboxylase (ACCase), glycerol-3-phosphate acyltransferase (GPAT), lyophosphatidate-acyltransferase (LPAT), diac ) and phospholipid: diacylglycerol acyltransferase (PDAT). Corresponding sequences εind known in the art ^'and auε databases or corresponding cDNA libraries of the respective plants easily accessible.

The introduction of an expression cassette according to the invention into an organism or cells, tissues, organs, parts or seeds thereof (preferably into plants or plant cells, tissues, organs, parts or seeds) can advantageously be implemented using vectors in which the Expression cassettes are included. Vectors can be, for example, plasmids, cosmids, phages, viruses or even agrobacteria. The expression cassette can be introduced into the vector (preferably a plasmid vector) via a suitable restriction interface. The resulting vector is first introduced into E. coli. Correctly transformed E. coli are selected, grown and the recombining vector obtained using methods familiar to the person skilled in the art. Restriction analysis and sequencing can be used to check the cloning step. Preferred vectors are those which enable stable integration of the expression cassette into the host genome.

The production of a transformed organism (or a transformed cell or tissue) requires that the corresponding DNA (for example the expression vector), RNA or protein be introduced into the corresponding host cell. A large number of methods are available for this process, which is referred to as transformation (or transduction or transfection) (Keown et al. (1990) Methods in Enzymology 185: 527-537). For example, the DNA or RNA can be introduced directly by microinjection or by bombardment with DNA-coated microparticles. The cell can also be chemically permeabilized, for example with polyethylene glycol, so that the DNA can pass through Diffusion can get into the cell. The DNA can also be carried out by protoplast fusion with other DNA-containing units such as micelles, cells, lysoomes or liposomes. Electroporation is another suitable method for introducing DNA, in which the cells are reversibly permeabilized by an electrical impulse. Corresponding methods are described (for example in Bilang et al. (1991) Gene 100: 247-250; Scheid et al. (1991) Mol Gen Genet 228: 104-112; Guerche et al. (1987) Plant Science 52: 111- 116; Neuhause et al. (1987) Theor Appl Genet 75: 30-36; Klein et al. (1987) Nature 327: 70-73; Howell et al. (1980) Science 208: 1265; Horεch et al. (1985 ) Science 227: 1229-1231; DeBlock et al. (1989) Plant Physiology 91: 694-701; Methodε for Plant Molecular Biology (Weiεsbach and Weissbach, eds.) Academic Preεs Inc. (1988); and Methods in Plant Molecular Biology (Sch ler and Zielinεki, ed.) Academic Press Inc. (1989)).

In plants, the methods described for transforming and regenerating plants from plant tissues or plant cells for transient or stable transformation are used. Suitable methods include protoplast transformation by polyethylene glycol-induced DNA uptake, the biological method with the gene gun, the so-called "particle bo bardment" method, electroporation, the incubation of dry embryos in DNA-containing solution and microinjection.

In addition to these "direct" transformation techniques, a transformation can also be carried out by bacterial infection using Agrobacterium tumefaciens or Agrobacterium rhizogenes. ^' The Agrobacteriύm-mediated transformation is best suited for dicotyledonous plant cells. The methods are described, for example, by Horsch RB et al. (1985) Science 225: 1229f).

If Agrobacteria are used, the expression cassette has to be integrated into special plasmids, either into an intermediate vector (English: shuttle or intermediate vector) or into a binary vector. If a Ti or Ri plasmid is to be used for the transformation, at least the right boundary, but mostly the right and left boundary of the Ti or Ri plasmid T-DNA as a flanking region, is connected to the expression cassette to be introduced.

Binary vectors are preferably used. Binary vectors can replicate in both E. coli and Agrobacterium. They usually contain a selection marker gene and one Left or polylinker flanked by the right and left T-DNA delimitation sequence. They can be transformed directly into Agrobacterium (Holsters et al. (1978) Mol Gen Genet 163: 181-187). The selection marker gene allows selection of transformed agrobacteria and is, for example, the nptll gene which confers resistance to kanamycin. The Agrobacterium which acts as the host organism in this case should already contain a plasmid with the vir region. This is necessary for the transfer of T-DNA to the plant cell. An Agrobacterium transformed in this way. can be used to transform plant cells. The use of T-DNA for the transformation of plant cells has been intensively investigated and described (EP 120 516; Hoekema, In: The Binary Plant Vector System, Offsetdrukkerij Kanterε BV, Alblasserdam, Chapter V; An et al. (1985) EMBO J 4: 277-287). Various binary vectors are known and some are commercially available, for example pBHOl.2 or pBIN19 (Clontech Laboratorieε, Inc. USA).

Other promoters suitable for expression in plants are described (Rogers et al. (1987) Meth in Enzymol 153: 253-277; Schardl et al. (1987) ^' Gene 61: 1-11; Berger et al. (1989) Proc Natl Acad Sei USA 86: 8402-8406).

Direct transformation techniques are suitable for every organism and cell type. In the case of injection or electroporation of DNA or RNA into plant cells, there are no special requirements for the plasmid used. Simple plasmids such as the pUC series can be used. If complete plants are to be regenerated from the transformed cells, then it is necessary that there is an additional selectable marker gene on the plasmid.

Stably transformed cells, ie those which contain the inserted DNA integrated into the DNA of the host cell, can be selected from untransformed cells if a selectable marker is part of the inserted DNA. As an example, any gene can act as a marker that can confer resistance to antibiotics or herbicides (such as kanamycin, G 418, bleomycin, hygromycin or phosphinotricin etc.) (see above). Transformed cells that express such a marker gene are able to survive in the presence of concentrations of an appropriate antibiotic or herbicide that kill an untransformed wild type. Examples are mentioned above and preferably comprise the bar gene which confers resistance to the herbicide phosphinotricin (Rathore KS et al. (1993) Plant Mol Biol 21 (5): 871-884), the nptll gene which confers resistance to kanamycin, the hpt gene which confers resistance to hygromycin, or the EPSP gene which confers resistance to the herbicide glyphosate. The selection marker allows the selection of transformed cells from untransformed ones (McCormick et al. (1986) Plant Cell Report 5: 81-84). The plants obtained can be grown and crossed in a conventional manner. Two or more generations should be cultivated to ensure that the genomic integration is stable and inheritable.

The above-mentioned methods are described, for example, in Jeneε B et al. (1993) Techniqueε for Gene Transfer, in: T.ranεgenic Plantε, Vol. 1, Engineering and Utilization, edited by SD Kung and R Wu, Academic Preεs, p.128 -143 and in Potrykus (1991) Annu.Rev Plant Physiol Plant Molec Biol 42: 205-225). The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBinl9 (Bevan et al. (1984) Nucl Acids Reε 12: 8711f).

Once a transformed plant cell has been made, a whole plant can be obtained using methods known to those skilled in the art. This is based on the example of callus cultures. The formation of shoots and roots can be induced in a known manner from these still undifferentiated cell masses. The sprouts obtained can be planted out and grown.

Methods are known to the person skilled in the art to regenerate from plant cells, plant parts and whole plants. For example, methods for this are described by Fennell et al. (1992) Plant Cell Rep. 11: 567-570; Stoeger et al (1995) Plant Cell Rep. 14: 273-278; Jahne et al. (1994) Theor Appl Genet 89: 525-533.

With regard to, for example, a nucleic acid sequence, an expression cassette or a vector containing said nucleic acid sequence or an organism transformed with said nucleic acid sequence, expression cassette or vector, “transgene” means all such constructions, either in which the genetic engineering methods are used, in which

a) the storage protein nucleic acid sequence, or

b) a genetic control sequence functionally linked to the storage protein nucleic acid sequence, for example a promoter, or c) (a) and (b)

are not in their natural, genetic environment, which have been modified by genetic engineering methods, such modification being, for example, substitution, addition, deletion, inversion or insertion of one or more STucleotide residues. Natural genetic environment means a natural chromosomal locus in the organism of origin or the presence in a genomic library. In the case of a genomic library, the natural, genetic environment of the nucleic acid sequence is preferably at least partially preserved. The environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, particularly preferably at least 1000 bp, very particularly preferably at least 5000 bp. A naturally occurring expression cassette - for example the naturally occurring combination of the storage protein promoter with the corresponding storage protein gene - becomes a transgenic expression cassette if this is changed by non-natural, synthetic ("artificial") methods such as, for example, mutagenization. Corresponding methods are described (US 5,565,350; WO 00/15815; see also above).

Preferred host or starting organisms as transgenic organisms are, above all, plants as defined above. All genera and species are Eingeεchlosεen in the context of the invention, higher and lower plants of the plant kingdom, in particular plants that are used for the extraction of oils such as rapeseed, sunflower, sesame, safflower, olive tree, ^'soya, maize, wheat and nut species. Also included are the mature plants, seeds, sprouts and seedlings, as well as parts, propagation material and cultures derived from them, for example cell cultures. Mature plants mean plants at any stage of development beyond the seedling. Seedling means a young, immature plant at an early stage of development.

The production of the transgenic organisms can be carried out using the processes described above for transforming or transfecting organisms.

Another object of the invention relates to the use of the transgenic organisms according to the invention and the cells, cell cultures, parts derived therefrom - such as roots, leaves etc. for transgenic plant organisms - and transgenic propagation material such as seeds or fruits for the production of Food or feed, pharmaceuticals or fine chemicals, in particular of oils, fats, fatty acids or derivatives of the aforementioned.

sequences

1. SEQ ID NO: 1

Nucleic acid sequence coding for A.thaliana albumin 2S subunit 1 (GenBank Acc. -No.: M22032)

2. SEQ ID NO: 2

Protein sequence coding for A.thaliana Albumin 2S subunit 1

3. SEQ ID NO: 3

Nucleic acid sequence coding for A.thaliana albumin 2S subunit 3 (GenBank Acc.-No .: M22035)

4. SEQ ID NO: 4

Protein sequence coding for A.thaliana Albumin 2S subunit 3

5. SEQ ID NO: 5

Nucleic acid sequence coding for A.thaliana Albumin.2S subunit 2 (GenBank Acc.-No .: M22034)

6. SEQ ID NO: 6

Protein sequence coding for A.thaliana Albumin 2S subunit 2

7. SEQ ID NO: 7

Nucleic acid sequence coding for A.thaliana albumin 2S εubunit 4 (GenBank Acc.-No .: M22033)

8. ^■ SEQ ID NO: 8

Protein sequence coding for A.thaliana albumin 2S ububit 4

9. SEQ ID NO: 9

Nucleic acid sequence coding for B.napuε cruciferin storage protein (GenBank Acc.-No .: X59294)

10. SEQ ID NO: 10

Protein sequence coding for B.napuε cruciferin storage protein

11. SEQ ID NO: 11

Nucleic acid sequence coding for Brassica napuε cruciferin (GenBank Acc.-No .: X14555)

12. SEQ ID NO: 12

Protein sequence coding for Braεεica napuε cruciferin 13. SEQ ID NO: 13

Nucleic acid sequence coding for B.napuε BnC2 cruciferin storage protein (GenBank Acc.-No .: X59295)

14. SEQ ID NO: 14

Protein sequence coding for B.napus BnC2 cruciferin storage protein

15. SEQ ID NO: 15 partial nucleic acid sequence coding for B.napuε cruciferin cru4 ububit (GenBank Acc.-No .: X57848)

16. SEQ ID NO: 16 partial protein sequence coding for B.napus cruciferin cru4 subunit

17. SEQ ID NO: 17

Nucleic acid sequence coding for B.napus crul cruciferin εubunit (GenBank Acc.-No .: X62120)

18. SEQ ID NO: 18

Protein sequence coding for B.napuε crul cruciferin subunit

19. SEQ ID NO: 19

Nucleic acid sequence coding for glycinin A-la-B-x subunit from the soybean (GenBank Acc.-No .: M36686)

20. SEQ ID NO: 20

Protein sequence coding for glycinin A-la-B-x subunit from the soybean

21. SEQ ID NO: 21

Nucleic acid sequence coding for soybean glycinin subunit G2 (GenBank Acc.-No .: X15122)

22. SEQ ID NO: 22

Protein sequence coding for soybean glycinin subunit G2

23. SEQ ID NO: 23

Nucleic acid sequence coding for soybean A5A4B3 glycinin subunits (GenBank Acc. -No.: X02626)

24. SEQ ID NO: 24

Protein sequence coding for soybean A5A4B3 glycinin subunits 25th SEQ ID NO: 25

Nucleic acid sequence coding for soybean (G.max) glycinin storage protein subunit A3-B4 (GenBank Acc.-No .: M10962)

26. SEQ ID NO: 26

Protein sequence coding for soybean (G.max) glycinin storage protein subunit A3-B4

27. SEQ ID NO: 27

Nucleic acid sequence coding for soybean glycinin subunit G3 (GenBank Acc.-No .: X15123)

28. SEQ ID NO: 28

Protein sequence coding for soybean glycinin εubunit G3

29. SEQ ID NO: 29

Nucleic acid sequence coding for sunflower IIS storage protein (G3-D1) (GenBank Acc.-No .: M28832)

30. SEQ ID NO: 30

Protein sequence coding for sunflower IIS storage protein (G3-D1)

31. SEQ ID NO: 31

Nucleic acid sequence coding for rapeseed (B.napus) napin (GenBank Acc.-No.: J02586)

32. SEQ ID NO: 32

Protein sequence coding for rapeseed (B.napuε) napin

33. SEQ ID NO: 33

Nucleic acid sequence coding for Brasεica juncea 2S storage protein (GenBank Acc.-No .: X65040)

34. SEQ ID NO: 34

Protein sequence coding for Braεεica juncea 2S storage protein

35. SEQ ID NO: 35

Nucleic acid sequence coding for Brassica oleracea 2S storage protein (GenBank Acc.-No .: X65038)

36. SEQ ID NO: 36

Protein sequence coding for Brasεica oleracea 2S storage protein 37. SEQ ID NO: 37

Nucleic acid sequence coding for Brassica napus cv. Topaε Napin (GenBank Acc. -No.: U04945)

38. SEQ ID NO: 38

Protein sequence coding for Brassica napus cv. Topaz Napin

39. SEQ ID NO: 39 partial nucleic acid sequence coding for Sinapis alba sinl storage protein (GenBank Acc. -No.: X91799)

40. SEQ ID NO: 40 partial protein sequence coding for Sinapis alba sinl • storage protein

41. SEQ ID NO: 41

Nukleinεäureεequenz. coding for soybean (Glycine max) napin-type 2S Albumin 1 (GenBank Acc.-No .: U71194)

42. SEQ ID NO: 42

Protein sequence coding for soybean (Glycine max) napin-type 2S albumin 1

43. SEQ ID NO: 43

Nucleic acid sequence coding for soybean (Glycine max) 2S albumin (GenBank Acc. -No.: AF005030)

44. SEQ ID NO: 44

Protein sequence coding for soybean (Glycine max) 2S albumin

45. SEQ ID NO: 45

Nucleic acid sequence coding for Braεsica nigra 2S storage protein (GenBank Acc.-No .: X65039)

46. SEQ ID NO: 46

Protein sequence coding for Brassica nigra 2S storage protein

47. SEQ ID NO: 47

Nucleic acid sequence coding for Sinapis alba sin5 storage protein (GenBank Acc.-No .: X91798)

48. SEQ ID NO: 48

Protein sequence coding for Sinapiε alba εin5 storage protein 49. SEQ ID NO: 49

Nucleic acid sequence coding for sunflower HaG5 2 S albumin (GenBank Acc. -No.: X06410)

50th SEQ ID NO: 50 protein sequence coding for sunflower HaG5 2 S albumin

51. SEQ ID NO: 51 partial nucleic acid sequence coding for sunflower (Helianthus annuus) 2S albumin (GenBank Acc.-No.: X76101)

52. SEQ ID NO: 52 partial protein sequence coding for sunflower (Helianthus annuus) 2S albumin

53.-104:

SEQ ID NO: 51-104 sequence motifs from different storage protein classes

105. SEQ ID NO: 105

Nucleic acid sequence coding for dsRNA for the suppression of Arabidopsis thaliana 12S storage protein AtCru3 (insert of vector pCR2.1-AtCRU3-RNAi)

106. SEQ ID NO: 106

Ribonucleic acid sequence coding for dsRNA for the suppression of Arabidopsis thaliana 12S storage protein AtCru3

107. SEQ ID NO: 107

Nucleic acid sequence coding for dsRNA for the suppression of Arabidopsis thaliana 12S storage protein AtCral

108. SEQ ID NO: 108

Ribonucleic acid sequence coding for dsRNA for the suppression of Arabidopεis thaliana 12S storage protein AtCral

109. SEQ ID NO: 109

Nucleic acid sequence coding for dsRNA for the suppression of Arabidopsis thaliana 2S storage protein At2S2

110. SEQ ID NO: 110

Ribonucleic acid sequence coding for dsRNA for the suppression of Arabidopsis thaliana 2S storage protein At2S2 111. SEQ ID NO: 111

Nucleic acid sequence coding for Arabidopsis thaliana 12S cruciferin storage protein (ATCRU3; GenBank Acc. -No.: U66916)

.12. SEQ ID NO: 112

Protein sequence coding for Arabidopsis thaliana 12S cruciferin storage protein (ATCRU3)

L13.SEQ ID. NO: 113

Nucleic acid sequence coding for A.thaliana 12S storage protein (CRA1; GenBank Acc. -No.: M37247)

L14.SEQ ID NO: 114

Protein sequence coding for A.thaliana 12S storage protein (CRA1)

115. SEQ ID NO: 115

Nucleic acid sequence coding for Arabidopεialian thaliana 12S storage protein AT5g44120 / MLNl_4 (GenBank Acc. No .: AY070730)

116. SEQ ID NO: 116

Protein sequence coding for Arabidopsis thaliana 12S storage protein AT5g44120 / MLNl_4

117. SEQ ID NO: 117

Nucleic acid sequence coding for Arabidopsis 12S storage protein (CRB; GenBank Acc.-No .: X14313; M37248)

118. SEQ ID NO: 118

Protein sequence coding for Arabidopsis 12S storage protein (CRB)

119. SEQ ID NO: 119

Nucleic acid sequence coding for Arabidopsis thaliana putative 12S storage protein (from GenBank. Acc. -No.: AC003027)

120. SEQ ID NO: 120

Protein sequence coding for Arabidopsiε thaliana putativeε storage protein (Protein_id = "AAD10679.1)

121. SEQ ID NO: 121

Nucleic acid sequence coding for Arabidopsiε thaliana cruciferin 12S Spwicherprotein (Atlg03890) (GenBank Acc.-No .: AY065432) 122. SEQ ID NO: 122

Protein sequence coding for Arabidopεiε thaliana cruciferin 12S storage protein (Atlg03890)

123.-131:

SEQ ID NO: 123-131 Sequence motifs from nuclear acid sequences of different storage protein classes

132. SEQ ID NO: 132

Nucleic acid sequence coding for Arabidopsis thaliana prohibitin 1 (Atphbl) (GenBank Acc.-No .: U66594)

133. SEQ ID NO: 133

Protein sequence coding for Arabidopsiε thaliana prohibitin 1 (Atphbl)

134. SEQ ID NO: 134 oligonucleotide primer OPN1

135. SEQ ID NO: 135 oligonucleotide primer 0PN2

136. SEQ ID NO: 136 oligonucleotide primer OPN3

137. SEQ ID NO: 137 oligonucleotide primer OPN4

138. SEQ ID NO: 138 oligonucleotide primer OPN5

139. SEQ ID NO: 139 oligonucleotide primer OPN6

140. SEQ ID NO: 140 oligonucleotide primer OPN7

141. SEQ ID NO: 141, oligonucleotide primer OPN8

142. SEQ ID NO: 142 oligonucleotide primer OPN9

143. SEQ ID NO: 143 oligonucleotide primer OPN10

144. SEQ ID NO: 144

Nucleic acid sequence coding for sRNAi4-dsRNA for the suppression of several storage proteins

145. SEQ ID NO: 145

Ribonucleic acid sequence coding for sRNAi4-dsRNA for the suppression of several storage proteins 146. SEQ ID NO: 146

Nucleic acid sequence coding for sRNAi8-dsRNA for the suppression of several storage proteins

147. SEQ ID NO: 147

Ribonucleic acid sequence coding for εRNAiδ-dsRNA for the suppression of several storage proteins

148. SEQ ID NO: 148 oligonucleotide primer OPN11

149..SEQ ID NO: 149 oligonucleotide primer OP12

150. SEQ ID NO: 150 oligonucleotide primer OPN13

151. SEQ ID NO: 151 oligonucleotide primer OPN15

152. SEQ ID NO: 152 oligonucleotide primer OPN16

153. SEQ ID NO: 153 oligonucleotide primer OPN17

154. SEQ ID NO: 154

Nucleic acid sequence coding for Arabidopsis thaliana "globulin-like protein" (GenBank Acc.-No .: NM_119834)

155. SEQ ID NO: 155

Protein sequence coding for Arabidopsiε thaliana "globulin-like protein" (Protein_id = "NP_195388.1)

156. SEQ ID NO: 156

Nucleic acid sequence coding for Glycine max 7S seed globulm (GenBank Acc.-No .: U59425)

157. SEQ ID NO: 157

Protein sequence coding for Glycine max 7S seed globulin

158. SEQ ID NO: 158

Nucleic acid sequence coding for Zea may 19kD Zein (GenBank Acc.-No .: E01144)

159. SEQ ID NO: 159

Protein sequence coding for zea may 19kD zein

160. SEQ ID NO: 160

Nucleic acid sequence coding for Zea mays 19kD alpha Zein Bl (GenBank Acc.-No .: AF371269) 161. SEQ ID NO: 161

Protein sequence coding for Zea mays 19kD alpha Zein Bl

162. SEQ ID NO: 162

Nucleic acid sequence coding for Zea mays 19kD alpha Zein B2 (GenBank Acc.-No .: AF371270)

163. SEQ ID NO: 163

Protein sequence coding for Zea mays 19kD alpha Zein B2

164. SEQ ID NO: 164

Nucleic acid sequence coding for Zea mays 22kD alpha-zein (GenBank Acc.-No .: X61085)

165. SEQ ID NO: 165

Protein sequence coding for Zea mays 22kD alpha-zein

166. SEQ ID NO: 166

Nucleic acid sequence coding for Oryza εativa prolamin (GenBank Acc.-No .: AB016503)

167. SEQ ID NO: 167

Protein sequence coding for Oryza sativa prolamin

168. SEQ ID NO: 168

Nucleic acid sequence coding for A. sativa Avenin (GenBank Acc.-No.: M38446)

169. SEQ ID NO: 169

Protein sequence coding for A. sativa Avenin

170. SEQ ID NO: 170

Nucleic acid sequence coding for Hordeum vulgar C-hordein (GenBank Acc.-No .: M36941)

171. SEQ ID NO: 171

Protein sequence part 1 coding for Hordeum vulgar C-hordein

172. SEQ ID NO: 172

Protein sequence part 2 coding for Hordeum vulgar C-hordein

173. SEQ ID NO: 173

Nucleic acid sequence coding for Triticum aetivum LMW Glutenin-IDL (GenBank Acc. -No.: X13306) 174. SEQ ID NO: 174

Protein sequence coding for Triticum aestivum LMW Glutenin-IDL

175. SEQ ID NO: 175

Expression cassette for Arabidosis ^' thaliana ACCase (GenBank Acc.-No .: D34630) as a fusion protein with the plausoidal signal sequence of the tranεketolase from tobacco under the control of the napin promoter

176. SEQ ID NO: 176

Protein sequence encoding a fusion protein from the Arabidosis thaliana ACCase (GenBank Acc.-No .: D34630) and the plastid signal sequence of the transketolase from tobacco

177. SEQ ID NO: 177

Nucleotide sequence coding for Arabidoεiε thaliana ACCase (GenBank Acc.-No .: D34630) as a fusion protein with the platinum signal sequence of the tobacco transketolase under the control of the napin promoter

178. SEQ ID NO: 178

Binary expression vector for agrobacterium-mediated plant transformation pSUN2-USPl, 2,3.

179. SEQ ID NO: 179

Binary expression vector for Agrobacterium-mediated plant transformation pSUN2-USP.

pictures

1. Fig. La-b: Alignment of Brassica 2S albumins

The nucleic acid sequences coding for the individual storage proteins are indicated with their respective GenBank Acc. -No. :

J02586 Brasεica napus 2S Albumin (SEQ ID NO: 31) X65040 Brassica juncea 2S Albumin (SEQ ID NO: 33) X65038 Brassica oleracea 2S Albumin (SEQ ID NO: 35) U04945 Brasεica napus cv. Topas 2S Albumin (SEQ ID NO: 37) X91799 Sinapis alba 2S Albumin (SEQ ID NO: 39) 2. Fig. 2: Alignment of soy (Glycine max) 2S albumins

U71194 Glycine max 2S Albumin 1 (SEQ ID NO: 41)

AF005030 Glycine max 2S Albumin (SEQ ID NO: 43)

3. Fig. 3a-b: Alignment of Brassica nigra, Sinapis alba and

Helianthus annuus 2S albumins.

X65039 Brasεica napus 2S Albumin (SEQ ID NO: 45)

X91798 Sinapis alba 2S Albumin (SEQ ID NO: 47)

X06410 Helianthus annuus 2S Albumin HaG5 (SEQ ID NO: 49) X76101 Helianthus annuus 2S Albumin (SEQ ID NO: 51)

4. Fig. 4a-b: Alignment of Helianthus annuus 2S albumins.

X06410 Helianthuε annuuε 2S Albumin HaG5 (SEQ ID NO: 49) X76101 Helianthuε annuus 2S Albumin (SEQ ID NO: 51)

5. Fig. 5: Alignment of Arabidopsis thaliana 2S albumins.

The nucleic acid sequences coding for the individual storage proteins are indicated with their respective GenBank Acc. -No. : gi 1 _. 166609: 951-1445 (M22032) At2Sl (SEQ ID.NO: 1) gijl66611: 212-706 (M22035) At2S3 (SEQ ID NO: 3) gi | l66610: 375-887 (M22034) At2S2 (SEQ ID NO: 5 ) gi 166612: 500-1000 (M22033) At2S4 (SEQ ID NO: 7)

6. Fig. 6a-c: DNA alignment of Brasεica napus IIS memory

proteins

X59294 CRUl_Bn (SEQ ID NO: 9)

X14555 CRUA_Bn (SEQ ID NO: 11)

X59295 CRU2_Bn (SEQ ID NO: 13)

X57848 CRU4_Bn (SEQ ID NO: 15)

X62120 CRU3_BN (SEQ ID NO: 17)

(sequence ID from soybean IIS εtorage proteinε after alignement)

7. Fig.7a-d:

DNA alignment of soybean IIS storage proteins. The nucleic acid sequences coding for the individual storage proteins with their respective GenBank Acc. -No. :

GLC1: M36686; D00566 GMGLYBSU_2 (SEQ ID NO: 19)

GLC2: X15122 GMGY2_8 (SEQ ID NO: 21)

GLC3: X02626 GMGLYRl_3 (SEQ ID NO: 23)

GLC4: Ml0962 GMGLYAB_4 (SEQ ID NO: 25)

GLC5: X15123; S44896 GMGY3_7 (SEQ ID NO: 27)

8. Fig. 8:

Results of the measurement of the lipid content (TAG) in T3 seeds of transgenic Arabidopsis plants which were transformed with the construct Napin-TK-AtACCase. Seeds from 10 individual T2 plants per independent transgenic line were measured as described in Example 9. The amount of TAG in percent corresponds to the proportion of the total mass of the dry weight of the seeds. Wt denotes the non-transformed control, 5L, 3L, 12L and IL are the independent transgenic lines. The cantilevers describe the standard error from all measured values. 9. Fig. 9:

Schematic representation ^'of the storage protein suppression- constructs.

A: Insert (1155 bp) from vector pCR2. l-AtCRU3-RNAi (5025 bp) coding for a dsRNA which suppresses the AtCru3 expression.

B: Insert from vector pCR2. l-εRNAi4 (1) and pCR2. l-εRNAi8 (2) coding for a dεRNA which suppresses the AtCru3, AtCRB and At2S3 expression. In the two constructs, the "sense" RNA strands and "anti-sense" RNA strands are arranged differently for the individual targets to be suppressed. Hatched areas represent intron sequences (linkers).

10. -Fig.l0: Result of the quantitative oil determination.

Seeds from independent transgenic plants of the TI generation were analyzed. The fatty acid content is given in percent by weight of the seed (% FA [w / w]). Several independent lines (2.1; 3-1; 5-1; 12-1; 14-1; 16-1; 17-1) showed a significantly increased oil content (up to 38% higher oil content for line 16- 1) compared to control plants (C).

Beiεpiele

General methods:

Unless otherwise stated, all chemicals come from the companies Fluka (Buchs), Merck (Darmstadt), Roth (Karlsruhe), Serva

(Heidelberg) and Sigma (Deisenhofen). Restriction enzymes, DNA-modifying enzymes and molecular biology kits were obtained from Amerεham-Pharmacia (Freiburg), Biometra (Göttingen), Röche

(Mannheim), New England Biolabε (Schwalbach), Novagen (Madiεon, Wiεconεin, USA), Perkin-Elmer (Weiterstadt), Qiag ^' en (Hilden), Stratagen (Amsterdam, Netherlands), Invitrogen (Karlsruhe) and Ambion (Cambridgeshire, United Kingdom) . The reagents used were used in accordance with the manufacturer's instructions.

The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner, using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The cloning steps carried out in the context of the present invention, such as, for example, restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking of DNA fragments, transformation of E. coli cells, cultivation of bacteria, multiplication of phages and sequence analysis of recombinant DNA are as in Sambrook et al. (1989) Cold Spring Harbor Laboratory Preεε; ISBN 0-87969-309-6 described performed. The sequencing of recombinant DNA molecules is carried out using a laser fluorescence DNA sequencer from ABI using the method of Sanger (Sanger et al. (1977) Proc Natl Acad Sei USA 74: 5463-5467).

Example 1: General procedures

The Arabidopsis thaliana plant represents a member of the higher plants (seed plants). This plant is closely related to other plant species from the cruciferous family such as Brasεica napus, but also with other dicotyledonous plant families. Because of the high degree of homology of their DNA sequences or polypeptide sequences, Arabidopsis thaliana can be used as a model plant for other plant species.

a) Cultivation of Arabidopsiε plants

The plants are either grown on Murashige-Skoog medium with 5% sucrose (Ogas et al. (1997) Science 277: 91-94) or on earth (Focks & Benning (1998) Plant Physiol 118: 91-101). In order to achieve uniform germination and flowering times, the seeds are stratified at 4 ° C for two days after plating or sprinkling on soil. After flowering, the pods are marked. According to the markings, pods are harvested 6 to 20 days after flowering.

b) Isolation of total RNA and poly-A ⁺ RNA from plants

RNA or polyA ⁺ RNA is isolated for the production of suppression constructs. RNA was isolated from pods of Arabidopsis plants according to the following procedure: pod material from 6 to 20 days after flowering was harvested and snap-frozen in liquid nitrogen. The material was stored at -80 ° C before further use. 75 mg of the material was ground in a cooled mortar to a fine powder and mixed with 200 μL of the lysis buffer from the Ambion RNAqueoε kit. The isolation of the total RNA was then carried out according to the manufacturer's instructions. The RNA was eluted with 50 μL elution buffer (Ambion) and the concentration was determined by absorbing a solution diluted 1 to 100 on a photometer (Eppendorf) at 260 nm. 40 μg / ml RNA corresponds to an absorption of 1. The RNA solutions were with RNAεe free water adjusted to a concentration of 1 μg / μL. The concentrations were checked by agarose gel electrophoresis. For the isolation of polyA + RNA, oligo (dT) cellulose from Amerεham Pharmacia according to the manufacturer's instructions was used. RNA or polyA + RNA was stored at -70 ° C.

c) Construction of the cDNA library

To construct the cDNA library from Arabidopsis pod RNA, the first strand synthesis using reverse transcriptase from mouse leukemia virus (Clontech) and oligod (T) primers, the second strand synthesis by incubation with DNA polymerase I, Klenow- Enzyme and RNAse H cleavage achieved at 12 ° C (2 hrs), 16 ° C (1 hrs) and 22 ° C (1 hrs). The reaction was stopped by incubation at 65 ° C. (10 min) and then transferred to ice. Double-stranded DNA molecules were blunt-ended with T4-DNA polymerase (Röche, Mannheim) at 37 ° C (30 min). The nucleotides were removed by phenol / chloroform extraction and Sephadex G50 centrifugation columns. EcoRI / XhoI adapters (Pharmacia, Freiburg, Germany) were ligated to the cDNA ends using T4-DNA-Ligaεe (Röche, 12 ° C, overnight), cut with Xhol and by incubation with polynucleotide kinase (Röche, 37 ° C , 30 min) phosphorylated. This mixture was subjected to separation on a low-melting agarose gel. DNA molecules over 300 base pairs were eluted from the gel, phenol-extracted, concentrated on Elutip-D columns (Schleicher and Schüll, Dassel, Germany) and ligated to vector arms and in la bda-ZAPII phage or lambda-ZAP -Expreεs phages packaged using the Gigapack Gold Kit (Stratagene, Amsterdam, the Netherlands), using the manufacturer's material and following its instructions.

d) isolation of genomic DNA from plants such as Arabidopsis thaliana or Brassica napus (CTAB method)

In order to isolate genomic DNA from plants such as Arabidopsis thaliana or Brassica napus, approx. 0.25 g of leaf material from young plants in the vegetative stage is ground into fine powder in liquid nitrogen. The powdered plant material is added to a preheated second mortar together with 1 ml of 65 ° C warm CTAB I buffer (CTAB: hexadecyltrimethylammonium bromide, also called cetyltrimethylammonivimbromide; Sigma cat. No .: H6269) and 20 μl ß-mercaptoethanol after complete hoogenization, the extract is transferred to a 2 ml Eppendorf tube and for 1 h - at 65 ° C with regular, careful mixing incubated. After cooling to room temperature, the mixture is extracted with 1 ml of chlorofor / octanol (24: 1, shaken with IM Tris / HCl, pH 8.0) by slow inverting and centrifuged for 5 min at 8,500 rpm (7,500 xg) and room temperature , The aqueous phase is then extracted again with 1 ml of chloroform / octanol, centrifuged and carefully mixed by inverting with 1/10 volume of CTAB II buffer preheated to 65 ° C. Subsequently, the mixture is mixed carefully with 1 ml of chloroform / octanol mixture (see above) and centrifuged for 5 min at 8,500 rpm (7,500 xg) and room temperature to separate the phases again. The aqueous lower phase is transferred to a fresh Eppendorf tube and the upper organic phase is centrifuged again in a fresh Eppendorf tube for 15 min at 8,500 rpm (7,500 xg) and room temperature. The resulting aqueous phase is combined with the aqueous phase of the previous centrifugation step and the entire batch is mixed with exactly the same volume of preheated CTAB III buffer. This is followed by incubation at 65 ° C until the DNA precipitates in flakes. This can take up to 1 h or can be done by incubation at 37 ° C overnight. The sediment resulting from the subsequent centrifugation step (5 min, 2000 rpm (500 × g), 4 ° C.) is mixed with 250 μl of CTAB IV buffer preheated to 65 ° C. and added for at least 30 minutes or until the sediment is completely dissolved Incubated at 65 ° C. The solution for precipitating the DNA is then mixed with 2.5 volumes of ice-cold ethanol and incubated for 1 h at -20 ° C. Alternatively, the batch can be mixed with 0.6 volumes of isopropanol and centrifuged immediately for 15 min at 8,500 rpm (7,500 xg) and 4 ° C without further incubation. The sedimented DNA is washed twice with 1 ml of 80% ice-cold ethanol by inverting the Eppendorf tube, centrifuged again after each washing step (5 min, 8,500 rpm (7,500 xg), 4 ° C) and then air-dried for approx. 15 min , Finally, the DNA is resuspended in 100 μl TE with 100 μg / ml RNase and incubated for 30 min at room temperature. After a further incubation phase at 4 ° C overnight, the DNA solution is homogeneous and can be used for further experiments.

Solutions for CTAB:

Solution I (for 200 ml):

100 mM Tris / HCl pH 8.0 (2.42 g)

1.4 M NaCl (16.36 g)

20 mM EDTA (8.0 ml of 0.5 M stock solution) 2% (w / v) CTAB (4.0 g)

Before each use, freshly added: 2% ß-mercaptoethanol (20 ul for 1 ml of solution I).

Solution II (for 200 ml): 0.7 M NaCl (8.18 g) 10% (w / v) CTAB (20 g)

Solution III (for 200 ml):

50 mM Tris / HCl pH 8.0 (1.21 g)

10 mM EDTA (4 ml 0.5 M of 0.5 M stock solution)

1% (w / v) CTAB (2.0 g)

Solution IV (high-salt TE) (for 200 ml): 10 mM Tris / HC1 pH 8.0 (0.242 g) 0.1 mM EDTA (40 μl 0.5 M stock solution) 1 M NaCl (11.69 g)

Chloroform / octanol (24: 1) (for 200 ml):

192 ml chloroform

8 ml octanol The mixture is shaken twice with 1 M TriεHCl pH 8.0 and stored protected from light.

Example 2: Production of suppression constructs

Starting from the genomic Arabidopsis thaliana DNA or cDNA, the following fragments of storage protein sequences were amplified by PCR using the oligonucleotides listed. It came. following PCR protocol for use: -

Composition of the PCR approach (50 μL):

5.00 μL template cDNA or genomic DNA (approx. 1 μg)

5.00 μL 10X buffer (Advantage polymerase) + 25 mM MgCl ₂

5.00 µL 2mM dNTP

1.25 μL per primer (10 pmol / μL)

0.50 μL Advantage polymerase (Clontech)

PCR program: initial denaturation for 2 min at 95 ° C, then 35 cycles with 45 sec 95 ° C, 45 sec 55 ° C and 2 min 72 ° C. Final extension of 5 min at 72 ° C. Suppression construct for Arabidopεis thaliana 12S storage protein AtCRU3 (SEQ ID NO: 111 or 112; GenBank Acc.-No: U66916):

For the sequence encoding the senεe strand of the dsRNA and the linker, genomic Arabidopsis thaliana DNA with a subsequent pair of oligonucleotides was used to convert an exon region with the complete subsequent intron, including the splice acceptor sequence following the intron (base pair 1947 to 2603 of the sequence with the gene B Acc.-No: U66916) amplified:

0NP1 (SEQ ID NO: 134):

5 -ATAAGAATGCGGCCGCGTGTTCCATTTGGCCGGAAACAAC-3 '

0NP2 (SEQ ID NO: 135):

5 ^Λ -CCCGGATCCTTCTGTAACATTTGACAAAACATG-3 '

The PCR product was cloned into the pCR2.1-TOPO vector (Invitrogen) according to the manufacturer's instructions, resulting in the pCR2.1-1 vector and the sequence checked.

For the sequence encoding the antisense strand of the dεRNA, only the same exon as above (base pair 1947 to 2384) was amplified with the following primer pair from Arabidopεis thaliana cDNA:

0NP3 (SEQ ID NO: 136):

5 'ATAAGAATGCGGCCGCGTGTTCCATTTGGCCGGAAACAAC-S'

0NP4 (SEQ ID NO: 137):

5 ^λ ATAAGAATGCGGCCGCGGATCCACCCTGGAGAACGCCACGAGTG-3 '

The PCR product was cloned into the pCR2.1-TOPO vector (Invitrogen) according to the manufacturer's instructions, resulting in the pCR2.1-2 vector and the sequence checked.

0.5 μg of vector pCR2.1-l were incubated with the restriction enzyme BamHI (New England Biolabs) for 2 hours according to the manufacturer's instructions and then dephosphorylated for 15 min with alkaline phosphatase (New England Biolabs). The vector prepared in this way (1 μL) was then ligated with the fragment obtained from vector pCR2.1-2. For this purpose, 0.5 μg of vector pCR2.1-2 was digested with BamHI (New England Biolabε) for 2 hours and the DNA fragments were separated by gel electrophoresis. The 489 bp piece created next to the vector (3.9 kb) was cut out of the gel and cut with the "Gel purification" kit (Qiagen) purified according to the manufacturer's instructions and eluted with 50 μL elution buffer. 10 μL of the eluate were ligated with vector pCR2.1-l (see above) overnight at 16 ° C. (T4 ligase, New England Biolabs). The ligation products were then transformed into TOP10 cells (Stratagene) according to the manufacturer's instructions and selected accordingly. Positive clones were verified with the primer pair ONP1 and 0NP2 by PCR. The vector pCR2.l-AtCRU3-RNAi ^{• obtained} was then incubated for 2 hours with Notl (New England Biolabs), "blunted" with Klenow fragment and the DNA fragments analyzed by gel-electrophoresis. The 1155 bp fragment was then ligated into the StuI-cut, dephosphorylated binary vector pSUN2-USPl, 2, 3 (SEQ ID NO: 178; see Example 5). The vector pSUN2-USPl, 2, 3 is a derivative of the vector pPZPlll ((Hajdukiewicz, P et al. 1994 Plant Mol Biol 25: 989-994), in which three expression cassettes, each under the control of the USP promoter Vectors with the desired orientation of the insert were determined by restriction digestion and sequencing, and the resulting construct is called pSUN2-USP-RNAi-a. The nucleic acid sequence coding for the dεRNA is described by SEQ ID NO: 105.

b) Suppression construct for Arabidopεi thaliana 12S storage protein AtCRB (SEQ ID NO: 117 or 118; GenBank Acc.-No: X14313; M37248):

For the εenεe strand and antiεenεe strand of the dsRNA, an exon region (base pair 601 to 1874 of the sequence with GenBank Acc.-No: M37248) from Arabidopεiε thaliana cDNA is amplified with the following oligonucleotide primer pair:

ONP5 (SEQ ID NO: 138):

5 ^λ ATAAGAATGCGGCCGCGGATCCCTCAGGGTCTTTTCTTGCCCACT-3 '

ONP6 (SEQ ID NO: 139):

5 -CCGCTCGAGTTTACGGATGGAGCCACGAAG-3 '

The PCR product is cloned into the pCR2.1-T0P0 vector (Invitrogen) according to the manufacturer's instructions, resulting in the pCR2.1-3 vector and the sequence checked.

For the region functioning as a linker, Arabidopsis thaliana genomic DNA becomes an intron with the corresponding splice acceptor and donor sequences of the flanking exons (Base pair 1874 to 2117 of the sequence with GenBank Acc.-No: M37248) amplified with the following primer pair:

0NP7 (SEQ ID NO: 140):

5 * -CCGCTCGAGGTAAGCTCAACAAATCTTTAG-3 '

0NP8 (SEQ ID NO: 141):

5 ^λ -ACGCGTCGACGCGTTCTGCGTGCAAGATATT-3 '

The PCR product is cloned into the pCR2.1-T0P0 vector (Invitrogen) according to the manufacturer's instructions, resulting in the pCR2.1-4 vector and the sequence checked.

The construct for AtCRB is created in a strategy similar to that described for AtCRU3. Vector pCR2.1-3 is incubated with Xhol (New England Biolabs) for 2 hours and dephosphorylated (alkaline phosphate, New England Biolabs). Vector pCR2.1-4 is also incubated with Xhol in the same way and the gel fragments separated by gel electrophoresis. The corresponding fragments are purified and ligated in the manner described under AtCRU3, resulting after bacterial transformation in the vector pCR2.1-AtCRB exon / intron. This vector is incubated with Xbal (NEB) for 2 hours, then with Klenow fragment (NEB) for 15 minutes, then with SalI for 2 hours and finally treated with alkaline phosphatase (NEB) for 15 minutes. In parallel, the vector pCR2.1-3 is incubated with BamHI (NEB), then for 15 min with Klenow fragment and then for 2 hours with Xhol (NEB). The exon fragment of AtCRB is isolated after gel electrophoresis, purified and used for ligation. Both fragments are then ligated and the vector pCR2.1-AtCRB-RNAi results.

The vector pCR2.1-AtCRB-RNAi obtained is then digested with HindiII and Pvul for 2 hours and incubated for 15 min with Klenow fragment (blunted). The cut-out fragment is isolated by gel electrophoresis and then used for the ligation. The corresponding fragment is then ligated into the dephosphorylated vector pSUN2-USP-RNAi-a cut with EcoRV (see above). Vectors with the desired orientation of the insert are determined by means of restriction digestion and sequencing. The resulting construct is called pSUN2-USP-RNAi-b. The nucleic acid sequence coding for the dsRNA is described by SEQ ID NO: 107. Suppressεionεstrukt for Arabidopsiε thaliana 2S storage protein At2S3 (SEQ ID NO: 3 or 4; GenBank Acc.-No: M22035):

For the εenεe strand and antiεense strand of the dsRNA, an exon region (base pair 212 to 706 of the sequence with the GenBank Acc.-No: M22035) is amplified from Arabidopεiε thaliana cDNA with the subsequent pair of oligonucleotides and primers:

0NP9 (SEQ ID NO: 142):

5 ^λ -ATAAGAATGCGGCCGCGGATCCATGGCTAACAAGCTCTTCCTCGTC-3 '

ONP10 (SEQ ID NO: 143):

5 -ATAAGAATGCGGCCGCGGATCCCTAGTAGTAAGGAGGGAAGAAAG-3 '

The PCR product is cloned into the pCR2.1-TOPO vector (Invitrogen) according to the manufacturer's instructions, resulting in the pCR2.1-5 vector and the sequence checked.

The same intron as used under b) with the primers OPN 7 and OPN 8 is used for the area functioning as a linker.

The construct for At2S3 is created in a strategy similar to that explained for AtCRU3. Vector pCR2.1-5 is incubated with Xhol (New England Biolabs) for 2 hours and dephosphorylated (alkaline phosphate, New England Biolabs). Vector pCR2.1-3 is also incubated with Xhol in the same way and the gel fragments separated by gel electrophoresis. The corresponding fragments are purified and ligated in the manner described under At-CRU3, resulting after bacterial transformation in the vector pCR2.1-At2S3 exon / intron. This vector is incubated for 2 hours with SalI (NEB), then for 15 min with Klenow fragment (NEB) and lastly treated for 15 min with alkaline phosphate (NEB). In parallel, the vector pCR2.1-5 is incubated with BamHI (NEB) and then for 15 min with Klenow fragment. The exon fragment of At2S3 is isolated after gel electrophoresis, purified and used for ligation. Both fragments are then ligated and the vector pCR2. l-At2S3-RNAi resulted.

The vector pCR2 obtained. I-At2S3-RNAi is then digested for 2 hours with HindIII and Xbal (New England Biolabs) and incubated for 15 min with Klenow fragment (blunted). The cut-out fragment is isolated by gel electrophoresis and then used for the ligation. The corresponding fragment is then ligated into the vector pSUN2-USP-RNAi-b digested and dephosphed with Smal (see above). vectorial Ren with the desired orientation of the insert are determined by means of restriction digestion and sequencing. The resulting construct is called pSUN2-USP-RNAil. The nucleic acid sequence coding for the dsRNA is described by SEQ ID NO: 109.

Due to the above-mentioned cloning steps, all three constructs AtCRU3, AtCRB and At2S3 in the binary vector pSUN2-USP 1,2,3 are each under the control of the USP promoter (Bäumlein et al. 1991, Mol Gen Genet 225 (3): 459 -67).

Example 3: Plasmids for plant transformation

Binary vectors such as pBinAR can be used for plant transformation (Höfgen and Willmitzer (1990) Plant Science 66: 221-230). The binary vectors can be constructed by ligating the cDNA in sense or anti-sense orientation in T-DNA. 5 'of the cDNA, a plant promoter activates the transcription of the cDNA. A polyadenylation sequence is located 3 'from the cDNA.

The tissue-specific expression can be achieved using a tissue-specific promoter. For example, seed-specific expression can be achieved by cloning in the napin or LeB4 or USP promoter 5 'of the cDNA. Any other seed-specific promoter element can also be used. The CaMV-35S promoter can be used for constitutive expression in the whole plant.

Another example of a binary vector is the vector pSUN2-USPL, 2, 3, in which the fragments from Example 2 were cloned, and pSUN2-USP. The vector pSUN2-USP contains the USP promoter and the OCS terminator. pSUN2-USPl, 2, 3, contains three times the USP promoter. The fragments from Example 2 were cloned into the multiple cloning site of the vector pSUN2-USPL, 2, 3 in order to enable the seed-specific expression of the suppression constructs.

Example 4: Transformation of Agrobacterium

The Agrobacterium -mediated plant transformation can be carried out, for example, using the Agrobacterium tumefacienε strains GV3101 (pMP90) (Koncz and Schell (1986) Mol Gen Genet 204: -383- 396) or LBA4404 (Clontech). The transformation can be carried out by standard transformation techniques (Deblaere et al. (1984) Nucl Acids Res 13: 4777-4788). Example 5: Plant transformation

Agrobacterium-mediated plant transformation can be carried out using standard transformation and regeneration techniques (Gelvin, Stanton B., Schilperoort, Robert A., Plant Molecular Biology Manual, 2nd ed., Dordrecht: Kluwer Academic Publ., 1995 , in Sect., Ringbuc Central signature: BT11-P ISBN 0-7923-2731-4; Glick, Bernard R., Thompεon, John E., Methodε in Plant Molecular Biology and Biotechnology, Boca Raton: CRC Press, 1993, 360 S., ISBN 0-8493-5164-2).

The transformation using Agrobacterium from Arabidopsis thaliana was carried out by the Bechthold et al. , 1993 (C.R. Acad. Sci. Ser. III Sci. Vie., 316, 1194-1199). For example, rapeseed can be transformed using cotyledon or hypocotyl transformation (Moloney et al., Plant Cell Report 8 (1989) 238-242; De Block et al., Plant Physiol. 91 (1989) 694-701). The use of antibiotics for Agrobacterium and plant selection depends on the binary vector and Agrobacterium strain used for the transformation. Rapeseed selection is usually carried out using kanamycin as a selectable plant marker.

The Agrobacterium -mediated gene transfer in linseed (Linum usitatissimum) can be carried out using, for example, one of Mlynarova et al. (1994) Plant Cell Report 13: 282-285 perform the technique described.

The transformation of soya can be carried out using, for example, a technique described in EP-A-0 0424 047 (Pioneer Hi-Bred International) or in EP-A-0 0397 687, US 5,376,543, US 5,169,770 (University Toledo).

Plant transformation using particle detection, polyethylene glycol-mediated DNA recording or using silicon carbon fiber technology is described, for example, by Freeling and Walbot "The maize handbook" (1993) ISBN 3-540-97826-7, Springer Verlag New York) ,

Example 6: Examination of the expression of a recombinant gene product in a transformed organism

The activity of a recombinant gene product in the transformed host organism was measured at the transcription and / or translation level. A suitable method for determining the amount of transcription of the gene (an indication of the amount of RNA available for the translation of the gene product) is to carry out a Northern blot as explained below (for reference see Auεubel et al. (1988 ) Current Protocol in Molecular Biology, Wiley: New York, or the example section mentioned above), a primer which is designed in such a way that it binds to the gene of interest is labeled with a detectable label (usually radioactive or chemiluminescent), So when the total RNA of a culture of the organism is extracted, separated on a gel, transferred to a stable matrix and incubated with this probe, the binding and the extent of the binding of the probe, the presence and also the amount of mRNA for this Gene indicates. This information indicates the degree of transcription of the transformed gene. Total cellular RNA can be obtained from cells, tissues or organs using several methods, all of which are known in the art, such as, for example, by Bormann, ER, et al. (1992) Mol. Microbiol. 6: 317-326.

Northern hybridization:

For the RNA hybridization, 20 μg of total RNA or 1 μg of poly (A) ⁺ RNA were used by means of gel electrophoresis in agarose gels with a strength of 1.25% using formaldehyde, as described in A asino (1986, Anal. Biochem. 152, 304), transferred by capillary attraction using 10 x SSC to positively charged nylon membranes (Hybond N +, A ersham, Braunschweig), immobilized using UV light and 3 hours at 68 ° C using hybridization buffer (10% dextran sulfate wt . / Vol., 1 M NaCl, 1% SDS, 100 mg herring εperma DNA) prehybridized. The DNA probe was labeled with the Highprime DNA labeling kit (Röche, Mannheim, Germany) during the pre-hybridization using alpha- ³² P-dCTP (Amersham Pharmacia, Braunschweig, Germany). The hybridization was carried out after adding the labeled DNA probe in the same buffer at 68 ° C. overnight. The washing steps were carried out twice for 15 min using 2 × SSC and twice for 30 min using 1 × SSC, 1% SDS, at 68 ° C. The closed filters were exposed at -70 ° C for a period of 1 to 14 days.

Standard techniques such as a Western blot can be used to examine the presence or the relative amount of protein translated from this mRNA (see, for example, Auubel et al. (1988) Current Protocol in Molecular Biology, Wiley: New York). With this method the total cellular Proteins extracted, separated by means of gel electrophoresis, transferred to a matrix, such as nitrocellulose, and incubated with a probe, such as an antibody, which specifically binds to the desired protein. This probe is usually provided with a chemiluminescent or colorimetric label that is easy to detect. The presence and amount of the label observed indicates the presence and amount of the desired mutant protein present in the cell.

Example 7: Analysis of the effect of the recombinant proteins on the production of the desired product

The effect of genetic modification in plants, fungi, algae, ciliates or on the production of a desired compound (such as a fatty acid) can be determined by growing the modified microorganisms or the modified plant under suitable conditions (such as those described above) and that Medium and / or the cellular components for the increased production of the desired product (ie lipids or a fatty acid) is examined. These analysis techniques are known to the person skilled in the art and include spectroscopy, thin-layer chromatography, staining methods of various types, enzymatic and microbiological methods and analytical chromatography, such as high-performance liquid chromatography (see, for example, Ullman, Eneyclopedia of Industrial Chemistry, Vol. A2, pp. 89-90 and p. 443-613, VCH: Weinheim (1985); Fallon, A., et al., (1987) "Applications of HPLC in Biochemistry" in: Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 17; Rehm et al. (1993 ) Biotechnology, Vol. 3, Chapter III: "Product recovery and purification", pp. 469-714, VCH: Weinheim; Belter, PA, et al. (1988) Bioεeparationε: downstream processes for Biotechnology, John Wiley and Sons; Kennedy , JF, and Cabral, JMS (1992) Recovery processeε for biological Materials, John Wiley and Sons; Shaeiwitz, JA, and Henry, JD (1988) Biochemical Separationε, in: Ullmann'ε Eneyclopedia of Industrial Chemistry, Vol. B3; Chapter 11, pp. 1-27, VCH: Weinheim; and Dechow, F.J. (1989) Separation and purification techniques in biotechnology, Noyes Publicationε).

In addition to the methods mentioned above, plant lipids are made from plant material as described by Cahoon et al. (1999) Proc. Natl. Acad. Be. USA 96 (22): 12935-12940, and Browse et al. (1986) Analytic Biochemistry 152: 141-145, described extracted. The qualitative and quantitative lipid or fatty acid analysis is described by Christie, William W., Advances in Lipid Methodology, Ayr / Scotland: Oily Press (Oily Press Lipid Library; 2); Christie, William W., Gas Chromatography and Lipids. A Practical Guide - Ayr, Scotland: Oily Press, 1989, Repr. 1992, IX, 307 S. (Oily Presε Lipid Library; 1), - "Progreεε in Lipid Research, Oxford: Pergamon Presε, 1 (1952) - 16 (1977) udT: Progress in the Chemistry of Fatε and Other Lipidε CODEN.

In addition to measuring the end product of the fermentation, it is also possible to analyze other components of the metabolic pathways that are used to produce the desired compound, such as intermediates and by-products, in order to determine the overall efficiency of the production of the compound. The analysis methods include measurements of the amounts of nutrients in the medium (e.g. sugar, hydrocarbons, nitrogen sources, phosphate and other ions), measurements of the biomass composition and growth, analysis of the production of common metabolites of biosynthetic pathways and measurements of gases generated during fermentation. Standard methods for these are described in Applied Microbial Physiology Mesεungen ^'; 131-163 and 165-192; ^"A Practical Approach, Rhodes PM and Stanbury PF, eds, IRL Presε, pp 103-129: specified therein and (ISBN 0199635773). Literature parts described.

One example is the analysis of fatty acids (abbreviations: FAME, fatty acid methyl ester; GC-MS, gas liquid chromatography / mass spectrometry; TAG, triacylglycerol; TLC, thin layer chromatography).

The unambiguous detection of the presence of fatty acid products can be obtained by analysis of recombinant organisms according to standard analysis methods: GC, GC-MS or TLC, as described variously by Christie and the literature therein (1997, in: Advances on Lipid Methodology, Fourth Edition. : Christie, Oily Presε, Dundee, 119-169; 1998, gas chromatography-mass spectrometry method, lipids 33: 343-353).

The material to be analyzed can be broken up by ultrasound treatment, grinding in a glass mill, liquid nitrogen and grinding, or by other applicable methods. The material must be centrifuged after breaking up. The sediment is detached in aqua. resuspended, heated at 100 ° C. for 10 min, cooled on egg and centrifuged again, followed by extraction in 0.5 M sulfuric acid in methanol with 2% dimethoxypropane for 1 hour at 90 ° C., to give hydrolyzed oil and lipid - leads compounds that give trans-methylated lipids. These fatty acid methyl esters are extracted in petroleum ether and finally a GC analysis using a capillary column (chrome pack, WCOT fused silica, CP-Wax-52 CB, 25 microm, 0.32 mm) at a temperature gradient between 170 ° C and 240 ° C for 20 min and subjected to 5 min at 240 ° C. The identity of the fatty acid methyl esters obtained has to be defined using standards which are available from commercial sources (ie Sigma).

The following protocol was used for the oil analysis of the Arabidopsia plants transformed with the suppression constructs:

The extraction of lipids from seeds is carried out according to the method of Bligh & Dyer (1959) Can J Biochem Physiol 37: 911. For this purpose, 5 mg Arabidopsiε seeds in 1.2 ml Qiagen microtubes (Qiagen, Hilden) are weighed out on a Sartorius (Göttingen) microbalance. The seed material is mixed with 500 uL of chloroform / methanol (2: 1; includes mono-C17-glycerol from Sigma as internal standard) was homogenized in the Rätεchmühle MM300 from Retsch (Ηaan) and incubated for 20 min at RT ^"After addition of 500 uL. The phase is separated by 50 mM potassium phosphate buffer pH 7.5, 50 μL are removed from the organic phase, diluted with 1500 μL chloroform and 5 μL applied to the capillaries Chromarodε SIII from Iatroscan (SKS, Bechenheim) this for 15 min in a thin layer chamber, which is saturated with 6: 2: 2 chloroform: methanol: toluene, separated in a first step, after which the capillaries were dried for 4 min at room temperature and then for 22 min in a thin film chamber saturated with 7: 3 n-hexane: ethyl ether After a further drying step for 4 min at room temperature, the samples are mixed in an Iatroεcan MK-5 (SKS, Bechenheim) in accordance with F raεer & Taggart, 1988 J. Chromatogr. 439: 404 analyzed. The following parameters were set for the measurements: Slice width 50 msec, Treεhold 20 mV, Noiεe 30, Skim ratio 0. The data were quantified using the internal standard Mono-C17-glycerin (Sigma) and a calibration curve with Tri-C17- glycerin (Sigma) using the ChromStar program (SKS, Beichenheim).

For the quantitative determination of the oil contents, seeds from independent transgenic plants of the TI generation were analyzed. The harvested seeds were processed in accordance with the analysis methods described and the oil contents were determined quantitatively (FIG. 10). Several independent lines could be identified which show a significantly increased oil content compared to control plants which were transformed with the vector without the suppression construct. This results in seeds with up to 38% higher oil content for the transgenic lines (line 16-1 shows the highest oil quantity). The comparison with the control plants grown in parallel shows the specificity and thus the functionality of the construct used. It could thus be shown that a specific reduction in a storage protein class leads to an increase in the oil content in seeds.

Example 8: Cloning of the super-RNAi constructs for the

Suppression of storage proteins from different classes

a) Production of super suppression construct 1

The vectors pCR2. l-AtCRU3-RNAi and pCR2.1-4 (see Example 2) are incubated with the restriction enzymes Xhol and Sall for 2 hours at 37 ° C., the DNA fragments separated by agarose gel electrophoresis and both the vector and the PCR Inert cut out of pCR2.1-4 and purified with the "Gelpurification" kit from Qiagen according to the manufacturer's instructions and eluted with 50 μL elution buffer. 1 μL of the vector and 8 μL of the eluate from the PCR insert of pCR2.1-4 are used for the ligation, resulting in the construct pCR2.1-sRNAil. This vector is incubated for 2 hours with the restriction enzyme Xhol and then for 15 min with the Klenow fragment. The vector pCR2.1-AtCRB-RNAi (see example 2) is incubated with the enzyme EcoRI for 2 hours and also treated with Klenow fragment for 15 minutes. Both incubation approaches are separated by gel electrophoresis and the vector (pCR2.1-εRNAil) or the insert (from pCR2.1-AtCRB-RNAi) is cut out of the agarose gel and the DNA fragments are purified as described above. For the ligation, 1 μL of the eluate from the vector and 8 μL of the eluate from the insert are used and incubated at 4 ° C. overnight. The resultant construct is made with pCR2. designated l-sRNAi2. The resulting vector is incubated with the enzyme Xbal and then with Klenow fragment. The vector pCR2.1-4 is incubated with the enzymes EcoRV and Xbal and then with the Klenow fragment. After gel electrophoresis and purification, the fragment from pCR2.1-4 with the vector pCR2. l-εRNAi2 ligated, resulting in the construct pCR2. l-sRNAi3. The resulting vector is then incubated with the Apal enzyme for 2 hours and then with the Klenow fragment for 15 minutes. The vector pCR2 is used as an insert. Incubate l-At2S3-RNAi with the EcoRI enzyme for 2 hours and then with the Klenow fragment for 15 minutes. After gel electrophoresis and purification, the eluates are ligated, resulting in the vector pCR2. l-sRNAi4. This vector then becomes the sRNAi4 fragment (SEQ ID NO: 144), coding for the super-suppressing dsRNA, by incubation with HindIII and Pvul cut out and ligated into the binary vector pSUN-USP (SEQ ID NO: 179). The construct serves the simultaneous suppression of Arabidopsis thaliana storage proteins CRB (SEQ ID NO: 4), CRU3 (SEQ ID NO: 112) and At2S3 (SEQ ID NO: 118).

Production of Super Suppression Construction 2

Starting from Arabidopsis thaliana cDNA, a fragment from the storage protein AtCRU3 (SEQ ID NO: 111, 112) is amplified with the following pair of oligonucleotides-primers under the PCR conditions given in Example 2:

OPN 11: 5 -AAAAGGCCTGTGTTCCATTTGGCCGGAAACAAC-3 '(SEQ ID NO: 148)

OPN 12: 5 '-AAAGATATCACCCTGGAGAACGCCACGAGTG-3' (SEQ ID NO: 149).

The fragment obtained is cloned into the vector pCR2.1-TOPO vector (Invitrogen) according to the manufacturer's instructions, resulting in the pCR2.1-6 and the sequences checked.

Starting from Arabidopsis thaliana cDNA, a fragment from the storage protein At2S3 (SEQ ID NO: 3, 4) is amplified with the following pair of oligonucleotides-primers under the PCR conditions given in Example 2:

OPN 13: 5 '-AAAAGGCCTATGGCTAACAAGCTCTTCCTCGTC-3' (SEQ ID NO: 150)

OPN 14: 5 -AAAGATATCCTAGTAGTAAGGAGGGAAGAAAG-3 '(SEQ ID NO: 151).

The fragment obtained is cloned into the vector pCR2.1-T0P0 vector (Invitrogen) according to the manufacturer's instructions, resulting in the pCR2.1-7 and the sequences checked.

The constructs from pCR2.1-3, pCR2.1-4 (see Example 2) and pCR2.1-6 and pCR2.1-7 are then ligated together as follows: The vector pCR2.1-3 is used for 2 hours with EcoRV incubated and then dephoεphorylated for 15 min with alkaline phosphate. The vector pCR2.1-6 is incubated with the enzymes StuI and EcoRV for 2 hours and the PCR insert is isolated by gel electrophoresis and purification. Vector pCR2.1-3 and insert from pCR2.1-6 are then ligated overnight at 4 ° C, resulting in the construct pCR 2. l-sRNAi5. This vector is then incubated with EcoRV and dephosphorylated and ligated with the StuI / EcoRV incubated and gel-purified fragment from pCR2.1-7, resulting in the construct pCR2. l-εRNAi6. This vector is then incubated with Xhol and dephosphorylated. The vector pCR2.1-4 is incubated with SalI and Xhol and the inert to pCR2.1-4 with the prepared vector pCR2. l-εRNAi6 ligated, resulting in the construct pCR2.l-sRNAi7. Starting from pCR2. l-sRNAi7, a PCR is carried out with the following primer pair under the conditions given in Example 2:

OPN 15: 5 CCGCTCGAGCTCAGGGTCTTTTCTTGCCCACT (SEQ ID NO: 152)

OPN 16: 5 ^λ -CCGGTCGACCTAGTAGTAAGGAGGGAAGAAAG (SEQ ID NO: 153).

The resulting PCR product is incubated with the enzymes Xhol and Sall. The fragment is then ligated into the vector pCR2.l-sRNAi7 (incubated with Xhol), resulting in the construct pCR2.1-sRNAiδ. The sRNAi8 fragment (SEQ ID NO: 146), coding for the super-suppressing dsRNA, is then cut out of this vector by incubation with HindIII and Xbal and ligated into the binary vector pSUN-USP (SEQ ID NO: 179). The construct serves for the simultaneous suppression of Arabidopsi thaliana storage proteins CRB (SEQ ID NO: 4), CRU3 (SEQ ID NO: 112) and At2S3 (SEQ ID NO: 118).

Comparative test 1:

The effect of the transgenic expression of the cytosolic, non-light-regulated Arabidopεis thaliana ACCase (GenBank Acc.- No.: D34630) as a fusion protein with a signal sequence for transport in chloroplasts from the transketolase from tobacco (Henkes S et al. (2001 ) Plant Cell 13 (3): 535-51) for the oil content of the plants was examined. For this purpose, the fusion protein (cf. SEQ ID NO: 176, 177) was expressed in Arabidopsis thaliana plants under the control of the napin promoter. The nucleic acid sequence coding for this expression construct is described by SEQ ID NO: 175. The plants were produced and examined using the above-mentioned methods. No significant change in the oil content in seeds compared to wild-type control plants could be determined (see FIG. 8).

Claims

claims

1. A method for increasing the total oil content in a plant organism, characterized in that the subsequent work steps include

b) Selection of plant organisms in which - in contrast to or compared to the starting organism - the total oil content in said plant organism or in a tissue, organ, part or cell of said plant organism is increased.

2. The method according to claim 1, characterized in that the total oil content in the seed of a plant is increased.

3. The method according to claim 1 or 2, characterized in that the storage protein is selected from the storage protein classes of the 2S albumins, 7S globulins, 11S / 12S globulins or zein prolamines.

4. The method according to any one of claims 1 to 3, characterized in that the storage protein is selected from

a) the group of polypeptides according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40 , 42, 44, 46, 48, 50, 52, 112, 114, 116, 118, 120, 122, 133, 155, 157, 159, 161, 163, 165, 167, 169, 171, 172 or 174 or

b) a functional equivalent of one of the polypeptides under a) with a homology to this of at least 65%.

5. The method according to any one of claims 1 to 4, characterized in that the storage protein is described by a polypeptide according to SEQ ID NO: 112 or a functional equivalent thereof with a homology to this of at least 65%.

18 drawings

6. The method according to any one of claims 1 to 5, characterized in that the amount of protein of at least two storage proteins is reduced, the homology of at least two of the storage proteins reduced in their amount of protein among each other being less than 90%.

7. The method according to one of claims 1 to 6, characterized in that at least two of the storage proteins to be reduced count to different classes selected from the group of classes of 2S-albumins, 7S-globulins, 11S / 12S-globulins or zein-prolamines.

8. The method according to one of claims 1 to 7, characterized in that the reduction in the amount of protein of at least one storage protein is ensured by using a method selected from the group consisting of

a) introduction of a double-stranded RNA nucleic acid sequence or an expression cassette or expression cassettes ensuring its expression, the double-stranded RNA sequence comprising the following elements

i) at least one “sense” ribonucleotide sequence which is essentially identical to at least part of the “sense” RNA transcript of a storage protein nucleic acid sequence and

ii) "antiεenεe" ribonucleotide sequences to be said

"sense" ribonucleotide sequence under i) are essentially complementary

b) introduction of a storage protein antisense-RNA-nucleic acid sequence or an expression cassette guaranteeing its expression, the storage protein antisense-RNA-nucleic acid sequence being essentially complementary to an independent part of the "εense" -RNA transcript nucleic acid of a storage protein

c) introduction of a storage protein antisenεe-RMA-nucleic acid sequence combined with a ribozyme or an expression cassette ensuring its expression,

d) Introduction of storage protein sense RNA nucleic acid sequences for inducing a co-suppression or an expression cassette guaranteeing its expression, the storage protein sense RNA nucleic acid sequence being essentially identical to at least part the "sense" RNA transcript of a storage protein nucleic acid sequence

e) introduction of DNA-binding factors against storage protein genes or RNAs or an expression cassette ensuring their expression,

f) introduction of viral nucleic acid sequences and expression constructs causing the degradation of RNA in the protein and expression constructs or an expression cassette ensuring their expression,

g) introduction of constructs for the induction of a homologous recombination on endogenous storage protein genes and

h) Introduction of mutations into an endogenous storage protein gene.

9. The method according to any one of claims 1 to -8, comprising

^'I) stably transforming a plant cell with a recombinant expression cassette comprising, in functional linkage with a promoter active in plants, a nucleic acid sequence coding for

a) a double-stranded storage protein RNA nucleic acid sequence, the double-stranded RNA sequence comprising the following elements

i) at least one "senεe" ribonucleotide sequence which is essentially identical to at least part of the "εenεe" RNA transcript of a storage protein nucleic acid sequence and

ii) “antisense” ribonucleotide sequences which are essentially complementary to the said “εense” ribonucleotide sequences under i),

or

b) a storage protein antisense-RNA-nucleic acid sequence, the storage protein antisense-RNA-nucleic acid sequence being essentially complementary to at least part of the "sense" -RNA transcript of a storage protein nucleic acid sequence, or c) a storage protein antiεenεe nucleic acid sequence combined with a ribozyme or

d) a storage protein sense-nucleic acid sequences for inducing a cosuppression, the storage protein sense-RNA nucleic acid sequence being essentially identical to at least part of the "εenεe" RNA transcript of a storage protein nucleic acid sequence, or

f) DNA binding factors against storage protein genes or RNAs

g) viral nucleic acid sequences causing the storage protein RNA degradation

II) regeneration of the plant from the plant cell, and

III) Expression of said nucleic acid sequence in an amount and for a time sufficient to increase the total oil content in said plant.

10. Double-stranded RNA molecule comprising

a) at least one “εenεe” ribonucleotide sequence which is essentially identical to at least part of the “senεe” RNA transcript of a storage protein nucleic acid sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 111, 113, 115, 117, 119, 121, 132, 154, 156, 158, 160, 162, 164, 166, 168, 170 or 173 and

b) “antisense” ribonucleotide sequences which are essentially complementary to said “senεe” ribonucleotide sequences under a).

11. Double-stranded RNA molecule according to Claim 10, comprising

a) at least two "sense" ribonucleotide sequences, wherein

i) each of these “senεe” ribonucleotide sequences is essentially identical to at least part of the “senεe” RNA transcript of a storage protein nucleic acid sequence according to SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 111, 113, 115, 117, 119, 121, 132, 154, 156, 158, 160, 162, 164, 166, 168, 170 or 173 and where

ii) at least two of the storage protein nucleic acid sequences, to whose "εenεe" RNA transcript the said "εense" ribonucleotide sequences are essentially identical, have a homology of less than 90% with one another, and

b) "antisenεe" ribonucleotide sequences to be said

"senεe" ribonucleotide sequences under a) are essentially complementary.

12. Double-stranded RNA molecule according to claim 10 or 11, characterized in that at least two of the storage protein nucleic acid sequences, for whose "sense" RNA transcript the said "εenεe" ribonucleotide sequences are essentially identical, to two different classes storage proteins include selected from the group of storage protein classes consisting of 2S-albumin, 7S-globulin, HS / 12S-globulin and zein-prolamine.

13. Double-stranded RNA molecule according to one of claims 10 to 12, characterized in that the "εense" ribonucleotide sequences and the "antisense" ribonucleotide sequences are covalently linked to one another.

14. In functional linkage with a promoter, transgenic expression cassettes contain a nucleic acid sequence coding for double-stranded RNA molecule according to one of claims 10 to 13.

15. Containing transgenic expression system

a) in functional linkage with a promoter encoding a nucleic acid sequence for "sense" ribonucleotide sequences of a double-stranded RNA molecule according to one of claims 10 to 12 and

b) in functional linkage with a promoter, a nucleic acid sequence coding for "antiεenεe" ribonucleotide sequences of a double-stranded RNA molecule according to one of Claims 10 to 12, the promoters being selected such that the simultaneous expression of ^' "εenεe" ribonucleotide sequences and "antisense" ribonucleotide sequences is guaranteed in a particular organism.

16. A transgenic vector containing a transgenic expression cassette according to claim 14 or a transgenic expression system according to claim 15.

17. A transgenic organism containing a transgenic expression cassette according to claim 14 or a transgenic expression system according to claim 15 or a transgenic vector according to claim 16.

18. Transgenic organism according to claim 17 selected from the group consisting of bacteria, yeast, non-human animals and plants.

19. Transgenic organism according to one of claims 17 or 18, characterized in that the plant is selected from the group consisting of Arabidopsiε, rapeseed, sunflower, Se-εa, coloring agent, olive tree, soybean, maye, wheat and nut varieties.

20. Use of a transgenic organism according to one of claims 17 to 19 for the production of oils, fats, free fatty acids or derivatives of the aforementioned.