WO2003076583A2 - Bacteriophage genetiquement modifie et utilisation d'un tel bacteriophage pour administrer un acide nucleique a des bacteries - Google Patents

Bacteriophage genetiquement modifie et utilisation d'un tel bacteriophage pour administrer un acide nucleique a des bacteries Download PDF

Info

Publication number
WO2003076583A2
WO2003076583A2 PCT/US2003/006941 US0306941W WO03076583A2 WO 2003076583 A2 WO2003076583 A2 WO 2003076583A2 US 0306941 W US0306941 W US 0306941W WO 03076583 A2 WO03076583 A2 WO 03076583A2
Authority
WO
WIPO (PCT)
Prior art keywords
phage
bacteriophage
cell
cells
bacteria
Prior art date
Application number
PCT/US2003/006941
Other languages
English (en)
Other versions
WO2003076583A3 (fr
Inventor
Laura M. Kasman
Alex Kasman
Caroline Westwater
Joseph W. Dolan
Michael G. Schmidt
James S. Norris
David A. Schofield
Original Assignee
Musc Foundation For Research Development
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Musc Foundation For Research Development filed Critical Musc Foundation For Research Development
Priority to AU2003220072A priority Critical patent/AU2003220072A1/en
Publication of WO2003076583A2 publication Critical patent/WO2003076583A2/fr
Publication of WO2003076583A3 publication Critical patent/WO2003076583A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/10011—Details dsDNA Bacteriophages
    • C12N2795/10311—Siphoviridae
    • C12N2795/10321—Viruses as such, e.g. new isolates, mutants or their genomic sequences

Definitions

  • the invention relates to methods and materials involved in the delivery of nucleic acid to bacteria.
  • the invention relates to genetically engineered phage and the use of genetically engineered phage to deliver nucleic acid (e.g., nucleic acid encoding antigens or antimicrobial agents) to bacteria.
  • nucleic acid e.g., nucleic acid encoding antigens or antimicrobial agents
  • the invention also relates to methods and materials involved in determining the number of infectious particles needed to infect cells.
  • Enteric bacterial pathogens are an important cause of gastrointestinal disease (48), urinary tract infections (11, 12), and sepsis (8, 39) throughout the world. Resistance among Gram-negative bacteria to extended-spectrum cephalosporins and penicillins has become increasingly common, making empiric therapy decisions difficult (40). The emergence and spread of multidrug resistance among a multitude of bacterial pathogens has demanded the development of novel antibacterial therapies.
  • the invention involves methods and materials related to the delivery of nucleic acid to bacteria (e.g., gram-negative and/or gram-positive bacteria).
  • bacteria e.g., gram-negative and/or gram-positive bacteria.
  • the invention provides genetically engineered phage and the use of such phage to deliver nucleic acid encoding one or more polypeptides to bacteria.
  • Lytic phages which kill their host following amplification and release of progeny phage into the environment, may offer an alternative strategy for combating bacterial infections.
  • the invention provides the use of a non-lytic phage to specifically target and deliver to bacteria DNA encoding bactericidal proteins.
  • the Ml 3 phagemid system and the addiction toxins Gef and ChpBK were used. Phage delivery of lethal agent phagemids reduced target bacterial numbers by several orders of magnitude in vitro and in a mouse bacteremic model of infection. Given the powerful genetic engineering tools available and the present knowledge in phage biology, this technology can have potential use in antimicrobial therapies and DNA vaccine development.
  • the invention also provides methods and materials involved in determining the number of infectious particles needed to infect cells.
  • One explanation for the apparent threshold density discussed above would be a requirement on the part of the phage for the host cell to be in a particular metabolic state, and that this state is only reached when the cell density is 10 4 colony forming units (cfu)/ml or more.
  • Small molecules called autoinducers or quorum factors are known to be secreted into the environment by bacteria, which by their accumulation as the number of cells increases, allow the bacteria to monitor their local population density (De Kievit and Iglewski, 2000, Infection and Immun., 68(9): 4839-4849).
  • P / P Mone is the fraction of phage which remain unbound at time t (in minutes)
  • C is the concentration of host cells per cubic centimeter (cm 3 ) which remains constant over time t
  • k is an adsorption rate constant (cnrVmin) which can be determined experimentally for a given phage-host combination. Variations between phage-host systems in the number of phage binding sites per cell, the diffusion rate constant of the virus, and the efficiency with which collisions between cells and phage result in infection are accounted for by empirical determination of the adsorption rate constant, k , for each system (see Schlesinger, supra; Stent, supra for method).
  • T-even phages which can utilize up to 300 binding sites per host cell have an adsorption rate constant of 2.4 x 10 "9 cmVmin (Stent, supra), while the adsorption rate constant for filamentous phage Ml 3 which has only 2-3 binding sites per cell is 3 x 10 "11 cnrVmin (Caro and Schnos, 1966, Proc. Natl. Acad. Sci USA 56: 126-132 and Tzagoloff and Pratt, 1964, Virology 24:372- 380).
  • MOI actua ⁇ would indicate the number of phage calculated to be bound per host cell at the end of the adsorption period according to Schlessinger's model, and therefore the effective multiplicity of infection in a given experiment. Finally, a simple method for calculating MOI actua ⁇ is given, and the implications for phage therapy applications are discussed.
  • the invention provides methods and materials for determining the number of infectious particles needed to infect cells. For example, the methods and materials provided herein can be used to determine the number of phage or virus needed to infect at least about 95 percent (e.g., at least about 96, 97, 98, 99, or 99.5 percent) of a population of cells.
  • the theory underlying this invention allows the computation of the minimum amount of phage or virus needed to have an expected infection rate of, for example, 99.99% (or any other desired expected infection rate) and conversely to compute the expected infection rate.
  • the cell population to be infected can be any type of cell population.
  • a population of human cells, mouse cells, monkey cells, or rabbit cells can be used.
  • the phage or virus can be any type of phage or virus.
  • viruses that infect eukaryotic cells e.g., mammalian cells such as human cells, mouse cells, monkey cells, and rabbit cells
  • prokaryotic cells e.g., bacteria cells
  • viruses include, without limitation, bacteriophage, lentiviruses, herpesviruses, adenoviruses, vaccinia viruses, and retroviruses.
  • viruses can be recombinant chimeric viruses having particular activities such as toxic activities.
  • a virus can be engineered to express fas, fas ligand, and/or p53 to treat cancerous cells that are in suspension in the body (e.g., leukemia, metastatic cancers of all forms that are in suspension).
  • the viruses also can be engineered such that gene replacement therapies can be performed, for example, when the virus requires a cell capable of division.
  • Such viruses can be Lenti-virus based vectors and/or retroviral vectors that will infect lymphoid cells, pluripotent stem cells, stem cells, and other dividing cells that will likely function as gene therapies rather than molecular medicines.
  • Lentiviral vectors are a type of retrovirus that can infect both dividing and non- dividing cells because their pre-integration complex is capable of penetrating the intact membrane of the nucleus of the target cell.
  • Lentiviruses can be used to provide highly effective gene therapy as lentiviruses can change the protein expression of their target cells for extended periods. They can be used for nondividing or terminally differentiated cells such as neurons, macrophages, haematopoietic stem cells, retinal photoreceptors, and muscle and liver cells; cell types for which previous gene therapy methods could not be used.
  • the methods and materials provided herein can be used to determine the minimum amount of virus need to infect at least 95 percent of a cell population in an ex vivo gene transfer protocol using, for example, retroviral vector-corrected cells that are to be transplanted directly into the brain to circumvent the blood-brain barrier. This is especially true when the cell population has a density less than a concentration C .
  • Such cases include, without limitation, case where the cells (e.g., multipotent progenitor cells, neural stem cells, and fetal liver haematopoietic stem cells) are in short supply.
  • one aspect of the invention features a non-lytic bacteriophage containing nucleic acid encoding a lethal agent for treating an infection caused by a pathogenic organism.
  • the bacteriophage can be a filamentous bacteriophage.
  • the invention features a method of treating a mammal.
  • the method includes administering an effective amount of a non-lytic bacteriophage containing nucleic acid encoding a lethal agent to said mammal.
  • the bacteriophage can be a filamentous bacteriophage.
  • the bacteriophage can be administered via a topical or dermatological formulation.
  • Another embodiment of the invention features a pharmaceutical composition containing one or more non-lytic bacteriophage containing nucleic acid encoding a lethal agent.
  • the bacteriophage can be a filamentous bacteriophage.
  • the non-lytic bacteriophage can be formulated for delivery via a patch, lotion, ointment, cream, or gel.
  • Another embodiment of the invention features a method for making a cellular ghost.
  • the method includes contacting a cell with a bacteriophage, wherein the bacteriophage contains nucleic acid encoding an antimicrobial agent, and wherein the contacting is under conditions wherein (a) the bacteriophage delivers the nucleic acid to the cell and (b) expression of the antimicrobial agent within the cell changes the cell into a cellular ghost.
  • the bacteriophage can be a non-lytic bacteriophage.
  • the bacteriophage can be a filamentous bacteriophage.
  • the nucleic acid can encode an antigen.
  • the ghost can contain the antigen.
  • Another embodiment of the invention features a method for making a cellular ghost containing an antigen.
  • the method includes (a) contacting a cell with a bacteriophage containing nucleic acid encoding an antimicrobial agent and the antigen under conditions wherein the bacteriophage delivers the nucleic acid to the cell, (b) expressing the antigen within the cell, and (c) expressing the antimicrobial agent within the cell under conditions wherein the cell changes into the cellular ghost.
  • the bacteriophage can be a non-lytic bacteriophage.
  • the bacteriophage can be a filamentous bacteriophage.
  • Expression of the antigen within the cell can be driven by a constitutive promoter.
  • Expression of the antimicrobial agent within the cell can be driven by a inducible promoter. Expression of the antigen within the cell can occur prior to inducing expression of the antimicrobial agent within the cell.
  • Another embodiment of the invention features a method for vaccinating a mammal against an antigen.
  • the method includes administering a cellular ghost containing the antigen to the mammal, the cellular ghost being made according to a method provided herein.
  • Another embodiment of the invention features a cellular ghost produced according to a method provided herein.
  • the invention features a method for determining the number of virus (e.g., bacteriophage) sufficient to infect at least about 95%, 96%, 97%, 98% or 99% of a population of host cells, wherein the method includes calculating P m ⁇ n and determining the number of virus needed to infect at least about 95%, 96%, 97%, 98% or 99% of a population of host cells.
  • the method can be for determining the number of virus sufficient to infect at least about 99.9% of a population of host cells.
  • the population of host cells can be in a cell culture or in an animal.
  • the host cells can be prokaryotic cells (e.g., bacteria) or eukaryotic cells (e.g., human cells).
  • the invention features a composition of virus (e.g., bacteriophage), wherein the concentration of virus has been optimized to infect at least about 95%, 96%, 97%, 98% or 99% of a population of host cells.
  • the composition can be a pharmaceutical formulation.
  • Another embodiment of the invention features a method of treating a subject (e.g., human). The method includes administering a pharmaceutical formulation containing a concentration of virus that has been optimized to infect at least about 95%, 96%, 97%, 98% or 99% of a population of host cells.
  • Another embodiment of the invention features a method of infecting a population of host cells.
  • the method includes contacting a composition with a population of host cells.
  • the composition contains a concentration of virus that has been optimized to infect at least about 95%, 96%, 97%, 98% or 99% of a population of host cells (e.g., bacteria or human cells).
  • the host cells can be in a cell culture.
  • FIG. 3 In vitro phage delivery of lethal agents to E. coli.
  • a colony- forming unit assay was performed to evaluate the effects of the phage delivered lethal agents on the killing of E. coli ⁇ R2738.
  • Target cells were grown to mid-exponential phase (OD600 of 0.8) in LB broth containing tetracycline and diluted to approximately 1 x 10 6 CFU/ml in LB broth containing 1 mM IPTG. An aliquot of cells (10 5 CFU, 100 ⁇ l) was incubated at 37°C with an equal volume of phage lysate (8 x 10 9 PFU/ml). Control experiments were carried out in the absence of phage lysate.
  • Treatments were as follows: (1) cells plus buffer, (2) cells plus Gef-phagemid lysate, (3) cells plus ChpBK-phagemid lysate. Treatments reflect viable cell counts following 30 minutes incubation at 37°C. Viable counts were determined following dilution and plating of the infection on LB plates containing 1 mM IPTG. The figure is representative of at least two experiments with each infection performed in triplicate. All values are means plus standard deviation.
  • Figure 4. Cell death following phage delivery of pGef and pChpBK is IPTG dependent. A colony- forming unit assay was performed to evaluate the effects of the phage delivered lethal agents in the presence and absence of IPTG. E.
  • coli ERAPlacI cells were grown to mid-exponential phase (OD600 of 0.8) in LB broth containing appropriate antibiotics (kanamycin and tetracycline) and diluted to approximately 1 x 10 6 CFU/ml in LB with (solid bars) or without (open bars) 1 mM IPTG. An aliquot of cells (100 ⁇ l, 1 x 10 5 CFU/ml) was incubated at 37°C with an equal volume of phage lysate (8 x 10 9 PFU/ml). Control experiments were carried out in the absence of phage lysate.
  • Treatments were as follows: (1) cells plus buffer, (2) cells plus Gef-phagemid lysate, (3) cells plus ChpBK-phagemid lysate. Treatments reflect viable cell counts following 30 minutes incubation at 37°C. Viable counts were determined following dilution and plating of the infection on LB plates with (solid bars) or without (open bars) 1 mM IPTG. The figure is representative of at least two experiments with each infection performed in triplicate. The values are means plus standard deviation.
  • Mice were treated with a single dose of phage preparation containing phagemid pGef, pChpBK or pUPRIP (MOI actua i of 3.6).
  • the control vector pUPRIP is identical to the phagemids pGef and pChpBK except it lacks a gene encoding a lethal agent.
  • blood samples were taken, and bacterial counts were determined by plating onto LB plates containing tetracycline (20 ⁇ g/ml). Mice with tail blood containing less than 20 CFU/ml (lowest level of detection) at 1 h were eliminated from the analysis. The viable bacterial counts in the blood were plotted as the mean plus standard deviation for (A) each treatment group and for (B) each animal within each treatment group.
  • LACweak promoter has three mismatches (outlined) from the consensus E. coli -10 and -35 promoter elements.
  • the lad repressor-binding site (underlined) has been placed between the -10 and -35 E. coli canonical sequences (bold) to more effectively repress transcription.
  • FIG. 7 Expression of Gef results in "Ghost Cells. 'Ghost' cells were observed by placing an aliquot (lOO ⁇ l) of culture on a glass microscope slide. The cells were visualized with phase-contrast microscopy (400x magnification). Translucent cells with polar bodies of condensed material are considered ghost cells.
  • FIG. 8 Phage delivered lethal agents Gef and ChpBK.
  • a colony- forming unit assay was performed to evaluate the effects of the phage delivered lethal agents on the killing of E. coli ER2738.
  • Target cells were grown to mid-exponential phase (OD600 of 0.8) in LB-Tet media and diluted to approximately 1 x 10 6 CFU/ml in LB-IPTG media.
  • An aliquot of cells (10 5 CFU, 100 ⁇ l) was incubated at 37°C with an equal volume of phage lysate (2 x 10 9 PFU/ml).
  • M13K07 is naturally long circulating in mice.
  • M13K07 phage was passaged through mice three times. For each passage, 1 x 10 9 phage were injected intraperitoneally and phage remaining in circulation after 6, 24 or 48 hours were amplified for the next round respectively.
  • two isolates (LI and R3) were cloned by limiting dilution and evaluated for their ability to remain in circulation compared with wildtype M13K07 in new mice.
  • the concentration of Phage, M13K07, Wild type phage PI, and long circulating variants of the wild type parents, M13-LC1, M13-LC2 and Pl-LC were evaluated by isolating peripheral blood from the tip of the tail collected at intervals indicated, and were immediately plated, either neat or diluted in ice- cold LB, onto LB agar plates containing tetracycline (20 ⁇ g/ml).
  • FIG. 10 Comparison of the Circulation Characteristics of Phages Ml 3 and PI.
  • the kinetics of phage clearance by the RES was monitored by intraperitoneally injecting 1 x 10 9 phage into mice.
  • the concentration of Phage, M13K07, Wild type phage PI, and long circulating variants of the wild type parents, M13-LC1, M13-LC2 and Pl-LC were evaluated by isolating peripheral blood from the tip of the tail collected at intervals indicated, and were immediately plated, either neat or diluted in ice-cold LB, onto LB agar plates containing tetracycline (20 ⁇ g/ml).
  • Figure 12 In vivo evaluation of routes of inoculation of phage and bacteria in the neutropenic model of infection. Neutropenic (cyclophosphamide treated) mice were inoculated and the efficiency of transduction was determined by viable plate counting of blood isolated from the animal and recording the presence of a blue colony (transfected) or white colony (untransfected). Figure 13. In vivo evaluation of routes of inoculation of phage and bacteria in the neutropenic model of infection. Neutropenic (cyclophosphamide treated) mice were inoculated as described in the text above and the efficiency of transduction was determined by viable plate counting of blood isolated from the animal and recording the presence of a blue colony (transfected) or white colony (untransfected).
  • FIG. 15 In vivo evaluation of routes of inoculation of phage and bacteria in ICR mice. Six female ICR mice were injected IP with 9 x 10 7 cfu of ER2738 E. coli. After five minutes, three mice were injected at the same site with 5 xlO 9 tu Ml 3 phage carrying pBlueGFP phagemid while three mice received control injections at the same site. Tail blood was collected at one three five and seven hours and plated on LB agar plates impregnated with IPTG and XGAL.
  • FIG. 17 Pretreatment of mice with cyclophosphamide improved the model of non-lethal bacteremia. Mice were either pretreated or not with cyclophosphamide prior to inoculation with bacteria by the indicated routes. Efficiency of the treatment was measured by determining the viable number of bacteria present in the circulation at the times indicated.
  • Figure 23 Manufacturing advantages for filamentous phage.
  • Figure 24 Manufacturing advantages and the life cycle of filamentous phage.
  • FIG 25 Manufacturing advantages and the Ml 3 delivery system.
  • Figure 26 Manufacturing advantages and filamentous helper phage.
  • Figure 27 Manufacturing advantages and filamentous helper phage.
  • Figure 28 Effect of conditioned medium on transduction efficiency. Actively growing E. coli (ER2738) cells in LB containing 20 ⁇ g tetracycline/ml, in order to maintain the F' plasmid, were briefly chilled on ice before being diluted 10,000-fold in either fresh LB containing tetracycline or filter sterilized conditioned medium isolated from logarithmic growth or saturated cultures of the same cells. Transducing M13K07 phage carrying the pBlue-GFPuv plasmid were added to the corresponding cell suspensions. Green fluorescent protein is abbreviated GFP.
  • PI transducing phage Approximately 400 plaque forming units (pfu) PI transducing phage were incubated with serial dilutions of P1C600 host cells at the cell densities indicated for 30 min, then plated on kanamycin to select for cells which had been transduced with the reporter phagemid.
  • B Approximately 400 pfu M13K07 transducing phage were incubated with serial dilutions of ER2738 host cells at the cell densities indicated for 30 min, then plated on carbenicillin and X-Gal to select for cells which had been transduced with the pBlue- GFPuv reporter phagemid.
  • the expected number of transductants for each cell density was calculated as either N(l - e- MOI actua ⁇ ) plotted with open circles, or N(l - e- MOI, nput ) plotted with open squares. Observed numbers of transductants are plotted with filled triangles.
  • Figure 30 Fixed number of cells (low), serial dilutions of phage.
  • Nine dilutions of M13K07 transducing phage lysate carrying the pBlue-GFPuv phagemid were used to infect nine aliquots of 200 cfu ER2738 host cells at a cell density of 1000 cfu / cm 3 .
  • After 30 min of incubation at 37°C each reaction was plated on non-selective LB-agar containing IPTG and X-Gal. The percentage of blue and GFP-positive colonies was determined by direct count, and is plotted as the observed values (closed symbols).
  • Equation 4 in text for phages Ml 3 ( 1 ) and PI ( n ) is plotted as a function of host cell density, for an adsorption time of 30 min, a volume of 1 cm 3 , and an MOI act u a i of 10. Note that for all cell concentrations below C, P min is essentially the same.
  • the invention provides methods and materials related to the delivery of nucleic acid to bacteria (e.g., gram-negative and/or gram-positive bacteria).
  • bacteria e.g., gram-negative and/or gram-positive bacteria
  • the invention provides genetically engineered phage and the use of such phage to deliver nucleic acid encoding one or more polypeptides to bacteria.
  • the encoded polypeptides can be antigens (e.g., viral antigens, bacterial antigens, and/or fungal antigens) or antimicrobial agents.
  • the phage can contain nucleic acid encoding any type of lethal agent such as Gef and/or ChpBK. Other types of lethal agents include, without limitation, those described in PCT/US00/10229. Any type of phage can be used.
  • non-lytic phage and/or filamentous phage can be used.
  • the phage is Ml 3.
  • Other examples of phage that can be used as described herein include, without limitation, those listed in Figures 18 and 19 and Table A. Table A.
  • the phage can be designed to deliver lethal agents.
  • LADS vehicles can be developed to deliver bacteriostatic or bactericidal agents for the treatment of topical, systemic, and/or biofilm based infections ( Figure 19).
  • the methods and materials provided herein can be used to make bacterial cell ghosts (or other bacterial cell derivatives lacking nucleic acid).
  • the phage provided herein can be used to deliver nucleic acid encoding one or more polypeptides to bacteria.
  • expression of the encoded polypeptides e.g., a polypeptide having antimicrobial activity such as Gef
  • Any bacteria can be made into ghost cells including, without limitation, Escherichia coli, Salmonella typhimurium, Salmonella enteritidis, Klebsiella pneumoniae, Bordetella bronchiseptica, Helicobacter pylori, Vibrio, cholerae, Actionbacillus pleuropneumoniae, Haemophilus influenzae, Pasteurella haemolytica, Pasteurella multocida, Pseudomonas aeruginosa, Psuedomonas putida, Ralstonia eutropha, and Erwina cypripedii.
  • the bacterial ghosts can be used as nonliving candidate vaccines.
  • phage can be designed such that particular antigens (e.g., bacterial antigens, viral antigens, and/or fungal antigens) are expressed by the bacterial cells prior to being converted into a bacterial cell ghost.
  • a phage can be designed to deliver nucleic acid encoding (1) a bacterial antigen and (2) a polypeptide having antimicrobial activity.
  • the bacterial antigen can be expressed by the transduced bacteria prior to initiating expression of the antimicrobial polypeptide.
  • the resulting ghosts will be non- viable bacterial cells that contain the encoded antigen polypeptide, for example, on their surface.
  • non-lytic bacteriophage can be used to deliver nucleic acid to bacteria.
  • the non-lytic bacteriophage contemplated as delivery vehicles include filamentous bacteriophage as well as lysogenic or lytic phage that have been engineered to be non- lytic. Such engineering may be accomplished using molecular biological techniques.
  • Non-lytic phage can be identified by screening populations of bacteriophage to identify bacteriophage that have lost the ability to lyse a host cell.
  • non-lytic bacteriophage can be used with minimal modification to their genome.
  • Ml 3 phage can be obtained and modified in such a way that the difference between wild-type M13 and the modified M13 is simply the addition of nucleic acid that directs the expression of one or more polypeptides (e.g., viral antigens, bacterial antigens, and/or fungal antigens) or antimicrobial agents.
  • polypeptides e.g., viral antigens, bacterial antigens, and/or fungal antigens
  • filamentous bacteriophages can be used to deliver nucleic acid to bacteria.
  • Filamentous bacteriophages also known as filamentous phage, are long, thin bacteriophages ranging form about 1 to 2 ⁇ m in length and about 6 to 7 nm in diameter.
  • filamentous bacteriophages that infect a wide variety of bacteria are known, those that infect F+ strains of Escherichia coli are the best studied from a genetic and physiological point of view, and much is known about them.
  • Pfl a phage whose biology is not well understood, has proven to be the most tractable for X-ray crystallographic studies, although its structure differs in important respects from that of the F-specific phages.
  • the F-phages such as fl, fd, and Ml 3 are very similar to one another differing at a few nucleotide positions.
  • Filamentous phages contain single stranded DNA, their length is determined by the size of the DNA they encapsidate, and they are continually extruded from their host without lysis and without markedly affecting it.
  • the phages consist of a circular, single-stranded DNA genome encapsidated as a loop in what is essentially a protein tube.
  • the walls of this protein tube are comprised of about 2700 copies of one small protein, the product of gene VIII, and the ends bear minor proteins specific to each end. The ends are differentiable from each other morphologically in the electron microscope, biochemically, and by function.
  • the DNA need not be regularly arranged although it may be stacked within the particle.
  • the phage genome encodes 10 proteins, five of which are virion structural proteins, three are required for phage DNA synthesis, and two serve assembly functions. There is also an R intergenic region that contains signals for synthesis of both the (+) and (-) strands of DNA, but it does not code for any proteins. All of the phage-encoded proteins are required for progeny phage synthesis, but parts of the intergenic portions are dispensable.
  • the phage approaches the surface of the cell and infects the cell by entering.
  • the single-stranded DNA also known as the (+) strand
  • the initial double-stranded RF molecule serves as the template for transcription and protein synthesis. All genes are expressed immediately.
  • the gene II protein then makes a break at a specific place in the (+) strand of the RF molecule, and the resulting 3' terminus is elongated by the host's DNA synthesis apparatus until it is twice the length of the genome.
  • the displaced strand is then cut and circularized.
  • This form of replication is often referred to as the rolling circle form of replication. This is a frequently used form of replication by all types of viruses.
  • the resulting products are a free circular single strand and an RF molecule. There is a high probability that, early in infection, this newly formed single strand will, like the initial (+) strand that entered the cell, enter the doubling up cycle and become new RF.
  • the product of gene V is a single-stranded DNA binding protein that can sequester the newly synthesized single strands. DNA-gene V protein complexes do not serve as templates for DNA synthesis, and so these single strands remain available for assembly into virions.
  • phage structural proteins Two of the phage structural proteins have been shown to be transmembrane proteins, and the other three are believed to be membrane-associated. No complete virus particles can be detected within the cells, so the assembly of the progeny virus must take place at the membrane. All of the single-stranded DNA binding protein, gene V product, is removed from the single-stranded DNA and is replaced by the virion structural proteins as the phage particles are extruded through the cell envelope. All this is accomplished without apparent damage to the host cell. Because very little stress is imposed on the cell and the cells are not lysed during phage extrusion, very high phage titers, up to 10 13 particles per milliliter, are achievable. Like other small phages, filamentous phages are heavily dependent on host functions for all macromolecular synthesis and for assembly.
  • the invention also provides methods and materials for determining the number of infectious particles needed to infect cells.
  • Prior observations of phage-host systems in vitro have led to the conclusion that susceptible host cell populations must reach a critical density before phage replication can occur. Such a "replication threshold density" would have broad implications for the therapeutic use of phage.
  • the data provided herein demonstrates that no such replication threshold exists.
  • the data provided herein demonstrates that the frequently used measure of Multiplicity of Infection (MOI) computed as the ratio of the number of phage to the number of cells is generally inappropriate for situations in which cell concentrations are less than 10 7 cells/ml. In its place, we propose an alternative measure, MOI aclua ⁇ which takes into account the cell concentration and adsorption time.
  • MOI Multiplicity of Infection
  • compositions provided herein can be administered via any route.
  • M13 phage can be administered orally, topically, intravenously, or intramuscularly.
  • topical administration the compositions can be applied in liquid form or in the form of creams, gels, ointments, salves, lotions, sprays or the like.
  • compositions or formulations in combination with a dermatologically acceptable carrier.
  • Useful liquid carriers include water, alcohols, or glycols or water-alcohol/glycol blends, in which the compositions provided herein can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants.
  • the resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers.
  • the carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Adjuvants such as additional medicaments and additional antimicrobial agents, antifungal agents, fungicidal agents, wound-healing agents and blood clotting or thinning agents may be added to optimize the properties for a given use.
  • Physiologically acceptable adjuvants are chosen from pH-regulating agents, antioxidants, preservatives, pharmaceutically active ingredients including, for example, anti-inflammatory agents (such as salicylates and steroids), antibacterials, antibiotics, antifungals, antivirals, antiseboithocic agents, anti-acne agents, keratolytics, antihistamines, anaesthetics, insect repellents, cicatrizing agents, pigmentation modifiers, sunscreens, anti-free radical agents, moisturizing agents, vitamins, proteins, ceramides and other similar compounds.
  • anti-inflammatory agents such as salicylates and steroids
  • antibacterials antibiotics, antifungals, antivirals, antiseboithocic agents, anti-acne agents, keratolytics, antihistamines, anaesthetics, insect repellents, cicatrizing agents, pigmentation modifiers, sunscreens, anti-free radical agents, moisturizing agents, vitamins, proteins, ceramides and other
  • the active compositions may contain adjuvant surfactants to enhance deposition, wetting, and penetration of the compositions onto the target surface.
  • Suitable adjuvant surfactants include ethoxylated nonyl phenols, ethoxylated synthetic or natural alcohols, salts of the esters of sulphosuccinic acids, ethoxylated organosilicones, ethoxylated fatty amines, and blends of surfactants with mineral or vegetable oils.
  • Additives such as excipients, diluents, fragrances, chelators and thickeners may also be added to the compositions provided herein for, for example, topical administration.
  • Additives also include pigments and colorings, emollients, antifoams, plant or animal oils or waxes, paraffins, silicones, perfumes, plasticizers, thickening polymers and other similar compounds.
  • Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, creams, lotions and the like, for application directly to the skin of the patient.
  • Examples of useful dermatological compositions which can be used to deliver the compositions described herein to the skin are known to the art; for example, see Niemiec et al. (U.S. Pat. Nos. 6,419,913 & 6,284,234), Tournilhac et al. (U.S. Pat. No. 6,287,552), Lorant (U.S. Pat. No. 5,908,618), Jacquet et al. (U.S. Pat. No. 4,608,392), Geria (U.S. Pat. No. 4,992,478), Smith et al. (U.S. Pat. No. 4,559,157) and Wortzman (U.S. Pat. No. 4,820,508).
  • compositions described herein can be administered to a mammal at any dose.
  • any method can be used to determine a dose to deliver to a mammal.
  • the methods provided herein relating to MOI a -tuai can be used to determine the amount of particles (e.g., M13 phage particles) to administer to a mammal.
  • dosages of the compositions provided herein can be determined by assessing their in vitro activity and in vivo activity in animal models. Methods for extrapolating effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949.
  • the compositions provided herein can be formulated to contain any amount particles.
  • a composition can be formulated to contain high concentrations of particles (e.g., 10 13 , 10 14 , 10 15 , or more pfu per ml). Such compositions can be used at their high concentration or can be diluted to form a composition having a lower concentration of particles.
  • a composition containing 10 15 pfu per ml of M13 phage can be diluted to form a composition containing 10 14 , 10 13 , 10 12 , lO 11 , 10 10 , 10 9 , 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 or less pfu per ml of M13 phage.
  • between about 10 5 to about 10 10 pfu (e.g., between about 10 6 to about 10 9 or between about 10 7 to about 10 8 pfu) of phage can be delivered to a mammal per day.
  • 10 7 pfu of Ml 3 can be applied as a liquid formulation, such as a lotion, to the skin of a mammal daily for any length of time (e.g., a week, two weeks, month, two months, a year, or longer).
  • the phage can be delivered on a regular basis (e.g., every other day, weekly, or monthly) or on an irregular basis when needed.
  • compositions provided herein can be conveniently administered in unit dosage form; for example, containing 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 u , 10 12 , 10 13 , or 10 14 pfu per dosage form.
  • the desired dose can conveniently delivered in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four, or more sub-doses per day.
  • the sub-dose itself can be further divided, e.g., into a number of discrete loosely spaced administrations.
  • E. coli strains Bacterial strains and plasmids. The following E. coli strains were used for the cloning, propagation and infection experiments: strain XLl-Blue MRF' [F' proAB lacPZAM15 TnlO(Tet R )/A(mcrA)183 A(mcrCB-hsdSMR-mrr) 173 endAl supE44 thi-1 recAl gyrA96 relAl lac], strain ER2738 [F' proAB lacPA(lacZ)M15 zzf: :Tnl OfTet )/ fhuA2 glnV A(lac-proAB) thi-1 A(hsdS-mcrB)5], and ERAPlacI [ER2738 transformed with the vector construct APlacITpBHR].
  • the R408 helper phage (Promega Corporation, Madison, WI), which has a defective packaging signal, was used for packaging the phagemids.
  • Bacterial cells were grown in Luria-Bertani (LB) broth, and for solid media, agar was supplemented to a concentration of 1.5% (wt/vol).
  • Appropriate antibiotics were added as required to select for the presence of plasmids at the following concentrations: ampicillin (Amp, 50 ⁇ g/ml), kanamycin (Kan, 50 ⁇ g/ml), and tetracycline (Tet, 20 ⁇ g/ml).
  • IPTG was added to a final concentration of 1 mM, unless otherwise stated. DNA manipulations were performed using standard methods (41).
  • lad repressor protein The levels of lad repressor protein were controlled by endogenously expressed Lad (lacP) and by a plasmid expressing the lad gene.
  • the lad gene was amplified by PCR from DH5 ⁇ with primers 5- CGAATTGGATCCGGAGGTGGAATG-TGAAACCAGTAACG-3' and 5'- TCGGCGGAATTCCTAATGAGTGAGCTAACT-3' (restriction recognition sites in bold).
  • the 1140 bp R ⁇ mHI/EeoRI-digested PCR product was cloned into the corresponding sites of pBluescript II SK + , yielding lacIpSK.
  • the plasmid APlacIpSK was generated by cloning an artificial promoter with consensus E. coli -35/- 10 hexamers (bold sequence) TTATGGTACCTGTTTCATCCCCTATTGACAATGAAACATC- GGCTCGTATAATGTGTTTCATTGTGAGCATGAAACAGCGGCCGCGGTACCAA CT into the Klenow polymerase-treated Spel site of lacIpSK.
  • the T LI transcriptional terminator derived from the E. coli ⁇ operon (49) was cloned into the Klenow polymerase-treated EcoRI site of APlacIpSK.
  • APlacITpSK The resulting plasmid, APlacITpSK, was digested with Xbal and Hwdlll, treated with DNA polymerase I Klenow fragment, and cloned into the Klenow treated-EcoRI site of the broad-host-range vector pBBR122 (Mobitec), yielding plasmid APlacITpBHR.
  • the lacl-regulated promoter (UPRIP) containing a lad operator site (underlined sequence) flanked by consensus E. coli -35/-10 hexamers (bold sequence) GGATCCTCAGAAAATTATTTTAAATTTCCAATTGACATTGTGAGCGGATAAC AATATAATGTGTGGAGCTT was cloned into the ⁇ m ⁇ I/HmdIII sites of pBluescript II SK + , thereby generating plasmid UPRIPpSK.
  • Removal of the pBluescript lac promoter was accomplished by digesting UPRIPpSK with PvulUSacl, treating the digested fragments with T4 polymerase, and religating the UPRIP promoter-containing fragment to the vector backbone to yield plasmid pUPRIP.
  • the gene encoding Gef was amplified by PCR from the E. coli strain XLl-Blue MRF' with the upstream primer 5'- TACCGGAAGCTTGGAGGTGAGCAATGAAGC-AGCATAAGGCGAT-3 ' and downstream primer 5-ACAATTCTCGAGGAAGTGCCGGAT-CCGAA-3 ' .
  • the 395 bp H dIII/ ⁇ 7.oI-digested PCR product was cloned into the corresponding sites of pUPRIP, generating UPRTPgefpSK
  • the transcriptional terminator T 7 was cloned into the Klenow polymerase-treated Xh ⁇ site of UPRIPgefpSK, yielding pGef.
  • the gene encoding ChpBK was amplified by PCR from the E. coli strain XLl-Blue MRF' with the primers 5'-GCGTGTGGATCCGGAGGTG- AAATATGGTAAAGAAAAGTG-3' and 5'-ATTTTCGGATCCTTATTCCACC- ACCGCCT-3'.
  • the 386 bp undigested PCR fragment was cloned into the Klenow polymerase-treated Xhol site of pUPRIP, generating plasmid pChpBK.
  • phage stocks Preparation of phage stocks.
  • ERAPlacI cells harboring the toxic protein expression vector were grown overnight at 37°C in LB broth supplemented with tetracycline, ampicillin and kanamycin. The cultures were diluted 1 :100 and grown until an optical density at 600 nm (OD600) of 0.1 was reached.
  • OD600 optical density at 600 nm
  • the cells were infected with R408 helper phage at an input ratio of 10 phages per cell. The phage-infected cells were then incubated at 37°C with vigorous aeration for 6 h.
  • the cells were removed by centrifugation at 2,500 x g for 15 min at 4°C and phage-containing supernatants were passed through a 0.2 ⁇ m-pore-size filter.
  • the phages were precipitated overnight at 4°C with 5% polyethylene glycol 6000 and 0.5 M NaCl.
  • the phage pellets were resuspended in sterile SM buffer (50 mM Tris- ⁇ Cl p ⁇ 7.5, 100 mM NaCl, 10 mM MgSO ).
  • R408 helper phage was enumerated by using the soft agar overlay technique.
  • Phage containing the lethal agent-phagemid was measured by transduction of the pBluescript ampicillin resistance marker. Lysates were serially diluted with sterile SM buffer, mixed with 10 7 CFU of E. coli ER2738 or ERAPlacI, and overlaid on LB plates or plated on LB agar containing ampicillin and kanamycin, respectively. After overnight incubation at 37°C, the plates were examined for plaques or ampicillin resistant colonies. Phage infection and delivery of phagemids in vitro. Bacteria were grown in LB broth with antibiotic selection at 37°C until an OD600 of 0.8 was reached.
  • Bacterial cells were diluted in LB broth to a final density of 1 x 10 6 CFU/ml, and IPTG was added if appropriate to a final concentration of 1 mM. An aliquot of cells (10 5 CFU, 100 ⁇ l) was added with an equal volume of phage lysate (8 x 10 9 PFU/ml) and incubated for 30 min at 37°C without shaking. According to the kinetics of adsorption for Ml 3 phage, 97.3% of cells should be bound by at least one phage within the 30 minutes incubation (19). Survival of cells in phage-infected cultures was determined in triplicate by plating serial dilutions of cultures onto LB agar supplemented with 1 mM IPTG.
  • the surviving E. coli cells were enumerated and compared to the number of bacteria in a phage- free E. coli control culture. Phage-free cultures (containing only bacteria) and cell-free cultures (containing only phage) were used as controls in all experiments to demonstrate the absence of contamination.
  • mice Female ICR mice (20-25 g) were obtained from Harlan Sprague Dawley and Charles River Laboratories. Neutropenia was induced essentially according to the method of Cryz et al. (7). Briefly, 6 days, 3 days, and 1 day before the experiment, 200 ⁇ l cyclophosphamide (25 mg/ml; Sigma, St. Louis, MO) was administered to each mouse by intraperitoneal injection. In pilot experiments, this produced profound leukopenia for 3 to 4 days following the last dose, and slowed the clearance of bacteria from the blood. On the day of the experiment, overnight cultures of E.
  • coli ⁇ R2738 were diluted to an OD625 of 0.5, then held stationary at 37°C for 30 to 60 min and adjusted to an OD625 of 1.0, which corresponded to approximately 5 x 10 8 CFU/ml. Mice were then injected sequentially within 5 min with 200 ⁇ l ofE. coli ⁇ R2738 at 5 x 10 8 CFU/ml, 200 ⁇ l of phage lysate adjusted to 1.2 x 10 10 phagemid-containing particles/ml, and 100 ⁇ l of 250 mM IPTG. All injections were intraperitoneal, with bacteria and phage lysate administered in the left abdomen, and IPTG in the right abdomen.
  • Peripheral blood from the tip of the tail was collected at 1, 3, and 5 h following injections and immediately plated, either neat or diluted in ice-cold LB, onto LB agar plates containing tetracycline (20 ⁇ g/ml). Unpaired t tests were performed using GraphPad Prism version 3.0a for Macintosh (GraphPad Software, San Diego California USA). 2. Results
  • inducible gef and chpBK expression plasmids Conditionally lethal genes associated with bacterial plasmids or the E. coli chromosome are neutralized by their cognate protein antidote or an antisense RNA that inhibits the translation of the toxin-encoding mRNA.
  • Translation of chromosomally-encoded ge/ is normally coupled to an overlapping reading frame, orf69, which in turn is negatively regulated by the transacting antisense RNA 50/(33). Annealing between sof and orf69 mRNA leads to the formation of a stem-loop structure that sequesters the ribosome binding site (RBS) of gef thereby preventing gef ' from being translated.
  • RBS ribosome binding site
  • ChpBK is a member of the proteic killer gene system and is neutralized by the chromosomally-encoded chpBI gene. In wild-type cells, ChpBK will have to overcome the presence of the neutralizing antidote protein ChpBI in order to function as a lethal agent. To ensure adequate, but controlled, expression of the lethal genes in E.
  • coli, gef and chpBK were cloned into a high copy-number plasmid and placed under the control of a Lacl/isopropyl- ⁇ -thio-galactopyranoside (IPTG)-regulated promoter (P UPRIP ).
  • IPTG Lacl/isopropyl- ⁇ -thio-galactopyranoside
  • P UPRIP Lacl/isopropyl- ⁇ -thio-galactopyranoside
  • the UPRIP promoter differs from conventional lac and tac promoters with respect to the position of the lad operator, which was placed between the consensus -35 and -10 E. coli promoter elements.
  • an adenine/thymine rich sequence derived from the ribosomal RNA rrnB promoter which has been shown to increase promoter activity (35), was placed upstream of the -35 hexamer.
  • ChpBK affects cell growth.
  • Phage delivery systems provide the opportunity to target, at a high frequency, specific bacterial cells.
  • an Ml 3 phagemid system was developed and used. The genes encoding Gef and ChpBK were cloned into a vector carrying the fl intergenic region, and male E. coli cells carrying this phagemid were infected with helper phage R408. Using this helper phage allowed the preferential packaging of phagemid DNA over helper phage DNA, resulting in lysates with a high percentage of particles containing only the lethal agent-phagemid (95%).
  • Colony-forming unit assays were performed to evaluate the effects of the phage- delivered lethal agents on the viability of E. coli ⁇ R2738 (Fig. 3).
  • Cells expressing the F pilus were incubated, in the presence of IPTG, with different phage lysates (MOI actua i of 3.6, ref. 19) for 30 min.
  • the fraction of surviving cells was determined following dilution and plating of the infected culture onto non-selective (LB) and selective (LB-Amp) plates containing 1 mM IPTG.
  • LB non-selective
  • LB-Amp selective LB-Amp
  • ERAPlacI cells were protected from the lethal action of pGef and pChpBK due to the presence of excess Lad, which effectively repressed the UPRIP promoter (Fig. 4).
  • phage delivery of the lethal agent lysates in the absence of inducer did not affect the viability of ERAPlacI.
  • the number of viable cells dropped 275- and 370-fold following exposure to pGef and pChpBK lysates, respectively.
  • mice Reduction of bacterial load following phage delivery of gef and chpBK in mice.
  • F pilus expressing strain E. coli ⁇ R2738
  • a 2 x 10 9 CFU dose of ER2738 caused death in only 1 out of 18 animals.
  • transient bacteremia provided the cyclophosphamide treated-mice were challenged with a single intraperitoneal (i.p.) dose of 1 x 10 CFU.
  • Phage titers in the blood were also determined at 3 h post-injection and ranged from 1 x 10 7 to 5 x 10 8 phagemid-containing particles per ml, showing that both bacteria and phage migrated readily from the injection site.
  • the group of mice receiving pGef or pChpBK lysate showed a 98% and 94% reduction in blood bacterial titers compared to the control pUPRIP group, respectively.
  • phage Ml 3 is cleared slowly from the circulation (plasma half-life of approximately 4 h in 129/ICR white mice) with the liver and spleen mainly responsible of M13 uptake (27).
  • M13 helper phage was found to be naturally long circulating in ICR mice, and no significant improvement in half-life was obtained by using serial passage methods designed to isolate mutants that resist sequestration (26).
  • phage delivery systems have immense potential in the management of bacterial infections in a medical and veterinary setting.
  • lethal agent delivery systems also have immense potential at the preharvest stage in the biocontrol of E. coli O157:H7 in animals and fresh foods (22) and could play a role in preventing transmission of fish pathogens (31).
  • the ability to clone and manipulate almost any given piece of DNA together with our present knowledge of phage genetics may make it possible to adapt this technology for a multitude of bacterial pathogens.
  • the gene encoding Doc was PCR amplified and cloned into the broad-host-range vector pBBR122 (MobiTec) under the control of the Lacl-regulated promoter LACweak ( Figure 6), thereby generating LACwDOCpBHR. Expression of the lethal agent was therefore repressed in the presence of the Lad protein but could be induced in the presence of IPTG.
  • the 7 intergenic region was then amplified by PCR from pBluescript II SK + and cloned in both directions into LACwDOCpBHR. The intergenic region contained all the sequences necessary for initiation and termination of viral DNA synthesis and for morphogenesis of bacteriophage particles.
  • the lethal agent phagemid Upon infection with M13 helper phage the lethal agent phagemid replicates by the phage-directed rolling circle mode and allows the resultant single-stranded DNA to be encapsulated as transducing particles.
  • the Ml 3 helper phage, R408, has a defective packaging signal causing the phagemid single-stranded DNA to be preferentially packaged into phage particles.
  • R408 does not contain a kanamycin resistance gene.
  • the transducing particles can be used to infect E. coli bacteria harboring a F episome resulting in activation of the death cascade.
  • the DOC-phagemid was transformed into E. coli ⁇ R2738 (#E4104S, New England Biolabs) carrying an antidote expressing plasmid (PHD-RV2, parent vector pACYC184). Transformants were grown to an early-exponential phase (OD600 of 0.1) in LB containing the appropriate antibiotics.
  • the helper phage R408 (#P2291, Promega) was added at a multiplicity of infection of 10. The infection was allowed to proceed for 6 hours at 37°C with vigorous aeration. The supernatant was collected and clarified by centrifugation; PEG precipitated and passed through a 0.2 ⁇ m filter.
  • the concentration of virus containing single-stranded copies of the lethal agent-phagemid was measured by infecting ER2738 and ER2738 (PHD-RV2) cells with dilutions of the lysate and plating the infected cells on LB agar containing the selectable marker, kanamycin (Table 1).
  • the yield of phagemid particles can be optimized since the yield can be affected by the structure and type of plasmid carried within the cell.
  • the factors known to affect the yield of phagemid particles include but are not limited to: (i) the site at which the intergenic region is inserted into the plasmid; (ii) the nature of the superinfecting bacteriophage, for example, wild-type or interference-resistance mutants; (iii) the size and nature of the foreign DNA cloned in the phagemid.
  • gef functions as a toxic protein in Escherichia coli, Pseudomonas putida and Pseudomonas aeruginosa.
  • Transformants were grown to early-exponential growth phase (OD600 of 0.1) in LB containing the appropriate antibiotics and helper phage R408 was added at a multiplicity of infection of 10. The infection was allowed to proceed for 6 hours at 37°C with strong agitation. The supernatant was collected and clarified by centrifugation, PEG precipitated and passed through a 0.2 ⁇ m filter. The concentration of virus containing single-stranded copies of the lethal agent-phagemid was measured by infecting ER2738 and ER2738 (APlacIpBHR) cells with dilutions of the lysate followed by plating the infected cells on LB agar containing ampicillin (Table 2).
  • the colony-forming unit (CFU) assay regarded as the "gold-standard” antimicrobial assay, was used to evaluate the effects of the phage delivered lethal agents on the killing of E. coli ⁇ R2738 ( Figures 2-4 and 8).
  • the conditionally lethal protein Gef has been shown by the LINE/DEAD R ⁇ cLight bacterial viability assay to be bactericidal to E. coli.
  • the mechanism of action of ChpBK is unknown, Gef is thought to function by generating a membrane pore.
  • filamentous phages are nonlytic D ⁇ A viruses, the reduction in colony forming units reflects cell death following expression of the lethal agents. Lethal agent mediated cell killing resulted in a significant reduction of viable cell counts.
  • helper phage M13K07 purchased from New England Biolabs and was passaged through mice three times in an attempt to select for slower clearance by the reticuloendothelial system (RES). For each passage, 1 x 10 9 phage were injected intraperitoneally, and phage remaining in circulation after 6, 24 or 48 hours were amplified for the next round, respectively. After the third round, two isolates (LI and R3) were cloned by limiting dilution and compared with wildtype M13K07 in new mice.
  • RES reticuloendothelial system
  • MOI is defined as the average number of viruses infecting each cell, calculated as the ratio of the number of infectious virus particles divided by the number of host cells.
  • an MOI of 10 is often used. This is based on the fact that the virus particles do not distribute exactly evenly among the cells, and it can be calculated that an MOI of 10 gives each cell a better than 99.99% chance of being bound and infected by at least one virus.
  • MOI actua ⁇ 10 is still more than sufficient.
  • the observant reader may notice that for extremely low cell numbers, one can get nearly 100% infection with MOI actua ⁇ noticeably smaller than 10.
  • e-MOI aclua ⁇ is a good approximation for the expected percentage of uninfected cells. Consequently, the old "rule" that an MOI of 10 is sufficient to ensure that nearly all of the cells are infected should remain true assuming that one now means MOI actua ⁇ of at least 10 and not MOI ⁇ nput .
  • MOI act (l -kct - YX - actuuaall — A - «e-- ⁇ ) yMir -OI lnput (equation 2)
  • MOI actua approaches MOI i ⁇ put. This is logical since when cell density is higher or more time is allowed for adsorption, more phage would be expected to bind. It is because MOIiagi put and MOL, ctua , are essentially the same at high cell densities, that the need for MOI act -ai may not have been previously apparent.
  • the breakpoint at which MOIi nput and MOI actl ⁇ a ⁇ diverge can be specifically defined by introducing the special concentration:
  • C is the lowest cell density at which MOI input is equal to MOI actua ⁇ for a given k and t.
  • the derivation of C is as follows. In general, it is possible that MOI actua ⁇ is significantly less than MOIbput- If this is the case then the ratio MOI actua ⁇ /MOI input would be significantly smaller than one. In contrast, we will say that the two are essentially equal if this ratio has a value greater than .9999. It is easily determined that this will be the case for any concentration C > C with
  • MOIi nput is equal to MOI actua ⁇ for practical purposes, and it is reasonable to assume that every phage added will bind to a cell within the adsorption period, t.
  • C is less than C, then MOI actua ⁇ is noticeably less than MOI ⁇ npurent and MOI aclua ⁇ should be used. Note that C is dependent on t, and decreases as t increases for a given phage-host system.
  • MOI ⁇ npurent will result in incorrect expectations of infection rates in any case where C is less than C, while using MOI aclua , in its place will provide an accurate means of estimating the infection rate at any cell density.
  • Figure 29B shows the same type of experiment performed with the phage M13K07. Again, predictions based on MOI actua ⁇ modeled actual results much more accurately than those based on MOI, tract put . Because of the very small k (3 x 10 "H cmVmin), and consequently the very large C for this phage, it was not practical to achieve cell densities at which MOI put and MOI actua ⁇ are essentially the same.
  • C for Ml 3 phage based on a k of 3 x 10 "11 (Tzagoloff and Pratt, 1964, Virology 24: 372-380) and time t of 30 min is 1 x 10 10 cells/ml.
  • C for PI phage based on a k of 2.3 x 10 "9 and time t of 30 min is 1.3 x 10 8 cells/ml. Therefore, the model predicts and the previous experiment confirmed that at any cell density lower than these concentrations, an MOIi npu , of 10 will be inadequate to achieve infection of 99.99% of cells. However, this does not necessarily imply that it is impossible to achieve universal infection at cell densities significantly lower than C .
  • Table B Predicted number of input phage sufficient for infection of 99.99% of cells according to cell density.
  • a replication threshold density has been reported to exist in all phage-host systems tested, such that progeny phage are not produced when host cell density is below 10 4 cells per ml.
  • the results provided herein suggest that phage infection and therefore replication would be expected to happen at any host cell density, provided that there are sufficient phage present to ensure that the cell or cells present come into contact with and productively bind at least one phage. Proving this at low host cell densities, however, presents a practical problem for detection since unbound input phage will outnumber progeny phage to such an extent that the progeny phage will not be detectable as an increase in titer. This is both because of the high input phage numbers required and the low number of host cells producing progeny phage.
  • This experiment was set up such that actively growing pBluescript carrying host cells were diluted in ten- fold increments and each dilution was mixed with 10 10 M13K07 phage, adequate to ensure infection of most of the cells even at 10 cfu/cm 3 or less (Table B). Blue colonies representing the output titer at each cell density after 60 min are plotted in Figure 31.
  • the experiment was performed twice in different host cell lines, and with slightly different phagemids, with very similar results. Most importantly, the straight lines evident on this log/log plot indicate that on average the same number of progeny phage are being produced per host cell regardless of the cell density. This observation is inconsistent with the existence of a replication threshold density.
  • the Pmm function the minimum number of phage needed to achieve a given infection rate for any cell density
  • P m i n will not be less than t/ for any cell concentration less than C .
  • Table B This correlation is illustrated in Table B, where it is evident that the number of phage needed to achieve an MOI actua ⁇ of 10 decreases very little with large decreases in cell density, approaching but not reaching MV / tk for each phage.
  • P m i n does increase for larger values of N approaching the amount needed to get a concentration of C, it does not increase by much.
  • P m j n at C is only 5.31 times higher than the observed lower bound.
  • starting phage concentrations in their experiments ranged from approximately 200 to 1100 pfu / ml in a volume of 50 mis for a total input phage population of 10,000 - 55,000 pfu. It can be easily derived from equation 3 that at cell densities less than 10 4 cells per ml, these initial conditions would result in an average of 0.7 to 4 phages binding cells within 30 minutes respectively (fraction of phage bound multiplied by number of input phage equals 0.00007207 x 10,000 or 55,000). This would result in insufficient progeny phage to be detected against the input phage population.
  • the pBluescript II KS+TM phagemid was purchased from Stratagene.
  • the pBlue-GFPuv phagemid was constructed by ligating the smaller EcoRI/Kpnl fragment of plasmid pGFPuvTM (Clonetech) into pBluescript II KS+TM, also digested with EcoRJ/Kpnl.
  • the pBlue-GFPuv phagemid was transformed into and maintained in NovaBlue (Novagen) host cells. Eschericia coli ER2738 and M13K07 helper phage were purchased from New England Biolabs (Beverly, MA).
  • ER2738 cells were grown in Luria Broth (LB) with 20 ⁇ g tetracycline / ml (Sigma) to maintain the F' episome. Both M13 phagemids were maintained and selected with 80 ⁇ g carbenicillin/ ml (Novagen). M13K07 phage lysates were made by infecting cells carrying either pBluescriptTM or pBlue-GFPuv with M13K07 according to standard methods (Sambrook, J., E. F. Fritsch, and T. Maniatus. 1989. Molecular cloning: A laboratory manual (2nd ed.) Cold Spring Harbor Press.) at an approximate MOI acWa ⁇ of 0.1 , except without kanamycin in the medium.
  • Lysates were cleared of cell debris by centrifugation and cleared of any remaining bacteria by 0.2 ⁇ m filtration, infectious phage titers were determined by plaque formation on ER2738 cells by the agar overlay technique. Transducing phage titers were determined by incubation of diluted lysates with log phase ER2738 cells that had been concentrated by centrifugation to approximately 10 9 cfu/ml. After 30 min incubation at 37°C, the entire mixture was plated on LB agar containing X-Gal, IPTG, and carbenicillin (80 ⁇ g/ml) , and incubated at 37°C until blue colonies could be quantitated (16-20 h).
  • Each phagemid delivery event produces a carbenicillin-resistant, blue colony or blue and GFP- positive colonyon this medium.
  • Ml 3 phage do not kill their host and therefore no immunity in the target cells is necessary (Salivar et al., 1964, Virology 24:359-371). Since the helper phage M13K07 packaged the phagemid pBluescript 500 times more efficiently than its own genome, the Ml 3 lysates contained 99.8% transducing phage.
  • X-Gal and IPTG were obtained from Gold Biotechnology and used at 1.7 ⁇ M and 330 ⁇ M, respectively. Serial dilutions of cells and phage were carried out in LB using aerosol barrier tips (Fisher Scientific). 2. PI phagemid system.
  • a PI phagemid was constructed with the pBBRl vector (MoBiTec, Duseldorf, Germany) which carries a kanamycin resistance gene for transfer detection, a broad host range origin of replication, and essential elements for PI packaging.
  • C600 E. coli host cells (Stratagene) susceptible to PI infection were transformed with this phagemid and then infected with the wildtype PI phage Pl-kc to produce a PI phage lysate containing approximately 90% infectious phage and 10% transducing phage carrying the phagemid. C600 ⁇ .
  • P1C600 cells coli lysogenized with the PI mutant, PlCmCl.100 (Rosner, 1972, Virology 48(3): 679-680) are referred to as P1C600 cells and are immune to infectious PI phage but are ready acceptors of PI -delivered phagemid.
  • P1C600 cells were grown in LB containing 17.5 ⁇ g chloramphenicol / ml to maintain the lysogen. Phagemid delivery into P1C600 cells results in a kanamycin and chloramphenicol-resistant colony when plated on 50 ug kanamycin and 17.5 ug chloramphenicol/ ml (Sigma). Dilutions of cells and phage lysate were performed in LB containing 10 mM MgSO 4 , 5 mM CaCl 2 , with aerosol barrier tips.
  • the model made fairly accurate predictions using these assumptions when bacteria and phage were injected by different routes, approximating treatment of an infection in which the bacteria have already spread in the body. Given the phage concentrations used, the percentage of cells transduced by the marker LADS vehicle was predicted to be small, and it was. When samples of tail blood were plated on IPTG-X-Gal plates, transduced bacteria were detected as blue colonies, non-transduced bacteria as white colonies ( Figure 11). Neutropenic (cyclophosphamide treated) mice were used because the bacteria remain in circulation longer in such mice.
  • mice After five minutes, three mice were injected at the same site with 5 xl0 9 tu Ml 3 phage carrying pBlueGFP phagemid, while three mice received control injections at the same site.
  • Tail blood was collected at one, three, five, and seven hours and plated on LB agar plates impregnated with IPTG and XGAL. The results from that experiment revealed that the total cells recovered from blood of the animals were remarkably similar irrespective of phage injection (Figure 15).
  • Concentration of LADS required for the treatment of a localized infection is a concentrated concentration of LADS required for the treatment of a localized infection.
  • a localized infection is only different from a systemic infection because it is presumed to take place in a smaller volume. Therefore, in order to apply the mathematical model to such a situation, an estimate of the volume of the localized infection, such as an abscess, is used.
  • bacteria were injected IP followed by IP phage within five minutes, before the bacteria could disperse in the mouse.
  • LADS carrying the marker phagemid pBlue-GFP excellent levels of transduction were achieved in vivo in this manner, based on the transduction status of bacteria recovered from tail blood at various times post injection (Figure 16). Since such high levels of transduction were achieved in this way, it was this methodology, approximating a localized infection that was carried through in additional experiments.
  • mice were injected with either 0.1 ml saline, 250mM IPTG or 25mM IPTG, followed 30 minutes later by bacteria containing the phagemid encoding ChpBK.
  • Tail blood was collected 1, 2, and 3 hours after injection of the bacteria, and plated for viable counts on plain LB agar. The results showed that lethal genes were induced in vivo (in mice) with EPTG, so testing of M13-based LADS in animals could proceed (Table 4).
  • the MOI model provided herein can be used for topical infections in that topical infections are systemic infections within a defined surface volume. Using the same assumptions associated with bacterial and phage distribution made for a systemic infection, here too in a topical infection, the model holds by using an estimate that a gram of live weight is equivalent to the surface volume of the infection whereupon at a first approximation one milliliter of surface volume is equivalent to one milliliter of volume of a systemic infection in the body of the host. The principal difference between a systemic infection and topical infection then is in the manner by which the therapeutic is introduced.
  • the material is introduced in an appropriate hydrophilic vehicle in order to preserve the Brownian distribution of the LADS vehicle once it comes in contact with the topical lesion.
  • the LADS vehicle can act similarly to the data obtained in the systemic presentation.
  • an x-ray, computer aided tomography (CAT) scan, and/or Magnetic Resonance instrument (MRI) scan of the infected surface can be used.
  • the infected volume can be computed using software associated with the diagnostic equipment.
  • the model can be applied in order to determine the concentration of LADS vehicles required to effectively treat the infection.
  • another value used for the effective treatment of an infection in the equation is the value of P mm -
  • an assumption of least one microorganism per cubic milliliter can be assigned to P m ⁇ n to insure that a sufficient number of LADS particles will be present in the preparation in order to sufficiently target and deliver the appropriate genetic therapeutic to each of the microorganisms within the defined area.
  • Ml 3 phage were found to be remarkably stable and persistent in the circulation of mice. Three passages through mice did not significantly increase the half-life of M13KO7 phage in vivo ( Figure 9). Wild-type M13KO7 phage were apparently much more resistant to clearing by the reticuloendothelial system than wild-type PI or even a long circulating version of PI phage. In fact, it seems likely that the decline in phage numbers after 50 hours of relatively stable numbers in circulation most likely represents a decrease in phage viability from proteolysis rather than clearing. In summary, M13-based LADS will persist in circulation at almost the same concentration from 1-48 hours post-injection, with a slightly higher peak between 1 and 24h.
  • mice pretreatment of mice with cyclophosphamide did improve the model of non-lethal bacteremia by reducing clearing and thereby stabilizing the concentration of bacteria in the blood (Figure 17).
  • Escherichia coli infections in mice using phage its general superiority over antibiotics.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des procédés et des matériaux permettant d'administrer un acide nucléique à des bactéries. Plus particulièrement, cette invention concerne un bactériophage génétiquement modifié ainsi que l'utilisation d'un tel bactériophage pour administrer un acide nucléique (par exemple, un acide nucléique codant pour des antigènes ou des agents antimicrobiens) à des bactéries. Cette invention concerne également des procédés et des matériaux permettant de déterminer le nombre de particules infectieuses nécessaires pour infecter des cellules. Par exemple, la présente invention concerne des procédés pouvant être utilisés pour déterminer un nombre minimum de virus nécessaire pour infecter 99% des cellules d'une population de cellules.
PCT/US2003/006941 2002-03-06 2003-03-06 Bacteriophage genetiquement modifie et utilisation d'un tel bacteriophage pour administrer un acide nucleique a des bacteries WO2003076583A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003220072A AU2003220072A1 (en) 2002-03-06 2003-03-06 Genetically engineered phage and the use of genetically engineered phage to deliver nucleic acid to bacteria

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US36240902P 2002-03-06 2002-03-06
US60/362,409 2002-03-06
US37289202P 2002-04-15 2002-04-15
US60/372,892 2002-04-15
US43317802P 2002-12-13 2002-12-13
US60/433,178 2002-12-13

Publications (2)

Publication Number Publication Date
WO2003076583A2 true WO2003076583A2 (fr) 2003-09-18
WO2003076583A3 WO2003076583A3 (fr) 2004-02-12

Family

ID=27808633

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/006941 WO2003076583A2 (fr) 2002-03-06 2003-03-06 Bacteriophage genetiquement modifie et utilisation d'un tel bacteriophage pour administrer un acide nucleique a des bacteries

Country Status (2)

Country Link
AU (1) AU2003220072A1 (fr)
WO (1) WO2003076583A2 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011080505A3 (fr) * 2009-12-28 2011-08-25 Bigdna Ltd Procédé de culture de phage pour un usage commercial
WO2016055587A1 (fr) * 2014-10-08 2016-04-14 Phico Therapeutics Ltd Modification de bactériophage à l'aide de bêta-galactosidase en tant que marqueur sélectionnable
US9676641B2 (en) 2014-01-29 2017-06-13 Synphagen Llc Therapeutic phages and methods for delivery of nucleic acids for therapeutic uses
WO2017114979A1 (fr) * 2016-01-03 2017-07-06 Glaxosmithkline Biologicals S.A. Composition immunogène
US10953052B2 (en) 2014-10-08 2021-03-23 Phico Therapeutics Ltd Modifying bacteriophage
US11236306B2 (en) 2014-10-08 2022-02-01 Phico Therapeutics Ltd Multiple host range bacteriophage with different tail fibres
US11492601B2 (en) 2014-10-08 2022-11-08 Phico Therapeutics Ltd. Multiple host range bacteriophage with hybrid tail fibres

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5688501A (en) * 1994-04-05 1997-11-18 Exponential Biotherapies, Inc. Antibacterial therapy with bacteriophage genotypically modified to delay inactivation by the host defense system

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5688501A (en) * 1994-04-05 1997-11-18 Exponential Biotherapies, Inc. Antibacterial therapy with bacteriophage genotypically modified to delay inactivation by the host defense system

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011080505A3 (fr) * 2009-12-28 2011-08-25 Bigdna Ltd Procédé de culture de phage pour un usage commercial
US9676641B2 (en) 2014-01-29 2017-06-13 Synphagen Llc Therapeutic phages and methods for delivery of nucleic acids for therapeutic uses
US10351452B2 (en) 2014-01-29 2019-07-16 Synphagen Llc Compositions for in vivo expression of therapeutic sequences in the microbiome
WO2016055587A1 (fr) * 2014-10-08 2016-04-14 Phico Therapeutics Ltd Modification de bactériophage à l'aide de bêta-galactosidase en tant que marqueur sélectionnable
US10953052B2 (en) 2014-10-08 2021-03-23 Phico Therapeutics Ltd Modifying bacteriophage
US11236306B2 (en) 2014-10-08 2022-02-01 Phico Therapeutics Ltd Multiple host range bacteriophage with different tail fibres
US11492601B2 (en) 2014-10-08 2022-11-08 Phico Therapeutics Ltd. Multiple host range bacteriophage with hybrid tail fibres
WO2017114979A1 (fr) * 2016-01-03 2017-07-06 Glaxosmithkline Biologicals S.A. Composition immunogène
CN108472391A (zh) * 2016-01-03 2018-08-31 葛兰素史密丝克莱恩生物有限公司 免疫原性组合物
JP2019500049A (ja) * 2016-01-03 2019-01-10 グラクソスミスクライン バイオロジカルズ ソシエテ アノニム 免疫原性組成物
JP2021112202A (ja) * 2016-01-03 2021-08-05 グラクソスミスクライン バイオロジカルズ ソシエテ アノニム 免疫原性組成物
US11998579B2 (en) 2016-01-03 2024-06-04 Glaxosmithkline Biologicals Sa Immunogenic composition

Also Published As

Publication number Publication date
AU2003220072A8 (en) 2003-09-22
AU2003220072A1 (en) 2003-09-22
WO2003076583A3 (fr) 2004-02-12

Similar Documents

Publication Publication Date Title
AU699322B2 (en) Antibacterial therapy with genotypically modified bacteriophage
Secor et al. Pf bacteriophage and their impact on Pseudomonas virulence, mammalian immunity, and chronic infections
Westwater et al. Use of genetically engineered phage to deliver antimicrobial agents to bacteria: an alternative therapy for treatment of bacterial infections
Wang et al. Use of bacteriophage in the treatment of experimental animal bacteremia from imipenem-resistant Pseudomonas aeruginosa
JP5127708B2 (ja) バクテリオファージ及びその使用
KR100943041B1 (ko) 시포비리대에 속하는 박테리오파지 및 이를 포함하는 세균사멸용 조성물
WO1995027043A9 (fr) Therapie anti-bacterienne a l'aide de bacteriophages genotypiquement modifies
US11975060B2 (en) Controlled release vaccines and methods of treating Brucella diseases and disorders
JP2019510052A5 (fr)
JP6908593B2 (ja) 送達ビークル
Yang et al. Antibiofilm activities of a novel chimeolysin against Streptococcus mutans under physiological and cariogenic conditions
US20070248573A1 (en) Chimeric Bacteriophages, Chimeric Phage-Like Particles, and Chimeric Phage Ghost Particles, Methods for Their Production and Use
CA2872694C (fr) Bacteriophage pour la lutte biologique contre salmonella et dans la fabrication ou le traitement d'aliments
WO2023096766A1 (fr) Méthodes de blocage d'une infection asfv par interruption d'interactions de récepteurs cellulaires et viraux
WO2003076583A2 (fr) Bacteriophage genetiquement modifie et utilisation d'un tel bacteriophage pour administrer un acide nucleique a des bacteries
Hu et al. Immersion immunization of koi (Cyprinus carpio) against cyprinid herpesvirus 3 (CyHV-3) with carbon nanotube-loaded DNA vaccine
US20160310549A1 (en) Reducing conjugative plasmids in bacteria
Hao et al. Recombinant surface display vaccine enhances the immersion immune effect against grass carp reovirus in grass carp (Ctenopharyngodon idella)
CA2504331A1 (fr) Bacteriophages a holine modifiee et leurs utilisations
Shimodori et al. Morphological features of a filamentous phage of Vibrio cholerae O139 Bengal
Attama et al. Bacteriophage: Clinical Applications
Hossain Molecular Interactions between phage and the catfish pathogen Edwardsiella ictaluri and Comparative Genomics of Epidemic strains of Aeromonas hydrophila
WO2024118959A1 (fr) Méthodes de blocage/neutralisation d'une infection à asfv par interruption d'interactions de récepteurs cellulaires et viraux
Erdem et al. PHAGE THERAPY: AN ALTERNATIVE TREATMENT OPTION FOR MULTI-DRUG RESISTANT KLEBSIELLA PNEUMONIAE STRAINS
DE10326189A1 (de) Bakterielle Träger für Nukleotidsequenzen kodierend für Wirkstoffe

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP