WO2003060129A1 - Regulation d'enzyme de liaison amp du type coa ligase d'acides gras humains - Google Patents

Regulation d'enzyme de liaison amp du type coa ligase d'acides gras humains Download PDF

Info

Publication number
WO2003060129A1
WO2003060129A1 PCT/EP2003/000314 EP0300314W WO03060129A1 WO 2003060129 A1 WO2003060129 A1 WO 2003060129A1 EP 0300314 W EP0300314 W EP 0300314W WO 03060129 A1 WO03060129 A1 WO 03060129A1
Authority
WO
WIPO (PCT)
Prior art keywords
fatty acid
coa ligase
binding enzyme
acid coa
polynucleotide
Prior art date
Application number
PCT/EP2003/000314
Other languages
English (en)
Inventor
Zhimin Zhu
Original Assignee
Bayer Healthcare Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Healthcare Ag filed Critical Bayer Healthcare Ag
Priority to AU2003235632A priority Critical patent/AU2003235632A1/en
Publication of WO2003060129A1 publication Critical patent/WO2003060129A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)

Definitions

  • the invention relates to the regulation of human fatty acid CoA ligase-like AMP- binding enzyme.
  • Fatty acid CoA ligase enzymes catalyze the activation of short- and medium-chain fatty acids and xenobiotic carboxylic acids.
  • Vessey & Hu J. Biochem. Toxicol. 10, 329-37, 1995; Vessey et al., J. Biochem. Toxicol. 11, 73-78, 1996; Vessey & Kelley, Biochim. Biophys. Ada 1346, 231-36, 1997; Vessey et ah, J. Biochem. Mol. Toxicol. 12, 151-55, 1998; Vessey & Kelley, Biochim. Biophys. Ada 1382, 243-48, 1998;
  • One embodiment of the invention is a fatty acid CoA ligase-like AMP-binding enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2;
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 4;
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 6;
  • Yet another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a fatty acid CoA ligase-like AMP-binding enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2;
  • amino acid sequence shown in SEQ ID NO: 2 v. amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 4;
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 6;
  • Binding between the test compound and the fatty acid CoA ligase-like AMP-binding enzyme polypeptide is detected.
  • a test compound which binds to the fatty acid CoA ligase-like AMP-binding enzyme polypeptide is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • the agent can work by de- creasing the activity of the fatty acid CoA ligase-like AMP-binding enzyme.
  • Another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a polynucleotide encoding a fatty acid CoA ligase-like AMP-binding enzyme polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1 ;
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 3 ;
  • nucleotide sequence shown in SEQ ID NO: 3 nucleotide sequences which are at least about 50% ⁇ identical to the nucleotide sequence shown in SEQ ID NO: 5;
  • nucleotide sequences which are at least about. 50% identical to the nucleotide sequence shown in SEQ ID NO: 7;
  • Binding of the test compound to the polynucleotide is detected.
  • a test compound which binds to the polynucleotide is identified as a potential agent for decreasing extracellular matrix degradation.
  • the agent can work by decreasing the amount of the fatty acid CoA ligase-like AMP-binding enzyme through interacting with the fatty acid CoA ligase-like AMP-binding enzyme mRNA.
  • Another embodiment of the invention is a method of screening for agents which regulate extracellular matrix degradation.
  • a test compound is contacted with a fatty acid CoA ligase-like AMP-binding enzyme polypeptide comprising an amino acid sequence selected from the group consisting of:
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2;
  • amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 4;
  • amino acid sequence shown in SEQ ID NO: 4 amino acid sequences which are at least about 50%> identical to the amino acid sequence shown in SEQ ID NO: 6; and
  • a fatty acid CoA ligase-like AMP-binding enzyme activity of the polypeptide is detected.
  • a test compound which increases fatty acid CoA ligase-like AMP-binding enzyme activity of the polypeptide relative to fatty acid CoA ligase-like AMP-bind- ing enzyme activity in the absence of the test compound is thereby identified as a potential agent for increasing extracellular matrix degradation.
  • a test compound which decreases fatty acid CoA ligase-like AMP-binding enzyme activity of the polypeptide relative to fatty acid CoA ligase-like AMP-binding enzyme activity in the absence of the test compound is thereby identified as a potential agent for de- creasing extracellular matrix degradation.
  • Even another embodiment of the invention is a method of screening for agents which decrease extracellular matrix degradation.
  • a test compound is contacted with a fatty acid CoA ligase-like AMP-binding enzyme product of a polynucleotide which com- prises a nucleotide sequence selected fro -the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ 3D NO: 1;
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 3;
  • nucleotide sequence shown in SEQ ID NO: 3 nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 5;
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 7;
  • Binding of the test compound to the fatty acid CoA ligase-like AMP-binding enzyme product is detected.
  • a test compound which binds to the fatty acid CoA ligase-like AMP-binding enzyme product is thereby identified as a potential agent for decreasing extracellular matrix degradation.
  • Still another embodiment of the invention is a method of reducing extracellular matrix degradation.
  • a cell is contacted with a reagent which specifically binds to a polynucleotide encoding a fatty acid CoA ligase-like AMP-binding enzyme polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1;
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 3;
  • nucleotide sequence shown in SEQ ID NO: 3 nucleotide sequences which are at least about 50%> identical to the nucleotide sequence shown in SEQ ID NO: 5;
  • nucleotide sequences which are at least about 50%> identical to the nucleotide sequence shown in SEQ ID NO: 7;
  • Fatty acid CoA ligase-like AMP-binding enzyme activity in the cell is thereby decreased.
  • the invention thus provides a human fatty acid CoA ligase-like AMP-binding en- zyme that can be used to identify test compounds that may act, for example, as activators or inhibitors at the enzyme's active site.
  • Human fatty acid CoA ligase-like AMP-binding enzyme and fragments thereof also are useful in raising specific antibodies that can block the enzyme and effectively reduce its activity.
  • the invention relates to an isolated polynucleotide from the group consisting of:
  • e a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a fatty acid CoA ligase-like AMP-binding enzyme polypeptide.
  • a novel fatty acid CoA ligase-like AMP-binding enzyme can be used in therapeutic methods to treat obesity, dia- betes, CNS disorders, cardiovascular disorders, gastrointestinal disorders, cancer and genitourinary disorders.
  • Human fatty acid CoA ligase-like AMP-binding enzyme comprises the amino acid sequence shown in SEQ ID NO:2, 4 or 6.
  • DNA sequence harboring the coding sequence (ORF) for the human fatty acid CoA ligase-like AMP- binding enzymes of SEQ JD NOs: 2 and 6 are shown in SEQ ID NO:l and 5, respec- tively.
  • SEQ ID NO:l is located on chromosome 10 (NT_008771.7, NT_024042.7).
  • the ORFs are shown in SEQ ID NO:3 and 7, respectively.
  • Related ESTs (BI520312; BG337394; BI040829; AL119948; AL120906; BF958233; BF304559; BM174932; W26035; AA995279; BF726674; BE783710; BF766213; BG981205) are expressed in medulla, uterine tumor, normal brain, brain tumor, amygdala, melanoma, rhabdo- myosarcoma, kidney tumor, retina, lens, colon, and colon tumor.
  • the sequences are shown in SEQ ID NO.8 to 24.
  • Human fatty acid CoA ligase-like AMP-binding enzyme also can be used to screen for human fatty acid CoA ligase-like AMP-binding enzyme activators and inhibitors.
  • Human fatty acid CoA ligase-like AMP-binding enzyme polypeptides comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 400, 500, 750, 1000, 1250, or 1449 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO:2 or at least 6, 10, 15, 20, 25,
  • a fatty acid CoA ligase-like AMP-binding enzyme polypeptide of the invention therefore can be a portion of a fatty acid CoA ligase-like AMP-binding enzyme protein, a full-length fatty acid CoA ligase-like AMP-binding enzyme protein, or a fusion protein comprising all or a portion of a fatty acid CoA ligase-like AMP-binding enzyme protein.
  • Human fatty acid CoA ligase-like AMP-binding enzyme polypeptide variants which are biologically active, e.g., retain an enzymatic activity, also are human fatty acid
  • CoA ligase-like AMP-binding enzyme polypeptides Preferably, naturally or non-naturally occurring human fatty acid CoA ligase-like AMP-binding enzyme polypeptide variants have amino acid sequences which are at least about 50, 55, 60, 65, or 70, preferably about 75, 80, 85, 90, 96, 97, 98, or 99% identical over its full length to the amino acid sequence shown in SEQ ID NO: 2, 4 or 6 or a fragment thereof. Percent identity between a putative human fatty acid CoA ligase-like AMP- binding enzyme polypeptide variant and an amino acid sequence of SEQ ID NO:2, 4 or 6 is determined by conventional methods. See, for example, Altschul et al., Bull. Math.
  • the "FASTA" similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant.
  • the FASTA algorithm is described by Pearson & Lipman, Proc. Nat'lAcad. Sci. USA 55:2444(1988), and by Pearson, Meth. Enzymol. 183:63 (1990).
  • the trimmed initial regions are examined to determine whether the regions can be joined to form an ap- proximate alignment with gaps.
  • the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch- Sellers algorithm (Needleman & Wunsch, J. Mol. Biol.48:444 (1970); Sellers, SIAMJ. Appl. Math.26:lSl (1974)), which allows for amino acid insertions and deletions.
  • FASTA can also be used to determine the sequence identity of nucleic acid mole- cules using a ratio as disclosed above.
  • the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
  • Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
  • Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid insertions or deletions are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a human fatty acid CoA ligase-like AMP- binding enzyme polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
  • the invention additionally, encompasses fatty acid CoA ligase-like AMP-binding enzyme polypeptides that are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc.
  • Additional post-translational modifications encompassed by the invention include, : for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression.
  • the fatty acid CoA ligase-like AMP-binding enzyme polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • the invention also provides chemically modified derivatives of fatty acid CoA ligase-like AMP-binding enzyme polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337).
  • the chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol, and the like.
  • the polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
  • Fusion protein Fusion proteins are useful for generating antibodies against fatty acid CoA ligase-like AMP-binding enzyme polypeptide amino acid sequences and for use in various assay systems.
  • fusion proteins can be used to identify proteins that interact with portions of a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide.
  • Protein affinity chromatography or library-based assays for protein-protein interactions such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
  • a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
  • the first polypeptide segment comprises at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 400, 500, 750, 1000, 1250, or 1449 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO:2 or at least 6, 10,
  • the first polypeptide segment also can comprise full-length fatty acid CoA ligase-like AMP-binding enzyme protein.
  • the second polypeptide segment can be a full-length protein or a protein fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • GFP green fluorescent protein
  • BFP blue fluorescent protein
  • GST glutathione-S-transferase
  • luciferase luciferase
  • HRRP horseradish peroxidase
  • CAT chloramphenicol acetyltransferase
  • epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
  • fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions.
  • MBP maltose binding protein
  • S-tag S-tag
  • GAL4 DNA binding domain fusions GAL4 DNA binding domain fusions
  • HSV herpes simplex virus
  • a fusion protein also can be engineered to contain a cleavage site located between the fatty acid CoA ligase-like AMP-binding enzyme polypeptide-encoding sequence and the heterologous protein sequence, so that the fatty acid CoA ligase-like AMP-binding enzyme polypeptide can be cleaved and purified away from the heterologous moiety.
  • a fusion protein can be synthesized chemically, as is known, in the art.
  • a fusion protei is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
  • Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises coding sequences selected from SEQ ID NO:l or 5 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
  • kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).
  • Species homologs of human fatty acid CoA ligase-like AMP-binding enzyme polypeptide can be obtained using fatty acid CoA ligase-like AMP-binding enzyme poly- peptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of fatty acid CoA ligase-like AMP-binding enzyme polypeptide, and expressing the cDNAs as is known in the art.
  • a human fatty acid CoA ligase-like AMP-binding enzyme polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a fatty acid CoA ligase-like AMP-binding enzyme polypeptide.
  • a coding sequence for human fatty acid CoA ligase-like AMP-binding enzyme is . shown in SEQ ID NO:3 and 7.
  • nucleotide sequences encoding human fatty acid CoA ligase-like AMP- binding enzyme polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO:l, 3, 5 or 7 or their complements also are fatty acid CoA ligase-like AMP-binding enzyme polynucleotides.
  • Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
  • Complementary DNA (cDNA) molecules, species homologs, and variants of fatty r ⁇ J acid CoA ligase-hke AMP-binding enzyme polynucleotides that encode biologically active fatty acid CoA ligase-like AMP-binding enzyme polypeptides also are fatty acid CoA ligase-like AMP-binding enzyme polynucleotides.
  • Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO:l, 3, 5 or 7 or their complements also are fatty acid CoA ligase-like
  • AMP-binding enzyme polynucleotides These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides.
  • Variants and homologs of the fatty acid CoA ligase-like AMP-binding enzyme polynucleotides described above also are fatty acid CoA ligase-like AMP-binding enzyme polynucleotides.
  • homologous fatty acid CoA ligase-like AMP-binding enzyme polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known fatty acid CoA ligase-like AMP-binding enzyme polynucleotides under stringent conditions, as is known in the art.
  • Species homologs of the fatty acid CoA ligase-like AMP-binding enzyme polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
  • Human variants of fatty acid CoA ligase-like AMP-binding enzyme polynucleotides can be identified, for example, by screemng human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1- 1.5°C with every 1% decrease in homology (Bonner et ah, J. Mol. Biol. 81, 123 (1973).
  • Variants of human fatty acid CoA ligase-like AMP-binding enzyme polynucleotides or fatty acid CoA ligase-like AMP-binding enzyme polynucleotides of other species can therefore be identified by hybridizing a putative homologous' fatty acid CoA ligase-like AMP-binding enzyme polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:l, 3, 5 or 7 or the complement thereof to form a test hybrid.
  • the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
  • Nucleotide sequences which hybridize to fatty acid CoA ligase-like AMP-binding enzyme polynucleotides or their complements following stringent hybridization and/or wash conditions also are fatty acid CoA ligase-like AMP-binding enzyme polynucleotides " .
  • Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al., MOLECULAR CLO NG: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
  • a combination of temperature and salt concentration should be chosen that is approximately 12-20°C below the calculated T m of the hybrid under study.
  • T m of a hybrid between a fatty acid CoA ligase-like AMP-binding enzyme polynucleotide having a nucleotide sequence shown in SEQ ID NO:l, 3, 5 or 7 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
  • Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C.
  • Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
  • a human fatty acid CoA ligase-like AMP-binding enzyme polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such tech- nique for obtaining a polynucleotide can be used to obtain isolated fatty acid CoA ligase-like AMP-binding enzyme polynucleotides.
  • restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise fatty acid CoA ligase-like AMP-binding enzyme nucleotide sequences. Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% o free of other molecules.
  • Human fatty acid CoA ligase-like AMP-binding enzyme cDNA molecules can be * made with standard molecular biology techniques, using fatty acid CoA ligase-like AMP-binding enzyme mRNA as a template.
  • Human fatty acid CoA ligase-like AMP-binding enzyme cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989).
  • An amplification technique such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
  • CoA ligase-like AMP-binding enzyme polynucleotides The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide having, for example, an amino acid sequence shown in SEQ ID NO:2, 4 or 6 or a biologically active variant thereof.
  • PCR-based methods can be used to extend the nucleic acid sequences dis- closed herein to detect upstream sequences such as promoters and regulatory elements.
  • restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus. Sarkar, PCR Methods Applic. 2, 318-322, 1993; Triglia et al., Nucleic Acids Res. 16, 8186, 1988; Lagersrrom et al., PCR Methods Applic. 1, 111-119, 1991; Parker et al., Nucleic Acids Res. 19, 3055-3060, 1991).
  • PCR, nested primers, and PROMOTERFINDER libraries are examples of the nucleic acid sequences dis- closed herein to detect upstream sequences such as promoters and regulatory elements.
  • restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus. Sarkar, PCR Methods Applic. 2, 318-322, 1993; Triglia et al., Nucleic Acids Res. 16, 8
  • Human fatty acid CoA ligase-like AMP-binding enzyme polypeptides can be obtained, for example, by purification from human cells, by expression of fatty acid CoA ligase-like AMP-binding enzyme polynucleotides, or by direct chemical synthesis.
  • Human fatty acid CoA ligase-like AMP-binding enzyme polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with fatty acid CoA ligase-like AMP-binding enzyme polynucleotides.
  • a purified fatty acid CoA ligase-like AMP-binding enzyme polypeptide is separated from other compounds that normally associate with the fatty acid CoA ligase-like AMP-binding enzyme polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractiona- tion, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
  • a preparation of purified fatty acid CoA ligase-like AMP-binding enzyme polypep- tides is at least 80%> pure; preferably, the preparations are 90%, 95%, or 99% pure.
  • Purity of the preparations can be assessed by any means known ' in the art, such as SDS-polyacrylamide gel electrophoresis.
  • the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding fatty acid CoA ligase-like AMP- binding enzyme polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
  • a variety of expression vector/host systems can be utilized to contain and express sequences encoding a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cos id DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems. See WO 01/98340.
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed fatty acid CoA ligase-like AMP-binding enzyme polypeptide in the desired fashion.
  • modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
  • Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa,
  • MDCK, HEK293, and WI38 are available from the American Type Culture Collec-
  • host cells which contain a human fatty acid CoA ligase-like AMP- binding enzyme polynucleotide and which express a human fatty acid CoA ligase- like AMP-binding enzyme polypeptide can be identified by a variety of procedures known to those of skill in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioi munoassay (RIA), and fluorescence activated cell sorting
  • Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding fatty acid CoA ligase-like AMP-binding enzyme polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
  • sequences encoding a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide can be cloned into a vector for the production of an mRNA probe.
  • RNA probes are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6.
  • RNA polymerase such as T7, T3, or SP6.
  • reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofac- tors, inhibitors, magnetic particles, and the like.
  • Host cells transformed with nucleotide sequences encoding a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide can be cultured under conditions suit- able for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained mtracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode fatty acid CoA ⁇ ligase-like AMP-binding enzyme polypeptides can be designed to contain signal sequences which direct secretion of soluble fatty acid CoA ligase-like AMP-binding enzyme polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound fatty acid CoA ligase-like AMP- binding enzyme polypeptide. See WO 01/98340.
  • Sequences encoding a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232, 1980).
  • a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem, Soc.
  • Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
  • fragments of fatty acid CoA ligase-like AMP-binding enzyme polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule. See WO 01/98340.
  • codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable proper- ties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter fatty acid CoA ligase-like AMP-binding enzyme poly- peptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
  • site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
  • Any type of antibody known in the art can be generated to bind specifically to an epitope of a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide.
  • Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide.
  • Fab fragment antigen binding protein
  • F(ab') 2 fragment antigen binding protein
  • Fv fragment antigen binding protein binding protein binding protein binding protein binding protein sequence.
  • epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
  • An antibody which specifically binds to an epitope of a human fatty acid CoA ligase- like AMP-binding enzyme polypeptide can be used therapeutically, as well as in im- munochemical assays, such as Western blots, ELISAs, radioi munoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • im- munochemical assays such as Western blots, ELISAs, radioi munoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradi- ometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
  • an antibody that specifically binds to a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide provides a detection signal at least 5-, 10-, or 20- fold higher than a detection signal provided with other proteins when used in an im- munochemical assay.
  • antibodies that specifically bind to fatty acid CoA ligase-like AMP-binding enzyme polypeptides do not detect other proteins in immu- nochemical assays and can immunoprecipitate a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide from solution. See WO 01/98340.
  • Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of fatty acid CoA ligase-like AMP- binding enzyme gene products in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphos- phonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkyl- phosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, car- boxymethyl esters, carbonates, and phosphate triesters.
  • Modifications of fatty acid CoA ligase-like AMP-binding enzyme gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the fatty acid CoA ligase-like AMP-binding enzyme gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology.
  • Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al, in Huber & Carr, MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y., 1994).
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes. See WO 01/98340.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
  • ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
  • Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a human fatty acid CoA ligase-like AMP-binding enzyme polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the fatty acid CoA ligase-like AMP-binding enzyme poly- nucleotide.
  • Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been devel- oped and described in the art (see Haseloff et al Nature 334, 585-591, 1988).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201). See WO
  • genes whose products interact with human fatty acid CoA ligase-like AMP-binding enzyme may represent genes that are differentially expressed in disorders including, but not limited to, obesity, diabetes, CNS disorders, cardiovascular disorders, gastrointestinal disorders, cancer, and genitourinary disorders. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human fatty acid CoA ligase-like AMP-binding enzyme gene or gene product may itself be tested for differential expression.
  • the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
  • standard characterization techniques such as differential display techniques.
  • Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
  • RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS ⁇ N MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single- step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
  • Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl.
  • the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human fatty acid CoA ligase-like AMP-binding enzyme.
  • treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human fatty acid CoA li- gase-like AMP-binding enzyme.
  • the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human fatty acid CoA ligase-like AMP-binding enzyme gene or gene product are up-regulated or down-regulated.
  • the invention provides assays for screening test compounds that bind to or modulate the activity of a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide ' or a human fatty acid CoA ligase-like AMP-binding enzyme polynucleotide.
  • a test compound preferably binds to a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide or polynucleotide. More preferably, a test compound decreases or increases enzymatic activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to fatty acid CoA ligase-like AMP-binding enzyme polypeptides or polynucleotides or to affect fatty acid CoA ligase-like AMP-binding enzyme activity or fatty acid CoA ligase-like AMP-binding enzyme gene expression using high throughput screening.
  • high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
  • the most widely established techniques utilize 96-well microtiter plates. The wehs of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
  • free format assays or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994).
  • the cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose.
  • the combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were par- 3/060129
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • the test compound is preferably a small molecule that binds to and occupies, for example, the active site of the fatty acid CoA ligase-like AMP- binding enzyme polypeptide, such that normal biological activity is prevented.
  • small molecules include, but are not limited to, small peptides or peptide-like molecules.
  • either the test compound or the fatty acid CoA ligase-like AMP- binding enzyme polypeptide can comprise a detectable label, such. as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • a detectable label such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • Detection of a test compound that is bound to the fatty acid CoA ligase-like AMP-binding enzyme polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
  • binding of a test compound to a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide can be determined without labeling either of the interactants.
  • a microphysiometer can be used to detect binding of a test compound with a human fatty acid .CoA ligase-like AMP-binding enzyme polypep- tide.
  • a microphysiometer e.g., CytosensorTM
  • a microphysiometer is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable poten- tiometric sensor (LAPS).
  • Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a human fatty acid CoA ligase- like AMP-binding enzyme polypeptide (McConnell et al, Science 257, 1906-1912, 1992).
  • Determining the ability of a test compound to bind to a human fatty acid CoA ligase- like AMP-binding enzyme polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5,
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • SPR surface plasmon resonance
  • a human fatty acid CoA ligase-like AMP- binding enzyme polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Barrel et al, BioTech- niques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct, polynucleotide 3/060129
  • encoding a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4).
  • a DNA sequence that encodes an unidentified protein (“prey” or “sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait” and the "prey” proteins are able to interact in vivo to form an protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity.
  • reporter gene e.g., LacZ
  • a reporter gene e.g., LacZ
  • Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the fatty acid CoA ligase-like AMP-binding enzyme polypeptide.
  • either the fatty acid CoA ligase-like AMP-binding enzyme polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
  • Suitable solid supports include, but are not limited to, glass or plastic'slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
  • any method known in the art can be used to attach the enzyme polypeptide (or polynucleotide) or test compound. to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reac- 3/060129
  • tants examples include microtiter plates, test tubes, and microcentri- fuge tubes.
  • the fatty acid CoA ligase-like AMP-binding enzyme polypeptide is a fusion protein comprising a domain that allows the fatty acid CoA ligase-like
  • AMP-binding enzyme polypeptide to be bound to a solid support.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed fatty acid CoA ligase-like AMP-binding . enzyme polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alter- natively, the complexes can be dissociated from the solid support before binding is determined.
  • a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide or polynucleotide
  • a test compound can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated fatty acid CoA ligase-like AMP-binding enzyme polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N- hydroxysuc- cinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • antibodies which specifically bind to a fatty acid CoA ligase-like AMP-binding enzyme polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the fatty acid CoA ligase-like AMP-binding enzyme polypeptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to the fatty acid CoA ligase-like AMP-binding en- zyme polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the fatty acid CoA ligase-like AMP-binding enzyme polypeptide, and SDS gel electrophoresis under non-reducing conditions.
  • Screening for test compounds which bind to a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a fatty acid CoA ligase-like AMP-binding enzyme polypeptide or polynucleotide can be used in a cell-based assay system. A fatty acid CoA ligase-like AMP-binding enzyme polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a fatty acid CoA ligase-like AMP-binding enzyme polypeptide or polynucleotide is determined as described above.
  • Test compounds can be tested for the ability to increase or decrease the enzymatic activity of a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide. Enzymatic activity can be measured, for example, as described in Vessey et al, J. Biochem. Mol. Toxicol. 12, 151-55, 1998.
  • Enzyme assays can be carried out after contacting either a purified fatty acid CoA ligase-like AMP-binding enzyme polypeptide, a cell membrane preparation, or an intact cell with a test compound.
  • a test compound that decreases enzymatic activity of a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing fatty acid CoA ligase-like AMP-binding enzyme activity.
  • a test compound which increases enzymatic activity of a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human fatty acid CoA ligase-like AMP-binding enzyme activity.
  • test compounds that increase or decrease fatty acid CoA ligase-like AMP-binding enzyme gene expression are identified.
  • a fatty acid CoA ligase-like AMP-binding enzyme polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the fatty acid CoA ligase- like AMP-binding enzyme polynucleotide is determined.
  • the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test com- pound.
  • the test compound can then be identified as a modulator of expression based on this comparison..
  • test compound when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression.
  • test compound when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
  • the level of fatty acid CoA ligase-like AMP-binding enzyme mRNA or polypeptide expression in the cells can be determined by methods well known in the art for de- tecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a human fatty acid CoA ligase-like AMP-binding enzyme polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as ra- dioimmunoassay, Western blotting, and immunohistochemistry.
  • poly- peptide synthesis can be determined in vivo, in a cell culture, or in an in vitro transla- tion system by detecting incorporation of labeled amino acids into a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide.
  • Such screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell that expresses a human fatty acid CoA ligase-like AMP-binding enzyme polynucleotide can be used in a cell-based assay system.
  • the fatty acid CoA ligase-like AMP-binding enzyme polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
  • compositions of the invention can comprise, for example, a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide, fatty acid CoA ligase-like AMP-binding enzyme polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a fatty acid CoA ligase-like AMP-binding enzyme polypeptide, or mimetics, activators, or inhibitors of a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide activity.
  • compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • agent such as stabilizing compound
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mamiitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypro- pylmethyl-cellulose ⁇ or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, car- bopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, car- bopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
  • Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Non-lipid polycationic amino polymers also can be used for delivery.
  • the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aque- ous or other protonic solvents than are the corresponding free base forms.
  • the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
  • compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
  • Human fatty acid CoA ligase-like AMP-binding enzyme can be regulated to treat obesity, diabetes, CNS disorders, cardiovascular disorders, gastrointestinal disorders, cancer, and genitourinary disorders.
  • Obesity and overweight are defined as an excess of body fat relative to lean body mass. An increase in caloric intake or a decrease in energy expenditure or both can bring about this imbalance leading to surplus energy being stored as fat. Obesity is associated with important medical morbidities and an increase in mortality. The causes of obesity are poorly understood and may be due to genetic factors, environmental factors or a combination of the two to cause a positive energy balance. In contrast, anorexia and cachexia are characterized by an imbalance in energy intake versus energy expenditure leading to a negative energy balance and weight loss.
  • Agents that either increase energy expenditure and/or decrease energy intake, absorption or storage would be useful for treating obesity, overweight, and associated comorbidities.
  • Agents that either increase energy intake and/or decrease energy expenditure or increase the amount of lean tissue would be useful for treating cachexia, anorexia and wasting disorders.
  • This gene, translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity, overweight, anorexia, cachexia, wasting disorders, appetite suppression, appetite enhancement, increases or decreases in satiety, modulation of body weight, and/or other eating disorders such as bulimia.
  • this gene translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity/overweight-associated comor- bidities including hypertension, type 2 diabetes, coronary artery disease, hyperlipidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hirsutism, stress incontinence, and depression.
  • obesity/overweight-associated comor- bidities including hypertension, type 2 diabetes, coronary artery disease, hyperlipidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hir
  • Diabetes mellitus is a common metabolic disorder characterized by an abnormal elevation in blood glucose, alterations in lipids and abnormalities (complications) in the cardiovascular system, eye, kidney and nervous system. Diabetes is divided into two separate diseases: type 1 diabetes (juvenile onset), which results from a loss of cells which make and secrete insulin, and type 2 diabetes (adult onset), which is caused by a defect in insulin secretion and a defect in insulin action.
  • type 1 diabetes juvenile onset
  • type 2 diabetes adult onset
  • Type I diabetes is initiated by an autoimmune reaction that attacks the insulin secreting cells (beta cells) in the pancreatic islets.
  • Agents that prevent this reaction from occurring or that stop the reaction before destruction of the beta cells has been accomplished are potential therapies for this disease.
  • Other agents that induce beta cell proliferation and regeneration also are potential therapies.
  • Type II diabetes is the most common of the two diabetic conditions (6% of the population).
  • the defect in insulin secretion is an important cause of the diabetic condition and results from an inability of the beta cell to properly detect and respond to rises in blood glucose levels with insulin release.
  • Therapies that increase the response by the beta cell to glucose would offer an important new treatment for this disease.
  • the defect in insulin action in Type II diabetic subjects is another target for therapeutic intervention.
  • Agents that increase the activity of the insulin receptor in muscle, liver, and fat will cause a decrease in blood glucose and a normalization of plasma lipids.
  • the receptor activity can be increased by agents that directly stimulate the receptor or that increase the intracellular signals from the receptor.
  • Other therapies can directly activate the cellular end process, i.e. glucose transport or various enzyme systems, to generate an insulin-like effect and therefore a produce beneficial outcome. Because overweight subjects have a greater susceptibility to Type II diabetes, any agent that reduces body weight is a possible therapy.
  • Type I and Type II diabetes can be treated with agents that mimic insulin action or that treat diabetic complications by reducing blood glucose levels.
  • agents that reduces new blood vessel growth can be used to treat the eye complica- - tions that develop in both diseases.
  • the novel human fatty acid CoA ligase like protein AMP-binding enzyme is highly expressed in the following brain tissues: cerebellum, cerebellum (left), cerebellum (right), Alzheimer cerebral cortex, corpus callosum, cerebral cortex, hippocampus, parietal lobe, frontal lobe, occipital lobe, precentral gyrus, temporal lobe, tonsilla cerebelli , fetal brain, vermis cerebelli, postcentral gyrus, cerebral peduncles, Alzheimer brain frontal lobe, brain, pons, spinal cord, neuroblastoma 1MR32 cells, neuroblastoma SH5Y cells, Alzheimer brain, thalamus, neuroblastoma SK-N-MC cells.
  • the expression in brain tissues and in particular the differential expression between diseased tissue Alzheimer cerebral cortex and healthy tissue cerebral cortex, between diseased tissue Alzheimer brain frontal lobe and healthy tissue frontal lobe, between diseased tissue Alzheimer brain and healthy tissue brain demonstrates that the novel human fatty acid CoA ligase like protein AMP-binding enzyme or mRNA can be used to diagnose nervous system diseases. Additionally, the activity of the novel human fatty acid CoA ligase like protein AMP-binding enzyme can be modulated to treat nervous system diseases.
  • Central and peripheral nervous system disorders also can be treated, such as primary and secondary disorders after brain injury, disorders of mood, anxiety disorders, disorders of thought and volition, disorders of sleep and wakefulness, diseases of the motor unit, such as neurogenic and myopathic disorders, neurodegenerative disorders such as Alzheimer's and Parkinson's disease, and processes of peripheral and chronic pain.
  • Pain that is associated with CNS disorders also can be treated. Pain which can be treated includes that associated with central nervous system disorders, such as multi- pie sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • central nervous system disorders such as multi- pie sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • Non-central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy (RSD), trigeminal neuralgiaradioculopathy, post-surgical pain, HIV/AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralgia. Pain associated with cancer and cancer treatment also can be treated, as can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania.
  • headache pain for example, migraine with aura, migraine without aura, and other migraine disorders
  • episodic and chronic tension-type headache tension-type like headache, cluster headache, and chronic par
  • the novel human fatty acid CoA ligase like protein AMP-binding enzyme is highly expressed in the following cardiovascular related tissues: heart ventricle (left), heart atrium (right), interventricular septum, pericardium, heart, heart atrium (left), fetal heart, coronary artery smooth muscle primary cells, aorta, HUVEC cells. Expression in the above mentioned tissues demonstrate that the novel human fatty acid CoA li- gase like protein AMP-binding enzyme or mRNA can be used to diagnose cardiovascular diseases. Additionally, the activity of the novel human fatty acid CoA ligase like protein AMP-binding enzyme can be modulated to treat cardiovascular diseases.
  • Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
  • Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high ⁇ output and low-output, acute and chronic, right-sided or left-sided, systolic or diastolic, independent of the underlying cause.
  • MI Myocardial infarction
  • Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which inadequate to meet the myocardial requirement for oxygen.
  • This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
  • Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of arrhythmias.
  • Vascular diseases include primary as well as all kinds of secondary arterial hypertension (renal, endocrine, neurogenic, others). The disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications.
  • Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
  • PAOD peripheral arterial occlusive disease
  • acute arterial thrombosis and embolism inflammatory vascular disorders
  • Raynaud's phenomenon Raynaud's phenomenon
  • venous disorders venous disorders.
  • the novel human fatty acid CoA ligase like protein AMP-binding enzyme is highly expressed in the following tissues of the gastrointestinal system: rectum, stomach tumor, stomach, ileum, esophagus, colon, small intestine, esophagus tumor, colon tumor, ileum tumor.
  • the expression in the above mentioned tissues and in particular the differential expression between diseased tissue ileum tumor and healthy tissue ileum demonstrates that the novel human fatty acid CoA ligase like protein AMP-binding enzyme or mRNA can be used to diagnose gastrointestinal disorders.
  • the activity of the novel human fatty acid CoA ligase like protein AMP-binding enzyme can be modulated to treat gastrointestinal disorders.
  • Gastrointestinal disorders comprise primary or secondary, acute or chronic diseases of the organs of the gastrointestinal tract which may be acquired or inherited, benign or malignant or metaplastic, and which may affect the organs of the gastrointestinal tract or the body as a whole. They include but are not limited to disorders of the esophagus, such as achalasia, vigoruos achalasia, dysphagia, cricopharyngeal incoor- dination, pre-esophageal dysphagia, diffuse esophageal spasm, globus sensation, Barrett's metaplasia, and gastroesophageal reflux.
  • disorders of the esophagus such as achalasia, vigoruos achalasia, dysphagia, cricopharyngeal incoor- dination, pre-esophageal dysphagia, diffuse esophageal spasm, globus sensation, Barrett's metaplasia, and gastroesophageal reflux.
  • stomachs include disorders of the stomach and duodenum, such as functional dyspepsia, inflammation of the gastric mucosa, gastritis, stress gastritis, chronic erosive gastritis, atrophy of gastric glands, metaplasia of gastric tissues, gastric ulcers, duodenal ulcers, and neoplasms of the stomach.
  • disorders of the stomach and duodenum such as functional dyspepsia, inflammation of the gastric mucosa, gastritis, stress gastritis, chronic erosive gastritis, atrophy of gastric glands, metaplasia of gastric tissues, gastric ulcers, duodenal ulcers, and neoplasms of the stomach.
  • Gastrointestinal disorders also include disorders of the pancreas, such as acute or chronic pancreatitis, insufficiency of the exocrinic or endocrinic tissues of the pancreas like steatorrhea, diabetes, neoplasms of the exocrine or endocrine pancreas (e.g., multiple endocrine neoplasia syndrome, ductal adenocarcinoma, cystade- nocarcinoma, islet cell tumors, insulinoma, gastrinoma, carcinoid tumors, and gluca- gonoma), Zollinger-E.llison syndrome, Vipoma syndrome, and malabsorption syndrome.
  • disorders of the pancreas such as acute or chronic pancreatitis, insufficiency of the exocrinic or endocrinic tissues of the pancreas like steatorrhea, diabetes, neoplasms of the exocrine or endocrine pancreas (e.g
  • Gastrointestinal disorders also include disorders of the bowel, such as chronic inflammatory diseases of the bowel, Crohn's disease, ileus, diarrhea and constipation, colonic inertia, megacolon, malabsorption syndrome, and ulcerative colitis, functional bowel disorders, such as irritable bowel syndrome, neoplasms of the bowel, such as familial polyposis, adenocarcinoma, primary malignant lymphoma, carcinoid tumors, Kaposi's sarcoma, polyps, and cancer of the colon and rectum.
  • disorders of the bowel such as chronic inflammatory diseases of the bowel, Crohn's disease, ileus, diarrhea and constipation, colonic inertia, megacolon, malabsorption syndrome, and ulcerative colitis
  • functional bowel disorders such as irritable bowel syndrome, neoplasms of the bowel, such as familial polyposis, adenocarcinoma, primary malignant lymphoma, carcinoi
  • novel human fatty acid CoA ligase like protein AMP-binding enzyme is highly expressed in the following cancer tissues: ovary tumor, stomach rumor, uterus tumor, breast tumor, thyroid tumor, kidney tumor, esophagus tumor, colon tumor, ileum tumor.
  • tissue stomach tumor and healthy tissue stomach demonstrates that the novel human fatty acid CoA ligase like protein AMP-binding enzyme or mRNA can be used to diagnose cancer. Additionally, the activity of the novel human fatty acid CoA ligase like protein AMP-binding enzyme can be modulated to treat cancer.
  • Cancer disorders within the scope of the invention comprise any disease of an organ or tissue in mammals characterized by pooriy controlled or uncontrolled multiplica- tion of normal or abnormal cells in that tissue and its effect on the body as a whole.
  • Cancer diseases within the scope of the invention comprise benign neoplasms, dys- plasias, hyperplasias as well as neoplasms showing metastatic growth or any other transformations, e.g., leukoplakias, which often precede a breakout of cancer.
  • Cells and tissues are cancerous when they grow more rapidly than normal cells, displacing or spreading into the surrounding healthy tissue or any other tissues of the body described as metastatic growth, assume abnormal shapes and sizes, show changes in their nucleocytoplasmatic ratio, nuclear polychromasia, and finally may cease.
  • Cancerous cells and tissues may affect the body as a whole when causing paraneo- plastic syndromes or if cancer occurs within a vital organ or tissue, normal function will be impaired or halted, with possible fatal results.
  • the ultimate involvement of a vital organ by cancer, either primary or metastatic, may lead to the death of the mammal affected. Cancer tends to spread, and the extent of its spread is usually re- lated to an individual's chances of surviving the disease.
  • Cancers are generally said to be in one of three stages of growth: early, or localized, when a tumor is still confined to the tissue of origin, or primary site; direct extension, where cancer cells from the tumour have invaded adjacent tissue or have spread only to regional lymph nodes; or metastasis, in which cancer cells have migrated to distant parts of the body from the primary site, via the blood or lymph systems, and have established secondary sites of infection. Cancer is said to be malignant because of its tendency to cause death if not treated.
  • Benign tumors usually do not cause death, although they may if they interfere with a normal body function by virtue of their location, size, or paraneoplastic side effects.
  • cancer cells divide at a higher rate than do normal cells, but the distinction between the growth of cancerous and normal tissues is not so much the rapidity of cell division in the former as it is the partial or complete loss of growth restraint in cancer cells and their failure to differentiate into a useful, limited tissue of the type that characterizes the functional equilibrium of growth of normal tissue.
  • Cancer tissues may express certain. molecular receptors and probably are influenced by the host's susceptibility and immunity and it is known that certain cancers of the breast and prostate, for example, are considered dependent on specific hormones for their existence.
  • the term "cancer” under the scope of the invention is not limited to simple benign ⁇ eoplasia but includes any other benign and malign neoplasia, such as 1) carcinoma, 2) sarcoma, 3) carcinosarcoma, 4) cancers of the blood-forming tis- sues, 5) rumors of nerve tissues including the brain, and 6) cancer of skin cells.
  • Carcinoma occurs in epithelial tissues, which cover the outer body (the skin) and line mucous membranes and the inner cavitary structures of organs e.g. such as the breast, lung, the respiratory and gastrointestinal tracts, the endocrine glands, and the geni- tourinary system.
  • Ductal or glandular elements may persist in epithelial tumors, as in adenocarcinomas, e.g., thyroid adenocarcinoma, gastric adenocarcinoma, and uterine adenocarcinoma.
  • Cancers of the pavement-cell epithelium of the skin and of certain mucous membranes such as cancers of the tongue, lip, larynx, urinary bladder, uterine cervix, or penis, may be termed epidermoid or squamous-cell carcinomas of the , respective tissues and are within the scope of the definition of cancer as well.
  • Sarcomas develop in connective tissues, including fibrous tissues, adipose (fat) tissues, muscle, blood vessels, bone, and cartilage such as osteogenic sarcoma, liposar- coma, fibrosarcoma, and synovial sarcoma.
  • Carcinosarcoma is cancer that develops in both epithelial and connective tissue.
  • Cancer disease within the scope of this definition may be primary or secondary, whereby primary indicates that the cancer originated in the tissue where it is found rather than was established as a secondary site through metastasis from another le- sion.
  • Cancers and tumor diseases within the scope of this definition may be benign or malign and may affect all anatomical structures of the body of a mammal.
  • the novel human fatty acid CoA ligase like protein AMP-binding enzyme is highly expressed in the following tissues of the genitourinary system: ovary tumor, prostate, bladder, uterus, uterus tumor, placenta, cervix.
  • the expression in the above mentioned tissues demonstrate that the novel human fatty acid CoA ligase like protein AMP -binding enzyme or mRNA can be used to diagnose genitourinary disorders.
  • the activity of the novel human fatty acid CoA ligase like protein AMP-binding enzyme can be modulated to treat genitourinary disorders.
  • Genitourological disorders comprise benign and malign disorders of the organs constituting the genitourological system of female and male, renal diseases such as acute or chronic renal failure, immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulopa- thies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hyperplasia (BPH), neurogenic bladder syndrome, urinary incontinence such as urge-, stress-, or overflow incontinence, pelvic pain, and erectile dysfunction.
  • renal diseases such as acute or chronic renal failure
  • immunologically mediated renal diseases such as renal transplant rejection, lupus nephritis, immune complex renal diseases, glomerulopa- thies, nephritis, toxic nephropathy, obstructive uropathies such as benign prostatic hyperplasia (BPH), neurogenic bladder syndrome, urinary incontine
  • Urinary incontinence is the involuntary loss of urine. Urge urinary incontinence
  • UUI is one of the most common types of UI together with stress urinary incontinence (SU1), which is usually caused by a defect in the urethral closure mechanism.
  • UUI is often associated with neurological disorders or diseases causing neuronal damages such as dementia, Parkinson's disease, multiple sclerosis, stroke and diabe- tes, although it also occurs in individuals with no such disorders.
  • One of the usual causes of UUI is overactive bladder (OAB) which is a medical condition referring to the symptoms of frequency and urgency derived from abnormal contractions and instability of the detrusor muscle.
  • OAB overactive bladder
  • Dry mouth symptoms alone are responsible for a 70% non-compliance rate with oxybutynin.
  • the inadequacies of present therapies highlight the need for novel, efficacious, safe, orally available drugs that have fewer side effects.
  • Benign prostatic hyperplasia is the benign nodular hyperplasia of the periure- thral prostate gland commonly seen in men over the age of 50. The overgrowth occurs in the central area of the prostate called the transition zone, which wraps around the urethra. BPH causes variable degrees of bladder outlet obstruction resulting in progressive lower urinary tract syndromes (LUTS) characterized by urinary frequency, urgency, and nocturia due to incomplete emptying and rapid refilling of the bladder. The actual cause of BPH is unknown but may involve age-related alterations in balance of steroidal sex hormones.
  • LUTS progressive lower urinary tract syndromes
  • the selective alphal -adrenocept ⁇ r antagonists such as prazosin, indoramin and tam- sulosin are used as an adjunct in the symptomatic treatment of urinary obstruction caused by BPH, although they do not affect on the underlying cause of BPH.
  • BPH increased sympathetic tone exacerbates the degree of obstruction of the urethra through contraction of prostatic and urethral smooth muscle.
  • These compounds inhibit sympathetic activity, thereby relaxing the smooth muscle of the urinary tract.
  • Uroselective alphal -antagonists and alphal -antagonists with high tissue selectivity for lower urinary tract smooth muscle that do not provoke hypotensive side-effects should be developed for the treatment.
  • 5alpha-reductase inhibitors such as fmasteride are prescribed for BPH. These agents selectively inhibit 5alpha-reductase, which mediates conversion of testosterone to dihydrotestosterone, thereby reducing plasma dihydrotestosterone levels and thus prostate growth.
  • the 5alpha-reductase inhibitors do not bind to androgen receptors and do not affect testosterone levels nor do they possess feminizing side effects.
  • Androgen receptor antagonists are used for the treatment of prostatic hyperplasia due to excessive action or production of testosterone.
  • Various antiandrogens are under investigation for BPH including chlorrhadione derivatives with no estrogenic activity, orally active aromatase inhibitors, luteinizing hormone-releasing hormone (LHRH) analogues.
  • This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide binding molecule
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above- described screening assays for treatments as described herein.
  • a reagent which affects fatty acid CoA ligase-like AMP-binding enzyme activity can be administered to a human cell, either in vitro or in vivo, to reduce fatty acid CoA ligase-like AMP-binding enzyme activity.
  • the reagent preferably binds to an expression product of a human fatty acid CoA ligase-like AMP-binding enzyme gene. If the expression product is a protein, the reagent is preferably an antibody.
  • an antibody can be added to a preparation of stem cells that have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
  • the reagent is delivered using a Hposome.
  • the Hposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours.
  • a Hposome comprises a lipid composition that is capable of ⁇ targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
  • the lipid composition of the Hposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
  • a Hposome useful in the present invention comprises a lipid composition that is ca- pable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
  • the transfection efficiency of a Hposome is about 0.5 ⁇ g of DNA per 16 nmole of Hposome delivered to about 10 6 cells, more preferably about 1.0 ⁇ g of DNA per 16 nmole of Hposome delivered to about 10 6 cells, and even more preferably about 2.0 ⁇ g of DNA per 16 nmol of Hposome delivered to about 10 6 cells.
  • a Hposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
  • Suitable liposomes for use in the present invention include those liposomes stan- dardly used in, for example, gene delivery methods known to those of skill in the art.
  • More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
  • a Hposome comprises a compound capable of targeting the Hposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the Hposome.
  • Complexing a Hposome with a reagent such as an antisense oligonucleotide or ribo- ⁇ zyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151).
  • polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993);
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases enzymatic activity relative to the enzymatic activity which occurs in the absence of the therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in
  • LD 50 the dose lethal to 50% of the population
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 5 o/ED 50 .
  • compositions that exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Fac- tors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy.
  • Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
  • Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • Guidance as to particular dosages and methods of deHvery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
  • polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well-established techniques including, but not limited to, fransferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome-mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g kg, about 50 ⁇ g to about 5 mg/kg, about 100 ⁇ g to about 500 ⁇ g/kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
  • effective in vivo dos- ages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
  • the reagent is preferably an antisense oligonu- cleotide or a ribozyme.
  • Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a human fatty acid CoA ligase-like AMP- binding enzyme gene or the activity of a fatty acid CoA ligase-like AMP-binding enzyme polypeptide by at least about 10, preferably about 50, more preferably about
  • the effectiveness of the mechanism chosen to decrease the level of expression of a human fatty acid CoA ligase-like AMP-binding enzyme gene or the activity of a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to fatty acid CoA ligase- like AMP-binding enzyme-specific mRNA, quantitative RT-PCR, immunologic detection of a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide, or measurement of enzymatic activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeu- tic agents.
  • Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this ap- proach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
  • Human fatty acid CoA ligase-like AMP-binding enzyme also can be used in diag- nostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the enzyme. For example, differences can be determined between the cDNA or genomic sequence encoding fatty acid CoA ligase-like AMP-binding enzyme in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
  • Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
  • cloned DNA segments can be employed as probes to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags. Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents.
  • DNA fragments of different se- quences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85,
  • the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • mu- tations can also be detected by in situ analysis.
  • Altered levels of fatty acid CoA ligase-like AMP-binding enzyme also can be detected in various tissues.
  • Assays used to detect levels of the receptor polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
  • the polynucleotide of SEQ ID NO: 3 or 7 is inserted into the. expression vector pCEV4 and the expression vector pCEV4-fatty acid CoA ligase-like AMP-binding enzyme polypeptide obtained is transfected into human embryonic kidney 293 cells. From these cells extracts are obtained and fatty acid CoA ligase-like AMP-binding enzyme activity is determined in the following assay:
  • the cell extracts are added to reaction mixtures containing 200 mM Tris HCl, pH 7.5, 50 ⁇ M ATP, 8 mM MgCl 2 , 2 mM EDTA, 20 mM NaF, 0.1% Triton X-100, varying concentrations of [3H]oleate, 0.5 mM coenzyme A and incubated 10 min at 37°C. Reactions are initiated by the addition of CoA and terminated by the addition of isopropyl, n-heptane, 1 M H 2 SO 4 (40:10:1). The aqueous phase, containing oleoyl-
  • CoA formed during the reaction is extracted three times with 2.5 ml of n-heptane and subjected to scintillation counting. It is shown that the polypeptide of SEQ ID NO: 2 (and 6) have fatty acid CoA ligase-like AMP-binding enzyme activity.
  • the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human fatty acid CoA ligase-like AMP- binding enzyme polypeptides in yeast.
  • the fatty acid CoA ligase-like AMP-binding enzyme-encoding DNA sequence is derived from SEQ ID NO:l or 5.
  • the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an en- terokinase cleavage site, a His6 reporter tag and a termination codon.
  • the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombi- nantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea.
  • the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San
  • Purified fatty acid CoA ligase-like AMP-binding enzyme polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of
  • test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • Human fatty acidOoA ligase-like AMP-binding enzyme polypeptides comprise the amino acid sequence shown in SEQ ID NO:2, 4 or 6.
  • the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
  • the buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide is detected by fluorescence measurements of the contents of the wells.
  • a test compound that increases the fluorescence in a well by at least 15%o relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human fatty acid CoA ligase-like AMP-binding enzyme polypeptide.
  • test compound is administered to a culture of human cells fransfected with a fatty acid CoA ligase-like AMP-binding enzyme expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been fransfected is incubated for the same time without the test compound to provide a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and. hybridized with a 32 P-labeled fatty acid CoA ligase-like AMP-binding enzyme-specific probe at 65°C in Express-hyb (CLONTECH).
  • the probe comprises at least 11 con- tiguous nucleotides selected from the complement of SEQ ID NO:l or 5.
  • a test compound that decreases the fatty acid CoA ligase-like AMP-binding enzyme-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of fatty acid CoA ligase-like AMP-binding enzyme gene expression.
  • a test compound is administered to a culture of human cells fransfected with a fatty acid CoA ligase-like AMP-binding enzyme expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been fransfected is incubated for the same time without the test compound to provide a negative control.
  • Enzymatic activity is measured using the method of Vessey et al, J. Biochem. Mol. Toxicol. 12, 151-55, 1998.
  • a test compound which decreases the enzymatic activity of the fatty acid CoA ligase- like AMP-binding enzyme relative to the enzymatic activity in the absence of the test compound is identified as an inhibitor of fatty acid CoA ligase-like AMP-binding enzyme activity.
  • RT-PCR Reverse Transcription-Polymerase Chain Reaction
  • fatty acid CoA ligase-like AMP-binding enzyme is involved in the disease process of obesity, expression is determined in the following tissues: subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle small intestine, spleen, stomach, testes, thymus, thyroid trachea, and uterus.
  • tissues subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung
  • AMP-binding enzyme expression As a final step, the expression of fatty acid CoA ligase-like AMP-binding enzyme in cells derived from normal individuals with the expression of cells derived from obese individuals is compared.
  • fatty acid CoA ligase-like AMP-binding enzyme is involved in the disease process of diabetes
  • the following whole body panel is screened to show predominant or relatively high expression: subcutaneous and mesenteric adipose tissue, adrenal gland, bone marrow, brain, colon, fetal brain, heart, hypothalamus, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, thyroid, trachea, and uterus.
  • Human islet cells and an islet cell library also are tested.
  • the expression of fatty acid CoA ligase-like AMP-binding enzyme in cells derived from normal individuals with the expression of cells derived from diabetic individuals is compared.
  • CNS disorders the following tissues are screened: fetal and adult brain, muscle, heart, lung, kidney, liver, thymus, testis, colon, placenta, trachea, pancreas, kidney, gastric mucosa, colon, liver, cerebellum, skin, cortex (Alzheimer's and normal), hypothalamus, cortex, amygdala, cerebellum, hippocampus, choroid, plexus, thalamus, and spinal cord.
  • fatty acid CoA ligase-like AMP-binding enzyme is involved in cancer
  • expression is determined in the following tissues: adrenal gland, bone marrow, brain, cerebellum, colon, fetal brain, fetal liver,, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid, trachea, uterus, and peripheral blood lymphocytes.
  • Expression in the following cancer cell lines also is determined: DU-145 (prostate), NCI-H125 (lung), HT-29 (colon), COLO-205 (colon), A-549 (lung), NCI-H460 (lung), HT-116 (colon), DLD-1 (colon), MDA- MD-231 (breast), LS174T (colon), ZF-75 (breast), MDA-MN-435 (breast), HT-1080, MCF-7 (breast), and U87. Matched pairs of malignant and normal tissue from the same patient also are tested.
  • Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et al, BioTechnology
  • the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in direct pro- portion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
  • the amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction.
  • the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used. All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700. .
  • RNA extraction and cDNA preparation Total RNA from the tissues listed above are used for expression quantification.
  • RNAs labeled "from autopsy” were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer ' s protocol. 50 ⁇ g of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l RNase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; 10 mM MgCl 2 ; 50 mM NaCl; and 1 mM DTT.
  • RNA is extracted once with 1 volume of pheno chloroform:- isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
  • RNA from the autoptic tissues Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectropho- tometric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manufacturer's protocol. The final concentration of RNA in the reaction mix is 200 ng/ ⁇ L. Reverse transcription is carried out with 2 ,5 ⁇ M of random hexamer primers .
  • TaqMan quantitative analysis Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy- tetramethyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
  • FAM 6-carboxy-fluorescein
  • TAMRA 6-carboxy- tetramethyl-rhodamine
  • Total cDNA content is normalized with the simultaneous quantification (multiplex PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents (PDAR) Control Kit (PE Applied Biosystems, CA).
  • PDAR Pre-Developed TaqMan Assay Reagents
  • the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 ⁇ l.
  • IX final TaqMan Universal PCR Master Mix from 2X stock
  • PE Applied Biosystems, CA PE Applied Biosystems, CA
  • IX PDAR control - 18S RNA from 20X stock
  • 300 nM forward primer from 900 nM reverse primer
  • 200 nM probe 10 ng cDNA
  • water water to 25 ⁇ l.
  • Each of the following steps are carried out once: pre PCR, 2 minutes at 50°C, and 10 minutes at 95°C.
  • the following steps are carried out 40 times: denaturation, 15 seconds at 95 °C, annealing/extension, 1 minute at 60°C.
  • Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats or mice fed ad libitum.
  • Rats are made diabetic with a single intravenous injec- tion of 40 mg/kg of streptozotocin while C57BL/KsJ mice are given 40-60 mg/kg i.p. for 5 consecutive days.
  • Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle-treated control group.
  • Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hy- perinsulinemic and insulin resistant.
  • the animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group.
  • Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group.
  • Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load. • When measuring insulin levels, compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice. At the appropriate time an intravenous glucose load (0.4 g/kg) is given, blood is collected one minute later. Plasma insulin levels are determined. Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • animals When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intra- peritoneal glucose load (1 g/kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined. Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • test compounds which regulate fatty acid CoA ligase-like AMP-binding enzyme are administered by different routes (p.o., i.p., s.c, or i.v.) to overnight fasted normal rats or mice.
  • routes p.o., i.p., s.c, or i.v.
  • an intravenous glucose load 0.4 g/kg
  • Plasma insulin levels are determined.
  • Test compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • mice When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (1 g kg), bled again after 15, 30, 60, and 90 minutes and plasma glucose levels determined. Test compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • Animals are orally gavaged (2 ml/kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/compound. At this time, body weight, food and water consumption are measured. On the final day, animals are euthanized using CO 2 inhalation.
  • mice made obese by exposure to a 45% kcal/g high fat diet during more than 10 weeks.
  • the body weight of mice selected for the studies is higher than three standard deviations from the weight of a control group of mice fed standard low fat (5-6% fat) mouse chow.
  • Diet-induced obese (DIO) animals are frequently used in the determination of compound efficacy in the reduction of body weight (Brown et al, Br. J. Pharmacol. 132, 1898-1904, 2001; Guerre-Millom et al, J. Biol. Chem. 275 (22), 16638-42, 2000; Han et al, Int. J. Obes. Relat. Metab. Disord. 23, 174-9, 1999; Surwit et al, Endocrinology 141 (10),
  • Mice are kept in standard animal rooms under controlled temperature and humidity and a 12/12 light dark cycle. Water and food are continuously available. Mice are single housed in shoeboxes. Animals are sham dosed with study vehicle for at least four days before the recording of two-days baseline measurement of body weight and 24 hr food and water consumption. Mice ' are assigned to one of 6-8 treatment groups based upon their body weight on base- line. The groups are set up so that the mean and standard error of the mean of body weight were similar.
  • Animals are orally gavaged (5 ml kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/compound. At this time, body weight, food and water consumption are measured. Data is analyzed using appropriate statistics following the research design. On the final day, animals are euthanized using CO 2 inhalation.
  • This protocol is to determine the effect of a single dose of an unknown compound on food consumption of lean overnight fasted rats.
  • the fasted-refed rat model is frequently used in the field of obesity to identify compounds with potential for anorectic effects.
  • This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans.
  • the efficacy test The rats are fasted overnight during the dark phase (total of approx.
  • Acute pain is measured on a hot plate mainly in rats.
  • Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to
  • the other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a hind paw. The temperature which is reached when hind paw licking begins is a measure for pain. threshold.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t, i.c.v., s.c, intradermal, transdermal
  • Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5% formalin or 10 to 100 ⁇ g capsaicin is injected into one hind paw of the experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the af- fected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to formalin or capsaicin administration.
  • application routes i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal
  • Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia.
  • the first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve.
  • the second variant is the tight ligation of about the half of the diameter of the common sciatic nerve.
  • a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% ⁇ spinal nerve only.
  • the fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation.
  • the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia.
  • Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, ETC Inc-Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey System, Somedic Sales AB, H ⁇ rby, Sweden).
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10°C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity.
  • a further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb.
  • Chronic pain in gen- eral is assessed by registering the circadanian rhythms in activity (Surjo and Arndt,
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intfadermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intfadermal, transdermal
  • Inflammatory Pain Inflammatory pain is induced mainly in rats by injection of 0.75 mg carrageenan or complete Freund's adjuvant into one hind paw.
  • the animals de- ⁇ velop an edema with mechanical allodynia as well as thermal hyperalgesia.
  • Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, ITTC Inc.-Life Science Instruments, Woodland Hills, SA, USA).
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy, Paw thermal stimulator, G. Ozaki, University of Califor- nia, USA).
  • Plant Test Ugo Basile, Comerio, Italy
  • Paw thermal stimulator G. Ozaki, University of Califor- nia, USA.
  • For edema measurement two methods are being used. In the first method, the animals are sacrificed and the affected hindpaws sectioned and
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal
  • Diabetic neuropathic pain Rats treated with a single intraperitoneal injection of 50 to 80 mg/kg streptozotocin develop a profound hyperglycemia and mechanical allodynia within 1 to 3 weeks. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, HTC Inc.-Life Science Instruments, Woodland Hills, SA, USA).
  • Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different ap- plication routes (i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal) prior to pain testing.
  • ap- plication routes i.v., i.p., p.o., i.t., i.c.v., s.c, intradermal, transdermal
  • 6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic ni- grostriatal and striatopallidal pathways is the central pathological event in Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereo taxic injections of 6-OH-DA into the medium fore- brain bundle (MFB).
  • MFB medium fore- brain bundle
  • mice Male Wistar rats (Harlan Winkelmann, Germany), weighing 200 ⁇ 250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques.
  • Animals are administered pargyline on the day of surgery (Sigma, St. Louis, MO, USA; 50 mg kg i.p.) in order to inhibit metabolism of 6-OHDA by monoamine oxi- dase and desmethylimipramine HCl (Sigma; 25 mg/kg i.p.) in order to prevent uptake of 6-OHDA by noradrenergic terminals. Thirty minutes later the rats are anesthetized with sodium pentobarbital (50 mg/kg) and placed in a stereotaxic frame.
  • DA nigrostriatal pathway 4 ⁇ l of 0.01% ascorbic acid-saline containing 8 ⁇ g of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 ⁇ l/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
  • Stepping Test Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol. In brief, the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface.
  • Balance Test Balance adjustments following postural challenge are also measured during the stepping test sessions.
  • the rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score 3 is given for no reaction of movement. The test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
  • Staircase Test (Paw Reaching).
  • a modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement.
  • Plexiglass test boxes with a central platform and a removable stair- case on each side are used.
  • the apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use.
  • For each test the animals are left in the test boxes for 15 min.
  • the double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side.
  • MPTP mesencephalic dopaminergic
  • DAergic mesencephalic dopaminergic
  • TH tyrosine hydroxylase
  • mice are perfused transcardially with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% parafor- maldehyde (Merck) in PBS for 15 min.
  • the brains are removed and placed in 4% paraformaldehyde for 24 h at 4°C. For dehydration they are then transferred to a 20% sucrose (Merck) solution in 0.1 M PBS at 4°C until they sink.
  • the brains are frozen in methylbutan at -20°C for 2 min and stored at -70°C.
  • sledge microtome (mod. 3800-Frigocut, Leica) 25 ⁇ m sections are taken from the genu of the corpus callosum (AP 1.7 mm) to the hippocampus (AP 21.8 mm) and from AP 24.16 to AP 26.72. Forty-six sections are cut and stored in assorters in 0.25 M Tris buffer (pH 7.4) for immunohistochemistry.
  • TH free-floating tyrosine hydroxylase
  • Rotarod Test We use a modification of the procedure described by Rozas and La- bandeira-Garcia (1997), with a CR-1 Rotamex system (Columbus Instruments, Columbus, OH) comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit.
  • the rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse.
  • the system software allows preprogramming of session protocols with varying rotational speeds (0-80 rpm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod.
  • the system logs the fall as the end of the ex- periment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded.
  • the system also allows a weak current to be passed through the base grid, to aid training.
  • the object recognition task has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents.
  • a rat is placed in an open field, in which two identical objects are present.
  • the rats inspects both objects during the first trial of the object recognition task.
  • a second trial after a retention interval of for example 24 hours, one of the two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field.
  • the inspection time at each of the objects is registered.
  • the basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
  • Administration of the putative cognition enhancer prior to the first trial predominantly allows assessment of the effects on acquisition, and, eventually on consolidation processes.
  • Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
  • the passive avoidance task assesses memory performance in rats and mice.
  • the inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment.
  • Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours. In the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec.
  • the rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
  • the guillotine door between the compartments is lowered as soon as the rat has entered the dark compartment with its four paws, and a scrambled 1 mA footshock is administered for 2 sec.
  • the rat is removed from the apparatus and put back into its home cage.
  • the procedure during the retention session is identical to that of the habituation sessions.
  • the step-through latency that is the first latency of entering the dark compartment (in sec.) during the retention session is an index of the memory performance of the animal; the longer the latency to enter the dark compartment, the better the retention is.
  • the Morris water escape task measures spatial orien- tation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice.
  • the performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank.
  • Abundant ex- tra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence of the experimenter, and by a radio on a shelf that is playing softly.
  • the animals receive four trials during five daily acquisition sessions.
  • a trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized.
  • the escape platform is always in the same position.
  • a trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds.
  • an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds.
  • the probe trial all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
  • mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits are used.
  • the T-maze spontaneous alternation task assesses the spatial memory performance in mice.
  • the start arm and the two goal arms of the T-maze are provided with guillotine doors which can be oper- ated manually by the experimenter. A mouse is put into the start arm at the beginning of training. The guillotine door is closed.
  • the 'forced trial' either the left or right goal arm is blocked by lowering the guillotine door.
  • the mouse After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for 5 seconds, by lowering the guillotine door. Then, the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
  • the percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials (in s) is analyzed.
  • Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start of the training session. Scopolamine reduced the per-cent alternations to chance level, or below.
  • a cognition enhancer which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
  • mice Effects on plasma cholesterol levels including HDL cholesterol are typically assessed in humanized apo-AI transgenic mice. Modulation of human target proteins can be determined in corresponding transgenic mice (e.g., CETP transgenic mice). Triglyc- eride-lowering is usually evaluated in ob/ob mice or Zucker rats. Animals are fed with normal diets or modified diets (e.g., enriched by 0.5%) cholesterol 20% coconut oil). Standard protocols consist of oral applications once daily for 7 to 10 days at doses ranging from 0,1 to 100 mg/kg. The compounds are dissolved (e.g., in
  • Solutol/Ethanol/saline mixtures and applied by oral gavage or intravenous injection.
  • blood samples are typically drawn by refroorbital punctuation.
  • Plasma cholesterol and triglyceride levels are determined with standardized clinical diagnostic kits (e.g., INFINITYTM cholesterol reagent and INF1NITY TM triglyceride reagent; Sigma, St. Louis).
  • HDL cholesterol is determined after phosphotungstic acid precipitation of non-HDL lipoproteins or FPLC gel filtration with post-column derivatization of cholesterol using the reagents mentioned above.
  • Plasma levels of human apolipoprotein-AI in relevant humanized transgenic mice are measured by immunoturbidimetry (Sigma).
  • mice Male Wistar rats weighing 300-350 g (Harlan Winkelmann, Borchen, Germany) are anesthetized with thiopental "Nycomed (Nycomed, Kunststoff, Germany) lOO mg kg "1 i.p. A tracheotomy is performed, and catheters are inserted into the femoral artery for blood pressure and heart rate measurements (Gould pressure transducer and recorder, model RS 3400) and into the femoral vein for substance administration. The animals are ventilated with room air and their body temperature is controlled. Test compounds are administered orally or intravenously.
  • Female conscious SHR (Moellegaar ⁇ VDenmark, 220 - 290 g) are equipped with implantable radiotelemetry, and a data aquisition system (Data Sciences, St. Paul, MN, USA), comprising a chronically implantable transducer/transmitter unit equipped with a fluid-filled catheter is used.
  • the transmitter is implanted into the peritoneal cavity, and the sensing catheter is inserted into the descending aorta.
  • the animals of control groups only receive the vehicle.
  • mean blood pressure and heart rate of treated and untreated control groups are measured.
  • Anesthesia is initiated by slow intravenous injection of 25 mg kg "1 sodium thiopental (Trapanal ® , Byk Gulden, Konstanz, Germany). The anesthesia is continued and maintained throughout the experiment by continuous infusion of 0.04 mg kg "1 h "1 fentanyl (Fentanyl ® , Janssen, Neuss, Germany) and 0.25 mg kg "1 h “1 droperidol (DihydrobenzperidolR, Janssen, Neuss, Germany). During this anaesthesia, heart rate is as low as 35-40 bpm due to increased vagal tone.
  • a parasympathetic blockade is achieved by intermittent injections of atropine (0.1 mg per animal) (AtropinsulfatR, Eifelfango, Bad Neuenahr, Germany). After intubation the animals are artificially ventilated at constant volume (Engstr ⁇ mR 300, Engstr ⁇ m, Sweden) with room air enriched with 30% oxygen to maintain an end-tidal CO 2 concentration of about 5% (NormocapR, Datex, Finland).
  • a tip catheter for recording of left ventricular pressure is inserted into the ventricle via the carotid artery (PC350, Millar Instruments, Houston, TX, USA), a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1,
  • Telos Medical, Upland, CA, USA for recording of arterial blood pressure two venous catheters are inserted into either femoral vein and one additional catheter into a forearm vein for application of the anesthetic and drugs, respectively, and an oxyme- try catheter for recording of oxygen saturation is inserted into the coronary sinus via the jugular vein (Schwarzer 1VH4, M ⁇ nchen, Germany).
  • LCX left coronary artery
  • LCX left coronary artery
  • an electromagnetic flow probe Gould Statham, Oxnard, CA, USA
  • Arterial blood pressure, electrocardiogram (lead H), left ventricular pressure, first derivative of left ventricular pressure (dP/dt), heart rate, coronary blood flow, and oxygen saturation in the coronary sinus are continuously recorded on a pen recorder (Brush, Gould, Cleveland, OH, USA).
  • the maximum of dP/dt is used as measure of left ventricular contractility (dP/dtmax).
  • test compound is intravenously applied as bolus injections. Care is taken that all measured cardiovascular parameters have returned to control level before injection of the next dose.
  • Each dose of the test compound is tested at least three times in different animals. The order of injection of the different doses is randomized in each animal.
  • Wistar rats (200-250 g / Charles River Japan) are anesthetized intraperitoneally with ketamine. The abdomen is opened through a midline incision and the bladder and the proximal urethra are exposed. A constant degree of urethral obstruction is produced by tying a ligature around the urethra and a catheter with an outer diameter of 1 mm. The abdominal well is closed and the animals allowed to recover.
  • the rats are anesthetized with ketamine, and the ligature around the urethra is carefully removed to normalize the outlet resistance and enable- repetitive micturition.
  • a polyethylene catheter is implanted in the bladder through the dome, and exteriorized at the scapular level. Animals are then allowed to recover for at least 48 hours.
  • Cytometric investigation is performed without anesthesia two days after bladder catheter implantation in control and obstructed animals.
  • the bladder catheter was connected via a T-tube to a strain gauge and a microinjection pump.
  • the conscious rats are held under partial restraint in a resfraining device.
  • Warmed saline is infused into the bladder at a rate of 3 ml/hr for control and obstructed animals.
  • the rate of infusion is increased from 3 to 10 ml/hr to obtain similar interval times between micturitions in obstructed and control rats.
  • Overactivity of the obstructed bladders is assessed by measuring the cystometric parameters such as basal pressure, peak micturition pressure, threshold pressure, micturition interval, amplitude and frequency of spontaneous activity and micturition slope. Lluel et al, J. Urol. 160, 2253-57, 1998.
  • test compound is dissolved in an appropriate vehicle, such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v), is administered intravenously through the catheter.
  • an appropriate vehicle such as a mixture of ethanol, Tween 80 (ICN Biomedicals Inc.), and saline (1:1:8, v/v/v
  • An organ bath assay is employed to measure the agonist-induced contraction of prostate for assessing the biological activity of test compounds (i.e., drug candidates).
  • Male Wistar rats (200 ⁇ 250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole prostate is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the following composition (112 mM NaCl, 5.9 mM KCl, 1.2 mM MgCl 2 , 1.2 mM NaH 2 PO 4 , 2 mM CaCl 2 , 2.5 mM NaHCO 3 , 12 mM glucose).
  • Ventricle prostate lobes were dissected into several strips depending on the size of prostate. Prostate strips are equilibrated for 60 min in organ bath chambers before any stimulation.
  • Isometric tension is recorded under an appropriate load. Contractile response to adrenergic agonists or electric field stimulation is determined several times until reproducible responses are obtained. Test compounds are pre-incubated prior to the agonistic or electric stimulation. The ratio of each contraction to the negative control is calculated and the effect of the test compounds on the prostate contraction is evaluated.
  • An organ bath assay is employed to measure the agonist-induced contraction of urinary bladder for assessing the biological activity of test compounds (i.e., drug candidates).
  • Male Wistar rats (200 ⁇ 250 g / Charles River Japan) are anesthetized with ether and sacrificed by dislocating the necks. The whole urinary bladder is excised and placed in oxygenated Modified Krebs-Henseleit solution (pH 7.4) of the follow- ing composition (112 mM NaCl, 5.9 mM KCl, 1.2 mM MgCl 2 , 1.2 mM NaH 2 PO 4 ,
  • Isometric tension is recorded under an appropriate load using longitudinal strips of rat detrusor muscle. Bladder strips are equilibrated for 60 minutes before each stimulation. Contractile response to 80 mM KCl is determined at 15 minute intervals until reproducible responses are obtained. The response to KCl is used as an internal standard to evaluate the effect of test compounds.
  • test compounds are investigated by incubating the strips with compounds for 30 minutes prior to stimulation with an appropriate agonist or electrical stimulation.
  • One of the preparations made from the same animal serves as a control, while others are used for evaluating test compounds.
  • the ratio of each contraction to the internal standard e.g., a KCl-induced contraction
  • the ratio of each contraction to the internal standard is calculated, and the effects of the test compounds on the contraction are evaluated.
  • Rats are anesthetized by intraperitoneal administration of urethane (Sigma) at 1.25 g/kg.
  • the abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder through the dome.
  • a polyethylene catheter BECTON DICKINSON, PE50
  • saline Otsuka
  • Rats are anesthetized by intramuscular administration of ketamine (75 mg/kg) and xylazine (15 mg/kg). The abdomen is opened through a midline incision, and a polyethylene catheter (BECTON DICKINSON, PE50) is implanted into the bladder through the dome. The catheter is tunneled through subcutis of the animal by needle (14 G) to neck.
  • ketamine 75 mg/kg
  • xylazine 15 mg/kg
  • PE50 polyethylene catheter
  • the inguinal region is incised, and a polyethylene catheter (BECTON DICKINSON, PE50) filled with saline (Otsuka) is inserted into a femoral vein.
  • the catheter is tunneled through subcutis of the animal by needle to neck.
  • the bladder catheter is connected via T-tube to a pressure transducer (Viggo-Spectramed Pte Ltd, DT-XXAD) and a microin- jection pump (TERUMO). Saline is infused at room temperature into the bladder at a rate of 10 ml/hr. Intravesicular pressure is recorded continuously on a chart pen recorder (Yokogawa). At least three reproducible micturition cycles are recorded before a test compound administration.
  • test compounds (4) Administration of test compounds.
  • a test compound dissolved in the mixture of ethanol, Tween 80 (ICN Biomedicals Inc.) and saline (1:1:8, v/v/v) is ad- ministered intravenously through the catheter.
  • the cell line used for testing is the human colon cancer cell line HCT116.
  • Cells are cultured in RPMI-1640 with 10-15% fetal calf serum at a concentration of 10,000 cells per milliliter in a volume of 0.5 ml and kept at 37°C in a 95%> air/5%CO 2 atmosphere.
  • Phosphorothioate oligoribonucleotides are synthesized on an Applied Biosystems Model 380B DNA synthesizer using phosphoroamidite chemistry. A sequence of 24 bases complementary to the nucleotides at position 1 to 24 of SEQ ID NO:3 or 7 is used as the test oligonucleotide. As a control, another (random) sequence is used: 5'- TCA ACT GAC TAG ATG TAC ATG GAC-3' (SEQ ID NO:25). Following assembly and deprotection, oligonucleotides are efhanol-precipitated twice, dried, and suspended in phosphate buffered saline at the desired concentration.
  • oligonucleotides Purity of the oligonucleotides is tested by capillary gel electrophoresis and ion exchange HPLC. The purified oligonucleotides are added to the culture medium at a concentration of 10 ⁇ M once per day for seven days.
  • test oligonucleotide for seven days results in significantly reduced expression of fatty acid CoA ligase-like AMP-binding enzyme as determined by Western blotting. This effect is not observed with the control oligonucleotide.
  • the number of cells in the cultures is counted using an automatic cell counter. The number of cells in cultures treated with the test oligonucleotide (expressed as 100%) is compared with the number of cells in cultures treated with the control oligonucleotide. The number of cells in cultures treated with the test oligonucleotide is not more than 30% of control, indicating that the inhibition of fatty acid CoA ligase-like AMP-binding enzyme has an anti-proliferative effect on. cancer cells.
  • This non-tumor assay measures the ability of a compound to reduce either the endogenous level of a circulating hormone or the level of hormone produced in response to a biologic stimulus.
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c).
  • test compound p.o., i.p., i.v., i.m., or s.c
  • Plasma is assayed for levels of the hormone of interest. If the normal circulating levels of the hormone are too low and/or variable to provide consistent results, the level of the hormone may be elevated by a pre-treatment with a biologic stimulus (i.e., LHRH may be injected i.m.
  • a biologic stimulus i.e., LHRH may be injected i.m.
  • mice were fed at a dosage of 30 ng/mouse to induce a burst of testosterone synthesis).
  • the timing of plasma collection would be adjusted to coincide with the peak of the induced hormone response.
  • Compound effects are compared to a vehicle-treated control group.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c.
  • Fibers are. harvested in accordance with specific readout assay protocol, these may include assays for gene expression (bDNA, PCR, or Taq an), or a specific biochemical activity (i.e., cAMP levels. Results are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group. Subacute Functional In Vivo Assays
  • Rodents are administered test compound (p.o., i.p., i.v., i.m., or s.c.) according to a predetermined schedule and for a predetermined duration (i.e., 1 week).
  • animals are weighed, the target organ is excised, any fluid is expressed, and the weight of the organ is recorded.
  • Blood plasma may also be collected. Plasma may be assayed for levels of a hormone of interest or for levels of test agent.
  • Organ weights may be directly compared or they may be normalized for the body weight of the animal. Compound effects are compared to a vehicle- treated control group. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • Hollow fibers are prepared with desired cell line(s) and implanted intraperitoneally and/or subcutaneously in rodents. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Fibers are harvested in accordance with specific readout assay protocol.
  • Cell proliferation is determined by measuring a marker of cell number (i.e., MTT or LDH). The cell number and change in cell number from the starting inoculum are analyzed by Student's t-test or Rank Sum test after the variance between groups is compared by an F-test, with significance at p ⁇ 0.05 as compared to the vehicle control group.
  • Hydron pellets with or without growth factors or cells are implanted into a micro- pocket surgically created in the rodent cornea.
  • Compound administration may be systemic or local (compound mixed with growth factors in the hydron pellet).
  • Corneas are harvested at 7. days post implantation immediately following intracardiac infusion of colloidal carbon and are fixed in 10%> formalin. Readout is qualitative
  • Image analysis data is evaluated by measuring the area of neovascularization (in pixels) and group averages are compared by Student's t-test (2 tail). Significance is p ⁇ 0.05 as compared to the growth factor or cells only group.
  • Matrigel containing cells or growth factors, is injected subcutaneously. Compounds are administered p.o., i.p., i.v., i.m., or s.c. Matrigel plugs are harvested at predetermined time point(s) and prepared for readout. Readout is an ELISA-based assay for 20 hemoglobin concentration and/or histological examination (i.e. vessel count, special staining for endothelial surface markers: CD31, factor-8). Readouts are analyzed by Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05 as compared to the vehicle control group.
  • Tumor cells or fragments are implanted subcutaneously on Day 0.
  • Vehicle and/or compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting at a time, usually on Day 1, prior to the ability to measure the tumor burden.
  • Body weights and tumor measurements are recorded 2-3 times weekly.
  • Anti- tumor efficacy may be initially determined by comparing the size of treated (T) and control (C) tumors on a given day by a Student's t-test, after the variance between groups is compared by an F-test, with significance determined at p ⁇ 0.05. The ex- periment may also be continued past the end of dosing in which case tumor measurements would continue to be recorded to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan- Meier curves from the times for individual tumors to attain the evaluation size. Significance is p ⁇ 0.05.
  • Tumor cells are injected intraperitoneally or intracranially on Day 0.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule starting on Day 1. Observations of morbidity and/or mortality are recorded twice daily. Body weights are measured and recorded twice weekly. Morbidity/mortality data is expressed in terms of the median time of survival and the number of long-term survi- vors is indicated separately. Survival times are used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment.
  • Tumor cells or fragments are implanted subcutaneously and grown to the desired size for treatment to begin. Once at the predetermined size range, mice are randomized into treatment groups. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size. Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 com- pared to the vehicle control group.
  • Tumor cells or fragments, of mammary adenocarcinoma origin are implanted directly into a surgically exposed and reflected mammary fat pad in rodents. The fat pad is placed back in its original position and the surgical site is closed. Hormones may also be administered to the rodents to support the growth of the tumors. Com- pounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule. Tumor and body weights are measured and recorded 2-3 times weekly. Mean tumor weights of all groups over days post inoculation are graphed for comparison. An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • Tumor measurements may be recorded after dosing has stopped to monitor tumor growth delay.
  • Tumor growth delays are expressed as the difference in the median time for the treated and control groups to attain a predetermined size divided by the median time for the control group to attain that size.
  • Growth delays are compared by generating Kaplan-Meier curves from the times for individual tumors to attain the evaluation size. Significance is p value ⁇ 0.05 compared to the vehicle control group.
  • this model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ, or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells or fragments, of prostatic adenocarcinoma origin are implanted directly into a surgically exposed dorsal lobe of the prostate in rodents.
  • the prostate is externalized through an abdominal incision so that the tumor can be implanted specifically in the dorsal lobe while verifying that the implant does not enter the seminal vesicles.
  • the successfully inoculated prostate is replaced in the abdomen and the incisions through the abdomen and skin are closed.
  • Hormones may also be administered to the rodents to support the growth of the tumors.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule.
  • Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is termi- nated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group. This model provides an opportunity to increase the rate of spontaneous metastasis of this type of tumor.
  • Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the lungs), or measuring the target organ weight (i.e., the regional lymph nodes). The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells of pulmonary origin may be implanted intrabronchially by making an incision through the skin and exposing the trachea.
  • the trachea is pierced with the beveled end of a 25-gauge needle and the tumor cells are inoculated into the main bronchus using a flat-ended 27-gauge needle with a 90° bend.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule.
  • Body weights are measured and recorded 2-3 times weekly. At a predetermined time, the experiment is terminated and the animal is dissected.
  • the size of the primary tumor is measured in three dimensions using either a caliper or an ocular micrometer attached to a dissecting scope.
  • An F-test is preformed to determine if the variance is equal or unequal followed by a Student's t-test to compare tumor sizes in the treated and control groups at the end of treatment. Significance is p ⁇ 0.05 as compared to the control group.
  • This model provides an opportunity to increase the rate of sponta- neous metastasis of this type of tumor. Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the contralat- eral lung), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment. Intracecal Assay
  • Tumor cells of gastrointestinal origin may be implanted intracecally by making an abdominal incision through the skin and externalizing the intestine. Tumor cells are inoculated into the cecal wall without penetrating the lumen of the intestine using a
  • Metastasis can be assessed at termination of the study by counting the number of visible foci per target organ (i.e., the liver), or measuring the target organ weight. The means of these endpoints are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment.
  • Tumor cells are inoculated s.c. and the tumors allowed to grow to a predetermined range for spontaneous metastasis studies to the lung or liver. These primary tumors are then excised. Compounds are administered p.o., i.p., i.v., i.m., or s.c. according to a predetermined schedule which may include the period leading up to the excision of the primary tumor to evaluate therapies directed at inhibiting the early stages of tumor metastasis. Observations of morbidity and/or mortality are recorded daily.
  • Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves. Significance is p ⁇ 0.05 by a log-rank test compared to the control group in the experiment. The mean number of visible tumor foci, as determined under' a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance determined at p ⁇ 0.05 compared to the control group in the experiment for both of these endpoints.
  • Tumor cells are injected into the tail vein, portal vein, or the left ventricle of the heart in experimental (forced) lung, liver, and bone metastasis studies, respectively.
  • Compounds are administered p.o., i.p., i.v., i.m., or s.c. according, to a predetermined schedule. Observations of morbidity and/or mortality are recorded daily. Body weights are measured and recorded twice weekly. Potential endpoints include survival time, numbers of visible foci per target organ, or target organ weight. When survival time is used. as the endpoint the other values are not determined. Survival data is used to generate Kaplan-Meier curves.
  • Significance is p ⁇ 0.05 by a log-rafrk test compared to the control group in the experiment.
  • the mean number of visible tumor foci, as determined under a dissecting microscope, and the mean target organ weights are compared by Student's t-test after conducting an F-test, with significance at p ⁇ 0.05 compared to the vehicle control group in the experiment for both end- points.
  • Total cellular RNA was isolated from cells by one of two standard methods: 1) gua- nidine isothiocyanate/cesium chloride density gradient centrifugation [Kellogg et al (1990)]; or with the Tri-Reagent protocol according to the manufacturer's specifications (Molecular Research Center, Inc., Cincinnati, Ohio). Total RNA prepared by the Tri-reagent protocol was treated with DNAse I to remove genomic DNA contamination.
  • RNA from each cell or tissue source was first reverse transcribed. Eighty-five ⁇ g of total RNA was reverse transcribed using 1 ⁇ mole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U RnaseQut (Invitrogen, Groningen, Netherlands) in a final volume of 680 ⁇ l.
  • the first strand synthesis buffer and Omniscript reverse transcriptase (2 U/ ⁇ l) were obtained from (Qiagen, Hilden, Germany). The reaction was incubated at 37°C for 90 minutes and cooled on ice. The volume was adjusted to 6800 ⁇ l with water, yielding a final concentration of 12.5 ng/ ⁇ l of starting RNA.
  • the forward primer sequence was: Primerl gtctaccggggaaggatagc (SEQ JD NO:26).
  • the reverse primer sequence was Primer2 acgatcacgatcctctcgt (SEQ ID NO:27).
  • the following reagents were prepared in a total of 25 ⁇ l : lx TaqMan buffer A, 5.5 mM MgCl 2 , 200 nM of dATP, dCTP, dGTP, and dUTP, 0.025 U/ ⁇ l A pHTaq GoldTM, 0.01 U/ ⁇ l AmpErase, and
  • Thermal cycling parameters were 2 min at 50°C, followed by 10 min at 95°C, followed by 40 cycles of melting at 95°C for 15 sec and annealing/extending at 60°C for 1 min.
  • the CT (threshold cycle) value is calculated as described in the "Quantitative determination of nucleic acids" section.
  • the CF-value (factor for threshold cycle correction) is calculated as follows:
  • PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
  • CT HKG - values were calculated as described in the "Quantitative determination of nucleic acids" section.
  • CT cD NA-n CT value of the tested gene for the cDNA n
  • CF CD N A - ⁇ correction factor for cDNA n
  • CT CO ⁇ - CD N A - ⁇ corrected CT value for a gene on cDNA n
  • highest CT cor-C DNA-n ⁇ 40 is defined as CT CO ⁇ -C DNA [high]
  • cerebellum cerebellum
  • cerebellum left
  • cerebellum right
  • heart ventricle left
  • Alzheimer cerebral cortex skeletal muscle, corpus callosum
  • cerebral cortex hippocampus
  • parietal lobe frontal lobe
  • occipital lobe precentral gyrus
  • temporal lobe tonsilla cerebelli
  • fetal brain rectum
  • vermis cerebelli heart atrium (right)
  • fetal kidney postcentral gyrus
  • cerebral peduncles breast, interven- tricular septum
  • Alzheimer brain frontal lobe pericardium, ovary tumor, stomach tumor, brain, kidney, pons, spinal cord, fetal lung fibroblast cells, neuroblastoma 1MR32 cells, neuroblastoma SH5Y cells, prostate, heart, Alzheimer brain, heart atrium (left), skin, thalamus, mammary gland, bladder, stomach, uterus, fetal heart, lung tumor, ileum, lung tumor, liver

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des réactifs qui régulent une enzyme de liaison AMP du type CoA ligase d'acides gras humains et des réactifs qui se lient à des produits géniques d'enzyme de liaison AMP du type CoA ligase d'acides gras humains pouvant jouer un rôle dans la prévention, l'amélioration, ou la correction de dysfonctionnements ou de maladies tels que, entre autres, l'obésité, le diabète, les troubles du système nerveux central, les troubles cardiovasculaires, les troubles hématologiques, les troubles génito-urinaires, et le cancer.
PCT/EP2003/000314 2002-01-16 2003-01-15 Regulation d'enzyme de liaison amp du type coa ligase d'acides gras humains WO2003060129A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003235632A AU2003235632A1 (en) 2002-01-16 2003-01-15 Regulation of human fatty acid coa ligase-like amp-binding enzyme

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US34838602P 2002-01-16 2002-01-16
US60/348,386 2002-01-16
US40604202P 2002-08-27 2002-08-27
US60/406,042 2002-08-27

Publications (1)

Publication Number Publication Date
WO2003060129A1 true WO2003060129A1 (fr) 2003-07-24

Family

ID=26995686

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/000314 WO2003060129A1 (fr) 2002-01-16 2003-01-15 Regulation d'enzyme de liaison amp du type coa ligase d'acides gras humains

Country Status (2)

Country Link
AU (1) AU2003235632A1 (fr)
WO (1) WO2003060129A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001053312A1 (fr) * 1999-12-23 2001-07-26 Hyseq, Inc. Nouveaux acides nucleiques et polypeptides
WO2001075067A2 (fr) * 2000-03-31 2001-10-11 Hyseq, Inc. Nouveaux acides nucleiques et polypeptides
WO2001090322A2 (fr) * 2000-05-19 2001-11-29 Millennium Pharmaceuticals, Inc. 32244, enzyme se liant a l'amp et utilisations correspondantes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001053312A1 (fr) * 1999-12-23 2001-07-26 Hyseq, Inc. Nouveaux acides nucleiques et polypeptides
WO2001075067A2 (fr) * 2000-03-31 2001-10-11 Hyseq, Inc. Nouveaux acides nucleiques et polypeptides
WO2001090322A2 (fr) * 2000-05-19 2001-11-29 Millennium Pharmaceuticals, Inc. 32244, enzyme se liant a l'amp et utilisations correspondantes

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DATABASE EM_HUM [online] EMBL; 9 April 1999 (1999-04-09), OHARA ET AL.: "Homo sapiens mRNA for KIAA0934 protein, partial cds.", XP002239927, retrieved from EBI Database accession no. AB023151 *
DATABASE GSN [online] 13 February 2002 (2002-02-13), DRMANAC ET AL.: "DNA encoding novel human diagnostic protein #8348", XP002239929, retrieved from EBI Database accession no. AAS72544 *
DATABASE GSN [online] 22 October 2001 (2001-10-22), TANG ET AL.: "Human polynucleotide SEQ ID NO 561", XP002239931, retrieved from EBI Database accession no. AAI58358 *
DATABASE GSP [online] 13 February 2002 (2002-02-13), DRMANAC ET AL.: "Novel human diagnostic protein #8348", XP002239930, retrieved from EBI Database accession no. ABG08357 *
DATABASE GSP [online] 22 October 2001 (2001-10-22), TANG ET AL.: "Human polypeptide SEQ ID NO 2347", XP002239932, retrieved from EBI Database accession no. AAM39202 *
DATABASE SWALL [online] 30 May 2000 (2000-05-30), NAKAJIMA ET AL.: "Hypothetical protein nKIAA0934", XP002239928, retrieved from EBI accession no. Y934_HUMAN Database accession no. Q9Y2E4 *
DNA RESEARCH, vol. 6, 1999, pages 63 - 70 *
VESSEY D A ET AL: "Characterization of the CoA ligases of human liver mitochondria catalyzing the activation of short- and medium-chain fatty acids and xenobiotic carboxylic acids", BBA - GENERAL SUBJECTS, ELSEVIER SCIENCE PUBLISHERS, NL, vol. 1428, no. 2-3, 5 August 1999 (1999-08-05), pages 455 - 462, XP004276468, ISSN: 0304-4165 *

Also Published As

Publication number Publication date
AU2003235632A1 (en) 2003-07-30

Similar Documents

Publication Publication Date Title
US20060121562A1 (en) Human receptor tyrosine kinase mertk
US20040253669A1 (en) Regulation of human dcamkl1-like serine/threonine protein kinase
WO2004031375A2 (fr) Regulation de la pde1c humaine
US7049118B2 (en) Regulation of human serine-threonine protein kinase
WO2003060129A1 (fr) Regulation d'enzyme de liaison amp du type coa ligase d'acides gras humains
US7179629B2 (en) Regulation of human serine/threonine kinase
US7052892B2 (en) Regulation of human wee1-like serine/threonine protein kinase
WO2003046165A1 (fr) Régulation de la protéine humaine de type aldose réductase
US20050208492A1 (en) Regulation of human serine/threonine kinase
US20040241796A1 (en) Regulation of human nek-like serine/threonine protein kinase
WO2003033708A2 (fr) Regulation de la proteine kinase humaine a serine/threonine
WO2003100046A1 (fr) Regulation de la kinase humaine
WO2004029237A1 (fr) Variants d'epissage de la leukotriene a-4 hydrolase humaine
US20050244825A1 (en) Regulation of human bmp-2 inducible kinase
WO2003093466A1 (fr) Proteine humaine associee au rhomboide
WO2003060110A2 (fr) Regulation d'enzyme de liaison amp du type coa ligase d'acides gras humains
US20030059918A1 (en) Regulation of human serine/threonine protein kinase
WO2004005501A1 (fr) Regulation la caseine kinase humaine i epsilon
WO2003087379A1 (fr) Regulation de la proteine kinase humaine
WO2003060109A2 (fr) Regulation d'une subtilase humaine
EP1506290A1 (fr) Regulation de la serine/threonine kinase humaine
US20040137593A1 (en) Regulation of human serine/threonine protein kinase-like protein
WO2004007728A1 (fr) Regulation de la tripeptidyl peptidase ii humaine
WO2003072767A2 (fr) Regulation de la lipase humaine
US20040171539A1 (en) Regulation of human protein kinase-like protein

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP