WO2003054224A2 - Method and integrated device for the detection of cytosine methylations - Google Patents

Method and integrated device for the detection of cytosine methylations Download PDF

Info

Publication number
WO2003054224A2
WO2003054224A2 PCT/DE2002/004507 DE0204507W WO03054224A2 WO 2003054224 A2 WO2003054224 A2 WO 2003054224A2 DE 0204507 W DE0204507 W DE 0204507W WO 03054224 A2 WO03054224 A2 WO 03054224A2
Authority
WO
WIPO (PCT)
Prior art keywords
dna
primers
amplification
solid phase
primer
Prior art date
Application number
PCT/DE2002/004507
Other languages
German (de)
French (fr)
Other versions
WO2003054224A3 (en
Inventor
Kurt Berlin
Original Assignee
Epigenomics Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Epigenomics Ag filed Critical Epigenomics Ag
Priority to EP02791612A priority Critical patent/EP1451359A2/en
Priority to AU2002357968A priority patent/AU2002357968A1/en
Publication of WO2003054224A2 publication Critical patent/WO2003054224A2/en
Publication of WO2003054224A3 publication Critical patent/WO2003054224A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification

Definitions

  • the present invention describes a method for the detection of the methylation state of genomic DNA samples.
  • 5-Methylcytosine is the most common covalently modified base in the DNA of eukaryotic cells. For example, it plays a role in the regulation of transcription, in genetic imprinting and in tumorigenesis. The identification of 5-methylcytosine as a component of genetic information is therefore of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing because 5- Methylcytosine has the same base pairing behavior as cytosine. In addition, in the case of PCR amplification, the epigenetic information which the 5-methylcytosines carry is completely lost.
  • the state of the art in terms of sensitivity is defined by a method which includes the DNA to be examined in an agarose matrix, thereby preventing the diffusion and renaturation of the DNA (bisulfite only reacts on single-stranded DNA) and all precipitation and purification steps replaced by rapid dialysis (Olek, A. et al., Nucl. Acids. Res. 1996, 24, 5064-5066). With this method, individual cells can be examined, which illustrates the potential of the method. However, only individual regions up to about 3000 base pairs in length have so far been investigated, and a global examination of cells for thousands of possible methylation analyzes is not possible.
  • PCR reactions polymerase chain reactions
  • two specifically binding primers one complementary to the (+) strand, the other complementary to the (-) strand of the one to be amplified Templates is.
  • the aim of such an amplification is to reproduce a certain fragment of the Te plat DNA, which is usually precisely defined and is largely or completely known in its base sequence.
  • PCR reactions using more than two different primers are also known. In most cases, they are used for the amplification of several fragments, likewise at least largely known in their base sequence, simultaneously in one vessel. In this case too, the primers used specifically bind to certain sections of the template DNA.
  • the hybridization chamber (DE19952723) developed by Epigenomics AG carries out periodic denaturation of the DNA sample without generating a detachment of DNA already hybridized to oligomers. Because the DNA sample is thermally denatured before being applied to the array and then suddenly cooled, it is predominantly in single-stranded form when contacted with the array. This means that a large part of the otherwise double-stranded DNA sample is available for hybridizations with the oligomer array. By pumping the sample liquid back and forth, the device ensures that this process is repeated until a sufficient part of the double-stranded DNA sample has hybridized to the oligomers of the array. At the same time, this process causes mixing in the chamber during the hybridization phase.
  • Genomic DNA is obtained by standard methods from DNA from cell, tissue or other test samples. This standard methodology can be found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
  • Coded particles have been used in very different areas for some time. Color-coded beads have been used for the parallel diagnosis of T and B cells (Baran and Parker, Am. J. Clin. Pathol. 1985, 83, 182-9). Beads containing radiaoactive indium have been used as indicators of the motility of the gastrointestinal tract (Dormehl et al Eur. J. Nucl. Med. 1985, 10, 283-5). Companies such as Lu inex or Illumina, who run highly parallel diagnostics with color-coded plastic beads, use 100 different different -coloured beads, to which many different probes can be attached. As a result, 100 different parameters can be queried in a reaction, which could be, for example, 100 different diagnostic tests.
  • the present invention is intended to provide a method which is particularly suitable for the detection of DNA polymorphisms and cytosine methylations in genomic DNA samples.
  • a device for analyzing DNA samples should preferably be used, which enables both the amplification of DNA fragments and the analysis of DNA polymorphisms and cytosine methylations in a vessel by means of immobilized primers and probes.
  • the object is achieved according to the invention by a method for the detection of DNA polymorphisms and cytosine methylation, the following steps being carried out: a) the DNA to be examined is obtained from a sample; b) the DNA to be examined is amplified in a polymerase reaction, a primer being in solution and a primer being bound to the surface of a solid phase, and at least one of the primers consisting of two domains, the one located at the 3 'end the DNA to be examined hybridizes, while the one located at the 5 'end does not hybridize; c) the DNA amplified in step b) is amplified again, the primers of this second amplification the domain located at the 5 'end hybridize or are identical to at least one of the first primers and these primers are provided with a detectable label for the second amplification; d) the amplificates are on oligonucleotides and / or
  • PNA oligomers hybridized, which are bound to a solid phase, which do not act as primers in the amplification, and concluded from the hybridization on sequence features or methylation ester of the DNA to be examined.
  • step a) the DNA to be examined is treated chemically and / or enzymatically after it has been obtained.
  • a particularly preferred embodiment of the method according to the invention for the detection of DNA polymorphisms and cytosine methylation is characterized in that the following steps are carried out: the DNA to be examined is obtained from a sample;
  • the DNA to be examined is treated chemically and / or enzymatically;
  • the DNA to be examined is amplified in a polymerase action, a primer being in solution and a primer being bound to the surface of a solid phase and at least one of the primers consisting of two domains, the one located at the 3 'end being attached to the DNA to be examined hybridizes, while the one located at the 5 'end does not hybridize;
  • the DNA amplified in the previous step is amplified again, the primers of this second amplification hybridizing or being identical to at least one of the first primers to the domain located at the 5 'end, and these primers being provided with a detectable label for the second amplification are; -
  • the amplificates are hybridized to oligonucleotides and / or PNA oligomers, which are bound to a solid phase, which do not function as primers in the amplification, and conclude from the hybridization on sequence features or methylation patterns of the DNA to be examined.
  • primers of the first amplification (step b) and the oligonucleotides (step d) are immobilized on the same solid phase.
  • the solid phase is flat. Furthermore, it is particularly preferred according to the invention that the solid phase is made of glass, metal, in particular gold or plastic.
  • beads are used as the solid phase, each bead being coded differently. It is particularly preferred here that the beads use fluorescent dyes and absorbents
  • Dyes via chemiluminescence, via transponders, via nuclides or via chemical labels which can be detected by mass spectrometry.
  • the surface is chemically treated in such a way that the oligonucleotides and primers can be covalently bound to it.
  • the present invention furthermore relates to a device consisting of a) a surface on which primer oligonucleotides are immobilized with their 5 'end and additionally oligonucleotides and / or PNA olig eres which cannot be extended by a polymerase; b) a chamber, the surface of which is a wall of this Chamber forms; c) a temperature control unit that controls the chamber temperature; d) a system which supplies liquids to the chamber.
  • the DNA to be examined is obtained from a sample.
  • the genomic DNA to be analyzed is preferably obtained from the usual sources for DNA, such as. B. cell lines, blood, sputum, stool, urine, brain spinal fluid, paraffin-embedded tissue, for example tissue from the eyes, intestines, kidneys, brain, heart, prostate, lungs, chest or liver, histological slides and all possible combinations of these.
  • the DNA can also already be processed or isolated.
  • the DNA to be examined is treated chemically and / or enzymatically.
  • bisulfite disulfite, hydrogen sulfite
  • the enzymatic treatment is preferably carried out using methylation-sensitive restriction enzymes which can differentiate between methylated and unmethylated DNA.
  • the DNA to be examined is amplified in a polymer laser action, with a
  • Primer is in solution and a primer is bound to the surface of a solid phase and at least one of the primers consists of two domains, the domain located at the 3 'end hybridizing to the DNA to be investigated, while the domain located at the 5' end not hybridized.
  • the amplified sections are immobilized on a solid phase via at least one primer used in the amplification.
  • the primer is preferably bound by chemical reactions (e.g. by introducing a C6 5 'amino function).
  • the 3 'domain preferably contains only bases C, A and T or bases G, A and T, as corresponds to bisulfite-treated DNA. In the 5 'domain, however, all four bases A, C, G and T are preferably included.
  • primers consisting of two domains
  • two-stage amplifications can be carried out, which particularly specifically provide a large number of fragments at the same time and which at the same time solves the problem that a large number of labeled and correspondingly expensive primers are normally used for such a complex amplification Need to become.
  • the amplification of the DNA in the two previous method steps is preferably carried out in a polymer chain reaction, preferably with a heat-resistant DNA polymerase.
  • the amplification of several DNA sections is preferably done in a reaction vessel.
  • the PCR products are preferably labeled via absorbing dyes and / or via chemiluminescence and / or via radioactive isotopes and / or via fluorescent labels.
  • the fluorescent label by a fluorescence-labeled nucleotide such.
  • B Cy5-dCTP introduced.
  • the amplificates are hybridized to oligonucleotides and / or PNA oligomers which are bound to a solid phase, which do not function as primers in the amplification, and from the hybridization conclusions are drawn about sequence features or methylation patterns of the DNA to be examined.
  • the hybridized oligonucleotides can be provided at the 3 'end with the following modifications, for example: amino, phosphate, thiophosphate, dideoxy, carboxy, dihydroxy, O-acetyl or alkyl.
  • DNA polymorphisms and cytosine methylations are analyzed in one experiment.
  • the present invention also relates to a device for the in situ amplification and analysis of DNA samples, as shown in FIG. 4. It consists of a closed and temperature-controlled hybridization chamber, a pump, a heating element and a cooling element, each of which is connected to one another by liquid-conveying conduction paths, preferably plastic tubes (DE 19952723 AI) and a commercially available slide (oligonucleotide array) on which DNA oligomers which can act as primers in a polymerase action, and PNA oligomers or DNA oligomers which cannot act as primers in a polymerase action are arranged.
  • the volume that the hybridization chamber holds when an oligomer array is inserted is particularly preferably less than 200 ⁇ l.
  • the present invention furthermore relates to a device for analyzing DNA samples.
  • This consists of at least one surface on which DNA oligomers which can act as primers in a polymerase action and PNA oligomers or DNA oligomers which cannot act as primers in a polymerase action are arranged.
  • the particularly preferred pumping of the sample liquid back and forth in the device ensures that a sufficient part of the double-stranded DNA sample hybridizes to the oligomers of the array.
  • ESR1 Acc. No. EP11141
  • PCR conditions 2 ⁇ l DNA (20 ng) (bisulfite treated); 0.4 ⁇ l Taq (2 units, Qiagen); 0.4 ⁇ l dNTP (25 each mmol / 1, MBI Fermentas) 0.25 mmol / 1 final concentration; 2 ul
  • Primer2 (12.5 pmol / ⁇ l) 0.5 pmol / ⁇ l final concentration; 5 ul 10X PCR buffer (Qiagen); 1 ⁇ l MgCl (15 mmol / 1, Qiagen)
  • the purified PCR products were used for the immobilization on glass surfaces (beads). They only differed in their 5 'modification. One product had the H 2 group at the 5 'end of the upper strand (for5 ward), the other had this group at the 5' end of the lower strand. reverse strand. During the test, double strands were bound, but after denaturing and washing, two different single strands are immobilized. The success of this binding process was determined using fluorescence measurements. First, a fluorescence signal from the beads was detected. Secondly, a decrease in the fluorescence signal of the immobilization buffer compared to a control buffer could be shown.
  • the beads were washed several times in the reaction vessels under denaturing conditions. After each denaturation step, the beads were additionally washed with 1 ml of water and some beads of each type were kept. All other beads were used for the next denaturation step (1. 5 min, 95 ° C with water; 2. 10 min, 25 ° C with 10 mM P0 4 buffer / 1% SDS; 3. 2 times 5 min, 25 ° C with 0.05 M NaOH; 4. 30 min 0.2 M NaOH / 0.1% SDS) was used. At the end the beads were dried in a vacuum and stored.
  • the DNA immobilized on the glass surfaces which was washed 4 times and denatured (see above), was used as a template for the PCR.
  • a master mix was prepared for the PCR and only one bead was added to each reaction vessel.
  • PCR conditions for 1 glass bead or 10 ng bisulfite-treated DNA as a control 0.2 ⁇ l Taq (1 unit), 0.2 ⁇ l dNTP (each 25 mM) 0.2 mM final concentration, 1 ⁇ l primer (12.5 pmol / ⁇ l) 0.5 pmol / ⁇ l final concentration; 1 ul Primer2 (12.5 pmol / ⁇ l) 0.5 pmol / ⁇ l final concentration; 2.5 ul (10x) buffer; 20.1 ul H 2 0
  • Example 2 Primer extension of an immobilized ESRI primer and amplification of the immobilized extension product with gene-specific and generic (M13 domain) PCR primers.
  • the immobilization buffer was optimized for the application of NH 2 -labeled oligonucleotides to PITC-derivatized lysine surfaces.
  • PCR was carried out in 0.2 ml reaction tubes as described above in the Eppendorf cycler; 5 primer-loaded PITC beads were placed in each reaction tube; PCR product was used as template (purified, undiluted, 5'-Cy5 labeled):
  • the primers of ESRI and MDRI with amino function were immobilized on PITC beads. All primers have an M13 domain and a gene-specific domain. After the immobilization, the beads were added to the PCR preparation without additional primer oligonucleotides using a PCR product as a template. During the cycles, the bound primers are attached to single-stranded DNA of the PCR products and extended. The success of the extension reaction is checked with this PCR. ESRI PCR product was used as a template that has no M13 domain. The primers used are specific for the extended primers (see results below). At a extension on the glass surfaces, only PCRs 3a and 4b are positive, as are controls 7a and
  • Example 3 In situ amplification of the ESRI gene and analysis of the methylation status of a CpG position on a microarray.
  • a glass slide (array) was chemically modified and the following oligonucleotides with a commercially available
  • ESRI-CG TAGGTTTTCGGGGTAGGG
  • ESR1-TG TAGGTTTTTGGGGTAGGG
  • the distribution of the oligonucleotides on the array is shown in FIG. 5.
  • the in-situ amplification was carried out in the hybridization chamber developed by Epigenomics AG.
  • 200 ⁇ l of the PCR solution 50 ng bisulfite-treated human genomic DNA, dNTPs 0.25 mM, 0.5 ⁇ M primer ESRI- BL ACAATAAAACCATCCCAAATAC or primer ESR1-BU-Ml3b CAGGAAACAGCTATGACACAATAAAACCATCCCAAATAC, 20 ⁇ l lOx reaction buffer, 5 U Taq polymerase (Qiagen, Hilden) filled in a reaction vessel (volume 500 ⁇ l) and covered with mineral oil.
  • the reaction vessel was placed in the denaturing position of the hybridization chamber and connected to the reaction (hybridization) chamber with a Teflon tube (see FIG. 4).
  • the PCR reaction was carried out by pumping the PCR solution back and forth between the denaturation position and the reaction (hybridization) chamber. This process was controlled by the following pump / temperature program (Tab. 1, steps 1-8). The PCR reaction was finished after the program steps 2-7 had been run through 38 times.
  • Step duration T-chamber pump T-Denat. Position d. PCR solution.
  • step 8 After the in-situ amplification (step 8, table 1), 400 ⁇ l hybridization buffer (6.9 x SSC, 2.7 Na-
  • Fig. 1 ESR PCR product
  • reaction vessels (Bead No. B): B1: beads after the second denaturation; B2: beads after the 3rd denaturation; B3: beads after the 4th denaturation; B4: no beads, no template;
  • Fig. 5 Schematic representation of the chip layout:
  • the black dots represent the positions of the immobilized primers (B). The location of the
  • Methylation detection oligos on the chip are represented by white dots TG oligonucleotide (TAGGTTTTTGGGGTAGGG) and gray dots CG oligonucleotide (TAGGTTTTCGGGGTAGGG) (A).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for detecting DNA polymorphisms and cytosine methylation, consisting of the following steps: a) DNA is extracted from a sample for analysis; b) if a cytosine methylation analysis is carried out, the DNA is chemically and/or enzymatically treated; c) the DNA is amplified in a polymerase reaction using a dissolved primer, and another primer is attached to the surface of a solid phase. At least one of the primers consists of two domains. The domain located at the 3' end hybridizes with the DNA, whereas the domain located at the 5' end does not hybridize; d) the DNA amplified in step c) is amplified once again. The primers of the second amplification hybridize with the domain located at the 5' end of at least one of the first primers or are identical therewith. The primers used for the second amplification contain a detectable marker; e) the amplified substances are hybridized with oligonucleotides and/or PNA oligomers that are bound to a solid phase which does not act as a primer during amplification. Sequential features or methylation patterns are detected by means of the hybridization.

Description

Verfahren und Integrierte Vorrichtung zum Nachweis von Method and integrated device for the detection of
Cy osinmethy1ierungenCy osinmethylations
Gebiet der ErfindungField of the Invention
Die nach den methodischen Entwicklungen der letzten Jahre in der Molekularbiologie gut studierten Beobachtungsebenen sind die Gene selbst, die Übersetzung dieser Gene in RNA und die daraus entstehenden Proteine. Wann imThe observation levels that have been well studied in molecular biology according to the methodological developments of recent years are the genes themselves, the translation of these genes into RNA and the resulting proteins. When in
Laufe der Entwicklung eines Individuums welches Gen angeschaltet wird und wie Aktivieren und Inhibieren bestimmter Gene in bestimmten Zellen und Geweben gesteuert wird, ist mit Ausmaß μnd Charakter der Methylierung der Gene bzw. des Genoms korrelierbar . Insofern äußern sich pathogene Zustände in einem veränderten Methylierungs- uster einzelner Gene oder des Genoms.In the course of the development of an individual which gene is switched on and how activation and inhibition of certain genes is controlled in certain cells and tissues can be correlated with the extent and character of the methylation of the genes or of the genome. In this respect, pathogenic conditions are expressed in a changed methylation pattern of individual genes or the genome.
Die vorliegende Erfindung beschreibt ein Verfahren zur Detektion des Methylierungszustandes genomischer DNA Proben.The present invention describes a method for the detection of the methylation state of genomic DNA samples.
Stand der TechnikState of the art
5-Methylcytosin ist die häufigste kovalent modifizierte Base in der DNA eukaryotischer Zellen. Sie spielt beispielsweise eine Rolle in der Regulation der Transkription, beim genetischen Imprinting und in der Tumorgenese. Die Identifizierung von 5-Methylcytosin als Bestandteil genetischer Information ist daher von erheblichem Interesse. 5-Methylcytosin-Positionen können jedoch nicht durch Sequenzierung identifiziert werden, da 5- Methylcytosin das gleiche Basenpaarungsverhalten aufweist wie Cytosin. Darüber hinaus geht bei einer PCR- Amplifikation die epigenetische Information, welche die 5-Methylcytosine tragen, vollständig verloren.5-Methylcytosine is the most common covalently modified base in the DNA of eukaryotic cells. For example, it plays a role in the regulation of transcription, in genetic imprinting and in tumorigenesis. The identification of 5-methylcytosine as a component of genetic information is therefore of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing because 5- Methylcytosine has the same base pairing behavior as cytosine. In addition, in the case of PCR amplification, the epigenetic information which the 5-methylcytosines carry is completely lost.
Eine relativ neue und die mittlerweile am häufigsten angewandte Methode zur Untersuchung von DNA auf 5- Methylcytosin beruht auf der spezifischen Reaktion von Bisulfit mit Cytosin, das nach anschließender alkalischer Hydrolyse in Uracil umgewandelt wird, welches in seinem Basenpaarungsverhalten dem Thymidin entspricht. 5- Methylcytosin wird dagegen unter diesen Bedingungen nicht modifiziert. Damit wird die ursprüngliche DNA so umgewandelt, dass Methylcytosin, welches ursprünglich durch sein Hybridisierungsverhalten vom Cytosin nicht unterschieden werden kann, jetzt durch „normale" molekularbiologische Techniken als einzig verbliebenes Cytosin beispielsweise durch Amplifikation und Hybridisierung oder Sequenzierung nachgewiesen werden kann. Alle diese Techniken beruhen auf Basenpaarung, welche jetzt voll ausgenutzt wird.A relatively new and the most frequently used method for the investigation of DNA for 5-methylcytosine is based on the specific reaction of bisulfite with cytosine, which is converted to uracil after subsequent alkaline hydrolysis, which corresponds to the thymidine in its base pairing behavior. 5-Methylcytosine, however, is not modified under these conditions. The original DNA is thus converted in such a way that methylcytosine, which originally cannot be distinguished from the cytosine by its hybridization behavior, can now be detected by "normal" molecular biological techniques as the only remaining cytosine, for example by amplification and hybridization or sequencing. All of these techniques are based on Base pairing, which is now fully utilized.
Die Bisulfit-Technik wird bisher bis auf wenige Ausnahmen (z. B. Zechnigk, M. et al., Eur. J. Hum. Gen. 1997, 5, 94-98) nur in der Forschung angewendet. Immer aber werden kurze, spezifische Stücke eines bekannten Gens nach einer Bisulfit-Behandlung amplifziert und entweder komplett sequenziert (Olek, A. und Walter, J., Nat. Genet. 1997, 17, 275-276) oder einzelne Cytosin-Positionen durch eine „Primer-Extension-Reaktion" (Gonzalgo, M. L. und Jones, P. A., Nucl. Acids Res. 1997, 25, 2529-2531, WO-PatentThe bisulfite technique has so far been used only in research with a few exceptions (e.g. Zechnigk, M. et al., Eur. J. Hum. Gen. 1997, 5, 94-98). However, short, specific pieces of a known gene are always amplified after bisulfite treatment and either completely sequenced (Olek, A. and Walter, J., Nat. Genet. 1997, 17, 275-276) or individual cytosine positions by a "Primer extension reaction" (Gonzalgo, ML and Jones, PA, Nucl. Acids Res. 1997, 25, 2529-2531, WO patent
9500669) oder einen Enzymschnitt (Xiong, Z. und Laird, P. W., Nucl. Acids. Res. 1997, 25, 2532-2534) nachgewiesen. Zudem ist auch der Nachweis durch Hybridisierung beschrieben worden (Olek et al., WO 99/28498).9500669) or an enzyme cut (Xiong, Z. and Laird, PW, Nucl. Acids. Res. 1997, 25, 2532-2534). Detection by hybridization has also been described (Olek et al., WO 99/28498).
Weitere Publikationen, die sich mit der Anwendung der Bi- sulfit-Technik zum Methylierungsnachweis bei einzelnenOther publications dealing with the use of the bisulfite technique for methylation detection in some
Genen befassen, sind: Xiong, Z. und Laird, P. W. (1997), Nucl. Acids Res. 25, 2532; Gonzalgo, M. L. und Jones, P. A. (1997), Nucl. Acids Res. 25, 2529; Grigg, S. und Clark, S. (1994), Bioassays 16, 431; Zeschnik, M. et al. (1997), Human Molecular Genetics 6, 387; Teil, R. et al. (1994), Nucl. Acids Res. 22, 695; Martin, V. et al. (1995), Gene 157, 261; WO 97/46705, WO 95/15373 und WO 95/45560.Genes are: Xiong, Z. and Laird, P.W. (1997), Nucl. Acids Res. 25, 2532; Gonzalgo, M.L. and Jones, P.A. (1997), Nucl. Acids Res. 25, 2529; Grigg, S. and Clark, S. (1994) Bioassays 16, 431; Zeschnik, M. et al. (1997), Human Molecular Genetics 6, 387; Teil, R. et al. (1994), Nucl. Acids Res. 22, 695; Martin, V. et al. (1995) Gene 157, 261; WO 97/46705, WO 95/15373 and WO 95/45560.
Der Stand der Technik, was die Empfindlichkeit betrifft, wird durch ein Verfahren definiert, welches die zu untersuchende DNA in einer Agarose-Matrix einschließt, dadurch die Diffusion und Renaturierung der DNA (Bisulfit reagiert nur an einzelsträngiger DNA) verhindert und alle Fällungs- und Reinigungsschritte durch schnelle Dialyse ersetzt (Olek, A. et al . , Nucl. Acids. Res. 1996, 24, 5064-5066) . Mit dieser Methode können einzelne Zellen untersucht werden, was das Potential der Methode veranschaulicht. Allerdings werden bisher nur einzelne Regio- nen bis etwa 3000 Basenpaare Länge untersucht, eine globale Untersuchung von Zellen auf Tausenden von möglichen Methylierungsanalysen ist nicht möglich.The state of the art in terms of sensitivity is defined by a method which includes the DNA to be examined in an agarose matrix, thereby preventing the diffusion and renaturation of the DNA (bisulfite only reacts on single-stranded DNA) and all precipitation and purification steps replaced by rapid dialysis (Olek, A. et al., Nucl. Acids. Res. 1996, 24, 5064-5066). With this method, individual cells can be examined, which illustrates the potential of the method. However, only individual regions up to about 3000 base pairs in length have so far been investigated, and a global examination of cells for thousands of possible methylation analyzes is not possible.
PCR Reaktionen (Polymerase Kettenreaktionen) werden nor- malerweise mit zwei spezifisch bindenden Primern durchgeführt, wobei einer komplementär zum (+) -Strang, der andere komplementär zum (-) Strang des zu amplifizierenden Templates ist. Das Ziel einer solchen Amplifikation ist es, ein bestimmtes Fragment der Te plat DNA zu vervielfältigen, das in der Regel genau definiert und in seiner Basensequenz zum großen Teil oder vollständig bekannt ist.PCR reactions (polymerase chain reactions) are normally carried out with two specifically binding primers, one complementary to the (+) strand, the other complementary to the (-) strand of the one to be amplified Templates is. The aim of such an amplification is to reproduce a certain fragment of the Te plat DNA, which is usually precisely defined and is largely or completely known in its base sequence.
Es sind auch PCR Reaktionen bekannt, die mehr als zwei verschiedene Primer einsetzen. Meist dienen sie zur Amplifikation mehrerer, ebenfalls wenigstens zum großen Teil in ihrer Basensequenz bekannter Fragmente gleichzeitig in einem Gefäß. Auch in diesem Fall binden die eingesetzten Primer spezifisch an bestimmte Abschnitte der Templat DNA.PCR reactions using more than two different primers are also known. In most cases, they are used for the amplification of several fragments, likewise at least largely known in their base sequence, simultaneously in one vessel. In this case too, the primers used specifically bind to certain sections of the template DNA.
Die von der Firma Epigenomics AG entwickelte Hybridisie- rungskammer (DE19952723) führt ein periodisches Denaturieren der DNA-Probe durch, ohne eine Ablösung bereits an Oligomere hybridisierter DNA zu erzeugen. Dadurch, daß die DNA-Probe vor dem Aufbringen auf den Array thermisch denaturiert und dann plötzlich abgekühlt wird, liegt sie bei Kontaktierung mit dem Array überwiegend in ein- zelsträngiger Form vor. Damit steht ein großer Teil der ansonsten doppelsträngigen DNA-Probe für Hybridisierungen mit dem Oligomer-Array zur Verfügung. Durch Hin- und Her- pumpen der Probenflüssigkeit stellt die Vorrichtung sicher, daß dieser Vorgang so häufig wiederholt wird, bis ein ausreichender Teil der doppelsträngigen DNA-Probe an die Oligomere des Arrays hybridisiert hat. Zugleich findet durch diesen Prozeß ein Mischen in der Kammer während der Hybridisierungsphase statt. Eine Übersicht über den Stand der Technik in der Oligomer Array Herstellung läßt sich aus einer im Januar 1999 erschienenen Sonderausgabe von Nature Genetics (Nature Ge- netics Supplement, Volume 21, January 1999), der dort zitierten Literatur und dem US-Patent 5994065 über Methoden zur Herstellung von festen Trägern für Zielmoleküle wie Oligonukleotide entnehmen. Neben Desoxyribonucleic Acids (DNA) können auch Peptide Nucleic Acids (PNA) auf der 0- berflache von Oligomer-Arrays fixiert werden.The hybridization chamber (DE19952723) developed by Epigenomics AG carries out periodic denaturation of the DNA sample without generating a detachment of DNA already hybridized to oligomers. Because the DNA sample is thermally denatured before being applied to the array and then suddenly cooled, it is predominantly in single-stranded form when contacted with the array. This means that a large part of the otherwise double-stranded DNA sample is available for hybridizations with the oligomer array. By pumping the sample liquid back and forth, the device ensures that this process is repeated until a sufficient part of the double-stranded DNA sample has hybridized to the oligomers of the array. At the same time, this process causes mixing in the chamber during the hybridization phase. An overview of the prior art in oligomer array production can be found in a special edition of Nature Genetics published in January 1999 (Nature Genetics Supplement, Volume 21, January 1999), the literature cited therein and US Pat. No. 5,994,065 on methods for the production of solid supports for target molecules such as oligonucleotides. In addition to deoxyribonucleic acids (DNA), peptide nucleic acids (PNA) can also be fixed on the surface of oligomer arrays.
In situ Aplifikationen sind in der Literatur zahlreich beschrieben (Tsongalis, G. J. und Silvermann L. M., Ann. Clin. Lab. Sei 1994, 24, 436-440) . In situ Reaktionen sind jedoch bisher dadurch gekennzeichnet, dass PCR und Hybridisierung in getrennten Reaktionsgefäßen erfolgen.In situ modifications have been extensively described in the literature (Tsongalis, G.J. and Silvermann L.M., Ann. Clin. Lab. Sei 1994, 24, 436-440). In situ reactions, however, have so far been characterized in that PCR and hybridization take place in separate reaction vessels.
Genomische DNA wird durch Standardmethoden aus DNA von Zeil-, Gewebe- oder sonstigen Versuchsproben gewonnen. Diese Standardmethodik findet sich in Referenzen wie Fritsch und Maniatis eds., Molecular Cloning: A Laborato- ry Manual, 1989.Genomic DNA is obtained by standard methods from DNA from cell, tissue or other test samples. This standard methodology can be found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
Kodierte Partikel (Beads) finden schon seit einiger Zeit in sehr unterschiedlichen Gebieten ihre Anwendung. Farb- kodierte Beads sind zur parallelen Diagnostik von T- und B-Zellen eingesetzt worden (Baran und Parker, Am. J. Clin. Pathol. 1985, 83, 182-9) . Mit radiaoaktive Indium versetzte Beads sind als Indikatoren der Motilität des gastrointestalen Trakts verwendet worden (Dormehl et al Eur. J. Nucl. Med. 1985, 10, 283-5). Firmen wie Lu inex oder Illumina, die mit farbkodierten Kunststoffkügelchen hoch-parallele Diagnostik betreiben, verwenden 100 ver- schieden -farbmarkierte Beads, an denen entsprechend viele verschiedene Sonden angebracht werden können. Dadurch können in einer Reaktion 100 verschiedene Parameter abgefragt werden, was z.B. 100 verschiedene diagnostische Tests sein könnten.Coded particles (beads) have been used in very different areas for some time. Color-coded beads have been used for the parallel diagnosis of T and B cells (Baran and Parker, Am. J. Clin. Pathol. 1985, 83, 182-9). Beads containing radiaoactive indium have been used as indicators of the motility of the gastrointestinal tract (Dormehl et al Eur. J. Nucl. Med. 1985, 10, 283-5). Companies such as Lu inex or Illumina, who run highly parallel diagnostics with color-coded plastic beads, use 100 different different -coloured beads, to which many different probes can be attached. As a result, 100 different parameters can be queried in a reaction, which could be, for example, 100 different diagnostic tests.
Aufgabenstellungtask
Die vorliegende Erfindung soll ein Verfahren bereitstel- len, welches sich zum Nachweis von DNA-Polymorphismen und Cytosin-Methylierungen in genomischen DNA-Proben besonders eignet. Zur Durchführung des Verfahrens soll bevorzugt eine Vorrichtung zur Analyse von DNA Proben verwendet werden, die sowohl die Amplifikation von DNA Fragmen- ten und die Analyse von DNA-Polymorphismen und Cytosin- Methylierungen in einem Gefäß mittels immobilisierter Primer und Sonden ermöglicht.The present invention is intended to provide a method which is particularly suitable for the detection of DNA polymorphisms and cytosine methylations in genomic DNA samples. To carry out the method, a device for analyzing DNA samples should preferably be used, which enables both the amplification of DNA fragments and the analysis of DNA polymorphisms and cytosine methylations in a vessel by means of immobilized primers and probes.
Beschreibungdescription
Die Aufgabe wird erfindungsgemäß durch ein Verfahren zum Nachweis von DNA-Polymorphismen und Cytosin-Methylierung gelöst, wobei man die folgenden Schritte ausgeführt: a) man gewinnt die zu untersuchende DNA aus einer Probe; b) die zu untersuchende DNA wird in einer Polymeraserak- tion amplifiziert, wobei ein Primer in Lösung vorliegt und ein Primer an die Oberfläche einer Festphase gebunden ist und wobei mindestens einer der Primer aus zwei Domänen besteht, wobei die am 3 '-Ende befindliche an die zu untersuchende DNA hybridisiert, während die am 5 '-Ende befindliche nicht hybridisiert; c) die in Schritt b) amplifizierte DNA wird erneut amplifiziert, wobei die Primer dieser zweiten Amplifikation an die am 5 '-Ende befindliche Domäne mindestens eines der ersten Primer hybridisieren oder zu ihr identisch sind und wobei diese Primer für die zweite Amplifikation mit einer nachweisbaren Markierung versehen sind; d) die Amplifikate werden an Oligonukleotide und/oderThe object is achieved according to the invention by a method for the detection of DNA polymorphisms and cytosine methylation, the following steps being carried out: a) the DNA to be examined is obtained from a sample; b) the DNA to be examined is amplified in a polymerase reaction, a primer being in solution and a primer being bound to the surface of a solid phase, and at least one of the primers consisting of two domains, the one located at the 3 'end the DNA to be examined hybridizes, while the one located at the 5 'end does not hybridize; c) the DNA amplified in step b) is amplified again, the primers of this second amplification the domain located at the 5 'end hybridize or are identical to at least one of the first primers and these primers are provided with a detectable label for the second amplification; d) the amplificates are on oligonucleotides and / or
PNA-Oligomere hybridisiert, welche an eine Festphase gebunden sind, die in der Amplifikation nicht als Primer fungieren, und aus der Hybridisierung auf Sequenzmerkmale oder Methylierungs uster der zu untersuchenden DNA ge- schlössen.PNA oligomers hybridized, which are bound to a solid phase, which do not act as primers in the amplification, and concluded from the hybridization on sequence features or methylation ester of the DNA to be examined.
Besonders bevorzugt ist es erfindungsgemäß, dass man in Schritt a) die zu untersuchende DNA nach der Gewinnung chemisch und/oder enzy atisch behandelt.It is particularly preferred according to the invention that in step a) the DNA to be examined is treated chemically and / or enzymatically after it has been obtained.
Eine besonders bevorzugte Ausführungsform des erfindungsgemäßen Verfahren zum Nachweis von DNA-Polymorphismen und Cytosin-Methylierung ist dadurch gekennzeichnet, dass man die folgenden Schritte ausgeführt: - man gewinnt die zu untersuchende DNA aus einer Probe;A particularly preferred embodiment of the method according to the invention for the detection of DNA polymorphisms and cytosine methylation is characterized in that the following steps are carried out: the DNA to be examined is obtained from a sample;
- die zu untersuchende DNA wird, falls eine Cytosin- Methylierungsanalyse durchgeführt werden soll, chemisch und/oder enzymatisch behandelt;- If a cytosine methylation analysis is to be carried out, the DNA to be examined is treated chemically and / or enzymatically;
- die zu untersuchende DNA wird in einer Polymeraserakti- on amplifiziert, wobei ein Primer in Lösung vorliegt und ein Primer an die Oberfläche einer Festphase gebunden ist und wobei mindestens einer der Primer aus zwei Domänen besteht, wobei die am 3 '-Ende befindliche an die zu untersuchende DNA hybridisiert, während die am 5 '-Ende be- findlich nicht hybridisiert;- The DNA to be examined is amplified in a polymerase action, a primer being in solution and a primer being bound to the surface of a solid phase and at least one of the primers consisting of two domains, the one located at the 3 'end being attached to the DNA to be examined hybridizes, while the one located at the 5 'end does not hybridize;
- die im vorherigen Schritt amplifizierte DNA wird erneut amplifiziert, wobei die Primer dieser zweiten Amplifikation an die am 5 '-Ende befindliche Domäne mindestens eines der ersten Primer hybridisieren oder zu ihr identisch sind und wobei diese Primer für die zweite Amplifikation mit einer nachweisbaren Markierung versehen sind; - die Amplifikate werden an Oligonukleotide und/oder PNA- Oligomere hybridisiert, welche an eine Festphase gebunden sind, die in der Amplifikation nicht als Primer fungieren, und aus der Hybridisierung auf Sequenzmerkmale oder Methylierungsmuster der zu untersuchenden DNA geschlossen.- The DNA amplified in the previous step is amplified again, the primers of this second amplification hybridizing or being identical to at least one of the first primers to the domain located at the 5 'end, and these primers being provided with a detectable label for the second amplification are; - The amplificates are hybridized to oligonucleotides and / or PNA oligomers, which are bound to a solid phase, which do not function as primers in the amplification, and conclude from the hybridization on sequence features or methylation patterns of the DNA to be examined.
Bevorzugt ist weiterhin, dass die Primer der ersten Amplifikation (Schritt b) und die Oligonukleotide (Schritt d) auf derselben Festphase immobilisiert sind.It is further preferred that the primers of the first amplification (step b) and the oligonucleotides (step d) are immobilized on the same solid phase.
Erfindungsgemäß bevorzugt ist ferner, dass die Festphase eben ist. Weiterhin ist erfindungsgemäß besonders bevorzugt, dass die Festphase aus Glas, Metall, inbesondere Gold oder Kunststoff ist.It is further preferred according to the invention that the solid phase is flat. Furthermore, it is particularly preferred according to the invention that the solid phase is made of glass, metal, in particular gold or plastic.
Besonders bevorzugt ist auch, dass Beads als Festphase verwendet werden, wobei jeder Bead unterschiedlich codiert ist. Hierbei ist insbeondere bevorzugt, dass die Beads über Fluoreszenzfarbstoffe, über absorbierendeIt is also particularly preferred that beads are used as the solid phase, each bead being coded differently. It is particularly preferred here that the beads use fluorescent dyes and absorbents
Farbstoffe, über Chemiluminiszenz, über Transponder, über Nuklide codiert sind oder über chemische Markierungen, welche sich massenspektrometrisch nachweisen lassen.Dyes, via chemiluminescence, via transponders, via nuclides or via chemical labels which can be detected by mass spectrometry.
Ganz besonders bevorzugt ist es erfindungsgemäß, dass die Oberfläche derart chemisch behandelt ist, dass die Oligonukleotide und Primer kovalent daran gebunden werden können.It is very particularly preferred according to the invention that the surface is chemically treated in such a way that the oligonucleotides and primers can be covalently bound to it.
Gegenstand der vorliegenden Erfindung ist ferner eine Vorrichtung, bestehend aus a) einer Oberfläche, auf welcher Primeroligonukleotide mit ihrem 5 ' -Ende immobilisiert sind und zusätzlich Oligonukleotide und/oder PNA-Oligo ere, welche von einer Po- lymerase nicht verlängert werden können; b) einer Kammer, wobei die Oberfläche eine Wand dieser Kammer bildet; c) einer Temperierungseinheit, welche die Kammertemperatur steuert; d) einem System, welches der Kammer Flüssigkeiten zu- führt .The present invention furthermore relates to a device consisting of a) a surface on which primer oligonucleotides are immobilized with their 5 'end and additionally oligonucleotides and / or PNA olig eres which cannot be extended by a polymerase; b) a chamber, the surface of which is a wall of this Chamber forms; c) a temperature control unit that controls the chamber temperature; d) a system which supplies liquids to the chamber.
Beschrieben wird somit ein Verfahren zum Nachweis von DNA-Polymorphismen und Cytosin-Methylierungen, dadurch gekennzeichnet, dass die folgenden Schritte ausgeführt werden:A method for the detection of DNA polymorphisms and cytosine methylations is thus described, characterized in that the following steps are carried out:
Im ersten Verfahrensschritt wird die zu untersuchende DNA aus einer Probe gewonnen.In the first process step, the DNA to be examined is obtained from a sample.
Die zu analysierende genomische DNA wird bevorzugt aus den üblichen Quellen für DNA erhalten, wie z. B. Zelllinien, Blut, Sputum, Stuhl, Urin, Gehirn-Rückenmarks- Flüssigkeit, in Paraffin einbettetes Gewebe, beispielsweise Gewebe von Augen, Darm, Niere, Hirn, Herz, Prosta- ta, Lunge, Brust oder Leber, histologische Objektträger und alle möglichen Kombinationen hiervon. Die DNA kann auch bereits aufgearbeitet oder isoliert vorliegen.The genomic DNA to be analyzed is preferably obtained from the usual sources for DNA, such as. B. cell lines, blood, sputum, stool, urine, brain spinal fluid, paraffin-embedded tissue, for example tissue from the eyes, intestines, kidneys, brain, heart, prostate, lungs, chest or liver, histological slides and all possible combinations of these. The DNA can also already be processed or isolated.
Im optionalen zweiten Verfahrensschritt wird die zu un- tersuchende DNA, falls eine Cytosin-Methylierungsanalyse durchgeführt werden soll, chemisch und/oder enzymatisch behandelt.In the optional second process step, if a cytosine methylation analysis is to be carried out, the DNA to be examined is treated chemically and / or enzymatically.
Die chemische Behandlung der eingesetzten DNA erfolgt be- vorzugt mit Bisulfit (= Disulfit, Hydrogensulfit) derart, dass alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, dass eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben.The chemical treatment of the DNA used is preferably carried out with bisulfite (= disulfite, hydrogen sulfite) in such a way that all of the cytosines which are not methylated at the 5-position of the base are changed such that a base which is different with regard to the base pairing behavior is formed while the cytosines methylated in the 5-position remain unchanged.
Die enzymatische Behandlung erfolgt bevorzugt mit methy- lierungssensitiven Restriktionsenzymen, die zwischen me- thylierter und nicht methylierter DNA unterscheiden können.The enzymatic treatment is preferably carried out using methylation-sensitive restriction enzymes which can differentiate between methylated and unmethylated DNA.
Im nächsten Verfahrensschritt wird die zu untersuchende DNA in einer Polymeraseraktion amplifiziert, wobei einIn the next process step, the DNA to be examined is amplified in a polymer laser action, with a
Primer in Lösung vorliegt und ein Primer an die Oberfläche einer Festphase gebunden ist und wobei mindestens einer der Primer aus zwei Domänen besteht, wobei die am 3'- Ende befindliche Domäne an die zu untersuchende DNA hybridisiert, während die am 5 ' -Ende befindliche Domäne nicht hybridisiert.Primer is in solution and a primer is bound to the surface of a solid phase and at least one of the primers consists of two domains, the domain located at the 3 'end hybridizing to the DNA to be investigated, while the domain located at the 5' end not hybridized.
Die Immobilisierung der amplifizierten Abschnitte auf einer Festphase, erfolgt über zumindest einen in der Ampli- fikation verwendeten Primer. Die Bindung des Primers erfolgt vorzugsweise durch chemische Reaktionen (z.B. durch die Einführung einer C6 5 ' -Aminofunktion) .The amplified sections are immobilized on a solid phase via at least one primer used in the amplification. The primer is preferably bound by chemical reactions (e.g. by introducing a C6 5 'amino function).
Vorzugsweise werden bei der vorliegenden Erfindung Do ä- nenprimer verwendet, die selbst nicht methylierungsspezi- fisch sind, sondern vielmehr nur spezifisch sind für die chemisch (Bisulfit) behandelte DNA. Dies wird auch durch deren bevorzugte Sequenzzusammensetzung deutlich. In der 3 'Domäne sind bevorzugt entweder nur die Basen C, A und T oder aber die Basen G, A und T enthalten, wie es bisul- fitbehandleter DNA entspricht. In der 5 ' Domäne hingegen sind bevozugt alle vier Basen A, C, G und T enthalten. Mit den aus zwei Domänen bestehenden Primern können besonders spezifische zwei-Stufen-Amplifikationen durchgeführt werden, die besonders spezifisch eine Vielzahl von Fragmenten gleichzeitig bereitstellen und die zugleich das Problem löst, dass normalerweise eine Vielzahl von markierten und entsprechend teuren Primern für eine solche komplexe Amplifikation eingesetzt werden müssen.In the present invention, preference is given to using diene primers which are not themselves methylation-specific, but rather are only specific for the chemically (bisulfite) -treated DNA. This is also evident from their preferred sequence composition. The 3 'domain preferably contains only bases C, A and T or bases G, A and T, as corresponds to bisulfite-treated DNA. In the 5 'domain, however, all four bases A, C, G and T are preferably included. With the primers consisting of two domains, particularly specific two-stage amplifications can be carried out, which particularly specifically provide a large number of fragments at the same time and which at the same time solves the problem that a large number of labeled and correspondingly expensive primers are normally used for such a complex amplification Need to become.
Im weiteren Verfahrensschritt wird die im vorherigenIn the further process step, the one in the previous one
Schritt amplifizierte DNA erneut amplifiziert, wobei die Primer dieser zweiten Amplifikation an die am 5 '-Ende befindliche Domäne mindestens eines der ersten Primer hybridisieren oder zu ihr identisch sind und wobei diese Primer für die zweite Amplifikation mit einer nachweisbaren Markierung versehen sind.Step amplified DNA again amplified, the primers of this second amplification hybridizing to the domain located at the 5 'end or at least one of the first primers being identical to it and wherein these primers are provided with a detectable label for the second amplification.
Die Amplifikation der DNA in den beiden vorherigen Verfahrensschritten erfolgt vorzugsweise in einer Polymera- sekettenreaktion, bevorzugt mit einer hitzebeständigen DNA-Polymerase. Die Amplifikation von mehreren DNA- Abschnitten wird vorzugsweise in einem Reaktionsgefäß gemacht .The amplification of the DNA in the two previous method steps is preferably carried out in a polymer chain reaction, preferably with a heat-resistant DNA polymerase. The amplification of several DNA sections is preferably done in a reaction vessel.
Die Markierung der PCR-Produkte erfolgt bevorzugt über absorbierende Farbstoffe und/oder über Chemilumineszenz und/oder über radioaktive Isotope und/oder über Fluoreszenzmarkierungen.The PCR products are preferably labeled via absorbing dyes and / or via chemiluminescence and / or via radioactive isotopes and / or via fluorescent labels.
Vorzugsweise wird der Fluoreszenzmarker durch ein fluoreszenzmarkiertes Nukleotid wie z. B. Cy5-dCTP eingeführt . Im weiteren Verfahrensschritt werden die Amplifikate an Oligonukleotide und/oder PNA-Oligomere hybridisiert, welche an eine Festphase gebunden sind, die in der Amplifi- kation nicht als Primer fungieren, und aus der Hybridisierung auf Sequenzmerkmale oder Methylierungsmuster der zu untersuchenden DNA geschlossen.Preferably, the fluorescent label by a fluorescence-labeled nucleotide such. B. Cy5-dCTP introduced. In the further process step, the amplificates are hybridized to oligonucleotides and / or PNA oligomers which are bound to a solid phase, which do not function as primers in the amplification, and from the hybridization conclusions are drawn about sequence features or methylation patterns of the DNA to be examined.
Die hybridisierten Oligonukleotide können am 3 ' -Ende bei- spielsweise mit folgenden Modifikationen versehen sein: Amino, Phosphat, Thiophosphat, Didesoxy, Carboxy, Di- hydroxy, O-Acetyl oder Alkyl.The hybridized oligonucleotides can be provided at the 3 'end with the following modifications, for example: amino, phosphate, thiophosphate, dideoxy, carboxy, dihydroxy, O-acetyl or alkyl.
In einer besonders bevorzugten Variante des Verfahrens werden DNA-Polymorphismen und Cytosin-Methylierungen in einem Experiment analysiert.In a particularly preferred variant of the method, DNA polymorphisms and cytosine methylations are analyzed in one experiment.
Gegenstand der vorliegenden Erfindung ist ferner eine wie in Fig. 4 schematisierte Vorrichtung zur in situ Amplifi- kation und Analyse von DNA Proben. Sie besteht aus einer geschlossenen und temperierbaren Hybridisierungskammer, einer Pumpe, einem Heizelement und einem Kühlelement, die jeweils miteinander durch Flüssigkeit fördernde Leitungswege, bevorzugt Kunststoffschlauche verbunden sind (DE 19952723 AI) und einem handelsüblichen Objektträger (Oligonukleotid-Array) , auf dem DNA-Oligomere, die als Primer in einer Poly eraseraktion fungieren können, und PNA-Oligomere oder DNA-Oligomere, die nicht als Primer in einer Polymeraseraktion fungieren können, angeordnet sind. Besonders bevorzugt beträgt das Volumen, das die Hybridi- sierungskammer bei eingelegtem Oligomer-Array faßt, weniger als 200 μl.The present invention also relates to a device for the in situ amplification and analysis of DNA samples, as shown in FIG. 4. It consists of a closed and temperature-controlled hybridization chamber, a pump, a heating element and a cooling element, each of which is connected to one another by liquid-conveying conduction paths, preferably plastic tubes (DE 19952723 AI) and a commercially available slide (oligonucleotide array) on which DNA oligomers which can act as primers in a polymerase action, and PNA oligomers or DNA oligomers which cannot act as primers in a polymerase action are arranged. The volume that the hybridization chamber holds when an oligomer array is inserted is particularly preferably less than 200 μl.
Gegenstand der vorliegenden Erfindung ist weiterhin eine Vorrichtung zur Analyse von DNA Proben. Diese besteht mindestens aus einer Oberfläche, auf der DNA-Oligomere, die als Primer in einer Polymeraseraktion fungieren können, und PNA-Oligomere oder DNA-Oligomere, die nicht als Primer in einer Polymeraseraktion fungieren können, angeordnet sind.The present invention furthermore relates to a device for analyzing DNA samples. This consists of at least one surface on which DNA oligomers which can act as primers in a polymerase action and PNA oligomers or DNA oligomers which cannot act as primers in a polymerase action are arranged.
Das besonders bevorzugte Hin- und Herpumpen der Probenflüssigkeit in der Vorrichtung stellt sicher, daß ein ausreichender Teil der doppelsträngigen DNA-Probe an die Oligomere des Arrays hybridisiert.The particularly preferred pumping of the sample liquid back and forth in the device ensures that a sufficient part of the double-stranded DNA sample hybridizes to the oligomers of the array.
Die folgenden Beispiele erläutern die Erfindung:The following examples illustrate the invention:
Beispiel 1: Amplifikation immobilisierter DNA-FragmenteExample 1: Amplification of immobilized DNA fragments
Herstellung des ESR1 (Acc. No. EP11141) PCR-Produkts Die DNA Fragmente, von denen nur ein Strang verwendet wird, werden für eine kovalente Bindung mit Isothiocya- natgruppen auf der benutzten Lysinoberflache mit einerPreparation of the ESR1 (Acc. No. EP11141) PCR product. The DNA fragments, of which only one strand is used, are used for covalent binding with isothiocyanate groups on the lysine surface used
Aminomodifikationen am 5 ' -Ende versehen. Die entsprechenden PCR Produkte müssen mit Fluoreszenzmarkern zur Kontrolle des Bindungsvorgangs versehen werden, wobei die Glasoberflächen auf das Vorhandensein eines Fluoreszenz- signals geprüft werden.Amino modifications provided at the 5 'end. The corresponding PCR products must be provided with fluorescence markers to control the binding process, the glass surfaces being checked for the presence of a fluorescence signal.
PCR Bedingungen: 2 μl DNA (20 ng) (Bisulfit behandelt); 0.4 μl Taq (2 units, Qiagen) ; 0,4 μl dNTP (jeweils 25 mmol/1, MBI Fermentas) 0,25 mmol/1 Endkonzentration; 2 μlPCR conditions: 2 μl DNA (20 ng) (bisulfite treated); 0.4 µl Taq (2 units, Qiagen); 0.4 μl dNTP (25 each mmol / 1, MBI Fermentas) 0.25 mmol / 1 final concentration; 2 ul
Primerl (12,5 pmol/μl) 0,5 pmol/μl Endkonzentration; 2 μlPrimer (12.5 pmol / μl) 0.5 pmol / μl final concentration; 2 ul
Primer2 (12,5 pmol/μl) 0,5 pmol/μl Endkonzentration; 5 μl lOx PCR Puffer (Qiagen) ; 1 μl MgCl (15 mmol/1, Qiagen)Primer2 (12.5 pmol / μl) 0.5 pmol / μl final concentration; 5 ul 10X PCR buffer (Qiagen); 1 μl MgCl (15 mmol / 1, Qiagen)
2,0 mmol/1 Mg Endkonzentration; 1 μl dATP Fluorescin (0,05 mmol/1) 0,5 μmol/1 Endkonzentration und 36,2 μl ddH202.0 mmol / 1 mg final concentration; 1 μl dATP fluorescin (0.05 mmol / 1) 0.5 μmol / 1 final concentration and 36.2 μl ddH 2 0
PCR-Programm: 95°C für 15:00 min; 95°C für 1:00 min; 55 .0 °C für 0:45 min; 72°C für 1:15 min; Zyklen: 40; 72°C für 10:00 min; 4°C für den EndpunktPCR program: 95 ° C for 15:00 min; 95 ° C for 1:00 min; 55 .0 ° C for 0:45 min; 72 ° C for 1:15 min; Cycles: 40; 72 ° C for 10:00 min; 4 ° C for the end point
Figure imgf000015_0001
Figure imgf000015_0001
*U markiert den oberen Strang (forward) , L markiert* U marks the upper strand (forward), L marks
L5 den unteren Strang (reverse)L5 the lower strand (reverse)
**A markiert die Primer mit der Aminomodifikation am 5 ' -Ende** A marks the primers with the amino modification at the 5 'end
Immobilisierung der PCR-Produkte auf Oberflächen (Beads)Immobilization of the PCR products on surfaces (beads)
2020
Die gereinigten PCR-Produkte wurden für die Immobilisierung auf Glasoberflächen (Beads) verwendet. Sie unterschieden sich nur in ihrer 5 ' -Modifikation. Ein Produkt hatte die H2 Gruppe am 5 ' -Ende des oberen Strangs (for5 ward), das andere hatte diese Gruppe am 5 ' -Ende des unte- ren Strangs (reverse) . Während der Versuchsdurchführung wurden Doppelstränge gebunden, nach dem Denaturieren und Waschen werden jedoch zwei verschiedene Einzelstränge immobilisiert. Der Erfolg dieses Bindungsvorgangs wurde ü- ber Fluorenzenzmessungen bestimmt. Erstens konnte ein Fluoreszenssignal der Beads nachgewiesen werden. Zweitens konnte eine Abnahme des Fluoreszenssignals des Immobilisierungspuffers gegenüber einem Kontrollpuffer gezeigt werden.The purified PCR products were used for the immobilization on glass surfaces (beads). They only differed in their 5 'modification. One product had the H 2 group at the 5 'end of the upper strand (for5 ward), the other had this group at the 5' end of the lower strand. reverse strand. During the test, double strands were bound, but after denaturing and washing, two different single strands are immobilized. The success of this binding process was determined using fluorescence measurements. First, a fluorescence signal from the beads was detected. Secondly, a decrease in the fluorescence signal of the immobilization buffer compared to a control buffer could be shown.
18 μl gereinigtes PCR Produkt wurde zu 28 μl Immobilisierungspuffer (0,5 molares EDTA; 2,1% Methylimidazol; 0,06% Tween) gegeben. Dann wurden 23 μl der Mischung zu 42 mg PITC (Phenylendiisothiocyanat) modifizierten Beads (n=30) in Reaktionsgefäße gegeben und bei 28 °C über18 μl of purified PCR product was added to 28 μl of immobilization buffer (0.5 molar EDTA; 2.1% methylimidazole; 0.06% Tween). Then 23 μl of the mixture were added to 42 mg of PITC (phenylene diisothiocyanate) modified beads (n = 30) in reaction vessels and transferred at 28 ° C.
Nacht inkubiert. Danach wurde mit 1% Ammoniaklösung für 20 min desaktiviert .Incubated overnight. It was then deactivated with 1% ammonia solution for 20 min.
Immobilisierung der PCR-Produkte auf verschiedenen OberflächenImmobilization of the PCR products on different surfaces
In einem Vergleichsexperiment wurden die unterschiedlichen Bindungseigenschaften von Amino modifiziertem und unmodifiziertem PCR Produkt untersucht. Dabei wurde die Spezifität für drei verschiedene Oberflächen getestet: Lysin modifizierte, Isothiocyanat (PITC) modifizierte und mit Primern beladene und deaktivierte Glassoberflächen.In a comparative experiment, the different binding properties of amino modified and unmodified PCR products were examined. The specificity was tested for three different surfaces: lysine modified, isothiocyanate (PITC) modified and primer loaded and deactivated glass surfaces.
40 μl gereinigtes PCR-Produkt (~0, 25 pmol/μl) wurden mit 50 μl Immobilisierungspuffer gemischt, 42 mg Beads (n=30) wurden in ein Reaktionsgefäß gegegen, 30 μl des Gemisches zugegeben und bei 28 °C zwei Nächte inkubiert.
Figure imgf000017_0001
40 μl of purified PCR product (~ 0.25 pmol / μl) were mixed with 50 μl of immobilization buffer, 42 mg of beads (n = 30) were placed in a reaction vessel, 30 μl of the mixture were added and incubated at 28 ° C. for two nights.
Figure imgf000017_0001
Denaturierung des immobilisierten PCR-ProduktsDenaturation of the immobilized PCR product
Die Beads wurden mehrere Male in den Reaktionsgefäßen unter Denaturierungsbedingungen gewaschen. Nach jedem Dena- turierungs-schritt wurden die Beads zusätzlich mit 1 ml Wasser gewaschen und einige Beads von jedem Typ aufbewahrt. Alle anderen Beads wurden für den nächsten Denatu- rierungsschritt (1. 5 min , 95 °C mit Wasser; 2. 10 min , 25 °C mit 10 mM P04 -Puffer/ 1 % SDS; 3. 2 mal 5 min , 25 °C mit 0,05 m NaOH; 4. 30 min 0,2 M NaOH / 0,1 % SDS) verwendet. Am Ende wurden die Beads im Vakuum getrocknet und aufbewahrt.The beads were washed several times in the reaction vessels under denaturing conditions. After each denaturation step, the beads were additionally washed with 1 ml of water and some beads of each type were kept. All other beads were used for the next denaturation step (1. 5 min, 95 ° C with water; 2. 10 min, 25 ° C with 10 mM P0 4 buffer / 1% SDS; 3. 2 times 5 min, 25 ° C with 0.05 M NaOH; 4. 30 min 0.2 M NaOH / 0.1% SDS) was used. At the end the beads were dried in a vacuum and stored.
PCR und Reamplifikation der an die Glasoberfläche gebundenen DNA-FragmentePCR and reamplification of the DNA fragments bound to the glass surface
Die auf die Glasoberflächen immobilisierte DNA, die 4 Mal gewaschen und denaturiert wurde (siehe oben) , wurde für die PCR als Templat verwendet. Für die PCR wurde ein Mastermix hergestellt und nur ein Bead in jedes Reaktionsgefäß gegeben.The DNA immobilized on the glass surfaces, which was washed 4 times and denatured (see above), was used as a template for the PCR. A master mix was prepared for the PCR and only one bead was added to each reaction vessel.
PCR Bedingungen für 1 Glasbead bzw. 10 ng Bisulfit behandelte DNA als Kontrolle: 0.2 μl Taq (1 Einheit), 0,2 μl dNTP (jeweils 25 mM) 0,2 mM Endkonzentration, 1 μl Primerl (12,5 pmol/μl) 0,5 pmol/μl Endkonzentration; 1 μl Primer2 (12,5 pmol/μl) 0,5 pmol/μl Endkonzentration; 2,5 μl (lOx) Puffer; 20,1 μl H20PCR conditions for 1 glass bead or 10 ng bisulfite-treated DNA as a control: 0.2 μl Taq (1 unit), 0.2 μl dNTP (each 25 mM) 0.2 mM final concentration, 1 μl primer (12.5 pmol / μl) 0.5 pmol / μl final concentration; 1 ul Primer2 (12.5 pmol / μl) 0.5 pmol / μl final concentration; 2.5 ul (10x) buffer; 20.1 ul H 2 0
Primer:primer:
ER1-B-U AGGAGGGGGAATTAAATAGAER1-B-U AGGAGGGGGAATTAAATAGA
ER1-B-L ACAATAAAACCATCCCAAATACER1-B-L ACAATAAAACCATCCCAAATAC
Programm:Program:
95°C/15:00; 95°C/1:00; 55 °C/0:45; 72°C/1:15; cycles:40;95 ° C / 15: 00; 95 ° C / 1: 00; 55 ° C / 0:45; 72 ° C / 1: 15; cycles: 40;
72°C/10:00; 4°C/Endpunkt72 ° C / 10: 00; 4 ° C / endpoint
Beispiel 2: Primerverlängerung eines immobilisierten ESRl-Primers und Amplifikation des immobilisierten Verlängerungsprodukts mit Gen-spezifischen und generischen (M13 Domäne) PCR-Primern.Example 2: Primer extension of an immobilized ESRI primer and amplification of the immobilized extension product with gene-specific and generic (M13 domain) PCR primers.
Die folgenden aminomodifizierten Primer wurden auf PITC modifizierte Glasbeads gebunden:The following amino modified primers were bound to PITC modified glass beads:
R75 MDR1-B-U-M13a-AGTAAAACGACGGCCAGTTAAGTATGTTGAAGAAAGATTATTGTAG 5 ' -AminoR75 MDR1-B-U-M13a-AGTAAAACGACGGCCAGTTAAGTATGTTGAAGAAAGATTATTGTAG 5 'amino
R76 MDR1-B-L-M13b-ACAGGAAACAGCTATGACTAAAΑACTATCCCATAATAACTCCCAAC 5' -AminoR76 MDR1-B-L-M13b-ACAGGAAACAGCTATGACTAAAΑACTATCCCATAATAACTCCCAAC 5 'amino
R77 ER1-B-U-M13a-A GTAAAACGACGGCCAGTAGGAGGGGGAATTAAATAGA 5 ' -AminoR77 ER1-B-U-M13a-A GTAAAACGACGGCCAGTAGGAGGGGGAATTAAATAGA 5 'amino
R78 ER1-B-L-M13b-A CAGGAAACAGCTATGACACAATAAAACCATCCCAAATAC 5 ' -AminoR78 ER1-B-L-M13b-A CAGGAAACAGCTATGACACAATAAAACCATCCCAAATAC 5 'amino
Der Immobilisierungspuffer wurde optimiert für das Auftragen von NH2 markierten Oligonukleotiden auf PITC deri- vatisierte Lysinoberflachen. Hier wurde der Puffer für die Immobilisierung in den gleichen Konzentrationen ver- wendet: 0,5 molares EDTA; 2,1% Methyli idazol; 0,06% Tween, Verwendung von 14 μl (Puffer) + 7 μl (DNA/Oligonukleotid) Lösung, 5 pmol/μl Oligonukleotid Endkonzentration 21 μl der Mischung wurden zu 42 mg PITC modifizierten Beads (n=30) in Reaktionsgefäße gegeben und bei 28 °C ü- ber Nacht inkubiert. Danach wurde mit 1% Anmmoniaklösung für 15 min deaktiviert. Nach dem Entfernen der Lösung wurden die Beads getrocknet und unter Vakuum aufbewahrt.The immobilization buffer was optimized for the application of NH 2 -labeled oligonucleotides to PITC-derivatized lysine surfaces. Here the buffer for the immobilization was used in the same concentrations: 0.5 molar EDTA; 2.1% methyl idazole; 0.06% Tween, using 14 μl (buffer) + 7 μl (DNA / oligonucleotide) solution, 5 pmol / μl final oligonucleotide concentration 21 μl of the mixture were added to 42 mg of PITC-modified beads (n = 30) in reaction vessels and incubated at 28 ° C. overnight. Then it was deactivated with 1% ammonia solution for 15 min. After removing the solution, the beads were dried and stored under vacuum.
Die PCR wurde in 0,2 ml Reaktionsgefäßen wie oben beschrieben im Eppendorf Cycler durchgeführt; 5 Primer be- ladene PITC-Beads wurden in jedes Reaktionsgefäß gegeben; als Templat wurde PCR-Produkt verwendet (gereinigt, unverdünnt, 5'-Cy5 markiert):The PCR was carried out in 0.2 ml reaction tubes as described above in the Eppendorf cycler; 5 primer-loaded PITC beads were placed in each reaction tube; PCR product was used as template (purified, undiluted, 5'-Cy5 labeled):
5 Beads; 1 μl gereinigtes PCR-Produkt; 0,2 μl Taq (1 unit); 0,2 μl dNTP (jeweils 25 mM) 0,2 mM Endkonzentration; 2,5 μl (lOx) Puffer; 22,1 μl H205 beads; 1 µl of purified PCR product; 0.2 ul Taq (1 unit); 0.2 ul dNTP (25 mM each) 0.2 mM final concentration; 2.5 ul (10x) buffer; 22.1 ul H 2 0
Programm: 95°C/15:00; 95°C/1:00; 55 °C/0:45; 72°C/1:15; Zyklen: 40; 72°C/10:00; 4°C/EndkonzentrationProgram: 95 ° C / 15: 00; 95 ° C / 1: 00; 55 ° C / 0:45; 72 ° C / 1: 15; Cycles: 40; 72 ° C / 10: 00; 4 ° C / final concentration
Figure imgf000019_0001
Figure imgf000019_0001
Waschen (Puffer: 1 x PBS und 0,1 % SDS) und denaturieren der Beads mit verlängerten Primern.Wash (buffer: 1 x PBS and 0.1% SDS) and denature the beads with extended primers.
Vorgehen: 0,2 ml Reaktionsgefäße im Cycler bei 96°C; Zugabe von lOOμl lxPBS/0,1% SDS im Reaktionsgefäß, 5 min Reaktionszeit, Reinigung der Beads, alte Lösung verwerfen und erneut 100 μl zugeben, diesen Schritt 4 Mal wiederholen; abschließend wurden die Beads 2 Mal mit Wasser gewaschen und im Vakuum getrocknet.Procedure: 0.2 ml reaction tubes in the cycler at 96 ° C; Add 100 μl lxPBS / 0.1% SDS in the reaction vessel, 5 min Reaction time, cleaning the beads, discard old solution and add 100 μl again, repeat this step 4 times; finally the beads were washed twice with water and dried in vacuo.
Zur Überprüfung der spezifischen Verlängerung wurden auch 2 Sorten Beads eingesetzt, auf denen Primeroligonukleoti- de immobilisiert waren, die nicht komplementär zum verwendeten Templat waren und deshalb nicht verlängert wur- den.To check the specific extension, two types of beads were also used, on which primer oligonucleotides were immobilized, which were not complementary to the template used and were therefore not extended.
1 Bead von jedem Reaktionsgefäß wurde verwendet zum Scannen der Cy5 und Cy3 Signale. Es wurde erwartet, dass die Cy5 Signale von Bead 1-4 (nur Bead 1-4 wurden mit dem Cy5 PCR-Produkt kontaktiert) verschwinden würden. Bei erfolgreicher Verlängerung auf dem Bead sind Cy3 Signale detek- tierbar, auch nach stringenter Denaturierung. Die gescannten Bilder hierzu sind unten abgebildet.1 bead from each reaction tube was used to scan the Cy5 and Cy3 signals. The Cy5 signals from Bead 1-4 (only Bead 1-4 were contacted with the Cy5 PCR product) were expected to disappear. If the extension on the bead is successful, Cy3 signals can be detected, even after stringent denaturation. The scanned images are shown below.
PCR zur Überprüfung der gebundenen verlängerten Primer nach dem WaschenPCR to check the bound extended primer after washing
Die Primer von ESRl und MDRl mit Aminofunktion wurden auf PITC Beads immobilisiert. Alle Primer haben eine M13 Do- mäne und eine genspezifische Domäne. Nach der Immobilisierung wurden die Beads ohne zusätzliche Primeroligo- nukleotide in Lösung zur PCR Präparation gegeben mit einem PCR Produkt als Templat. Während der Zyklen werden die gebundenen Primer an einzelsträngige DNA der PCR Pro- dukte angelagert und verlängert. Mit dieser PCR wird der Erfolg der Verlängerungsreaktion überprüft. ESRl PCR Produkt wurde als Templat verwendet, das keine M13 Domäne aufweist. Die verwendeten Primer sind spezifisch für die verlängerten Primer (Ergebnisse siehe unten) . Bei einer erfolgten Verlängerung auf den Glasoberflächen sind nur die PCRs 3a und 4b positiv, ebenso die Kontrollen 7a undThe primers of ESRI and MDRI with amino function were immobilized on PITC beads. All primers have an M13 domain and a gene-specific domain. After the immobilization, the beads were added to the PCR preparation without additional primer oligonucleotides using a PCR product as a template. During the cycles, the bound primers are attached to single-stranded DNA of the PCR products and extended. The success of the extension reaction is checked with this PCR. ESRI PCR product was used as a template that has no M13 domain. The primers used are specific for the extended primers (see results below). At a extension on the glass surfaces, only PCRs 3a and 4b are positive, as are controls 7a and
7b. Nur diese Reaktionsgefäße beinhalten Templat für die entsprechenden Primer.7b. Only these reaction vessels contain templates for the corresponding primers.
PCR Bedingungen:PCR conditions:
1 Bead; 0.2 μl Taq;1 bead; 0.2 µl Taq;
0,2 μl dNTP (jeweils 25 mM) 0,2 mM Endkonzentration;0.2 ul dNTP (25 mM each) 0.2 mM final concentration;
1 μl Primerl (12,5 pmol/μl) 0,5 pmol/μl Endkonzentration;1 μl primer (12.5 pmol / μl) 0.5 pmol / μl final concentration;
1 μl Primer2 (12,5 pmol/μl) 0,5 pmol/μl Endkonzentration;1 ul primer2 (12.5 pmol / ul) 0.5 pmol / ul final concentration;
2,5 μl Puffer; 20,1 H202.5 ul buffer; 20.1 H 2 0
Primer:primer:
R61 M13-a GTAAAACGACGGCCAGTR61 M13-a GTAAAACGACGGCCAGT
R63 M13-b CAGGAAACAGCTATGACR63 M13-b CAGGAAACAGCTATGAC
R83 ESR1-B-U AGGAGGGGGAATTAAATAGAR83 ESR1-B-U AGGAGGGGGAATTAAATAGA
R84 ESR1-B-L ACAATAAAACCATCCCAAATACR84 ESR1-B-L ACAATAAAACCATCCCAAATAC
Templat:template:
1 Bead von der Verlängerung nach der Denaturierung wurde für den jeweiligen Versuch verwendet.1 bead from the extension after denaturation was used for the respective experiment.
Programm: 95°C/15:00; 95°C/1:00; 55 °C/0:45; 72°C/1:15; Zyklen:40; 72°C/10:00; 4°C/EndpunktProgram: 95 ° C / 15: 00; 95 ° C / 1: 00; 55 ° C / 0:45; 72 ° C / 1: 15; Cycles: 40; 72 ° C / 10: 00; 4 ° C / endpoint
Immobilisierte Primeroligonukleotide auf Glasbeads wie im vorangehenden Experiment beschrieben. Immobilized primer oligonucleotides on glass beads as described in the previous experiment.
Reaktionsgefäße :Reaction vessels:
Figure imgf000022_0001
Figure imgf000022_0001
Agarosegel (aufgetragen jeweils 5μl) zu den PCR Ansätzen mit Bead Nr. 1-7: siehe Fig. 3Agarose gel (5 μl applied in each case) for the PCR batches with bead no. 1-7: see FIG. 3
Beispiel 3: In situ-Amplifikation des Gens ESRl und Analyse des Methylierungsstatus einer CpG Position auf einem Mikroarray.Example 3: In situ amplification of the ESRI gene and analysis of the methylation status of a CpG position on a microarray.
1. Herstellung des Mikroarrays1. Manufacture of the microarray
Ein Glasobjektträger (Array) wurde chemisch modifiziert und folgende Oligonukleotide mit einem handelsüblichenA glass slide (array) was chemically modified and the following oligonucleotides with a commercially available
Spotter in vierfacher Redundanz auf den Array aufgetragen und mit dem 5 ' -Ende kovalent an die Oberfläche gebunden:Spotter applied to the array in fourfold redundancy and covalently bound to the surface with the 5 'end:
a) Das Oligonukleotid ESRl-B-U-M13aa) The oligonucleotide ESRI-B-U-M13a
GTAAACGACGGCCAGTAGGAGGGGGAATTAAATAGA, dessen kursiv gedruckte Nukleotide mit dem zu amplifizierenden ESRl Amplifikat (Position (1-20) übereinstimmen.GTAAACGACGGCCAGTAGGAGGGGGAATTAAATAGA, its italic printed nucleotides agree with the ESRI amplicon to be amplified (position (1-20)).
b) Die Oligonukleotide ESRl-CG (TAGGTTTTCGGGGTAGGG) und ESR1-TG (TAGGTTTTTGGGGTAGGG) für die Bestimmung des Methylierungsstatus des CpG an Position 457-474 des ERSl-Amplifikats . c) Die Bisulfitsequenz des ESRl Gens (Acc. No. EP11141) ist nachfolgend dargestellt:b) The oligonucleotides ESRI-CG (TAGGTTTTCGGGGTAGGG) and ESR1-TG (TAGGTTTTTGGGGTAGGG) for the determination of the methylation status of the CpG at position 457-474 of the ERS1 amplificate. c) The bisulfite sequence of the ESRI gene (Acc. No. EP11141) is shown below:
AGGAGGGGGAATTAAATAGAAAGAGAGATAAATAGAGATATATCGGAGTTTGGTACG GGGTATATAAGGTAGTATATTAGAGAAAGTCGGTTTTTGGATTCGTTTTTCGCGTTT ATTTTAAGTTTAGTTTTTTTTGGGTTATTTTTAGTAGATTTTCGTGCGTTTTCGTTT TTTGGTCGTGAAATTTAGTTTTTATTTAGTAGCGACGATAAGTAAAGTAAAGTTTAG GGAAGTTGTTTTTTGGGATGTTTAAATCGAGTTGTGTTTGGAGTGATGTTTAAGTTA ATGTTAGGGTAAGGTAATAGTTTTTGGTCGTTTTTTAGTATTTTTGTAATGTATATG AGTTCGGGAGATTAGTATTTAAAGTTGGAGGTTCGGGAGTTTAGGAGTTGGCGGAGG GCGTTCGTTTTGGGATTGTATTTGTTTTCGTCGGGTCGTTCGGTTTTATCGGATTCG TAGGTTTTCGGGGTAGGGTCGGGGTTAGAGTTCGCGTGTCGGCGGGATATGCGTTGC GTCGTTTTTAATTTCGGGTTGTGTTTTTTTTTTAGGTGGTTCGTCGGTTTTTGAGTT TTTTGTTTTGCGGGGATACGGTTTGTATTTTGTTCGCGGTTACGGATTATGATTATG ATTTTTTATATTAAAGTATTTGGGATGGTTTTATTGTAGGAGGGGGAATTAAATAGAAAGAGAGATAAATAGAGATATATCGGAGTTTGGTACG GGGTATATAAGGTAGTATATTAGAGAAAGTCGGTTTTTGGATTCGTTTTTCGCGTTT ATTTTAAGTTTAGTTTTTTTTGGGTTATTTTTAGTAGATTTTCGTGCGTTTTCGTTT TTTGGTCGTGAAATTTAGTTTTTATTTAGTAGCGACGATAAGTAAAGTAAAGTTTAG GGAAGTTGTTTTTTGGGATGTTTAAATCGAGTTGTGTTTGGAGTGATGTTTAAGTTA ATGTTAGGGTAAGGTAATAGTTTTTGGTCGTTTTTTAGTATTTTTGTAATGTATATG AGTTCGGGAGATTAGTATTTAAAGTTGGAGGTTCGGGAGTTTAGGAGTTGGCGGAGG GCGTTCGTTTTGGGATTGTATTTGTTTTCGTCGGGTCGTTCGGTTTTATCGGATTCG TAGGTTTTCGGGGTAGGGTCGGGGTTAGAGTTCGCGTGTCGGCGGGATATGCGTTGC GTCGTTTTTAATTTCGGGTTGTGTTTTTTTTTTAGGTGGTTCGTCGGTTTTTGAGTT TTTTGTTTTGCGGGGATACGGTTTGTATTTTGTTCGCGGTTACGGATTATGATTATG ATTTTTTATATTAAAGTATTTGGGATGGTTTTATTGT
Die Verteilung der Oligonukleotide auf dem Array ist in Fig. 5 dargestellt.The distribution of the oligonucleotides on the array is shown in FIG. 5.
2. Insitu-Amplifikation von ESRl2. In situ amplification of ESRI
Die Insitu-Amplifikation wurde in der von der Epigenomics AG entwickelten Hybridisierungskammer durchgeführt. Hierzu wurden 200 μl der PCR-Lsg. (50 ng Bisulfit behandelte humane genomische DNA, dNTPs 0,25 mM, 0,5 μM Primer ESRl- B-L ACAATAAAACCATCCCAAATAC oder Primer ESR1-B-U-Ml3b CAGGAAACAGCTATGACACAATAAAACCATCCCAAATAC, 20 μl lOx Reaktionpuffer, 5 U Taq-Polymerase (Qiagen, Hilden) in ein Reaktionsgefäß (Volumen 500μl) gefüllt und mit Mineralöl überschichtet. Das Reaktionsgefäß wurde in die Denaturie- rungsposition der Hybridisierungskammer gestellt und mit einem Teflonschlauch mit der Reaktions (Hybridisierungs) - kammer verbunden (s. Fig. 4). Die PCR-Reaktion erfolgte durch ein Hinundherpumpen der PCR-Lösung zwischen Denatu- rierungsposition und der Reaktions- (Hybridisierungs-) - kammer. Dieser Vorgang wurde durch folgendes Pump/Temperaturprogramm gesteuert (Tab. 1, Schritt 1-8). Die PCR-Reaktion war beendet, nachdem die Programmschritte 2-7 38mal durchlaufen waren.The in-situ amplification was carried out in the hybridization chamber developed by Epigenomics AG. For this purpose, 200 μl of the PCR solution. (50 ng bisulfite-treated human genomic DNA, dNTPs 0.25 mM, 0.5 μM primer ESRI- BL ACAATAAAACCATCCCAAATAC or primer ESR1-BU-Ml3b CAGGAAACAGCTATGACACAATAAAACCATCCCAAATAC, 20 μl lOx reaction buffer, 5 U Taq polymerase (Qiagen, Hilden) filled in a reaction vessel (volume 500μl) and covered with mineral oil. The reaction vessel was placed in the denaturing position of the hybridization chamber and connected to the reaction (hybridization) chamber with a Teflon tube (see FIG. 4). The PCR reaction was carried out by pumping the PCR solution back and forth between the denaturation position and the reaction (hybridization) chamber. This process was controlled by the following pump / temperature program (Tab. 1, steps 1-8). The PCR reaction was finished after the program steps 2-7 had been run through 38 times.
Tabelle: 1 Pumpen und TemperaturprogrammTable: 1 pumps and temperature program
Schritt Dauer T-Kammer Pumpe T-Denat. Position d. PCR- -Lsg.Step duration T-chamber pump T-Denat. Position d. PCR solution.
1 15min 55°C aus 96°C D1 15min 55 ° C from 96 ° C D
2 lsec 55°C ein 96°C D->K2 lsec 55 ° C a 96 ° C D-> K
3 1min 55°C aus 96°C K3 1min 55 ° C from 96 ° C K.
4 3min 70°C aus 96°C K4 3min 70 ° C from 96 ° C K.
5 1min 96°C aus 96°C K5 1min 96 ° C from 96 ° C K.
Schritt 2-5, 5mal wiederholenRepeat steps 2-5, 5 times
6 lsec 55°C ein 96°C ' K->D6 lsec 55 ° C a 96 ° C ' K-> D
7 1min 55°C aus 96°C D7 1min 55 ° C from 96 ° C D
8 lsec 55°C ein 96°C D->K8 lsec 55 ° C a 96 ° C D-> K
9 1min 55°C aus 96°C K9 1min 55 ° C from 96 ° C K.
10 3min 70°C aus 96°C K10 3min 70 ° C from 96 ° C K.
11 15min 70°C aus 96°C K11 15min 70 ° C from 96 ° C K.
12 lsec 70°C ein 25°C K->D12 lsec 70 ° C a 25 ° C K-> D
Schritt 6-10, 38mal wiederholenRepeat steps 6-10, 38 times
8 oo 38°C aus 25°C D8 oo 38 ° C from 25 ° C D
PAUSEBREAK
Zugabe des HybridisierungspuffersAdd the hybridization buffer
9 3min 40°C aus 96°G D9 3min 40 ° C from 96 ° G D
10 lsec 40°C ein 96°C D->K10 lsec 40 ° C a 96 ° C D-> K
11 5min 40°C ein 96°C K<->K11 5min 40 ° C a 96 ° C K <-> K
12 lsec 40°C ein 96°C K->D12 lsec 40 ° C a 96 ° C K-> D
Schritt 9-12, 70mal wiederholen 3. Analyse des MethylierungsstatusRepeat steps 9-12, 70 times 3. Analysis of the methylation status
Nach der Insitu-Amplifikation (Schritt 8, Tab. 1) werden 400 μl Hybridisierungspuffer (6,9 x SSC, 2,7 Na-After the in-situ amplification (step 8, table 1), 400 μl hybridization buffer (6.9 x SSC, 2.7 Na-
Laurylsarccosinat) zum PCR-Ansatz im Reaktionsgefäß (De- naturierungsposition) pipettiert und der Hybridisie- rungsprozess gestartet (Schritt 9, Tab. 1). Nach 70 Wiederholungen der Schritte 9-12 wird die Hybridisierung be- endet und die Arrays werden gewaschen. Die getrockneten Arrays wurden in eine Fluoreszensscanner analysiert und der Methylierungsstatus nach einer bekannten Methode bestimmt (Model F., Adorjan P., Olek, A. , Piepenbrock, C, Bioinformatics . 2001, 17, Suppll : 157-64) .Pipet lauryl sarcosinate) to the PCR mixture in the reaction vessel (denaturation position) and the hybridization process started (step 9, Tab. 1). After 70 repetitions of steps 9-12, the hybridization is ended and the arrays are washed. The dried arrays were analyzed in a fluorescence scanner and the methylation status was determined by a known method (Model F., Adorjan P., Olek, A., Piepenbrock, C, Bioinformatics. 2001, 17, Suppll: 157-64).
Kurze Beschreibung der Figuren:Brief description of the figures:
Fig. 1: ESR PCR-ProduktFig. 1: ESR PCR product
M = Größenmarker, 1 = PCR Set 1, 2 = PCR Set 2M = size marker, 1 = PCR set 1, 2 = PCR set 2
Fig. 2: Reaktionsgefäße (Bead Nr. B) : Bl: Beads nach der 2. Denaturierung; B2 : Beads nach der 3. Denaturierung; B3: Beads nach der 4. Denaturierung; B4 : keine Beads, kein Templat;2: reaction vessels (Bead No. B): B1: beads after the second denaturation; B2: beads after the 3rd denaturation; B3: beads after the 4th denaturation; B4: no beads, no template;
B5: keine Beads, 1 μl Bisulfit DNAB5: no beads, 1 μl bisulfite DNA
Fig. 3:Fig. 3:
Die Serie a zeigt die PCR Ansätze mit dem Kontrollset für Bead Nr. 3. Da die Kontrolle 6a (Templat ohne M13 Domäne) negativ ist und die Kontrolle 7a (Templat mit M13 Domäne) positiv ist, kann auf eine erfolgreiche Verlängerung geschlossen werden. An der Kontrolle 6b kann man sehen, dass die verwendeten Primeroligonukleotide auch Templat ohne M13 Domäme reamplifizieren. Fig. 4: P Pumpe T Schläuche K ReaktionskammerSeries a shows the PCR batches with the control set for Bead No. 3. Since control 6a (template without M13 domain) is negative and control 7a (template with M13 domain) is positive, a successful extension can be concluded. Control 6b shows that the primer oligonucleotides used also reamplify templates without M13 domains. Fig. 4: P pump T tubes K reaction chamber
D Denaturierungsposition C ChipD denaturation position C chip
Fig. 5: Schematische Darstellung des Chip Layouts:Fig. 5: Schematic representation of the chip layout:
Die schwarzen Punkte stellen die Positionen der immobilisierten Primer da (B) . Die Lage derThe black dots represent the positions of the immobilized primers (B). The location of the
Methylierungsdetektionsoligos auf dem Chip werden durch weiße Punkte TG-Oligonukleotid (TAGGTTTTTGGGGTAGGG) und graue Punkte CG-Oligonukleotid (TAGGTTTTCGGGGTAGGG) dargestellt (A) . Methylation detection oligos on the chip are represented by white dots TG oligonucleotide (TAGGTTTTTGGGGTAGGG) and gray dots CG oligonucleotide (TAGGTTTTCGGGGTAGGG) (A).

Claims

Patentansprüche claims
1. Verfahren zum Nachweis von DNA-Polymorphismen und Cy- tosin-Methylierung, dadurch gekennzeichnet, dass man die folgenden Schritte ausgeführt: a) man gewinnt die zu untersuchende DNA aus einer Probe; b) die zu untersuchende DNA wird in einer Polymerase- raktion amplifiziert, wobei ein Primer in Lösung vorliegt und ein Primer an die Oberfläche einer Festphase gebunden ist und wobei mindestens einer der Primer aus zwei Domänen besteht, wobei die am 3 '-Ende befindliche an die zu untersuchende DNA hybridisiert, während die am 5 '-Ende befindliche nicht hybridisiert; c) die in Schritt c) amplifizierte DNA wird erneut amplifiziert, wobei die Primer dieser zweiten Amplifikation an die am 5 '-Ende befindliche Domäne indes- tens eines der ersten Primer hybridisieren oder zu ihr identisch sind und wobei diese Primer für die zweite Amplifikation mit einer nachweisbaren Markierung versehen sind; d) die Amplifikate werden an Oligonukleotide und/oder PNA-Oligomere hybridisiert, welche an eine Festphase gebunden sind, die in der Amplifikation nicht als Primer fungieren, und aus der Hybridisierung auf Sequenzmerkmale oder Methylierungsmuster der zu untersuchenden DNA geschlossen.1. A method for the detection of DNA polymorphisms and cytosine methylation, characterized in that the following steps are carried out: a) the DNA to be examined is obtained from a sample; b) the DNA to be examined is amplified in a polymerase reaction, a primer being in solution and a primer being bound to the surface of a solid phase, and at least one of the primers consisting of two domains, the one located at the 3 'end the DNA to be examined hybridizes, while the one located at the 5 'end does not hybridize; c) the DNA amplified in step c) is amplified again, the primers of this second amplification hybridizing to the domain located at the 5 'end of at least one of the first primers or being identical to it, and these primers being used for the second amplification are provided with a detectable marking; d) the amplificates are hybridized to oligonucleotides and / or PNA oligomers which are bound to a solid phase and which do not function as primers in the amplification and conclude from the hybridization sequence features or methylation patterns of the DNA to be examined.
Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass man in Schritt a) die zu untersuchende DNA nach der Gewinnung chemisch und/oder enzymatisch behandelt. A method according to claim 1, characterized in that in step a) the DNA to be examined is treated chemically and / or enzymatically after the extraction.
3. Verfahren nach Anspruch 1 oder 2 , dadurch gekennzeichnet, dass die Primer der ersten Amplifikation (Schritt b) und die Oligonukleotide (Schritt d) auf derselben Festphase immobilisiert sind.3. The method according to claim 1 or 2, characterized in that the primers of the first amplification (step b) and the oligonucleotides (step d) are immobilized on the same solid phase.
4. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass die Festphase eben ist.4. The method according to any one of the preceding claims, characterized in that the solid phase is flat.
5. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass die Festphase aus Glas,5. The method according to any one of the preceding claims, characterized in that the solid phase made of glass,
Metall, inbesondere Gold oder Kunststoff ist.Metal, especially gold or plastic.
6. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass Beads als Festphase ver- wendet werden, wobei jeder Bead unterschiedlich codiert ist.6. The method according to any one of the preceding claims, characterized in that beads are used as a solid phase, each bead being coded differently.
7. Verfahren nach Anspruch 6, dadurch gekennzeichnet, dass die Beads über Fluoreszenzfarbstoffe, über ab- sorbierende Farbstoffe, über Chemiluminiszenz, über7. The method according to claim 6, characterized in that the beads via fluorescent dyes, via absorbing dyes, via chemiluminescence, via
Transponder, über Nuklide codiert sind oder über chemische Markierungen, welche sich massenspektro- metrisch nachweisen lassen.Transponders that are encoded using nuclides or chemical markings that can be detected by mass spectrometry.
8. Verfahren nach mindestens einem der Ansprüche 5-7, dadurch gekennzeichnet, dass die Oberfläche derart chemisch behandelt ist, dass die Oligonukleotide und Primer kovalent daran gebunden werden können.8. The method according to at least one of claims 5-7, characterized in that the surface is chemically treated in such a way that the oligonucleotides and primers can be covalently bound to it.
9. Vorrichtung, bestehend aus a) einer Oberfläche, auf welcher Primeroligonukleotide mit ihrem 5'-Ende immobilisiert sind und zusätzlich Oligonukleotide und/oder PNA-Oligomere, welche von einer Polymerase nicht verlängert werden können; b) einer Kammer, wobei die Oberfläche eine Wand dieser Kammer bildet; c) einer Temperierungseinheit, welche die Kammertemperatur steuert; d) einem System, welches der Kammer Flüssigkeiten zuführt . 9. Device consisting of a) a surface on which primer oligonucleotides are immobilized with their 5 'end and additionally oligonucleotides and / or PNA oligomers which cannot be extended by a polymerase; b) a chamber, the surface forming a wall of this chamber; c) a temperature control unit that controls the chamber temperature; d) a system which supplies liquids to the chamber.
PCT/DE2002/004507 2001-12-05 2002-12-05 Method and integrated device for the detection of cytosine methylations WO2003054224A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP02791612A EP1451359A2 (en) 2001-12-05 2002-12-05 Method and integrated device for the detection of cytosine methylations
AU2002357968A AU2002357968A1 (en) 2001-12-05 2002-12-05 Method and integrated device for the detection of cytosine methylations

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10160983.3 2001-12-05
DE10160983A DE10160983B4 (en) 2001-12-05 2001-12-05 Method and integrated device for the detection of cytosine methylation

Publications (2)

Publication Number Publication Date
WO2003054224A2 true WO2003054224A2 (en) 2003-07-03
WO2003054224A3 WO2003054224A3 (en) 2003-10-30

Family

ID=7708910

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2002/004507 WO2003054224A2 (en) 2001-12-05 2002-12-05 Method and integrated device for the detection of cytosine methylations

Country Status (4)

Country Link
EP (1) EP1451359A2 (en)
AU (1) AU2002357968A1 (en)
DE (1) DE10160983B4 (en)
WO (1) WO2003054224A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005204652A (en) * 2003-12-16 2005-08-04 Bayer Healthcare Llc Assay for detecting methylation status by methylation specific primer extension (mspe)
EP1525328B1 (en) * 2002-08-02 2010-01-20 Epigenomics AG Method for amplification of nucleic acids of low complexity

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007032748A1 (en) * 2005-09-15 2007-03-22 Agency For Science, Technology & Research Method for detecting dna methylation
AT502549B1 (en) 2005-10-07 2007-06-15 Anagnostics Bioanalysis Gmbh DEVICE FOR THE ANALYSIS OF LIQUID SAMPLES

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993004199A2 (en) * 1991-08-20 1993-03-04 Scientific Generics Limited Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids
US5629158A (en) * 1989-03-22 1997-05-13 Cemu Bitecknik Ab Solid phase diagnosis of medical conditions
US6017738A (en) * 1991-11-01 2000-01-25 Adelaide Children's Hospital Solid phase amplification process
WO2000063437A2 (en) * 1999-04-20 2000-10-26 Illumina, Inc. Detection of nucleic acid reactions on bead arrays
DE19952723A1 (en) * 1999-10-26 2001-05-10 Epigenomics Ag Device and method for hybridizing double-stranded DNA samples on oligomer arrays
WO2001062064A2 (en) * 2000-02-25 2001-08-30 Epigenomics Ag Method for detecting cytosine methylation in dna samples
US6310354B1 (en) * 1996-12-03 2001-10-30 Erkki Soini Method and a device for monitoring nucleic acid amplification reactions
US20010036632A1 (en) * 1999-12-29 2001-11-01 Zailin Yu Methods for amplifying and detecting multiple polynucleotides on a solid phase support

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19934084A1 (en) * 1999-07-15 2001-01-18 Universitaetsklinikum Charite Labeling DNA fragments during polymerase chain reaction, useful e.g. for sequencing or polymorphic analysis, uses labeled universal primer and sequence-specific primers
DE19935772C2 (en) * 1999-07-26 2002-11-07 Epigenomics Ag Method for the relative quantification of the methylation of cytosine bases in DNA samples

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5629158A (en) * 1989-03-22 1997-05-13 Cemu Bitecknik Ab Solid phase diagnosis of medical conditions
WO1993004199A2 (en) * 1991-08-20 1993-03-04 Scientific Generics Limited Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids
US6017738A (en) * 1991-11-01 2000-01-25 Adelaide Children's Hospital Solid phase amplification process
US6310354B1 (en) * 1996-12-03 2001-10-30 Erkki Soini Method and a device for monitoring nucleic acid amplification reactions
WO2000063437A2 (en) * 1999-04-20 2000-10-26 Illumina, Inc. Detection of nucleic acid reactions on bead arrays
DE19952723A1 (en) * 1999-10-26 2001-05-10 Epigenomics Ag Device and method for hybridizing double-stranded DNA samples on oligomer arrays
US20010036632A1 (en) * 1999-12-29 2001-11-01 Zailin Yu Methods for amplifying and detecting multiple polynucleotides on a solid phase support
WO2001062064A2 (en) * 2000-02-25 2001-08-30 Epigenomics Ag Method for detecting cytosine methylation in dna samples

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1525328B1 (en) * 2002-08-02 2010-01-20 Epigenomics AG Method for amplification of nucleic acids of low complexity
JP2005204652A (en) * 2003-12-16 2005-08-04 Bayer Healthcare Llc Assay for detecting methylation status by methylation specific primer extension (mspe)

Also Published As

Publication number Publication date
DE10160983B4 (en) 2004-12-09
EP1451359A2 (en) 2004-09-01
WO2003054224A3 (en) 2003-10-30
AU2002357968A1 (en) 2003-07-09
DE10160983A1 (en) 2003-06-26

Similar Documents

Publication Publication Date Title
EP1423533B1 (en) Method for high sensitivity detection of cytosine-methylation
DE10056802B4 (en) Method for the detection of methylation conditions for toxicological diagnostics
DE69713599T2 (en) METHOD FOR DETERMINING NUCLEIC ACID SEQUENCES AND DIAGNOSTIC APPLICATIONS THEREOF
DE69821540T2 (en) Competitive PCR with an adapter
WO2001077384A2 (en) Detection of single nucleotide polymorphisms (snp&#39;s) and cytosine-methylations
WO1999028498A2 (en) Method for producing complex dna methylation fingerprints
DE10112515A1 (en) Detecting methylation status of test DNA in a mixture, useful for diagnosis and prognosis of disease, comprises bisulfite treatment then selective amplification of test DNA
DE102004036285A1 (en) Method for determining the frequency of sequences of a sample
DE102005034628B4 (en) Method for the investigation of cytosine methylations in DNA
EP1228247B1 (en) Method for the controlled implementation of complex pcr amplifications
DE10132212B4 (en) Method for the detection of cytosine methylation by comparative analysis of the single strands of amplicons
EP1292711B1 (en) Method for the high-parallel analysis of polymorphisms
DE10119468A1 (en) Selective enrichment of specific polymerase chain reaction products, useful e.g. for diagnosis, by cycles of hybridization to an array and re-amplification
DE10128508A1 (en) Methods and nucleic acids for the differentiation of prostate tumors
EP1853724B1 (en) Method for investigating cytosine methylations in dna
DE10160983B4 (en) Method and integrated device for the detection of cytosine methylation
EP1228246B1 (en) Method for distinguishing 5-position methylation changes
EP1320632B1 (en) Method for determining the age of individuals
DE10392538B4 (en) Method for the analysis of methylated nucleic acids
DE10013847A1 (en) Parallel detection of methylation in genomic DNA where DNA is chemically modified, fragmented, amplified and hybridized to probes, useful to investigate gene expression regulation
WO2003002759A2 (en) Detection of specific dinucleotides in dna-samples by fluorescence resonance energy transfer (fret)
DE10021204A1 (en) Method for the highly parallel analysis of polymorphisms
WO2005075671A1 (en) Method for the calibration and verification of methylation analysis methods with the aid of non-methylated dna
DE102006035600B3 (en) Methylation detection, for diagnosis/prognosis of e.g. cancer disease, comprises converting non-methylated cytosine to uracil (nucleic acid) or into other base, so 5-methylcytosine remains unchanged and catalyzing nucleic acid activity
DE10065814B4 (en) Methods for the simultaneous amplification of many sequences in a PCR reaction and their labeling

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2002791612

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2002357968

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2002791612

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP