WO2003054214A2 - Reaction en chaine tsunami amplification geometrique de l'adn - Google Patents

Reaction en chaine tsunami amplification geometrique de l'adn Download PDF

Info

Publication number
WO2003054214A2
WO2003054214A2 PCT/US2002/039063 US0239063W WO03054214A2 WO 2003054214 A2 WO2003054214 A2 WO 2003054214A2 US 0239063 W US0239063 W US 0239063W WO 03054214 A2 WO03054214 A2 WO 03054214A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
composition
probe
probes
complementary
Prior art date
Application number
PCT/US2002/039063
Other languages
English (en)
Other versions
WO2003054214A3 (fr
Inventor
Richard V. Denton
James O. Bowlby, Jr.
Original Assignee
Denton Richard V
Bowlby James O Jr
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Denton Richard V, Bowlby James O Jr filed Critical Denton Richard V
Priority to AU2002351276A priority Critical patent/AU2002351276A1/en
Publication of WO2003054214A2 publication Critical patent/WO2003054214A2/fr
Publication of WO2003054214A3 publication Critical patent/WO2003054214A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/682—Signal amplification
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y10/00—Nanotechnology for information processing, storage or transmission, e.g. quantum computing or single electron logic
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery

Definitions

  • the present invention relates to improved methods, kits, and compositions for amplification and detection of target nucleic acids by releasing separated functional equivalents in a geometric manner thereby permitting specific detection of target nucleic acid sequences.
  • Applications include but are not limited to areas of disease diagnostics, infection, or other medical conditions relevant to the field of human, animal and plant health.
  • DNA microarrays in a form disclosed in U.S. Patent No. 5,800,992 (Fodor, et al.), significantly improved measurements of gene transcript abundance.
  • gene-specific oligonucleotides or polynucleotides representing the unique portions of the RNA transcripts are individually arrayed on a single matrix. This matrix is then simultaneously probed with fluorescently labeled cDNA representative of total RNA pools from experiment and reference cells. This allows one to determine the relative amount of gene transcript present between 2 states under investigation based on the relative intensity of individual spots.
  • a related approach disclosed in U.S. Patent No. 6,040,138 (Lockhart, et al.) addressed the quantitation of gene transcript abundance of a single pool of cells.
  • RNA required per hybridization is about 50-200 ⁇ g (2-5 ⁇ g are required when using poly(A) + RNA).
  • target derived from 100 ⁇ g of total RNA over an 800 mm 2 hybridization area (approx. 1 inch by 1 inch) containing 200 ⁇ m diameter probe spots will result in approximately 300 transcripts being sufficiently close to the probes to have a chance to hybridize (Duggan, D.
  • target RNA can be amplified by polymerase chain reaction ("PCR"), as disclosed in U.S. Pat. No. 4,683, 195 (Mullis et al., 1987).
  • PCR comprises treating separate complementary strands of the selected nucleic acid molecule with a molar excess of 2 oligonucleotide primers.
  • the primers permit formation of complementary primer extension products, which then act as templates for a next round of synthesis of the selected nucleic acid sequence. Therefore, the selected sequence is amplified and can be detected via many means.
  • One of the variations to this method is the 5'-nuclease assay with a self-quenching fluorescent probe, as disclosed in U.S. Pat. No.
  • the probe anneals to the template where it is digested by the 5'->3' exonuclease activity of the polymerase.
  • the quencher molecule is no longer close enough to the reporter molecule to quench emissions by energy transfer.
  • U.S. Patents 4,876,187 and 5,011,769 both to Duck et al. disclose nucleotide sequences having scissile linkages that are useful for the detection of selected nucleic acid sequences. Both utilize an RNA - DNA duplex wherein the RNA is hydrolyzed by RNase H. U.S. Pat. No. 5,011,769 specifically describes a RNA - DNA chimeric probe where the DNA is between 1 and about 20 bases.
  • U.S. Pat. No. 6,135,533 discloses cycling probe cleavage detection of nucleic acid sequences. In a further refinement of the cycling probe cleavage detection, U.S. Pat. No.
  • U.S. Pat. No. 6,135,533 discloses additives for use in cycling probe reactions such as ribosomal proteins to increase its cleavage efficiency thus improving overall detection limit.
  • the invention described herein addresses the unmet needs for accurate amplification and detection of nucleic acid samples.
  • a number of embodiments are described immediately below, to convey various aspects of the invention. The description below is not intended to be a complete enumeration of all possible embodiments. A more complete description of the possible embodiments may be inferred and/or generated from the detailed specification of the invention as described in Section V.
  • a method of detecting a target nucleic acid comprising the steps of:
  • a method of detecting a target nucleic acid comprising the steps of:
  • a method of providing multiple functional equivalents of a target nucleic acid comprising the steps of:
  • a method of providing multiple functional equivalents a target nucleic acid comprising the steps of:
  • Providing a third composition comprising multiple sets of probes, at least one probe in each set containing a single stranded sequence structure Z n - N n , wherein n is an integer greater than 1, and wherein Z n contains one or more scissile linkages and wherein a portion of Z n is complementary to a portion of N n - ⁇ , and wherein a portion of N n is complementary to a portion of Zi, and, if n is greater than 2, one or more additional sets of probes, at least one probe in each set containing a single stranded sequence structure Zj - Ni, wherein i is an integer greater than 1 and less than n, and wherein Zi contains one or more scissile linkages, and wherein a portion of Z; is complementary Nn.
  • composition consisting of probes that can hybridize to a target nucleic acid comprising:
  • a first composition comprising a set of probes, at least one of which contains a single stranded sequence structure Zi - Ni , wherein Z ⁇ contains one or more scissile linkages and wherein a portion of Zi is complementary to a portion of a nucleic acid target;
  • a second composition comprising a set of probes, at least one of which contains a single stranded sequence structure Zdon - N n , wherein n is an integer greater than 1, and wherein Z n contains one or more scissile linkages and wherein a portion of Z n is complementary N n- ⁇ , and wherein a portion of N legal is complementary to a portion of Zi, and, if n is greater than 2, one or more additional sets of probes, at least one probe in each set containing a single stranded sequence structure Z - N;, wherein i is an integer greater than 1 and less than n, and wherein Zi contains one or more scissile linkages, and wherein a portion of Zi is complementary Nn.
  • kit consisting of a one or more solid supports comprising:
  • a first composition comprising a set of probes, at least one of which contains a single stranded sequence structure Zi - Ni , wherein Zi contains one or more scissile linkages and wherein a portion of Zi is complementary to a portion of a nucleic acid target;
  • a second composition comprising a set of probes, at least one of which contains a single stranded sequence structure Z Conduct - N n , wherein n is an integer greater than 1 , and wherein Z n contains one or more scissile linkages and wherein a portion of Z n is complementary N n- i, and wherein a portion of N n is complementary to a portion of Zi, and, if n is greater than 2, one or more additional sets of probes, at least one probe in each set containing a single stranded sequence structure Zj - Nj, wherein i is an integer greater than 1 and less than n, and wherein Zi contains one or more scissile linkages, and wherein a portion of Z; is complementary Nn.
  • Figure 1 An example geometric amplification cycle using the two-probe case.
  • Figure 2. Example arrangement of two sets of probes on a slide.
  • Figure 3. Example sandwich arrangement of two sets of probes between two slides.
  • Figure 4. Concentrations of the various compounds as a function of time in seconds during
  • the present invention builds on the cycling probe technology concepts while offering a mechanism that promotes a geometric release of functional equivalents of the sample via cleavage of probes.
  • the invention operates isothermally with amplification power that approximates PCR.
  • cycling between denaturing and cleavage temperatures offers the same quantification advantage enjoyed by the 5'-nuclease assays.
  • TCR Tsunami Chain Reaction
  • TCR can be deployed in an array format to offer massively parallel assays for many genes with fluorescent detection just like regular microarrays but without for example dual dye-based comparisons.
  • TCR can be made to be a homogeneous assay and with greater precision in quantification just like the 5'-nuclease assay. TCR on arrays is thus efficient for carrying out gene expression profiling.
  • Our invention allows detection of extremely small concentrations of target DNA, down to a single molecule in a test volume.
  • a target nucleic acid of interest for example, the cDNA synthesized from the viral RNA genome derived from viruses present in the serum of HIV infected patients.
  • a practical example would involve detection of extremely low concentration of viruses, such as 50 HIV viral particles in one milliliter of serum. Since most of array-based experiments can only handle about 20-microliter volumes, this small volume corresponds to being able to detect a single cDNA molecule without concentrating the serum. Because of the geometric amplification offered by TCR, it is possible to detect a single copy cDNA molecule.
  • a scissile linkage usually describes some modification to the DNA structure to make a particular nucleotide- nucleotide bond more susceptible to hydrolysis than other nucleotide-nucleotide bonds.
  • a nickable linkage is a bond between nucleotides on a single strand that can be hydrolyzed by some nicking agent.
  • a cleavable linkage refers to bonds between nucleotides close to each other on both strands that can be hydrolyzed by some cleaving agent.
  • a scissile linkage on a single strand is a subset of a nickable linkage, because only one strand usually contains the modified bond.
  • this patent will use a broader definition of the term scissile so that it is interchangeable with nicking. This is straightforward when a DNA bond has been modified, for example, by exchanging one of the bases on one of the strands to RNA. However, it is different when we consider nicking enzymes. In this case, and for the purposes of this patent, the scissile linkage will be associated with the particular DNA sequence allowing the nicking agent to hydrolyze the nucleotide bonds on only one strand.
  • nicking enzyme N.BbvC IA from New England Biolabs. Operating on double stranded DNA, it recognizes the sequence GC'TGAGG and cuts only one strand between the C and T. This patent will consider the C-T bond in GCTGAGG as a scissile linkage because only a single strand is cut. Furthermore, a restriction enzyme cutting only one strand of double-stranded DNA (because, for example, the other side is intentionally already cut) will be considered to act on a scissile linkage, namely the restriction site on the un-cut strand. However, a restriction enzyme acting to cleave double stranded DNA by hydrolyzing both strands will not be considered acting on a scissile linkage because more than a single bond is cut.
  • Figure 1 is discussed in Example 1. It is provided as a simple example TCR cycle to generate 2, 4, 8, and in general, 2 k functional equivalents, where k is the number of iterations, in a simple case where there are only two probe sets.
  • the terminology "functional equivalent” is used instead of “identical” due the following:
  • a target nucleic acid could be quite long, say 100 kilobases, but only, for example, 30 contiguous bases of it might hybridize to a probe.
  • a functional equivalent might be this sequence of 30 deoxyribonucleic bases in the overall target sequence, or it could of course be a longer sequence up to the full 100 kilobase sequence even though only 30 bases are needed for interaction with the probe. It is the interaction of the functional equivalents with the probes that results in the TCR cycle.
  • the elements of the invention are clarified below.
  • single stranded nucleic acid is hybridized to the first probe.
  • Creating single stranded nucleic acid is well known to those skilled in the art.
  • cDNA made from mRNA used in gene expression analysis is already single stranded, as is the cDNA constructed from retroviruses such as HIV.
  • Genomic or mitochondrial DNA can be made single stranded using asymmetric PCR, or, for example, fragmenting it into smaller pieces and loading a small concentration into the reaction volume, following with denaturation. DNA at low concentrations takes several hours to hybridize to their complementary partners, longer than the time needed to hybridize to a probe. Regardless of the particular means for obtaining the single stranded nucleic acid, our focus is on single strands of nucleic acid as used in this array chain reaction.
  • the TCR mechanism works by using properties of certain enzymes to "nick", i.e., hydrolyze the phosphodiester bond, of one strand of a nucleotide duplex without cleaving the other strand.
  • This property can be used to release tags from probes which in turn hybridize to other nickable probes to release additional tags functionally equivalent to the original target DNA, thereby causing a geometric growth in the number of copies of the target DNA.
  • the nickable probes are physically separated prior to nicking, to avoid non- target initiated reactions that would result in a false positive detection.
  • they can be attached to a solid support, such as a glass slide, such that the complementary portion of different probe sets do not hybridize to each other.
  • the melting temperature of oligonucleotides increases as the length of the oligonucleotides increases.
  • the melting temperature of the oligo-complement complex defines two temperature regions: 1) a temperature well below the melting temperature, where we expect to find all oligos bound to their complement; and 2) a temperature well above the melting temperature, where we expect to find all oligos separated from their complements.
  • our invention defines three temperature regions because there are two different lengths of bound oligonucleotides: the length before nicking, and significantly shorter lengths after nicking.
  • the three regions are: 1) a temperature well below the melting temperature of the nicked oligos; 2) a temperature between the melting temperature of the nicked oligos and the melting temperature of the unnicked oligos; and 3) a temperature well above the melting temperature of the unnicked oligos.
  • the temperature is held constant in the 2 nd temperature region, namely, at a temperature between the melting temperature of the nicked oligos and the melting temperature of the unnicked oligos. In this temperature region, the unnicked oligos will hybridize and the nicked oligos will quickly separate.
  • the temperature is cycled between two temperature values. In this embodiment, the temperature is cycled between the 1 st temperature region, namely, a temperature well below the melting temperature of the nicked oligos, and the 3 rd temperature region, namely, a temperature well above the melting temperature of the unnicked oligos.
  • the temperature is cycled between the 2 nd temperature region, namely, a temperature between the melting temperature of the nicked oligos and the melting temperature of the unnicked oligos, and the 3 rd temperature region, namely, a temperature well above the melting temperature of the unnicked oligos. Cycling the temperature between well-defined temperature regions can improve quantitation by allowing the freed probes adequate time to diffuse to different probes before the next temperature cycle begins.
  • the nicking agent is any agent or method that hydrolyzes, i.e., interrupts or cleaves one DNA strand but not the other.
  • it could be a restriction endonuclease.
  • organisms that make restriction enzymes also make a companion modification enzyme (DNA methyltransferase) that protects their own DNA from cleavage. These enzymes recognize the same DNA sequence as the restriction enzyme they accompany, but instead of cleaving the sequence, they disguise it by methylating one of the bases in each DNA strand.
  • a restriction enzyme and its "cognate" modification methyltransferase form a restriction-modification (R-M) system.
  • R-M systems At least four different kinds exist, distinguished by the subunit compositions of the enzymes, the kinds of sequences recognized and the cofactors needed for activity. Most characterized enzymes (93%) belong to the Type II class; together with the Type IIS class (5%) they comprise the commercially available restriction enzymes used for DNA analysis and manipulation. Type I (1%) and Type III enzymes ( ⁇ 1%) are relatively uncommon and a few additional enzymes fit none of the classes.
  • the Type II enzymes are the simplest: they recognize symmetric DNA sequences and cleave within the sequences, leaving a 3' -hydroxyl on one side of the cut and a 5' - phosphate on the other. They require only magnesium for activity and their corresponding modification enzymes require only S-adenosyl-methionine.
  • the variety of sequences recognized is virtually unlimited, though few contain less than four or more than eight specific bases. This limited size range probably reflects a balance between the benefit of recognizing frequent sequences in foreign DNA molecules and the cost of protecting those same sequences in the cell's DNA.
  • They generally act as homodimers, proteins composed of two identical subunits bound to each other in opposite orientations. Such proteins necessarily interact with sequences that are inverted repeats, and hence symmetric, because each subunit recognizes the same pattern of bases on opposite strands of the DNA.
  • Type II modification enzymes in contrast, generally act as monomers, with a single protein recognizing the entire DNA sequence.
  • the rationale for why they act as monomers when restriction enzymes act as dimers probably lies in the different substrates they attend to in vivo.
  • the substrates for restriction enzymes are completely unmethylated duplexes, both strands of which must be cleaved.
  • the substrates for modification enzymes are newly replicated duplexes, only one strand of which requires modification because the other, parental strand is already modified.
  • Type IIS enzymes have similar cofactor requirements to Type II enzymes, but their recognition sequences are asymmetric and uninterrupted, 4-7 base pairs in length. They cleave at a defined distance, up to 20 base pairs, to one side of their recognition sequence. Modification is usually carried out by two methyltransferases, one for each strand, and in some systems, different bases are methylated on each strand.
  • the only currently known restriction endonuclease that nicks only one strand is a Type IIS enzyme called N.RstNB 1.
  • the concentration of the nicking agent needs to increase only in the location of the probes, not necessarily in the volume of the fluid.
  • Our invention includes the optional attachment of the nicking agent to the solid support in such a fashion to avoid steric hindrance and maintain good activity.
  • One embodiment is the use of linker arms of more than 6 carbon atoms.
  • Another embodiment constructs fused proteins of the active nicking agent and streptavidin, a technique commonly used by those skilled in the art. The streptavidin is captured by biotin attached to the solid support.
  • Our invention encompasses the use of several sets of probes.
  • One embodiment is the use of two probe sets as shown in Figure 1.
  • the cycle shown in steps 1 to 9 is repeated numerous times, resulting in geometric replication of a functional equivalent of the target.
  • the probes in this embodiment are chimeric in that they contain an RNA portion flanked by DNA sequences.
  • Such probes can be purchased from, for example, Biosource International, with an amine group attached at the 3' end and a fluorescent dye attached at the 5' end. They can be covalently attached to a glass slide or other substrate prepared in ways known to those skilled in the art. For example, glass slides can be coated with 3-aminopropyltriethoxy silane and then reacted with 1,4 phenylene diisothiocyanate.
  • Each probe has a scissile linkage, i.e., one or more bonds that can be easily cleaved under the proper conditions.
  • the proper conditions in this invention involve the specific hybridization of a complementary strand of DNA that does not contain a scissile linkage.
  • the scissile linkages in each probe can be, for example, RNA, and the associated cleaving agent can be RNaseH.
  • the scissile linkages can be a specific DNA sequence and the scissile properties can be provided by asymmetric restriction endonucleases, such as N.RstNB 1. This enzyme is a type II s restriction endonuclease that recognizes the non palindromic sequence 5' CTCAG 3', and hydrolyzes only one of the DNA strands 4 bases from the 3' end.
  • the target nucleic acid is prepared in a separate reaction. In this reaction, probes containing scissile linkages are added in free solution and hybridized to the target nucleic acid. T4 DNA polymerase is added to remove the 3' overhang from the probe-target duplex. RNaseH is added to remove the probes. T4 Ligase is added to ligate blunt end probes containing CTCAG. In another embodiment, instead of ligating probes containing CTCAG to the sample, the probes are added before hybridization to the array or other solid support as described above. The probes containing CTCAG hybridize with the target nucleic acid to the first attached probe and are optionally ligated to the target nucleic acid.
  • the probe sets that are used need to be physically separated.
  • the physical separation of the probe sets can be accomplished in many ways.
  • the probe sets can be attached to many different kinds of solid supports, such as linear or area arrays, or the walls of capillaries.
  • the material of the solid support can be glass, silicon, polystyrene, plastics, or other materials known to those skilled in the art.
  • the distance between the probe sets should be large enough so that unnicked dimers cannot form, and small enough so that diffusion of nicked primers is reasonably quick compared to the time needed to hybridize and nick. In some embodiments, the distance is 15 microns, 80 microns, or 200 microns.
  • Another example means to maintain the spatial separation between 2 or more probes involves using small particle to which the probes are attached.
  • These small particles can be microspheres, microbeads, or macroscopic particles. They can be composed of any material that binds DNA, for example, glass, polystyrene, or other plastics. The particles are modified so that if they touch a particle containing the complementary probe then the strands of DNA cannot hybridize.
  • Several methods for insuring physical separation are described in Example 5.
  • the probes are spotted onto the prepared glass slides or other substrate. Spot sizes and spot densities are not a limiting factor in the TCR mechanism. Example spot sizes used in the industry are 200 microns in diameter and with approximately 100,000 probes per square micron.
  • the two sets of probes are arranged in a checkerboard pattern on a single slide as shown in Figure 2, where the TCR mechanism can operate between any pair of probe sets. Only a single pair of spots corresponding to two different probe sets is adequate for the TCR reaction to proceed.
  • another slide is placed on top of the first slide and separated from it by a small distance, for example 80 microns.
  • One set of probes is spotted on the bottom slide, and another set of probes is spotted on the top slide as shown in Figure 3. For a slide area of 1 x 2.5 cm 2 , the volume between the slides is 20 microliters.
  • Our invention can be used to increase the number of functional equivalents in solution. It may also be used to measure the amount of DNA.
  • dye can be placed at the 3' end of the first probe, the second probe, or both. The nicked probes allow the dye to be washed away. The reduced signal indicates the amount of cleavage, and is a function of the starting concentration of the nucleic acid sample.
  • dyes can be used for this invention, including fluorescent dyes such as fluorescenes and rhodamines.
  • fluorescent dyes such as fluorescenes and rhodamines.
  • a variety of other dye types include quantum dots, phycobilisomes, microbead- hosted dyes or even metal barcodes..
  • the probes are attached to a two-dimensional array and contain closely spaced dyes with overlapping emission and absorbance spectra, also called Fluorescent Energy Resonance Transfer dyes, or FRET dyes.
  • FRET dyes Fluorescent Energy Resonance Transfer dyes
  • the FRET dyes will quench.
  • RNaseH nicks between the dyes fluorescence will increase.
  • This invention requires that the probe sets are adequately attached to the substrate. If any probes from one probe set become unattached during the chain reaction, for example due to poor attachment chemistry, they can diffuse to the other probe set, hybridize to these probes, and thus spuriously enhance the chain reaction. This probe "blow-off" effect thus competes with the main interactions associated with the chain reaction. Since there is always the potential for some blow-off, it is useful to assume a certain amount of random loss of probe, and to determine an upper bound on the amount of probe blow-off that can be tolerated as a function of the time constants associated with the Tsunami Chain Reaction proper. This issue is addressed in one of the examples. The needed attachment chemistries are available to keep this spurious effect at a negligible level. See for example Lindroos, K. et al, Minisequencing on oligonucliotide microarrays: comparison of immobilization chemistries, Nucleic Acids Res., 2001, Vol. 29, No 13.
  • kits in another aspect of this invention, includes the compositions needed to employ the Tsunami Chain Reaction.
  • the kit may also include the needed reagents and instructions to convert the time it takes for Tsunami to take place into an effective starting concentration of target nucleic acid.
  • Example 1 is an amplification cycle of 9 steps. It starts with a single strand of target nucleic acid and ends up with two functional equivalents of the same target nucleic acid.
  • functional equivalent we mean two molecules that hybridize to the same complementary strand and cause the scissile linkages on the probe to be hydrolyzed.
  • Step 1 shows introduction of single stranded nucleic acid into a solution.
  • Step 2 shows the first probe set consisting of scissile linkages in black, and an approximately 30 base sequence of nucleotides in a striped pattern.
  • Step 3 shows a nicking agent, such as RNase H when the scissile linkages are RNA, or a restriction endonuclease, such as N.RstNBl when the scissile linkages are DNA.
  • Step 4 shows the target nucleic acid hybridizing to the scissile portion of probe 1, and the probe hydrolyzing one of the scissile linkages at the location of the small vertical arrow.
  • Step 5 shows the two portions of the probe separating from the target nucleic acid, the portion containing the DNA (striped pattern) now being free to interact with the second probe set shown in Step 6.
  • Step 7 shows the nicking agent, and step 8 shows it interacting with the duplex formed by the scissile portion of probe two (striped pattern) and the striped DNA portion of probe 1.
  • the white DNA portion of probe 2, designated target copy tail, is functionally equivalent to the target nucleic acid and is released in Step 9.
  • Step 2 this is accomplished for example by attaching the scissile portion of probe set 1 (black band) to a solid support, and in Step 6 attaching the scissile portion of probe set 2 (striped band) to a solid support sufficiently far enough from probe 1 that no dimmers can form. Since the probes are quite short (a few Angstroms) compared to the distance between spots on microarrays (a few microns), placing the probe sets in different spots accomplishes the separation. An alternative embodiment places the different probe sets in the same spot, but insures that individual molecules are separated so that no dimers can form between unnicked probes.
  • Example 2 Design of probe sets containing RNA and example sequence of events
  • RNA nucleotides are written in lower case letters, and DNA nucleotides are written in upper case letters.
  • the first probe set is fabricated to detect the following 30 nucleotides from the HIV-1 target sequence A SE.SE8131 :
  • RNA sequence for probe set #1 is: 5' tttgcattatagggtaattttggctgacct 3'
  • the DNA sequence for set #1 is: 5' AAAGGATTTAACACAGGATATTACGATATA 3'
  • the entire first probe is: 5 'Amine C ⁇ -spacer C 18-spacer C 18-Spacer tttgcattatagggtaattttggctgacct AAAGGATTTAACACAGGATATTACGATATA 3'
  • the RNA sequence for probe set #2 is: 5' tatatcgtaatatcctgtgttaaatccttt 3'
  • the DNA sequence for set #2 is: 5' AGGTCAGCCAAAATTACCCTATAATGCAAA 3'
  • the entire second probe is: 5 'Amine C6-spacer CI 8-spacer C18-Spacer tatatcgtaatatcctgtgttaaatcct
  • Bromoacetamidosilane-coated slides are prepared by reacting microscope slides with a solution containing N,N-dimethylformamide, bromoacetic acid, 4-(dimethylamino)- pyridine, and 1,3-dicyclohexycarbodiimide (Zhao X., et al. Nuc. Acid. Res. 29(4): 955-959, 2001).
  • TAMRA - labeled probe is the 1 st probe and contains a recognition site for N.BstNB I (#R0607S from New England Biolabs):
  • ⁇ denotes where N.BstNB I cleaves.
  • the superscript S denotes the position of the phosphorothioate in the sequence of oligonucleotides.
  • TAMRA labeled probe is the 2nd probe, which also contains a recognition site (5'-GAGTC) for N.BstNB I: 5'-p s TTTTTTTAGTGAGTCTGAG TGTGCCTGCTGACTGACTCCTG- TAMRA-3'
  • ⁇ denotes where N.BstNB I cleaves.
  • the superscript S denotes the position of the phosphorothioate in the sequence of oligonucleotides.
  • the 1 st and 2 nd probes are dispensed onto bromoacetamidosilane-coated slides by a general purpose array spotter. The 5' end of the probes will attach to the surface of the slide.
  • oligonucleotide is the target nucleic acid to be detected:
  • the target nucleic acid is prepared in a buffer solution compatible with N.BstNB I and supports the enzymatic activity; b) The said buffer containing the target nucleic acid and appropriate amount of N.BstNB I is pipetted onto the slide containing 1 st and 2 nd probe sets and is covered with a cover slip; c) The slide-cover slip assembly is placed inside a hybridization chamber; d) The chamber is placed in a water batch at 55°C; e) The target nucleic acid hybridizes to an appropriate portion of the 1 st probe thus forming a duplex; f) The enzyme N.BstNB I binds to the recognition site on said duplex and cleaves the designated site on the 1 st probe (see above in this section) but leaving the target nucleic acid intact; g) After cleavage of the 1 st probe, the 3' portion of the 1 st probe and the target nucleic acid
  • the fluorescence intensity of the spots on the slides representing the 1 st probe and 2 nd probe sets is measured by an array scanner; o) One performs the experiment described above several times, stopping the reaction at different time points; p) One estimates the starting concentration of target nucleic acid by identifying the time at which '/2 of either the 1 st or 2 nd probe was cleaved.
  • Example 4 An example of the three-pad case, including extensions to use of n pads Our invention can work with 2 probe sets, or more than two probe sets. We describe here the use of 3 probe sets. Each probe set is physically separated from the others to avoid formation of dimers by unnicked probes.
  • the three sets of probes are attached to a glass slide via a 5' linker in spots 200 microns in diameter and spaced 80 microns apart.
  • Each probe contains two active portions, which we call Z and N.
  • the 5' portion Z contains at least one and possibly multiple scissile linkages, and hybridizes to the target nucleic acid.
  • the portion called N contains only nucleic acids, which in turn will hybridize to another probe.
  • the three probes can be referred to as: Zi - Ni, Z 2 - N 2 , and Z 3 - N 3 .
  • the first step is to cause a single stranded target nucleic acid to hybridize to Zi.
  • a nicking agent hydrolyzes the phosphodiester linkages within Zi thereby releasing Ni from the target nucleic acid.
  • Z 2 is constructed to be complementary to Ni
  • Z 3 is constructed to be complementary to N 2
  • N 3 is constructed to be complementary to Zi. Consequently, we have constructed N 3 to be a functional equivalent of the original target nucleic acid. This cycle is repeated over and over again, creating a geometric increase in the number of free functional equivalents.
  • the free functional equivalents can be detected in many ways known by those skilled in the art.
  • the nicked fragments can be detected by measuring the decrease in fluorescence of a 3 ' dye attached to the probes. In another embodiment, one can measure the increase of fluorescence of a FRET dye pair connected to the scissile portion of the probes.
  • the number of probe sets can be 4, 5, 6, or any number desired.
  • our invention embodies n probe sets, each with the structure Z - Nj, wherein Z contains one or more scissile linkages, and i is an integer between 1 and n representing one particular set of single-stranded probes.
  • Example 5 Maintaining physical separation of complementary probes using small particles, such as microbeads.
  • the physical separation of the complementary probes can be maintained using small particles.
  • a rough surface is one that has a plurality of groves and valleys that are deeper than the length of the DNA probes.
  • the DNA is attached to the microbead in ways that are standard to those skilled in the art. Some of the DNA is attached near the bottom of the groves and valleys, and some is attached near the surface.
  • the beads are then manually tumbled against each other to wear down the outside surface, thereby removing any DNA that is near the surface, or shearing any DNA that extends beyond the surface.
  • the resulting beads contain DNA that can never extend beyond the surface of the particle, and therefore can never interact with complementary beads prepared in a similar way.
  • Beads containing DNA probes and beads containing their complement are placed in a small tube, such as one tube in a 96, 384, or 1536 well tray.
  • the Tsunami reaction is detected using probes, for example, containing two FRET dyes that fluoresce only when cleaved.
  • probes for example, containing two FRET dyes that fluoresce only when cleaved.
  • Many beads can be placed in the tubes, thereby increasing the sensitivity of the reaction by increasing the concentration of probes.
  • a single DNA molecule plus a complement pair of probes can be placed in a tube.
  • other DNA molecules plus complement pairs can be added. They can be detected using the same FRET dyes if the following question is asked: Are any of a number of DNA sequences present in the sample?
  • FRET dyes with different emission spectra can be used if a different question is asked: Which of a number a DNA sequences is present in the sample?
  • the first order differential equation can be approximated [PCl]as a finite difference equation by letting the differential dt assume some small but finite value ⁇ t, and solving for the change in concentration ⁇ [A]:
  • Probei is deposited in a pad geometrically separated from Probe 2 by a few microns.
  • Probei contains an oligonucleotide complementary to the Sample. Upon hybridization,
  • Probei is nicked and separates from the Sample, releasing an oligonucleotide complementary to Probe2.
  • Ping diffuses to
  • Probe 2 hybridizes to it, and releases an oligonucleotide that is functionally equivalent to the Sample.
  • the reactions are numbered as follows: Probei + Sample ⁇ -> Probei.Sample + En ⁇ -> Probei* Sample.En -» Sample + En + Ping
  • k 3 and k& are zero in accordance with standard enzymology principals (Segel, Irwin H, Enzyme Kinetics, Behavior and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems, Wiley, 1975).
  • the time step ⁇ t is chosen as 1 sec to avoid nonphysical behavior such as period doubling and chaos.
  • Graph 1 The concentration of Sample increases as a function of the number of seconds since the start of hybridization. Appreciable increase occurs after 40 minutes of hybridization.
  • Graph 4 The concentration of Enzyme momentarily reduces as it forms multiple complexes Probei* Sample, Probei* Sample*En, Probe2* Sample, Probes Sample.En .
  • Graphs 6 - 9 The concentrations of Enzyme binding complexes (Probei* Sample, Probei* Sample*En, Probe 2 * Sample, Probe 2 * Sample*En) momentarily increase, peak, and then decline as the concentration of free Enzyme momentarily decreases.
  • Example 7 Relationship between development time and sample concentration
  • Example 6 The simulation in Example 6 was run at several concentrations of sample to determine the time at which half of the probes had been cleaved. The results are listed in the following table. The concentrations are, for convenience, also converted to the number of molecules present in a 50 ⁇ l hybridization volume.
  • Blow-off is the phenomenon that, during long hybridizations, the covalent bond between Si0 2 and some of the probes is hydrolyzed at biological pHs. This phenomenon is much less prevalent with other materials (e.g.: polypropylene), but is significant with glass slides.
  • Epoxy coated Dynal beads were used as a solid support. SH-terminated oligos were synthesized by DDT and attached to the beads. Each oligo contained a recognition sequence for a nickase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Nanotechnology (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Medical Informatics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Mathematical Physics (AREA)
  • Theoretical Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés, des kits et des compositions pour une amplification et une détection d'acide nucléique cible par libération de nombreuses copies libres de sondes contenant une séquence en commun avec ledit acide nucléique cible. Ceci est accompli à l'aide d'au moins deux ensembles de sondes séparées, l'une comprenant une partie contenant une séquence complémentaire audit acide nucléique cible, et l'autre comprenant une partie en commun avec ledit acide nucléique cible. Une hybridation répétée et une libération de sondes dans les ensembles sondes entraîne une augmentation géométrique rapide dans les copies libres dudit acide nucléique cible, entraînant ainsi une capacité à détecter ledit acide nucléique cible à très haute sensibilité Une détection peut se produire à l'aide d'une pluralité de marqueurs ou d'autre moyens.
PCT/US2002/039063 2001-12-10 2002-12-06 Reaction en chaine tsunami amplification geometrique de l'adn WO2003054214A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002351276A AU2002351276A1 (en) 2001-12-10 2002-12-06 Tsunami chain reaction - geometric dna amplification

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US33979601P 2001-12-10 2001-12-10
US60/339,796 2001-12-10

Publications (2)

Publication Number Publication Date
WO2003054214A2 true WO2003054214A2 (fr) 2003-07-03
WO2003054214A3 WO2003054214A3 (fr) 2004-07-01

Family

ID=23330632

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/039063 WO2003054214A2 (fr) 2001-12-10 2002-12-06 Reaction en chaine tsunami amplification geometrique de l'adn

Country Status (2)

Country Link
AU (1) AU2002351276A1 (fr)
WO (1) WO2003054214A2 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1668158A2 (fr) * 2003-08-11 2006-06-14 The Research Foundation of Cuny Detection et quantification d'arn
EP2401388A2 (fr) 2009-02-23 2012-01-04 Georgetown University Détection à spécificité de séquence de séquences nucléotidiques
US20150246336A1 (en) * 2012-10-22 2015-09-03 Universität Wien Method of in situ synthesizing microarrays
WO2017017424A1 (fr) * 2015-07-24 2017-02-02 Sense Biodetection Limited Procédé de détection d'acides nucléiques
ITUB20155706A1 (it) * 2015-11-18 2017-05-18 Fondazione St Italiano Tecnologia Procedimento di rivelazione di acidi nucleici e relativo kit.
WO2017085650A1 (fr) * 2015-11-18 2017-05-26 Fondazione Istituto Italiano Di Tecnologia Méthode et kit de détection d'acides nucléiques
CN110225980A (zh) * 2016-11-21 2019-09-10 纳米线科技公司 化学组合物及其使用方法
US11549139B2 (en) 2018-05-14 2023-01-10 Nanostring Technologies, Inc. Chemical compositions and methods of using same
US11591644B2 (en) 2017-01-25 2023-02-28 Sense Biodetection Limited Nucleic acid detection method

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5169766A (en) * 1991-06-14 1992-12-08 Life Technologies, Inc. Amplification of nucleic acid molecules
US5593840A (en) * 1993-01-27 1997-01-14 Oncor, Inc. Amplification of nucleic acid sequences

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5169766A (en) * 1991-06-14 1992-12-08 Life Technologies, Inc. Amplification of nucleic acid molecules
US5593840A (en) * 1993-01-27 1997-01-14 Oncor, Inc. Amplification of nucleic acid sequences

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1668158A4 (fr) * 2003-08-11 2007-05-23 Univ Georgia State Res Found Detection et quantification d'arn
EP1668158A2 (fr) * 2003-08-11 2006-06-14 The Research Foundation of Cuny Detection et quantification d'arn
EP2401388A2 (fr) 2009-02-23 2012-01-04 Georgetown University Détection à spécificité de séquence de séquences nucléotidiques
EP2401388A4 (fr) * 2009-02-23 2012-12-05 Univ Georgetown Détection à spécificité de séquence de séquences nucléotidiques
US20150246336A1 (en) * 2012-10-22 2015-09-03 Universität Wien Method of in situ synthesizing microarrays
US11390909B2 (en) 2015-07-24 2022-07-19 Sense Biodetection Limited Nucleic acid detection method
WO2017017424A1 (fr) * 2015-07-24 2017-02-02 Sense Biodetection Limited Procédé de détection d'acides nucléiques
ITUB20155706A1 (it) * 2015-11-18 2017-05-18 Fondazione St Italiano Tecnologia Procedimento di rivelazione di acidi nucleici e relativo kit.
WO2017085627A1 (fr) * 2015-11-18 2017-05-26 Fondazione Istituto Italiano Di Tecnologia Méthode et trousse de détection d'acides nucléiques
WO2017085650A1 (fr) * 2015-11-18 2017-05-26 Fondazione Istituto Italiano Di Tecnologia Méthode et kit de détection d'acides nucléiques
CN110225980A (zh) * 2016-11-21 2019-09-10 纳米线科技公司 化学组合物及其使用方法
US11279969B2 (en) 2016-11-21 2022-03-22 Nanostring Technologies, Inc. Chemical compositions and methods of using same
US11821026B2 (en) 2016-11-21 2023-11-21 Nanostring Technologies, Inc. Chemical compositions and methods of using same
US11591644B2 (en) 2017-01-25 2023-02-28 Sense Biodetection Limited Nucleic acid detection method
US11549139B2 (en) 2018-05-14 2023-01-10 Nanostring Technologies, Inc. Chemical compositions and methods of using same

Also Published As

Publication number Publication date
AU2002351276A1 (en) 2003-07-09
WO2003054214A3 (fr) 2004-07-01
AU2002351276A8 (en) 2003-07-09

Similar Documents

Publication Publication Date Title
JP3863189B2 (ja) Ｄｎａへの特徴付け
EP2920320B1 (fr) Sondes rca rapporteur et leur utilisation pour détecter des molécules d'acide nucléique
US9404155B2 (en) Alternative nucleic acid sequencing methods
US6245518B1 (en) Polynucleotide arrays and methods of making and using the same
US7371580B2 (en) Use of unstructured nucleic acids in assaying nucleic acid molecules
EP1880206B1 (fr) Capture multiplex d'acides nucleiques
EP2432795B1 (fr) Glycosylase/lyase d'adn et substrats d'endonucléase ap
US7399589B2 (en) Immunological detection of RNA:DNA hybrids on microarrays
JP2003521252A (ja) ユニバーサルプライミングを用いる核酸検出方法
JP2005516610A (ja) ニック形成剤を用いる遺伝子発現分析
CA2258745A1 (fr) Dosages avec protection par une nuclease
US5939261A (en) Method for capturing a nucleic acid
WO2002006511A2 (fr) Procedes de detection et de dosage de sequences nucleotidiques
US6692915B1 (en) Sequencing a polynucleotide on a generic chip
US20160017392A1 (en) Methods for Amplification of Nucleic Acids on Solid Support
EP1459075B1 (fr) Normalisation de donnees de jeux ordonnes d'echantillons basee sur l'hybridation avec une reference interne
Ramachandran et al. Target discrimination by surface-immobilized molecular beacons designed to detect Francisella tularensis
WO2001073134A2 (fr) Jeux ordonnes d'echantillons de profilage genique
WO2003054214A2 (fr) Reaction en chaine tsunami amplification geometrique de l'adn
EP1457573A1 (fr) Procédé et dispositif d'évaluation d' intégrité et d'analyse intégrés d' acides nucléiques
US20070148636A1 (en) Method, compositions and kits for preparation of nucleic acids
US20040081969A1 (en) Devices and methods for evaulating the quality of a sample for use in an array assay
US20110237449A1 (en) Methods and Compositions for Nucleic Acid Purification
US20020172960A1 (en) DNA microarrays of networked oligonucleotides
Consolandi et al. Development of oligonucleotide arrays to detect mutations and polymorphisms

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP