WO2003052107A1

WO2003052107A1 - Expression vector containing the promoter comprised of fis binding sites, up element and core promoter

Info

Publication number: WO2003052107A1
Application number: PCT/KR2002/002279
Authority: WO
Inventors: Dong-Hoon Chung; Seong-Won Song; Dong-Ho Seong; Moon-Hee Kim
Original assignee: Samchully Pharm Co., Ltd.
Priority date: 2001-12-14
Filing date: 2002-12-06
Publication date: 2003-06-26
Also published as: WO2003052107A9; KR20030049327A; AU2002366478A1; KR100449639B1

Abstract

The present invention relates to an expression vector comprising a promoter that consists of FIS binding sites, an UP element and a core promoter. Also, the inventive expression vector may additionally comprise and FIS gene, which is regulated by an inducible promoter. The inventive expression vector can maximize the expression level of a target protein of foreign origin, and can use a wide range of E. coli strains as host cells regardless of the genetic characteristics of the strains. Thus, inventive expression vector is useful in industrial fields requiring the production of various proteins.

Description

EXPRESSION VECTOR CONTAINING THE PROMOTER COMPRISED OF FIS BINDING SITES, UP ELEMENT AND

CORE PROMOTER

Background of Invention

Technical Field The present invention relates to an expression vector for use in the production of a recombinant protein.

Background Art With the recent rapid development in molecular biology and gene technology, there is gradually increased an interest in an efficient expression system, which allows mass production of proteins using the expression technology of a recombinant protein.

The process of obtaining the recombinant protein comprises the steps of connecting a gene for a target protein to an expression vector containing a signal regulating gene expression; introducing this plasmid into a host cell to be transformed; culturing the host cell under a condition suitable for protein expression; and extracting the expressed protein.

The expression vector useful in an industrial field including medicines must be able to be used in a wide range of host cells, and at the same time, must have a promoter with strong activity and a transcriptional regulatory system with strict regulatory capability. The host cells, which can be used for the mass production of protein after introduction with the expression vector, include bacterial cells, including E. coli, fungal cells, mammal cells, and insect cells. Particularly, E. coli is widely used as a host cell in the production of a wide range of recombinant proteins, since it has high growth rate, its genomic sequence was completely established and thus its genetic information is easily obtained, and also its growth regulation mechanism was established by many molecular biological studies.

The promoter is a DNA region upstream of a structural gene, and RNA polymerase recognizes and binds to the promoter region to initiate transcription. The amount of mRNA to be produced for protein expression varies depending on promoter strength, i.e., how the RNA polymerase efficiently recognizes and binds to the promoter. Namely, with an expression vector having a promoter of strong activity, protein production per cell is increased and the volume of cells to be cultured to oTΛain a given amount of protein is thus reduced, thereby reducing production costs. Furthermore, in the case of the expression vector having the strong promoter, a target protein occupies many portions of total protein produced by the host cells so that the isolation and purification processes of the target protein become easy. Accordingly, the efficient expression vector must have the promoter with strong activity.

The transcriptional regulatory system acts to activate transcription when mRNA needs to be produced, and it acts to inhibit transcription when the production of mRNA needs to be stopped. Operon that is a transcriptional regulatory system of E. coli regulates transcription according to whether an inducer is present or not. The use of the expression vector with excellent transcriptional capability allows easy regulation of protein production according to the intention of a producer even at the use of a small amount of the inducer, such that the target protein can be efficiently obtained.

Expression vectors developed up to now are those prepared by insertion of a lac or trp promoter known as having excellent transcriptional initiation strength and regulatory capability in E. coli, or by insertion of a tac or trc promoter that is a composite type of the lac and trp promoters.

However, after actual insertion into the expression vectors, these promoters show significantly low transcriptional efficiency as compared to the case where they are present in their original organisms. Thus, in order for the existing expression vectors to be efficiently used in industrial view, there are needed many improvements, including the investigation and introduction of additional factors which allows transcriptional efficiency to be as increased as the original promoters or can regulate transcription.

There were developed many kinds of expression vectors can be used in E. coli, especially E.coli strains containing lysogenicity to a virus. pET expression vectors developed by B. Moss and Novagen, etc., which contains a T7 bacteriophage promoter, show a high expression level as compared to expression vectors containing general E. coli promoters.

However, such expression vectors must use, as host cells, strains that is originally lysogenic in T7 bacteriophage, or certain strains inserted with a gene which is involved in the protein expression of bacteriophages through genetic deformation. Thus, the range of the host cells, which can be used, is limited.

In an attempt to overcome this problem, there can be contemplated a method where a promoter producing the largest amount of mRNA in E. coli ceils is used.

One occupying the largest amount among total RNA is rRNA forming ribosomes, which occupies more than 95% of total RNA. rRNA genes at the logarithmic growth phase where E. coli actively grows occupies about 60% or above of total transcription rate. Furthermore, in E. coli as a prokaryote, since one kind of rRNA polymerase takes charge of the transcription of all kinds of RNA in cells, an expression vector prepared using rRNA will produce recombinant protein at high efficiency in E. coli.

On the basic of this principle, expression vectors with rRNA were already developed, but their expression level was not extraordinarily superior to the existing expression vectors unlike original expectation. As the detailed structure of the rRNA promoters was reported later, a reason for this result was also established, which is because these expression vectors did not contain factors playing an essential role in an increase in transcriptional efficiency. rRNA is synthesized by 7 rm operons ranging from rrnA to rrnH, in which each of the operons has the double promoter structure of PI promoter and P2 promoter. It was found that among these promoters, rrnB promoter had the strongest activity and regulatory capability, and particularly, rrnB PI had higher activity than rrnB P2.

The rrnB PI promoter consists of three elements including a core promoter, an UP element and FIS binding sites.

A site to which RNA polymerase can bind to cause transcription, is the core promoter, but elements that greatly influence the activity and regulatory capability of rrnB PI are the UP element and the FIS binding sites. Transcriptional efficiency is increased by the UP element and also increased when the factor for inversion stimulation (FIS) as a transcriptional factor binds to the FIS binding sites. Owing to their synergistic effect, the transcriptional efficiency with rrnB PI is increased by more than 300 times.

Particularly, since the expression level of an FIS protein is regulated according to a growth phase of E. coli and the transcriptional level of rRNA is also regulated according to the growth phase of E. coli, it is believed that the FIS protein will play a very important role in the transcriptional activity and regulation of rRNA. Accordingly, there is an urgent need for the development of an expression vector, which utilizes the structure of the rrnB promoter known as having the most excellent transcriptional activity in E. coli and thus can be used in a wide range of E. coli strains, and upon introduction into E. coli, shows substantially high expression level and regulatory capability. The present invention provides an expression vector into which suitable factors are inserted so as to allow recombinant protein expression in E. coli to be maximized.

Disclosure of Invention The present invention relates to an expression vector for use in the production of recombinant protein using E. coli.

The expression vector of the present invention comprises a promoter consisting of FIS binding sites, an UP element and a core promoter.

Also, the expression vector of the present invention may additionally comprise a FIS gene, which is regulated by an inducible promoter. In the expression vector of the present invention, the FIS binding sites and the UP element have a base sequence represented by SEQ. ID. NO: 1. The base sequence of SEQ. ID. NO: 1 was reconstructed to have the smallest size after searching the base sequence of rrnB PI promoters and identifying the smallest sequence required for the expression of these promoters. Characteristics of the factors contained in this sequence are as follows.

The FIS binding sites that a FIS protein recognizes and binds thereto are present at three sites including -71, -102 and -143 (the transcriptional initiation site is expressed as +1, the base pairs downstream thereof are expressed as +2 and +3, and the base pairs upstream thereof are -1 and -2b). The FIS protein binds to these FIS binding sites as a dimer and it reacts with an alpha subunit of RNA polymerase, thereby greatly increasing the transcriptional efficiency of the core promoter.

The UP element is a site ranging from -40 to -60 of a rrnB gene. Similar to the FIS protein, this UP element reacts with the alpha subunit of RNA polymerase so that RNA polymerase can more easily recognize the core promoter site, thereby greatly increasing the transcriptional efficiency of the core promoter.

Thus, the expression vector having the promoter containing these factors can exhibit maximized transcriptional efficiency.

The core promoter which is a region including hexamers present at -10 and -35 of an rrnB gene makes the transcription of a target protein gene to be initiated. A sigma 70 subunit of RNA polymerase recognizes and binds to this core promoter, thereby initiating the transcription. As the core promoter that can be used in the present invention, there is an rrnB promoter which has been used previously, and also all promoters which have been widely used in the production of recombinant protein, including tac, trc, lac and trp promoters.

The inducible promoter whose transcriptional activity varies depending on whether inducers are present or not, is a region which will regulate the expression of the FIS gene. The expression of the gene, which is regulated by the inducible promoter, can be regulated according environmental change, i.e., medium composition. As the inducible promoter, which can be used in the present invention includes, there are inducible promoters which have been used previously, including lac, tac and trc promoters whose transcriptional activity varies depending on whether IPTG (isopropyl-beta-D-thiogalacto pyranoside) as an inducer is present or not. Preferably, the tac promoter, which is a composite type of the lac promoter and the trp promoter and shows strong induction capability, is used.

In addition to these factors, the expression vector of the present invention has an operator downstream of the promoter and a transcriptional terminator at the 3' end of a multiple cloning site, in order to increase its utility for the expression regulation and cloning of a target gene. The operator, which is one component of the operon, is mainly located between a promoter and a structural gene. The operator is essential for the induction of suitable expression and its transcriptional activity is regulated depending on whether the inducer is present or not. In the present invention, there is used the lac operator whose transcriptional activity is strictly regulated according to whether IPTG is present or not.

In the case of lac operon, when IPTG as an inducer is not present, a repressor expressed from lac I binds to the lac operator site and structurally prevents RNA polymerase from being bound to the adjacent promoter, so that transcription does not occur. However, if IPTG is introduced into a cell and binds to the repressor, the repressor is then structurally changed so that its affinity for the lac operator is decreased then it is released from a operator. Thus, when IPTG is present, RNA polymerase easily binds to the promoter such that transcription can be initiated.

The transcriptional terminator is a sequence making the transcription with RNA polymerase to be terminated. The vector containing this transcriptional terminator at the 3' end of a multiple cloning site can also express genes with no internal transcriptional terminator. In the present invention, although any of conventional transcriptional terminators may be used, T1/T2 transcriptional tenninators of the pKK223-3 vector are preferably used.

Hereinafter, a method for producing the expression vector of the present invention will be described in detail with reference to the case of pFRPT, a representative expression vector of the present invention.

In producing the expression vector pFRPT of the present invention, a connected DNA fragment which contains the smallest sequence essential for its function of the FIS binding sites, the UP element, the core promoter of rrnB PI and the lac operator is obtained and inserted into the 5' end of a multiple cloning site of a pET29(c) vector from which a promoter region was removed. The smallest sequence containing the TI and T2 terminator sites of the PKK223-3 vector is additionally inserted into the 3' end of the multiple cloning site. A DNA fragment to which the smallest sequence required for the expression of the FIS protein was connected is obtained and additionally inserted into the 3 ' end of the tac promoter of the ρKK223-3 vector.

In producing the expression vector pFRPT of the present invention, the base sequence of the E. coli rrnB gene (GenBank accession number J01695; SEQ ID NO: 2) and the lac operator (see, Watson et al, Molecular Biology of the Gene, 4th Edition, ρ471; SEQ ID NO: 3) are first searched. The smallest base sequences required for the expression of the FIS binding sites, the UP element, the core promoter of rrnB core PI and the lac operator is identified and rearranged to have a structure shown in FIG. 1, thereby designing 245 bp size promoter and operator sequences (SEQ ID NO: 4) to be inserted into the expression vector of the present invention.

To obtain this base sequences, oligomers of suitable size containing such sequences are synthesized. Upon the production of these oligomers, suitable restriction enzyme sites that can complementarily bind to the oligomers are inserted into both end sites of the oligomers to be connected to each other, such that a DNA fragment having the designed promoter structure can be obtained when all the oligomers were connected to each other.

The synthesized oligomers are connected to each other by recursive PCR, and then amplified using a primer that can complementarily bind to the base sequence of their both ends. A DNA fragment from PCR is inserted into the pET(29)(c) vector from which a promoter was removed. This gives the expression vector pERP, which contains the FIS binding sites, the UP element, the core promoter of rrnB PI and the lac operator (see, FIG. 2).

However, the expression vector pERP has no separate transcriptional terminator at the 3 ' end of its multiple cloning site and thus can be used only when cloning a gene having the transcriptional terminator. For this reason, a gene containing the TI and T2 transcriptional terminators is obtained from the pKK223-3 vector and additionally inserted into the 3 ' end of the multiple cloning site of the expression vector pERP, thereby obtaining the expression vector pERPT (see, FIG. 3). In these expression vectors of the present invention, the transcriptional activity of the promoter can be increased by an endogenous FIS protein, which is originally produced in E. coli. However, if the expression vector itself has an expression system which can express the FIS protein and regulate this expression, the transcriptional activity of the promoter will be increased while the expression of protein will become easy. For this reason, an inducible expression system of the FIS protein is additionally inserted into the expression vector pERPT.

First, the nucleotide sequence of an E. coli FIS gene is searched (Genbank accession number J03816, SEQ ID NO: 5), and PCR reaction is conducted using a primer which can amplify this gene. The FIS gene thus obtained is inserted into a multiple cloning site of the pKK223-3 vector having the tac promoter. Using this plasmid, PCR is conducted again so as to obtain a fragment extended from the tac promoter to the FIS gene and this fragment is additionally inserted into the 3 ' end of a replication origin of the expression vector pERPT, thereby obtaining an expression vector pFRPT of the present invention (see, FIG. 4). The expression vector pFRPT of the present invention was introduced into a

JM109 cell and deposited in the Korean Culture Center of Microorganisms (KCCM) under the accession number KCCM- 10320.

After a target protein gene to be expressed is inserted into the expression vector of the present invention, E. coli is transformed with this vector and an inducer is added, thereby expressing the target protein. As proteins that can be obtained by the expression vector of the present invention, there are proteins taking charge of functions, including bio-component, enzyme, signal transfer, hormone, immune system and bio-defense, and also any desired proteins.

The expression vector of the present invention contains the FIS binding sites and the UP element, which greatly improve the transcriptional initiation capability of the core promoter. Thus, this vector allows the expression level of the target protein to be greatly increased as compared to the conventional expression vectors only having the core promoter.

Among the expression vectors of the present invention, the vector that additionally contains the inducible expression system of the FIS protein easily regulates the expression of the FIS protein so that the vector itself can produce the FIS protein. Thus, in addition to the endogenous FIS protein originated from E. coli, the quantity of the FIS protein that can bind to the FIS binding sites will be increased while the transcriptional efficiency of the rrnB PI promoter will be increased, so that the production efficiency of the target protein can be maximized.

Furthermore, owing to the inducible expression system of the FIS protein, the transcription level of RNA forming a ribosome is increased while an increase in amount of the ribosome within an expression host. The host cell where the expression of original protein occurred tends to show a reduction in its growth with the passage of time, and hence, there have been many difficulties in the mass production of the target protein. However, as the amount of the ribosome that is an expression mechanism is increased by the inducible expression system of the FIS protein, the expression level of various proteins required for the growth of the host cell is increased, and thus the host cell is continued to grow, so that the expression level of the target protein can be further increased.

Since the expression vector of the present invention has a separate transcriptional terminator present at the 3' end of the multiple cloning site, a recombinant protein gene inserted into the multiple cloning site can be stably expressed. Moreover, since the expression vector of the present invention may contain the conventional promoters that have been used in a wide range of strains, it can be used regardless of the genetic characteristics of the strains to be used as a host cell. Thus, unlike the case where the conventional expression vectors with the bacteriophage expression system are used, the expression vector of the present invention does not require separate genetic deformation and allows an expression host to be selected according to the characteristics of the target protein. As a result, the expression vector of the present invention is useful in the industrial fields requiring the production of various proteins.

Brief Description of the Drawings

FIG. 1 is a drawing showing the structure of promoter and operator regions of an expression vector pFRPT according to the present invention;

FIG. 2 is a drawing showing the structure of an expression vector pERT according to the present invention; FIG. 3 is a drawing showing the structure of an expression vector pERPT according to the present invention; and

FIG. 4 is a drawing showing the structure of an expression vector pFRPT according to the present invention.

Best Mode for Carrying Out the Invention

The present invention will hereinafter be described in further detail by examples. It should be borne in mind that the present invention is not limited to or by the examples.

Example 1 : Production of inventive expression vector pERP

An expression vector, which contains FIS binding sites, an UP element and a core promoter of rrnB PI as components of a promoter and has a lac operator at the 3' end thereof, was produced.

First, the base sequences of the E. coli rrnB gene (SEQ ID NO: 2) and the lac operator (SEQ ID NO: 3) were searched. The smallest base sequences required for the expression of the FIS binding sites, the UP element, the rrnB PI promoter and the lac operator was identified, after which oligomers of suitable size containing these sequences were produced. In producing these oligomers, suitable restriction enzyme sites that can complementarily bind to the oligomers were inserted into both end sites of the oligomers to be connected to each other, such that a promoter of a structure shown in FIG. 1 can be constructed after all the oligomers were connected to each other. The base sequences of the oligomers used are given in Table 1 below.

Table 1 :

These oligomers were subjected to recursive PCR. IX Pfu buffer (Stratagene) containing 20 pmole of each of the oligomers and 200 μM dNTP was provided and reacted for 1 minute at 95 °C and 1 minute at 42 °C and this reaction was repeated four times under this condition. After 2.5U Pfu enzyme (Stratagene) was added to the reactant solution, the resulting reactant solution was reacted for 1 minute at 94 °C, 1 minute at 42 °C and 1 minute at 68 °C and this reaction was repeated five times under this condition. Thus, the oligomers were connected in the order of rrn 1, rrn 2, rrn 3, rrn 4, rrn 5 and rrn 6.

To amplify the connected oligomers, 2μl of the connected oligomer were added to 48μl of IX Pfu buffer containing 200μl dNTP, 20 pmole rrn Cla I primer, 20 pmole rrn Nde I primer and 2.5U Pfu DNA polymerase, and reacted for 1 minute at 94 °C, 1 minute at 52 °C and 1 minute at 72 °C and this reaction was repeated 25 times. At this time, the base sequences of the primers used are as follows. rrn Cla 1: AGATCGATCTCGATCCCGCGAA (SEQ ID NO: 12). rm Nde I: TTCTTTCATATGTATATCTCCTTCTTAAAG (SEQ ID NO: 13).

The 245 bp size PCR product thus amplified was examined by agarose gel electrophoresis and purified using a gel extraction kit (Quagen). The purified DNA fragment was treated with 50U Nde I for 6 hours, extracted using a mixed solvent of phenol and chloroform (l :l (v/v)), and purified by precipitation with a three-fold volume of ethanol (hereinafter, referred to as "ethanol purification").

As a vector into which the DNA fragment be inserted, an expression vector pET29(c)(Novagen) was selected. lOμg of this vector was digested with Sph I for 2 hours at 37 °C. After digestion, the ethanol-purified plasmid was added to 30μl of a reactant solution containing 30μM dNTP, 3U T4 polymerase and IX T4 polymerase buffer, and reacted for 10 minutes at 20 °C to remove an overhang at a 3' end, and then ethanol-purified. After purification, the resulting vector was reacted with 50U Ndel for 3 hours at 37 °C to remove a T7 promoter site that is an original promoter of the pET vector. A vector DNA which had been digested into the desired size was obtained by agarose gel electrophoresis and purified using a gel extraction kit.

The two DNA fragments obtained as described above were added to 20μl of a reactant solution containing 3U ligase (Promega) and IX ligase buffer and reacted for 18 hours at 20 °C. From E. coli colonies obtained by transforming E. coli cells

(JM109) with this reactant solution, a clone containing the desired plasmid was selected.

The expression vector thus obtained contains the FIS binding sites, the UP element, the core promoter of rrnB PI and the lac operator, at the 5 'end of the multiple cloning site thereof. This expression vector was termed pERP.

Example 2: Production of inventive expression vector pERPT

A transcriptional terminator was additionally inserted into the expression vector pERP, such that a gene to be inserted into an expression vector of the present invention can be stably expressed.

As the transcriptional tenninator, TI and T2 terminators of pKK223-3 (Phamacia) were selected. In order to obtain the transcriptional tenninator region from pKK223-2, lOμg pKK223-2 was digested in a reactant solution containing 10U Hindlll and 10U Hindi. The digested plasmid was analyzed by agarose gel electrophoresis to obtain a 767 bp size fragment containing the transcriptional terminator, and then purified using a gel extraction kit. Meanwhile, lOμg of the vector pERP was added to 50μl of a reactant solution containing 1U Aval, and partially digested at 37 °C for 15 minutes and then at 60 °C for 30 minutes, thereby inactivating enzyme. 33μιM dNTP and 10U Klenow enzyme were added to the reactant solution and reacted at 20 °C for 15 minutes to make the digested vector blunt-ended. After reaction, the vector was purified using agarose gel electrophoresis and a gel extraction kit. The purified vector was digested in 30μl of a reactant solution containing 30U Hindlll, and then purified using agarose gel electrophoresis and a gel extraction kit.

The two DNA fragments obtained as described above were added to a reactant solution containing 3U ligase and IX ligase buffer and reacted for 18 hours at 16 °C. From E. coli colonies obtained by transforming JM109 cells with this reactant solution, a clone containing the desired plasmid was selected.

The expression vector thus obtained contains the FIS binding sites, the UP element, the core promoter of rrnB PI and the lac operator, at the 5 'end of the multiple cloning site thereof, and also the transcriptional terminator at the 3' end of the multiple cloning site. This expression vector was termed pERPT.

Example 3: Production of expression vector pFRPT of the present invention

An inducible expression system of the FIS protein was inserted into the expression vector pERPT, such that the expression vector of the present invention can express the FIS protein by itself and regulate its expression.

JM109 cells were inoculated to LB medium and cultured in a shaking incubator at 37 °C. When absorbance of the culture medium reached 0.7, the culture medium was centrifuged to harvest cells. Then, total RNA was isolated using TRizol (Gibco BRJL) and dissolved in 50μl distilled water, heated at 70 °C for 10 minutes, and rapidly cooled in ice. 5μl RNA obtained as described above was added to 50μl reactant solution containing 10 pmole FIS down primer (SEQ ID NO: 14), 10 pmole FIS up primer (SEQ ID NO: 15), 200μM dNTP, IX reverse transcriptase buffer and 2μl reverse transcriptase (Gibco BRL), and reacted for 90 minutes at 42 °C and then for 15 minutes at 90 °C, thereby conducting reverse transcription reaction. The nucleotide sequences of the primers used are as follows:

FIS down primer: TTCAAGCTTAGTTCATGCCGTATTTTTTCAA (SEQ ID NO: 14).

FIS up primer: GGAATTCATGTTCGAACAACGCGTAAATT (SEQ ID NO: 15).

Using this reactant solution as a template, in the presence of 200μM dNTP, 20 pmole of each primers, IX Pfu buffer and 2.5U Pfu polymerase, PCR was repeated 28 times in the condition of 1 minute at 94 °C, 1 minute at 52 °C and 1 minutes at 68 °C. The resulting PCR product was analyzed by agarose gel electrophoresis and digested in 30μl reaction solution containing 30U EcoRI and Hindlll restriction enzymes.

In order to connect a tac promoter to the resulting DNA fragment, the DNA fragment was connected to pKK223-3 plasmid digested with EcoRI and Hindlll. 3μl of this reactant solution was subjected to PCR using a tac primer and the FIS down primer under the same condition as described above, thereby obtaining a fragment containing a tac promoter and a FIS gene at a 3' end. The base sequences of the tac primer used are as follows: tac primer: ctgaaatgagctgttgacaattaatcatc (SEQ ID NO: 16).

The PCR product thus obtained was digested with 20U Hindlll, and made blunt ends using Klenow enzyme. Then, the resulting product was purified using agarose gel electrophoresis and a gel extraction kit.

Meanwhile, 5μg pERPT was digested with Avill and then purified using agarose gel electrophoresis and a gel extraction kit.

The two fragments obtained as described above were added to a reactant solution containing 3U ligase and IX ligase buffer and reacted for 18 hours at 16 °C, so that an inducible expression system of the FIS protein was inserted into the 3 ' end of a replication origin of the vector. From E. coli colonies obtained by transforming JM109 cells with this reactant solution, a clone containing the desired plasmid was selected. The expression vector thus obtained contains the FIS binding sites, the UP element, the rrnB core promoter and the lac operator, at the 5 'end of the multiple cloning site thereof, and the transcriptional terminator at the 3' end of the multiple cloning site, and also the inducible expression cassette of the FIS protein at the 3' end of the replication origin thereof. The expression vector of the present invention was termed pFRPT. After introducing into JM109 cells, this expression vector was deposited in the Korean Culture Center of Microorganisms (KCCM) on September 24, 2001 under the accession number KCCM-10320.

Test Example 1 : Expression of human growth hormone using inventive expression vector pFRPT and conventional expression vector

Using the expression vector pFRPT of the present invention and a conventional expression vector, human growth hormone (hereinafter, referred to as hGH) was expressed, and the expression rate for the inventive expression vector was compared to the expression rate for the conventional vector.

As the conventional vector whose expression rate will be compared to the inventive expression vector pFRPT, an expression vector pEThink of a pET system using a T7 expression system was selected. To examine an expression rate according to the kind of an expression host, various strains were used as the expression host. As the strains used in this case, strains, including DH5, JM109, TOP10 and NovaBlue(DE3), which have been widely used in the expression of recombinant protein, were selected.

First, PCR was conducted using, as a template, a plasmid of the accession number ATCC-31389 into which an hGH gene had been cloned. The base sequences of primers used in this case are as follows: hGH forward primer: ttttcatatgttcccaaccattccct (SEQ ID NO: 17). hGH reverse primer: gcggtaccctagaagccacagctgcc (SEQ ID NO: 18).

In order to insert the hGH gene into the conventional expression vector pEThink, both the hGH gene from the PCR reaction and the expression vector pEThink were digested with Ndel and Hindlll, connected to each other and introduced into the respective host cells. Thus, a clone where the hGH gene is expressed by the vector pEThink was obtained.

Meanwhile, in order to insert the hGH gene into the expression vector pFRPT of the present invention, the vector pFRPT was digested with Ndel and Hindlll, and pEThink into which a hGH gene had been inserted was digested with Ndel and Hindlll to obtain the hGH gene. The hGH gene and the vector pFRPT was connected to each other and introduced into the respective host cells, thereby obtaining a clone where the hGH gene is expressed by the vector pFRPT.

Each of the strains was cultured overnight at 37 °C, diluted in fresh medium at the ratio of 1 :100, and then cultured at 37 °C. When absorbance of the culture medium reached 0.8, 0.4 mM IPTG as an expression inducer was added to the culture medium. After the culture medium was cultured for additional 3 hours in a shaking incubator, it was measured for its absorbance, a cell was harvested and protein was extracted. The extracted protein was subjected to SDS-PAGE, after which the resulting gel was Coomassie stained and absorbance of the total protein and the hGH gene was measured using a Gel Doc system through NIH image. Expression rate of the hGH gene relative to the total protein was calculated according to the expression vector and the expression host. Results are given in Table 2 below.

Table 2:

As evident from Table 2, when the conventional expression vector pEThink was used, the hGH gene exhibited some expression rate in only the NovaBlue(DE3) strain where the T7 expression system is well constructed. On the other hand, when the expression vector pFRPT of the present invention was used, the expression rate of the hGH gene occupied a half or above of the total protein in all the strains.

Furthermore, the amount of the inducer IPTG used in this test example is very small as compared to one used in the prior art. Thus, it can be found that the expression vector pFRPT of the present invention induces excellent protein expression even when a small amount of the inducer is used.

Meanwhile, in order to examine if the host cell is continued to grow even after the expression of the target protein occurred, absorbance measured before addition of the IPTG inducer was compared to absorbance measured after the addition of the IPTG inducer so that a change in growth rate of the host cell according to the kind of expression host was measured. Results are given in Table 3 below.

Table 3:

As evident from Table 3, the use of the expression vector pFRPT of the present invention exhibited an incieased growth rate of the host cells as compared to the conventional expression vector pEThink of the pET expression system.

As evident from the foregoing, unlike the conventional expression vector, the inventive expression vector allows the host cells to be continued to grow even after the induction of the target protein occurred. For this reason, the inventive expression vector can show significantly increased expression rate in total production per unit fermentation.

As a result, it can be found that the inventive expression vector can express the target protein at high yield even when the inducer is used at a small amount compared to the conventional expression vector. Also, the inventive expression vector allows the host cell to be continually grown such that the expression rate of the host cell can be further maximized.

Test Example 2: Examination of increase in transcription capability of conventional promoter with FIS binding sites and inducible expression system of FIS protein In order to examine if other promoters other than the rrnB promoter, which is the promoter of the inventive expression vector having the FIS binding sites along with the inducible expression system of the FIS protein, can be used, the FIS binding sites and the inducible expression system of the FIS protein were inserted into a vector having a tac promoter. To obtain a fragment excluding the rrnB promoter from the vector pFRPT,

PCR was conducted using the Quick-Change™ method (Stratagene). The base sequences of primers used in this case are as follows: rrnBP-excluded forward primer: gaggaaatttaaaataattttctga (SEQ ID NO: 19). rrnBP-excluded reverse primer: gcgcggaattgtgtgagcggataaca (SEQ ID NO: 20).

In order to obtain a tac promoter region to be inserted as a substitute for the rrnB promotor, oligomers with the following base sequence were constructed: oligo tac 1 : ttgacaattaatcatcggctcgtataatg (SEQ ID NO: 21). oligo tac 2: cattatacgagccgatgattaattgtcaa (SEQ ID NO: 22). 200 pmole of the respective oligomers were mixed with each other, boiled at 100 °C, and slowly annealed to become double strand. Then, the oligomers were phosphorylated by addition of 10U T4 DNA kinase and ImM ATP. The tac promoter DNA thus obtained and the vector pFRPT from which the rrnBPl promoter had been removed were connected to each other, thereby obtaining a new expression vector. This expression vector was termed pFTAC.

In order to compare the rate of target protein expression for the inventive expression vector pFRPT to the conventional vector having the tac promoter, the hGH gene was inserted into the respective expression vectors and introduced into host cells in the same manner as described in Test Example 1 , and then examined for its expression rate. In this case, as the conventional vector to be compared to the inventive vector pFT AC, the vector pKK223-3 was used.

The pFRPT-hGH plasmid obtained in Test Example 1 was digested with

Ndel/Hindlll to obtain a hGH gene. This hGH gene was inserted into the respective vector which had been digested with Ndel/Hindlll. Thereafter, the expression rate of the hGH gene according to the respective vectors was examined in the same manner as described in Test Example 1.

As a result, when the conventional expression vector pKK223-3 was used, the expression level of the hGH gene was very insignificant relative to the total protein, but when the inventive expression vector pFTAC was used, the expression level of the hGH gene was 3-5 times increased.

Therefore, it can be found that when the FIS binding sites and the inducible expression system of the FIS protein are additionally inserted into the conventional expression vector, the target protein can be expressed at significantly higher efficiency than the conventional expression vector.

Industrial Applicability

As described above, unlike the conventional expression vector containing only the core promoter itself, the expression vector of the present invention contains, at its promoter site, the core promoter and also the FIS binding sites and the UP element, which greatly improve the capability of transcriptional initiation of the promoter. Thus, the expression vector of the present invention has an effect of expressing the target protein of foreign origin at a high level.

When the FIS gene, which is regulated by the inducible promoter with strong regulation capability, is additionally inserted into the expression vector of the present invention, the expression of the FIS protein can be easily regulated so that the expression level of the FIS protein can be increased. Thus, the expression vector of the present invention additionally contains the inducible expression system of the FIS protein, and hence can increase the transcriptional efficiency of the core promoter, thereby maximizing the expression level of the target protein. Accordingly, this expression vector has an effect of producing large amounts of protein even when the inducer is used at significantly smaller amounts than the conventional expression vector.

Also, this inducible expression system of the FIS protein allows the amount of a ribosome as an expression merchinary to be increased, such that the expression rate of various proteins required for the growth of host cells can be increased. As a result, it has an effect of further maximizing the expression rate of the target protein. The expression vector of the present invention permits the use of a wide range of E. coli strains as host cells regardless of the genetic characteristic of the strains, so that the range of expression hosts, which can be selected according to the characteristic of target protein, widens. Accordingly, the expression vector of the present invention is useful in industrial fields requiring the production of various proteins.

Claims

What Is Claimed Is:

1. An expression vector comprising a promoter consisting of FIS binding sites, an UP element and a core promoter.

2. The expression vector of Claim 1, which additionally comprises a transcriptional terminator inserted into the 3' end of a multi-cloning site.

3. The expression vector of Claim 1, which additionally comprises an FIS gene that is regulated by an inducible promoter.

4. The expression vector of Claim 3, which additionally comprises a transcriptional terminator inserted into the 3' end of a multi -cloning site.

5. The expression vector of Claim 1, wherein the core promoter is a core promoter of rrnB PI, and an inducible promoter is a tac promoter.

6. The expression vector of Claim 5, which is an expression vector pERP.

7. The expression vector of Claim 2, wherein the core promoter is a core promoter of rrnB PI, an inducible promoter is a tac promoter, and the transcriptional terminator is a transcriptional terminator of pKK233-3.

8. The expression vector of Claim 7, which is an expression vector pERPT.

9. The expression vector of Claim 4, wherein the core promoter is a core promoter of rrnB PI, the inducible promoter is a tac promoter, and the transcriptional terminator is a transcriptional terminator of pKK233-3.

10. The expression vector of Claim 9, which is an expression vector pFRPT.

22

11. The expression vector of Claim 10, wherein the expression vector pFRPT is deposited under the accession number KCCM 10320.

12. The expression vector of Claim 4, wherein the core promoter is a core promoter of a tac promoter, the inducible promoter is a tac promoter, and the transcriptional terminator is a terminator of pKK233-3.

13. The expression vector of Claim 12, which is an expression vector pFTAC.

14. A microorganism in which the expression vector of any one of Claims 1 to 13 is introduced.

15. The microorganism of Claim 14, which is E. coli.

16. A method of increasing the expression level of a target protein using the expression vector of any one of Claims 1 to 13.

23