KR100207951B1 - High expression recombinant vector of e. coli and preparing method of human granulocyte colony stimulating factor - Google Patents

Abstract

A gene of phosphorus granulocyte colony stimulating factor comprising the nucleotide sequence of the following formula (I).

(Wherein, W represents an upstream DNA sequence including the promoter and shine-dalgano region of the gene of the phosphorus granulocyte colony stimulator as described above, wherein the shinedalgano region is defined between the shine-dalgano region and the initiation codon. A DNA base sequence of 7 to 11 bp comprising a base sequence selected from the group consisting of formulas (e) to (g),

The promoter region is a trp promoter; X represents the 5 'terminal DNA sequence of the gene of the above-mentioned phosphorus granulocyte colony stimulator selected from the group consisting of the following formulas (a) to (d);

Y represents a DNA sequence corresponding to the 11 to 174 amino acid sequence of the above phosphorus granulocyte colony stimulator gene; Z is a DNA sequence containing a transcription terminator below the end codon of the phosphorus granulocyte colony stimulator gene, which is a transcription terminator of a tetracycline resistance gene, a transcription terminator of bacteriophage fd, a transcription terminator of Staphylococcus protein A, transforming the host cell using a recombinant vector comprising a rrnB operon transcription terminator) can overexpress hG-CSF in the host cell.

Description

Overexpressed Recombinant Vectors of Escherichia Coli and Method for Preparation of Phospholipocyte Colony Stimulating Factor

1 is a diagram showing the nucleotide sequence of the hG-CSF synthetic gene and the codon use of the 5 'terminal variant.

2 is a restriction map of the expression vector pDA123.

Figure 3 is a production diagram of the expression vectors pCSF430, pCSF440, pCSF450, pCSF460, pCSF470.

Figure 4 is a diagram of the expression vector pCSF450R.

Figure 5 shows the preparation of the expression vectors pCSF451, pCSF452, pCSF453.

6 is a graph showing the growth curve of the fermentation process of W3110 / pCSF451 production strain.

Figure 7 shows the increase in the expression rate of hG-CSF with the induction time of W3110 / pCSF451 by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

[Industrial use]

The present invention relates to an overexpressed recombinant vector of Escherichia coli, and more specifically, human granulocyte-colony stimulating factor (hereinafter referred to as hG-CSF) chemically synthesized in an E. coli expression system (E. coli expression system). An overexpression vector using the gene and a method for mass production of hG-CSF in E. coli using the same.

[Private Technology]

With the breakthrough development of recombinant DNA technology, the use of microorganisms as a host for hormones (citing evidence: K.Itakura et al., Science 198, 1977 and DVGoeddel et al. Nature 281, 544, 1979), Saito Large quantities of important bioactive substances such as cytokines (quotation citation: AM Wang et al., Science 228, 149, 1985), interferons (quotation citation: T.Taniguchi et al., Nature 285, 547, 1980) Production is possible, and these mass-produced bioactive substances are widely used as useful medicines.

Host cells used in the method of producing a target protein using such recombinant DNA must be preceded by the study of their genetic and physiological prior to its use. For this reason, Escherichia coli, which has been used as the most common host cell, is known to be a very useful host because it is relatively easy to manipulate genetically and inexpensive medium, and can increase cell production.

In order to mass-produce the protein of interest from E. coli, plasmids (called plamids or vectors) are mainly used. Plasmids carry out their own replication with the chromosome and transfer the genetic information to the zygote. They also transcribe and translate the genetic information by the promoter, and have a selection marker so that the plasmid It can be identified even after being transported to other cells. Therefore, after cloning the gene of the protein of interest in the plasmid, it is possible to induce the production of the protein.

In this case, the plasmid in which the gene of the target protein is cloned is called a recombinant vector, and the generation of the target protein from the recombinant vector is called 'expression', and the plasmid used is called an 'expression vector'. The utility of expression vectors is increased.

In general, a recombinant vector i) cleaves a specific site on a desired plasmid by using an endonuclease capable of cleaving a specific site on a plasmid, among the restriction enzymes that recognize a specific DNA sequence and cleave the site. And ii) inserting a gene expressing the target protein into the site, and iii) recombining the cleavage site using an enzyme called ligase that recombines the cleavage site. In addition, it is possible to mass-produce the protein of interest by transforming the vector prepared by the above method into Escherichia coli, purely separating the transformant, and culturing in an appropriate medium.

Promoters mainly used to induce the expression of recombinant vectors include t promoter, lac promoter, tac promoter, and λ P _L promoter (IHMiller et al., The Operon, Cold Spring Harbor, 133-136, 1980). ). Among them, the Trp promoter (C. Yanofsky et al., Nucleic Acids Res. 9. 6647. 1981) is derived from the tryptophan operon. It has an operator site that is a sequence.

The binding of the repressor protein to the operator site is influenced by the concentration of tryptophan in the cell, and when the concentration of tryptophan is high, they bind strongly to each other and interfere with transcription by RNA polymerase. However, if the concentration of tryptophan in the cell is low or competitive inhibitors such as indole-3-propionic acid or indole acrylic acid (3-IAA) are present, It is isolated at the operator site and DNA is transcribed into mRNA in the 5 'to 3' direction by RNA polymerase. The sequence of transcription begins with the DNA sequence encoding the ribosomal binding site, followed by the translation initiation codon of the target protein (typically ATG on DNA and AUG on the resulting mRNA) and the gene of the target protein. After transcription, transcription is stopped when a transcription terminator is reached.

The mRNA thus produced binds to the ribosomes, and the ribosomes slowly move on the mRNA, translating genes from translation initiation codons to initiation and termination codons (typically UAA, UAG and UGA on mRNA). To produce the desired protein (GD Stormo et al., Nucleic Acids Res. 10, 2971, 1982).

In the preparation of overexpressed recombinant vectors using plasmids, the following points have generally been considered.

First, factors related to self-replication of the plasmid, namely gene copy number and stability (quotation: DW Zabriskie et al., Enzyme Microbiol. Lett. 22, 239, 1984), second, elements related to mRNA, ie mRNA Initiation rate of synthesis (K. Nakamura et al., EMBO J. 1,771, 1982), elongation and termination of synthesis (quotation: T. Platt et al. 'Gene functon in prokaryotes', p123, 1983) and the rate of degradation of mRNA (quotation citation: SF Newbuy et al., Cell 51, 1131, 1987), third, protein related factors, that is, the translation initiation rate of the desired protein (citation: GDStormo et al., Science 198, 1056, 1977), and fourth, protein degradation rate (quotation maxima: 'Maximizing Gene Expression' p287, 1977) has been considered to be compatible with host cells.

[Purpose of invention]

The present invention provides a hG-CSF gene chemically synthesized in an E. coli expression system (E. coli expression system) and an overexpression vector using the chemically synthesized gene, and in addition, hG- in E. coli using the overexpression vector. Its purpose is to provide a method for mass production of CSF.

[Configuration of Invention]

The present invention provides a gene of hG-CSF comprising the base sequence of the following formula (I) to achieve the above object.

Wherein W represents an upstream DNA sequence comprising the promoter and shine-dalgano region of the hG-CSF gene described above; X represents the 5 'terminal DNA base sequence of the hG-CSF gene described above selected from the group consisting of the following formulas (a) to (d);

Y represents a DNA sequence corresponding to the 11-174 amino acid sequence of the hG-CSF gene described above; Z represents a DNA base sequence including the transcription terminator below the termination codon of the hG-CSF gene.

W region of the hG-CSF gene of the formula (I) of the present invention comprises a DNA base sequence selected from the group consisting of the following formula (e) to (g) between the shine-dalgano region and the start codon.

In addition, the Y region of the hG-CSF gene of the formula (I) of the present invention includes the DNS base sequence of the following formula (II).

The W region of the hG-CSF gene of the formula (I) of the present invention includes a trp promoter and a DNA sequence of 7 to 11 bp between the shine-dalgano region and the start codon.

The Z region of the present invention includes a transcription terminator selected from the group consisting of a transcription terminator of a tetracycline resistance gene, a transcription terminator of bacteriophage fd, a transcription terminator of Staphylococcus protein A, and a transcription terminator of rrnB operon.

The present invention provides an amino acid sequence of hG-CSF expressed from the hG-CSF gene of the present invention.

The present invention also provides a vector comprising the hG-CSF gene of the present invention and a vector from which the nucleotide sequence including the DNA sequence corresponding to the rob protein is removed, wherein the vector is pDA 123, pCSF 430, pCSF 440, pCSF. 450, pCSF 450A, pCSF 450B, pCSF 450C, pCSF 450L, pCSF 450M, pCSF 450R, pCSF 451, pCSF 452, pCSF 453, pCSF 460, and pCSF 470.

In addition, the present invention inserts the hG-CSF gene of the present invention into a vector; Transforming the host cell with the vector into which the base sequence is inserted; Culturing the host; It provides a method of producing hG-CSF comprising the processes.

The present invention also transforms host cells with a vector of the present invention comprising the hG-CSF gene of the present invention; Culturing the host; It provides a method of producing hG-CSF comprising the processes.

In the above-described production method of the present invention, the host is selected from the group consisting of BE42, DH1, HB101, JM101, LE392, MC1061, NM522, W3110, Y1088, and the culture thereof is performed in a medium containing a low concentration of tryptophan. .

The present invention also relates to a plasmid having the characteristics of the plasmid pCSF450 contained in the Korean spawn association accession no. KFCC 10837 Escherichia coli W3110 and the characteristics of the plasmid pCSF451 included in the Korean spawn association accession No. KFCC 10838 eserikia coli W3110. It provides a plasmid having.

The present invention also provides a microorganism having the characteristics of the Korean spawn association accession No. KFCC 10837 Escherichia coli W3110 and a microorganism having the characteristics of the Korean spawn association accession No. KFCC 10838 Escherichia coli W3110.

In order to maximize the production of hG-CSF from E. coli, in the present invention, an overexpression vector was prepared in consideration of four considerations in the preparation of the recombinant vector.

First, as for plasmids, proteins produced from E. coli plasmids usually increase in amount as the gene dosage increases, so that the number of copies of the plasmid can be stably increased. It was intended to devise.

In general, the number and stability of plasmids are largely determined by the replication origin, which is the origin of self-replication, and the growth conditions and physiology of gene host cells including plasmids also have a great influence on plasmid stability (DWZabriskie et al., Enzyme). Microbiol, Lett. 22, 239, 1984). Self-replication of E. coli plasmids is accomplished using a number of enzymes made from the chromosomal gene of E. coli, the host cell. However, different plasmids use different enzymes, and thus the amount of self-replicating plasmids will vary. The site where the plasmid copy number is controlled is present in the Ripleycone. Most of the E. coli plasmids currently in use are those of the pMB1 (or ColE1) plasmid isolated from clinical samples (JRScott, Microbial. Rev. 48, 1, 1984: F Bolivar et al., Gene 2, 95, 1977) and usually maintains 15 to 20 copies under growth. Self-replication proceeds in one direction from the starting point, where RNA II acts as a primer for DNA synthesis (T. Itoh et al., Proc. Natl. Acad. Sci. 77, 2450, 1980). RNAII will continue to form a hybrid with the DNA template and proceed with self-replication. Small RNA molecules called RNAI may interfere with self-replication. In other words, the hybridization of DNA template and RNAII is hindered by RNAI binding to RNAII. The combination of RNAI and RNAII promotes the expression of a small 63 amino acid protein called the Rob protein. As a result, RNAI's ability to negatively regulate self-replication is enhanced by Rob protein (G. Cesareni et al., Trends Biochem. Sci. 10: 303, 1985).

From this fact, the present inventors sought to reduce the interference of self-replicating by RNAl by removing or cleaving the gene of the Rob protein from the plasmid and consequently increasing the number of copies of the expression vector of hG-CSF and the expression of hG-CSF.

Second, it is related to mRNA. The first stage of gene expression is a transcription initiation event catalyzed by RNA polymerase.

The initiation rate of transcription in E. coli is regulated by the nucleotide sequence of the promoter, that is, regulatory proteins bind to specific nucleotide sequences of the promoter to regulate the transcription mechanism. When mRNA transcription is initiated by a promoter, mRNA is elongated and transcribed. However, sometimes nonspecific premature termination occurs. This immature termination site is determined by a portion of the promoter transcribed into mRNA and the DNA sequence of the gene of interest.

In general, when a human or animal gene is directly expressed in E. coli in the form of cDNA (complementary DNA), in most cases, the expression is inadequate or rarely occurs. This phenomenon originates from various reasons, but the above is also one of the important reasons. Therefore, reconstituting the gene of the protein of interest to suit the E. coli expression system to eliminate premature termination is an essential process required for the production of overexpression vectors.

Transcription termination occurs at the separation of mRNA, mRNA polymerase, and DNA. In this process, factors such as nucleotide sequence, secondary structure of mRNA transcript, and proteins of host cells such as NusA and NusB are affected. To get involved. Therefore, the efficiency of the transcription process from DNA to mRNA depends on the ability of RNA polymerase to recognize and act on transcription initiation and termination sites.

In order for RNA polymerase to perform its basic functions, each promoter region and terminator region generally have a similar common structure, but in contrast, a structural structure that gives a difference in function (efficiency and effect factor dependence) between each promoter and terminator. There is a difference.

Therefore, in order to prepare an overexpression vector, it is necessary to exclude nonspecific sequences from the mRNA that may cause the above-mentioned immature termination.

Therefore, the present inventors chemically synthesize hG-CSF gene so as to be suitable for Escherichia coli, thereby completely eliminating immature transcripts and increasing the expression effect by altering and binding various transcription terminators after the 3 'end of the hG-CSF gene. I wanted to.

In general, the characteristics of the structures commonly used by transcription terminators include: i) symmetric sequences before the termination, ii) U base at the 3 'end of the mRNA transcript, and iii) within the symmetric sequence. In general, there are many G / c bases (T. Paltt The Operon, New York, Cold Spring Harbor, 1980).

The symmetric sequences form a stem-loop structure and the length of the stem structure varies depending on the length of the symmetric sequence, and the length of the loop structure depends on the length between the symmetric sequences. The size will be different. This stem-ring structure is known to terminate transcription by RNA polymerase, and the U bases present at the 3 'end of mRNA transcripts are known to separate transcripts from DNA.

On the other hand, it is desirable that the transcription terminator be located as close to the 3 'end of the target gene as possible, which minimizes unnecessary transcription by RNA polymerase, thereby increasing the stability of mRNA and reducing the energy used by cells. have.

Therefore, the present invention excludes the use of the cDNA-type hG-CSF gene, chemically synthesizes the hG-CSF gene so that immature transcription does not occur, and stabilizes mRNA by binding various mRNA transcription terminators to the hG-CSF gene. Increasing and decreasing the energy used by the cells was intended to induce an increase in expression accordingly.

Third, it is related to the translation process.

The translation process is a process in which a polypeptide is produced from mRNA. The translation initiation step is a combination of mRNA and rRNA and fMet-tRNA, which are already produced during transcription, and an SI and initiation factor (IF). And IF 1, IF 2, and IF 3 (GDStormo, Maximizing Gene Expression p195, Butterworth, Stoneham, Massachusetts, 1986).

Translation initiation efficiency is affected by several sites in the mRNA, in particular the distance between the binding site of the ribosome Shine-Dalgarno (hereinafter referred to as 'SD'), the start codon, the SD site and the start codon And sequence and mRNA secondary structure are important factors. In particular, in the case of hG-CSF, when the cDNA itself is used as the target gene in the E. coli expression system using the PL or trp promoter, the expression does not occur at all and reduces the GC base content of the hG-CSF gene and the 5 'terminal sequence, When modified, the expression of hG-CSF was greatly improved. This phenomenon has several possibilities, but the modification of mRNA secondary structure of ribosome was closer to the mRNA and increased the translation initiation efficiency. (PE Devlin et al., Gene 65, 13, 1988).

The SD region has a sequence complementary to the 3 'end of the 16S rRNA and is generally composed of 3 to 6 nucleotides. The start codon is mainly AUG, but sometimes GUG, UUG, AUU, AUA, etc. are used. In addition, the interval between the SD region and the start codon is usually composed of 9 ± 3 nucleotides, and the base composition A and U are more effective. On the other hand, the spacing and sequence between the SD site and the start codon are closely related to the 5 'end of the target gene, thus playing an important role in the formation of the mRNA secondary structure of the start codon site (ACLooman et al., Nucleic Acids Res. 12, 7663). , 1984).

Therefore, by changing the gene spacing and sequence of the region to be compatible with the target gene, the mRNA stem-ring structure near the initiation codon can be destabilized and the efficiency of translation initiation can be successfully increased (LHTeissier et al., Nucleic Acids Res. 12). , 7663, 1984: CRWood et al., Nucleic Acids Res. 12, 3937, 1984).

The enlongation step, in which translation is initiated to form the polypeptide, does not proceed at a constant rate. This is because several regions of the mRNA regulate this stage. Since the mRNA is transcribed from the sequence of the gene of interest, gene expression rate has a great effect on the codon usage of the gene of interest and the codon context. (HA de Boer Maximizing Gene Expression p225, Butterworth, Massachusetts, 1986). In other words, one of the main causes of poor expression of cDNA genes in E. coli expression systems is the use of codons for less distributed tRNAs in E. coli or the lack of compatibility between adjacent codons.

In Escherichia coli, two release factors (hereinafter referred to as' RF's), which recognize three termination codons, are involved in the translational stage. RF 1 recognizes UAA, UAG, while RF 2 recognizes UAA, UGA (C.T. Caskey, Trends Biochem, Sci, 5, 234, 1980). Although the efficiency of the three termination codons is different, it is known that UAA is mainly used for overexpressed genes (P.M. Sharp et al., Gene 63, 141, 1988). However, to ensure that translation termination occurs, it is ideal to design two exit codons in succession.

Therefore, the present inventors chemically synthesized the hG-CSF gene so as to be suitable for codon codon usage and codon pre-relationship relationship, and tried to induce translation termination by surely connecting the translation end codons of TAA and TAG to the 3 'end.

Eventually, the expression of the gene of interest is determined by the efficiency of several processes.

All steps must be combined in a complex manner without biasing the quantity and stability of genes, the transcriptional efficiency and stability of mRNA, and the translational efficiency.The bases such as promoters and transcription terminators that do not express the target protein but regulate expression Not only the composition but also the base composition of the target genes must be compatible with each other to increase the efficiency of each step and increase the expression of the target protein.

On the other hand, the present inventors have tried to further increase the expression of the gene of the expression vector in consideration of the expression effect by the host cell in addition to the increase of the expression effect by the gene of the expression vector.

Microorganisms determine their function and structure based on their vast genetic information and have the ability to adapt and grow in different environments (H.P. Meyer et al., Annu. Rev. Microbiol. 39. 29. 1985). Thus, the genetic background of the host cell plays an important role in producing a specific desired product. However, although there are determinants that can measure the role of the host cell on the surface such as stability of the plasmid and degradation of the target product, the reason for genetic change in the production rate of the target product greatly varies depending on the host cell. PS Kaytes et al., J. Biotechnol. 4, 205, 1986).

In most cases where the recombinant product is overexpressed, the host cell is subject to enormous metabolic burden to enter the growth, which may result in segregation of the plasmid, thereby selecting the host cell stably producing the desired product. Is a very important task.

In addition to the genetic background of the host cell, the following two factors should be considered and selected for the host cell. In other words, the growth requirement and gene expression of the host cell are regulated. The growth requirement consists of 1) the need for nutrients such as vitamins, amino acids, and metal ions, and 2) sensitivity to temperature, and 3) oxygen dependence. The factors have a great influence on the efficiency of the fermentation process. In addition, the method of controlling gene expression varies depending on the gene expression system (gene expression system).

Therefore, selection of host cells according to promoters should also be considered. If the induction method such as heat, chemical inducer, nutrient starvation is changed according to the promoter, the response may be minute or largely changed depending on the host cell. Is more important.

When production strains are selected based on the compatibility between the expression vector and the host cell, optimal culture conditions should be established to maximize the efficiency of the expression system. Optimal culture conditions mean fermentation process conditions in which the expression of the target gene is sufficiently induced as the growth of the production strain is actively progressed. The factors influencing this include physical factors such as temperature and oxygen supply, chemical composition such as medium composition, and pH. It can be largely classified into phosphorus elements. In particular, when overexpressing a foreign gene in a microorganism, the consumption of energy, etc. is increased, thereby increasing the metabolic burden of the cell, which may result in a lack of nutrients, trace elements, or growth by delayed production of by-products. On the other hand, stability of the expression vector is most important for improving productivity in the fermentation process. The stability of the expression vector is closely related to the genetic background of the host cell, but the culture conditions are also a major factor. Must be freed.

Therefore, the present inventors chemically synthesize the gene of hG-CSF according to codon utilization and codon relationship before and after the coliform system, and start the translation by changing the interval and sequence between the SD region of the promoter and the AUG initiator codon so as to be compatible with the synthetic gene. It provides a method of producing an expression vector that increases the rate and maximizes the production of hG-CSF by enhancing the stability of mRNA transcripts by placing a strong transcription terminator close to the translation termination codon. In addition, by transforming the expression vector of the produced hG-CSF to various host cells to determine the suitability with the host cells according to the expression rate and accordingly increase the production of hG-CSF through the fermentation process of the selected production strain according to the optimal conditions I wanted to.

EXAMPLE

The invention is illustrated in more detail by the following examples. The following examples are merely to aid the understanding of the present invention, but the present invention is not limited thereto.

Example 1

The hG-CSF gene was designed as shown in FIG. 1 and FIG.

Near the 5 'end, a HindIII site exists in the gene and expression vector alone to alter the 5' end sequence (see Figure 1) .In front of the 5G end of the hG-CSF gene, the EcoR I and Cla I sites were placed. After the 3 'end, the Sal I site was made to facilitate cloning into the pUC18 and pDA123 expression vectors (Figure 2).

Gene synthesis was performed by standard cyanoethyl phosphoamidite chemistry to synthesize oligonucleotides of appropriate size, and then isolate each oligonucleotide using a 16% polyacrylamide gel. The reaction was carried out at 15 ° C. for 15 minutes to bond with each other. The size of the synthetic gene was 549 bp (base pair), which was cloned between EcoR I and Sal I of pUC18 to make pCSF18 (KFCC-10836: Korean spawn association microorganism storage). On the other hand, 48 bp from the ClaI to the Hind IIII at the end of the synthetic gene was further modified by codon utilization and the like to further synthesize three kinds of variants, which will be used in Example 4 below to examine the suitability of the promoter region. . Variant A, B, or C was modified by partially replacing nucleotide T with A in the originally synthesized gene, and B variant was modified with 5 'terminal 10 codons identical to cDNA, and C variant was 5'. The terminal is modified with codons for the major tRNA of E. coli.

Example 2

The product obtained by cleaving the pDA 123 expression vector containing the tryptophan (trp) promoter and the multicloning site and the pCSF 18 vector with the restriction enzymes Cla I and Sal I was subjected to 1% agarose gel. Separated by electrophoresis. Expression vector pDA 123 fragment of 3.9 Kb and hG-CSF gene fragment of 541 bp were separated from the gel, respectively, and these were reacted with enzyme T4 ligase at 4 ° C. for 16 hours to prepare pCSF 440 expression vector. See also 3). pCSF 440 expression vector was transformed into E. coli HB101 strain by calcium chloride method, and the transformant was plated on LB solid medium containing antibiotic ampicillin to select E. coli HB101 strain containing pCSF 440 expression vector. .

Example 3

The gene interval from the SD region of the original pCSF 440 expression vector to the start codon is 8 bp. In order to modify this gene gap to 7, 9, 10, 11 bp, the Hpa I site in the promoter and the Cla I site before the start codon were chemically synthesized and replaced with a new sequence. In other words, pCSF 440 expression vector was cut with HpaI and Cla I to remove DNA fragments of about 30bp, and then 4 kinds of oligonucleotides synthesized with the new sequence were inserted into pCSE 430 and pCSE 450 (KFCC10837: KPAC10837: Korea spawn) , pCSF 460, pCSF 470 expression vector was constructed (see Figure 3). These expression vectors were inoculated with the transformant obtained by transforming E. coli W3110 strain into LB medium and incubated at 37 ° C for 4 hours, and then 3-IAA was added to a concentration of 50 µg / ml to inhibit the expression of hG-CSF. Induced. After incubation for 4 hours after induction of 3-IAA, the cells were recovered to measure the amount of hG-CSF, and the results are shown in Table 1 below.

The values given are those obtained by encapsulation from cells and converting them into active form followed by enzyme-immunoassay.

Example 4

To determine the adequacy of the DNA sequence between the ATG and the 5 'end of the hG-CSF gene from the SD region, the 5' end sequence of the hG-CSF was changed to the pCSF 450 expression vector (see Example 1). . The pCSF 450 expression vector was cleaved with Cla I and Hind III to remove the 5 'terminal DNA of the originally synthesized hG-CSF gene, and 3 kinds of DNA fragments with modified 5' terminal gene composition (see Example 1). Were cloned to obtain expression vectors of pCSF450-A, pCSF450-B, and pCSF450-C. Each of these expression vectors was transformed into E. coli W3110 strain, and then the expression of hG-CSF was induced as in Example 3 to measure the amount thereof, and the results are shown in Table 2 below.

At this time, HIBIO DNASISTM (Hitachi Co., Ltd., Japan) was used to determine the free energy value of mRNA secondary structure near translation initiation codon and compared with hG-CSF production to increase the production rate by destabilizing mRNA secondary structure. Reviewed. This result is used more specifically in Example 5 below.

Example 5

As in Example 4, the DNA sequence between the SD region and the ATG was changed to improve the suitability between the DNA sequence between the ATG and the 5 'end of the hG-CSF gene. This was designed based on the effect of increasing the production amount of hG-CSF according to the free energy value of the mRNA secondary structure examined in Example 4 as an attempt to further improve the effects in Examples 3 and 4. HIBIO DNASIS to partially replace DNA sequence while maintaining DNA gap between SD and ATG of pCSF450 expression vector at the original interval of 9 The program examined the possibility of various sequences and selected two of them and changed the sequence by site directed mutagenesis. The sequence change was performed by using the TransformerTM Site Directed Mutagenesis kit (ClonTex) as the sequence of the underlined CG in the -GTAACGAT-sequence of the pCSF 450 expression vector was changed to AT and TA, respectively. . As a selection primer, Trans Oligo Ssp I / EcoRV (5'CTTCCTTTTTCGATATCATTGAAGCATTT3 ') was used, and as a mutagenic primer, primer 1 (5'AAAAGGGTAATATATATGACTCCA3') was used as a mutation primer. In case of modification to primer 2 (5'AAAAGGGTAATTAATATGACTCCA3 ') was used respectively. 2 µl of pCSF 450 plasmid DNA (0.05 µg / ml), 2 µl of selective primer (0.05 µg / ml), 2 µl of mutant primer (0.05 µg / ml), 2 µl of 10-fold annealing buffer, and 12 µl of distilled water. After the addition, the mixture was reacted for 3 minutes at 100 ° C and cooled for 5 minutes in an ice bath at 0 ° C to anneal the DNA template. 1 µl of T4 DNA polymerase (2-4 units / µl), 1 µl of T4 DNA ligase (4-6 units / µl), 3 µl of 10-fold synthetic buffer solution, and 5 µl of distilled water were mixed well. Reaction DNA was synthesized by reacting for 1 hour at and quenched by heating at 70 ° C for 5 minutes. The reaction solution was cleaved with the restriction enzyme Ssp I to linearize the unmutated DNA to increase the proportion of mutant plasmids. The reaction solution was transformed into repair deficient strain BMH71-18 mutS Escherichia coli, plasmid DNA was isolated from each transformant, completely cleaved with Ssp I, and transformed back into E. coli DH5α strain. Plasmid DNA was isolated from the transformants, digested with EcoR V, and mutated plasmids were selected. Finally, the plasmid pCSF 450L and pCSF 450M transformed into AT and TA sequences by sequencing of the mutated region. Got. This plasmid vector was transformed into E. coli W3110 to induce expression in the same manner as in Example 3, and then the amount of hG-CSF was measured and the results are shown in Table 3 below.

Example 6

To increase the number of gene copies of the expression vector, the pCSF450 expression vector was digested with restriction enzymes PvuII and MscI to remove the 0.6 Kb gene fragment containing the Rob protein gene. Since the site of the expression vector cleaved with PvuII and MscI is the blunt end, it is easily linked by T4 ligase without a linker even after the rob protein gene is removed. There was no (Figure 4). In this manner, pCSF450R with a significantly increased copy number was produced. When the expression vector was transformed into Escherichia coli HB101 strain and grown under normal conditions, the copy number was 200 to 300, and this value was a copy of the pCSF 450 expression vector. It is about 10 times greater than the number. Meanwhile, when the pCSF450R expression vector was transformed into E. coli W3110 strain, expression of hG-CSF with 3-IAA as in Example 3 showed about a 2-fold increase in production rate compared to pCSF450.

Example 7

In order to examine the expression effect of hG-CSF gene according to mRNA transcription terminator, three transcription terminators were cloned into pCSF450 expression vector. The mRNA transcription terminator of the pCSF450 expression vector was designed to be regulated by the terminator of the tetracyclin resistant gene, which is derived from pBR322 (ATCC31344).

Transcription terminator of bacteriophage fd and transcription terminator of Staphyococcus protein A, rrnB operon The transcription terminator of was isolated and replaced with the transcription terminator of the tetracycline resistance gene of the pCSF 450 expression vector and compared the effect of the replacement on the expression of hG-CSF gene. The pCSF450 expression vector and pEX-1 vector were digested with restriction enzymes Sal I and Nde I, and the product was subjected to 1% agarose gel electrophoresis to separate 2.8Kb pCSF450 expression vector fragment and 0.5Kb fd transcription terminator. The pCSF451 expression vector was constructed by linking with T4 ligase. The pCSF 450 expression vector and pRIT2T vector were digested with the pCSF450 expression vector and pRIT2T vector with restriction enzymes Sal I and PvuII, and the product was subjected to 1% agarose gel electrophoresis. A transcription terminator fragment of Caucus protein A was isolated and linked to T4 ligase to prepare a pCSF452 expression vector. The product obtained by cutting pCSF450 expression vector with restriction enzymes Sal I and PvuII, cutting pKK233 vector with Sal I and PvuII, cutting pKK 223 vector with Sal I and Pvu II, and pKK 233 vector with Sal I and Hinc II Fragment of the 3.0 Kb pCSF 450 expression vector and the fragment of the 0.6 Kb rrnB transcription terminator were separated from the gel by 1% agarose gel electrophoresis and linked to the T4 ligase to prepare a pCSF453 expression vector (see FIG. 5). Therefore, pCSF451 (KCCF 10838: Korean spawn association microorganisms), pCSF 452, pCSF 453 expression vector is a protein gene is removed as in Example 6, but mRNA transcription terminators are different expression vectors. These vectors were transformed into E. coli W3110 strain in the same manner as in Example 3 above, and the hG-CSF gene was expressed with 3-IAA while culturing in LB medium, and then the production rate of hG-CSF was measured. Recorded at 4. It can be seen from Table 4 that the amount of hG-CSF production of the cloned expression vector was changed to be greater than that of pCSF 450.

Example 8

When the pCSF 451 expression vector (see Example 7) having the highest amount of hG-CSF production when E. coli W3110 was used as the host cell was transformed into E. coli host cells having different genetic properties, the amount of hG-CSF production according to the change of the host cell. Was measured and the results are shown in Table 5 below. hG-CSF production amount was measured in the same manner as in Example 3.

Example 9

In order to mass-produce hG-CSF, the fermentation process of W3110 / pCSF451 production strain was carried out by the oil price cultivation method, and cell production and expression rate of hG-CSF were investigated. The fermentation process was carried out using the KF-30L fermenter (Korean fermentation company) in the medium composition of Table 7 below.

C. Inducers

500 mg of 3-beta-indole acrylic acid is dissolved in 50 ml of ethanol.

Inducers are prepared 30 minutes before use.

D. Spawn Cultures

Inoculate spawn W3110 / pCSF451 to 500 ml of LB medium containing 50 μg / ml of ampicillin and incubate for 16 hours in a 37 ° C. incubator.

The culture was started by inoculating 500 ml of the seed culture solution in 10 l of sterile complex medium (A of Table 7). Three hours after the start of the cultivation (A600: 7-10), 200 ml of 50% bactotryptone in the fed-batch culture medium was added to induce the growth of the cells. Then, the culture was continued for 1-2 hours, and when the absorbance of the cells reached 20-30, 50% glucose and 25% casanomic acid in the organic culture medium were added at a rate of 100 ml / hour. Casamino acid is a nitrogen source lacking tryptophan and does not increase the amount of tryptophan even when added to the medium. Therefore, when the absorbance of the cells reached 40 to 50, tryptophan in the medium was almost depleted, and 500 mg of 3-beta-indolacrylic acid was added to induce the expression of hG-CSF.

Since the addition of the medium for the organic culture was gradually increased in accordance with the growth rate of the cells and at the end of the culture was added at a rate of 300ml / hour. The culture was continued for 5 to 7 hours after induction of hG-CSF expression, and the stirring speed was started at 200 rpm at the beginning of the culture and increased by 50 rpm per hour depending on the amount of dissolved oxygen to be 700 to 800 rpm at the end of the culture. At the end of the culture, the absorbance of the cells reached 100 to 120 (see FIG. 6). At this time, the hygroscopic weight of the cells was 100-120 g / l. The cells were collected and analyzed for expression rate of hG-CSF by SDS-polyacrylamide gel electrophoresis and the results are shown in FIG. Figure 7 shows that hG-CSF shows a high expression rate of 30 to 40% of the E. coli total protein.

[Effects of the Invention]

The hG-CSF recombinant vectors of the present invention from Examples 1 to 8 were modified by modifying the base sequence of the hG-CSF gene, the SD region in the vector and the start codon, and the base sequence of the transcription terminator, and removing the Rob protein in the vector. Compared with recombinant vectors, it was found to be overexpressed in the host cell more stably, and the vector of the present invention was more stably expressed in suitable host cell and culture conditions.

Claims (12)

A gene of phosphorus granulocyte colony stimulating factor comprising the nucleotide sequence of the following formula (I). Wherein W is an upstream DNA sequence comprising a promoter and a shine-dalgano region of the gene of the phosphorus granulocyte colony stimulating factor as described above, wherein the formulas (e) to (g) DNa sequence selected from the group consisting of X represents the 5 'terminal DNA base sequence of the gene of the above-mentioned phosphorus granulocyte colony stimulator selected from the group consisting of the following formulas (a), (b) and (d), Y represents a DNA base sequence corresponding to the 11 to 174 amino acid sequence of the phosphorus granulocyte colony stimulator gene described above, Z represents a DNA sequence containing a transcription terminator below the termination codon of the phosphorus granulocyte colony stimulator gene described above . The method according to claim 1, wherein Y is represented by the following formula ( ) Is the nucleotide sequence of Z is a phosphorus granulocyte colony stimulating factor comprising a transcription terminator of a tetracycline resistant gene, a transcription terminator of bacteriophage fd, a transcription terminator of Staphylococcus protein A, and a transcription terminator of a rrnB operon. Gene. The gene of claim 1, wherein W comprises a 7 to 11 bp DNA sequence between the trp promoter and / or the shine-dalgano site and the initiation codon. The amino acid sequence of the phosphorus granulocyte stimulator expressed in the gene of phosphorus granulocyte colony stimulator in any one of Claims 1, 2, and 3. The vector comprising the gene of the phosphorus granulocyte colony stimulating factor according to any one of claims 1, 2 and 3, wherein the nucleotide sequence comprising the DNA sequence corresponding to the rob protein is removed. The method of claim 5, wherein the vector is pDA 123, pCSF 18, pCSF 440, pCSF 450, pCSF 450A, pCSF 450B, pCSF 450C, pCSF 450L, pCSF 450M, pCSF 450R, pCSF 451, pCSF 452, pCSF 453, pCSF 460, and pCSF 470. Inserting the gene of the phosphorus granulocyte colony stimulator according to any one of claims 1, 2 and 3 into the vector; Transforming the host cell with the vector into which the base sequence is inserted; Culturing the host; A method of producing phosphorus granulocyte colony stimulator comprising processes. The method of claim 7, wherein the host is selected from the group consisting of BE42, DH, HB101, JM101, LE392, MC1061, NM522, W3110, Y1088. Plasmid having the characteristics of plasmid pCSF450 contained in Korean spawn association accession No. KFCC 10837 Escherichia coli W3110. Plasmid having the characteristics of plasmid pCSF451 contained in Korean spawn association accession No. KFCC 10838 Escherichia coli W3110. Microorganisms having the characteristics of Escherichia coli W3110. Microorganisms having the characteristics of Escherichia coli W3110.