WO2003040387A2 - Procedes d'identification de substances actives pour la modulation de l'apoptose a mediation pip92 - Google Patents

Procedes d'identification de substances actives pour la modulation de l'apoptose a mediation pip92 Download PDF

Info

Publication number
WO2003040387A2
WO2003040387A2 PCT/EP2002/012212 EP0212212W WO03040387A2 WO 2003040387 A2 WO2003040387 A2 WO 2003040387A2 EP 0212212 W EP0212212 W EP 0212212W WO 03040387 A2 WO03040387 A2 WO 03040387A2
Authority
WO
WIPO (PCT)
Prior art keywords
pip92
cell
cells
compound
protein
Prior art date
Application number
PCT/EP2002/012212
Other languages
German (de)
English (en)
Inventor
Armin Schneider
Daniela Spielvogel
Sigrid Scheek
Original Assignee
Basf-Lynx Bioscience Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basf-Lynx Bioscience Ag filed Critical Basf-Lynx Bioscience Ag
Publication of WO2003040387A2 publication Critical patent/WO2003040387A2/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863—Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2510/00—Detection of programmed cell death, i.e. apoptosis

Definitions

  • the present invention relates to methods for identifying active substance substances which intervene in the apoptotic signal cascade mediated by the protein pip92 as well as methods which can be used for identifying proteins interacting with pip92.
  • Stroke is the third leading cause of death and the main cause of disabilities in western industrialized nations. Every year around 250,000 people in Germany suffer a stroke, a third die within the first month, and 60% keep it Disabilities back. So far, there is no effective therapy for the majority of these patients.
  • extensive studies of the molecular mechanisms underlying the pathophysiology of the stroke can be found. For example, it has long been known that a nuclear enzyme that is highly conserved in higher eukaryotes, poly (ADP-ribose) polymerase (EC 2.3.2.30, PARP), is involved in both DNA repair and the apoptotic cell response. The inactivation of PARP is accompanied by a proteolytic cleavage of the active precursor form. In addition, it is known that an upregulation of the PARP mRNA at the molecular level and an increased cleavage of the protein PARP are related to the consequences of a stroke.
  • pip92 a hydrophilic, slightly basic protein with a length of 221 AS
  • results are available in the prior art which suggest an association with the processes of differentiation and apoptosis.
  • Coleclough et al. PNAS, Vol. 87, 1990, 1753ff.
  • An upregulation of pip92-mRNA (referred to there as chxl) was observed after addition of cycloheximide to activated T-lymphocytes, and Shimizu et al. (J. biol. Che., 1991, Vol. 266, No. 19, pp.
  • pip92 is induced by stimulation with TPA in a human promyeloid leukemia cell line.
  • anisomycin-induced cell death in the fibroblast cell line NIH3T3 is based on the activation of a signal transduction chain which proceeds via an activation of MAP kinases, such as, for example, JNK and p38.
  • the subsequent induction of pip92 is essentially due to the induction of the pip92 promoter attributed (Chung et al, Eur. J. Biochem., 267, 2000, p. 4676 ff.).
  • Trigger cell differentiation is regulated. Chung et al. prove (Mol. Cell Biol. 1998, 18 (4), p. 2272ff.) that the
  • NMDA neuropeptide deacetylase
  • NMDA can trigger neuronal cell death.
  • Chung et al. Speculate that pip92 is associated with apoptotic processes.
  • numerous genes are induced by pleitrope stimuli, for example NMDA, or by MAP-, kinases, of which a priori no statement about a pro-apoptotic effect can be made. The results are interpreted to mean that cell death induced by glutamate (and the corresponding ion channel glutamate receptors) on neuronal cells could be associated with neurodegenerative diseases.
  • the present invention is based on the one hand on the knowledge that changes in the gene expression of pip92 could be registered in an established animal model system for cerebral ischemia, the most pronounced form of which is stroke, which are functionally related to the extent of brain damage.
  • this animal model (“filament model”), a coated nylon thread that closes the branch of the A. cerebri media is introduced. By pulling back the thread, a re-circulation of the infarct area is possible. From the analysis of the transcriptome at different post-ischemic times, according to the invention pip92 could be identified and verified for the first time as a therapeutic target molecule for the indication stroke.
  • the present invention is based on the further finding that there is a causal relationship between the overexpression of the protein pip92 known in the prior art and the cellular phenotype of apoptosis and that overexpression of pip92 leads to an activation of the poly (ADP-ribose) polymerase ( PARP), that is, to their cleavage.
  • PARP poly (ADP-ribose) polymerase
  • test methods which, on the one hand, for in vitro diagnostic purposes and, on the other hand, for a scalable "screening" for active substance substances which interfere with the signal cascade mediated by pip92, in particular also for a therapeutic treatment of ischemic Cause infarcts.
  • Host cell systems from mammals especially neuronal cell lines, in particular human, mouse or rat cell lines (for example COS-1 cells, H19-7 cells, Raji cells, HEK cells, PC12 cells, THP-1- Cells, or primary cells such as neurons, astrocytes, micro- and astroglia etc.).
  • neuronal cell lines in particular human, mouse or rat cell lines
  • COS-1 cells for example COS-1 cells, H19-7 cells, Raji cells, HEK cells, PC12 cells, THP-1- Cells, or primary cells such as neurons, astrocytes, micro- and astroglia etc.
  • other immortalized and primary cell lines e.g. astrogliomas, SY-5Y
  • a plurality of cell lines and primary cells are preferably examined using a method according to the invention.
  • Such host cell systems can also be modified by transfection, for example by transfection with an expression vector which is suitable for the protein pip92 (with a human sequence or for example the sequence from the genome of another mammal) or a fragment thereof or a variant with at least 90% , advantageously at least 95% sequence homology.
  • an expression vector can contain the pip92 gene together with its native or an alternative, in particular an externally regulatable (inducible, in particular by temperature variation or activator (repressor) addition) regulatory sequence (promoter sequence).
  • Advantageous regulatory sequences for the pip92 gene in the context of the method according to the invention are, for example, the bacterial promoters of cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, laclq, T7, T5, T3, gal, trc, ara, SP6, 1-PR or 1-PL promoter, or yeast promoters from ADC1, MFa, AC, P-60, CYC1, GAPDH or mammalian promoters from CaM-Kinasell, CMV, Nestin, L7, BDNF, NF, MBP, NSE, beta-globin, GFAP, GAP43, tyrosine hydroxylase, kainate receptor subunit 1 or the glutamate receptor subunit B.
  • all natural promoters can with their regulatory sequences, such as those mentioned above, for an expression vector according to the invention.
  • the expression vector can also code for at least one further gene, for example for a reporter gene (for example EGFP) or a resistance gene (for example an antibiotic resistance gene)).
  • additional genes however, they can also be introduced into the host cell system on at least one further separate expression vector.
  • the method described above can also be carried out with cell extracts.
  • cell extracts are provided according to methods familiar to the person skilled in the art; if necessary, the cell disruption will be connected to a cell fractionation, for example isolation of the cytosolic fraction and / or a fraction of the cell nucleus.
  • a signal cascade can also be reconstituted in vitro, so that neither host cells nor cell extracts are used.
  • a nematode which expresses pip92 or variants, for example fragments of pip92 can be made available as a host organism and according to method step (b) Changes in cell death in this transgenic host organism compared to the control is detected.
  • the nematode C. elegans allows the examination of every single cell in the host organism.
  • test system provided according to method step (a) of the method according to the invention (screening method) allows the identification of a compound which could be considered as an active ingredient, for example for the indication of ischemic infarction, in particular stroke, in a preferred embodiment by the detection of a biological Signal that indicates apoptotic events.
  • Any structural or functional signal can be used as a signal
  • Modification of proteins which are triggered by a pip92 (over) expression can be considered according to the invention.
  • these are proteins that are further downstream in the signal cascade mediated by pip92.
  • Structural or functional changes include: proteolytic cleavage of proteins, activation of proteins by covalent or non-covalent changes (e.g. addition of phosphate groups, glycosylation, addition of additional protein ligands to form
  • detection of proteolytically cleaved proteins of the pip92-mediated signal cascade as a “marker” for corresponding apoptotic events for example PARP cleavage or the detection of DNA histone fragments (for example by “cell death "ELISA, ' particularly through the system from Röche Diagnostics, (Mannheim, DE)).
  • PARP cleavage in particular the presence and / or the intensity of the cleavage products is detected.
  • a signal which is absent or weak in comparison to the control for a PARP cleavage product indicates the effectiveness of a test compound when carrying out a method according to the invention.
  • a cleavage product preferably an approximately 89 kDa cleavage product from PARP (or, depending on the species, other corresponding cleavage products)
  • a cleavage product or products can For example, by using specific antibodies that recognize the cleavage product or products, in particular an antibody that recognizes the PARP binding domain, especially its C terinus.
  • the biological sample is preferably carried out on a solid phase support, such as. B. nitrocellulose or on another carrier material, so that the cells, cell parts, cell fractions or soluble proteins are immobilized.
  • a solid phase support such as. B. nitrocellulose or on another carrier material, so that the cells, cell parts, cell fractions or soluble proteins are immobilized.
  • the carrier can then be washed one or more times with a suitable buffer, with subsequent treatment with a detectably labeled antibody according to the present invention.
  • the solid phase support can then be washed with the buffer a second time to remove unbound antibody.
  • the amount of bound label on the solid phase support can then be determined using a conventional method.
  • Detectable antibody labeling can be done in different ways.
  • the antibody can be bound to an enzyme, which enzyme can finally be used in an immunoassay (EI ⁇ ).
  • EI ⁇ immunoassay
  • the enzyme can then react later with a corresponding substrate, so that a chemical compound is formed which can be detected in a manner familiar to the person skilled in the art and, if necessary, quantified, e.g. B. by spectrophotometry, fluorometry or other optical methods.
  • the detection can be ensured by other immunoassays, for example by radioactive labeling of the antibodies or antibody fragments (i.e. by a radioimmunoassay (RIA; Laboratory Techniques and Biochemistry in Molecular. Biology, Work, T. et al. North Holland Publishing Company, New York (1978).
  • RIA radioimmunoassay
  • the radioactive isotope can by using
  • Scintillation counters or by autoradiography can be detected and quantified.
  • Fluorescent compounds can also be used for labeling, for example compounds such as fluorescinisothiocyanate, rhodamine, phyoerythrin,
  • Fluorescamin Also fluorescent-emitting metals, such as. B. 152 E or other metals from the lanthanide group can be used. These metals are attached to the antibody via chelate groups, such as. B.
  • the antibody according to the invention can be coupled via a compound acting with the aid of chemiluminescence.
  • the presence of the chemiluminescence-labeled antibody is then detected via the luminescence which arises in the course of a chemical reaction.
  • luminescence is a subspecies of chemiluminescence found in biological systems, where a catalytic protein increases the efficiency of the chemiluminescent reaction.
  • the bioluminescent protein is in turn detected via luminescence, with luciferin, luciferase or aequorin, for example, being suitable as the bioluminescent compound.
  • An antibody of the invention can be used in an immunometric. Assay, also known as a "two-site” or “sandwich” assay.
  • Typical immunometric assay systems include so-called “forward” assays, which are characterized in that antibodies according to the invention are bound to a solid phase system and in that the antibody is brought into contact with the sample being examined.
  • the antigen is isolated from the sample by the formation of a binary solid phase-antibody-antigen complex from the sample.
  • the solid support is washed to remove the remainder of the liquid sample, including any unbound antigen, and then contacted with a solution containing an unknown amount of the labeled detection antibody.
  • the labeled antibody serves as a so-called reporter molecule.
  • the solid phase support is washed again to remove unreacted labeled antibodies.
  • a so-called "sandwich” assay can also be used.
  • a single incubation step can be sufficient if the antibody bound to the solid phase and the labeled antibody are both applied to the sample to be tested at the same time.
  • the solid phase support is washed to remove residues of the liquid sample and the non-associated labeled antibodies.
  • the presence of labeled antibody on the solid phase support is determined in the same way as in the conventional "forward" sandwich assay.
  • a solution of the labeled antibody is first gradually added to the liquid sample, followed by from the addition of unlabeled antibody bound to a solid phase support after a suitable incubation period.
  • the solid phase support is washed in a conventional manner in order to free it from sample residues and from labeled antibody which has not reacted. Determination of the labeled antibody with. the solid phase carrier has reacted, is then carried out as described above.
  • mass spectrometric methods can also be used (for example MALDI-TOF), the signal intensity of the corresponding cleavage product (with known molecular weight), for example also of the PARP cleavage product, being determined in relation to the signal intensity of the uncleaved protein.
  • morphological changes associated with apoptosis can also be used as a biological signal in an assay according to the invention, in order in this way to be able to serve as a “marker” for the effectiveness for the pip92-mediated apoptotic signal cascade.
  • Changes in the cell membrane for example, can , cell morphology, DNA morphology, in particular changes in the chromatin structure (for example also DNA fragmentation) can be detected via the following systems: Production of a virus, with which, for example, neurons can be infected, and thus an mRNA, which is coded pip92 and is channeled into neurons.
  • the detection of the nuclear condensation after such an overexpression of pip92 in neurons can be done via DAPI staining, DNA fragmentation using TUNEL staining and PARP cleavage using specific antibodies for cleaved PARP.
  • apoptotic events are staining with annexin (for example by the method from Röche Diagnostics, Mannheim, DE).
  • a measurement of apoptotic events can also be carried out via FACS analysis ("Fluorescence Activated Cell Sorting"), for example by fractionation either by staining the affected cells, by reaction with fluorescence-labeled antibodies or by cotransfection with, for example, GFP be made by cells.
  • FACS analysis Fluorescence Activated Cell Sorting
  • a method of the type according to the invention can also be designed as a so-called high-throughput (HTS) screening method for identifying corresponding connections.
  • the test systems described therefore allow chemical libraries to be searched for substances which have inhibitory or activating effects on pip92, for example by acting on its transcription, its translation, its biological function (for example on its DNA or protein binding capacity or its enzymatic properties), to have.
  • the identification of such substances represents the first step on the way to Identify new types of drugs that act specifically on pip92-mediated signal transduction, in particular to trigger apoptosis, but also, for example, with regard to any pip92-mediated cell growth, cell proliferation and / or cell plasticity.
  • apoptosis may also be stimulus-specific, in a method according to the invention, several stress situations are preferably used as external stimuli, for example heat shock, hypoxic conditions and / or cytokine treatments (for example 11-1, 11-6, TNF) -alpha, staurosporine, H 2 0 2 treatment).
  • cytokine treatments for example 11-1, 11-6, TNF
  • staurosporine H 2 0 2 treatment
  • the binding site of the pharmaceutically active compound on pip92 according to the method according to the invention is determined by a suitable biochemical or structural biological method (rational drug design (Böhm, Klebe, Kubinyi, 1996, drug design, Spectrum publishing house, Heidelberg)).
  • the binding sites of these substances on pip92 can be determined biochemically or structurally, for example with the aid of the two-hybrid system or other assays, ie the amino acids responsible for the interaction are limited.
  • Processes are typically carried out in process step (c).
  • a method for finding substances with specific binding affinity for the protein pip92 is disclosed according to the invention.
  • the candidate compound to the pip92 crystal can be determined. If the 3D structure of pip92 is already available after X-ray crystallization, after the diffraction pattern of the crystal and candidate compound in the complex has been recorded, the phase information of the 3D structure of pip92 can be used solely for structure calculation. With the support of molecular modeling programs / methods (SYBIL program package, 0, X-PLORE), after clarifying the interactions between the candidate compound and pip92, the compounds acting as agonists or antagonists can be modified so that, for example, an even higher affinity of the modified candidate connection to pip92 should result.
  • the chemical characteristics of the test compound can be changed by changing the steric arrangement of functional groups, modifying the functional groups, changing the hydrophobicity profile of the compound and / or its hydrogen bonding potential, etc. by using silico methods, in particular in one process step (i.e. ), can be modified.
  • the compound modified to this extent can again be subjected to the method according to the invention with method steps (a), (b), (c) and / or (d) and can be iteratively optimized in this way, the objective function in particular being an optimization of the biological properties of the test compound the inhibition of pip92-mediated apoptosis.
  • the original lead structure of the candidate compound After structural optimization of the original lead structure of the candidate compound, it can be tested in further in vitro assays or in an animal model for its effectiveness, for example against stroke, before appropriate clinical tests can be carried out.
  • a preferred method according to the invention will preferably be preceded by a ligand binding assay before the provision of a method according to claim 1.
  • a primary assay of this kind the binding ability of candidate substances, for example obtainable from substance libraries or synthesis processes in combinatorial chemistry, to pip92 is examined, in particular the binding constant is determined.
  • binding assays can be carried out according to all methods familiar to the person skilled in the art, for example with the aid of BIACORE devices, the mass increase which results when a ligand (for example the test substance) being measured being measured by means of a sensor chip which contains, for example, pip92 immobilized ) flows through the flow cell past the sensor chip.
  • the binding constant can also be determined calorimetrically, for example with the aid of differential “scanning” calorimeters.
  • the binding of ligands can also be simulated in silico, in that the binding capacity is more appropriate
  • Candidate substances the spatial structure of which has been elucidated or calculated by semi-quantum mechanical methods, to which the pip92-3D structure is investigated using corresponding “docking” programs (for example “Dock, Kuntz et al. 1982 J. Mol. Biol. 161, P. 269 ff .; Sybyl / Base program "FLEX-X" of the TRIPOS program package, see Rarey et al., J. Mol. Biol. 261, p. 470 ff., 1996).
  • Suitable candidates are identified in a silico primary assay (e.g. substances from a database: CCDC (Cambridge Crystal Data Center, 12 Union Road, Cambridge, GB; or also the databases available from TRIPOS (e.g. Derwent WORLD Drug Index)) and then examined according to the invention for their biological properties.
  • CCDC Common Crystal Data Center, 12 Union Road, Cambridge, GB; or also the databases available from TRIPOS (e.g. Derwent WORLD Drug Index)
  • further biological tests can also be carried out upstream or downstream of a method according to the invention, for example cell toxicity, membrane permeability or metabolism properties can be measured.
  • Methods according to the invention are used in particular in in vitro diagnostics, diseases, disorders or pathological conditions which are characterized by cell death events, in particular ischemic infarcts (for example also a stroke or heart attack), being able to be diagnosed. Based on the activity of pip92
  • pip92 for example detectable by pip92 mRNA or the protein
  • a diagnostic assay can be designed. All of the detection possibilities for a mentioned above within the scope of the disclosure of methods for the identification of ligands biological signals can also be used in the course of an in vitro process.
  • overexpression of pip92 as a diagnostic marker for diseases based on hyperapoptotic disorders, for example ischemic infarction is disclosed according to the invention.
  • the risk factor for the manifestation of degenerative diseases, ischemic infarcts, for example stroke, etc., which is caused by pip92 overexpression can already be determined.
  • the method according to the invention can also be used post-traumatically to support a clinical diagnosis, for example a stroke diagnosis.
  • a patient sample for example in the form of a tissue sample obtained by biopsy, being taken and / or removed cells from patients are cultivated in vitro
  • a parameter suitable for observing the pip92-mediated function in particular one for observing apoptosis, cell growth, cell proliferation and / or cell plasticity in comparison to the control for the according to (a ) sample obtained is measured in a suitable test system.
  • Methods are preferred in which in step (b) the cleavage of the protein PARP, the staining of cells with annexin and / or an apoptosis signal is detected by FACS analysis.
  • the present invention furthermore relates to those compounds which are obtained or obtainable with the aid of a process according to the invention, their Suitability as a medicament or method for the therapeutic use of such compounds, in particular for the treatment of the indications mentioned according to the invention.
  • These compounds to be tested in the context of the present method according to the invention will preferably be organic chemical compounds with a molecular weight of ⁇ 5000, in particular ⁇ 3000, especially ⁇ 1500, which is typically physiologically well tolerated and preferably the blood brain Barrier can pass, in particular also have at least unilateral hydrophilic groups.
  • An organic molecule will be particularly preferred as a candidate substance in a method according to the invention if the binding constant (which is determined in the context of a primary ligand binding assay) for the binding to pip92 is at least 10 7 mol -1 .
  • the compound according to the invention will preferably be such that it can pass through the cell membrane, be it by diffusion or via (intra) membranous transport proteins, if appropriate after appropriate modification (for example glycosylation).
  • a pharmaceutically active compound according to the invention can also intervene in other control processes of the cell, which can influence, for example, the expression rate of the protein pip92 (eg translation, splicing processes, native derivatization of pip92, for example phosphorylation, or regulation of the degradation of pip92).
  • the effect of the candidate compound can also be brought about by binding to the regulatory sequence of the pip92 gene or by binding to a transcription factor controlling the pip92 gene.
  • the mechanism of action of substances according to the invention can also be based on a modulation of the PARP cleavage, for example substances according to the invention can inhibit the PARP cleavage, for example by adding a non-native oligopeptide (peptidomimetic) which contains the cleavage sequence (proteolytic interface) of PARP , for example, a decamer with (at least) 5 AS N-terminal and (at least) 5 AS C-terminal from the cleavage site or as a peptidomimetic, this image.
  • a non-native oligopeptide peptidomimetic
  • a decamer with (at least) 5 AS N-terminal and (at least) 5 AS C-terminal from the cleavage site or as a peptidomimetic, this image.
  • the host cell systems are simultaneously transfected with an appropriate expression vector for an antibody described above (preferably coupled to an inducible promoter) and its effectiveness for the observation or non-observation of a biological signal (as described above) , for example the PARP cleavage.
  • an appropriate expression vector for an antibody described above preferably coupled to an inducible promoter
  • its effectiveness for the observation or non-observation of a biological signal for example the PARP cleavage.
  • Other potential compounds which can be tested in a method according to the invention are: anti-sense oligonucleotides (for example against pip92 mRNA) or ribozymes which can cut for example pip92 mRNA.
  • it can be an inhibitory variant of pip92, for example a fragment or a biologically inactive variant
  • compounds which are obtainable or obtained from a process according to the invention can be used as medicaments.
  • all of the aforementioned variants are included as compounds, that is to say, for example, organic chemical compounds or anti-sense oligonucleotides or “intrabody” antibodies.
  • a compound of the invention for the manufacture of a medicament for the treatment of diseases for which at least tw. a pathological hyperapoptotic or hypernecrotic or possibly also inflammatory reactions is causal or symptomatic.
  • a substance identified according to the invention for example an inhibitor of the pip92-mediated signal cascade, for example the apoptotic reaction, can thus be used as a medicament and very particularly in the treatment of the following diseases or for the manufacture of a medicament for the treatment of the following diseases: tumor diseases , Autoimmune diseases, especially diabetes, psoriasis, multiple sclerosis, rheumatoid arthritis or asthma, viral infectious diseases (e.g. HIV), degenerative diseases, especially neurodegenerative diseases, e.g. Alzheimer's or Parkinson's disease, epilepsy or muscular dystrophies, GvHD, e.g. liver or heart), ischemic infarction, especially stroke or heart attack, hypoxia, traumatic brain injury.
  • tumor diseases e.g. HIV
  • degenerative diseases especially neurodegenerative diseases, e.g. Alzheimer's or Parkinson's disease, epilepsy or muscular dystrophies, GvHD, e.g. liver or heart
  • GvHD e.g. liver or heart
  • apoptosis-inhibiting substances identified according to the invention can also be part of a pharmaceutical composition which can contain further pharmaceutical excipients and / or additives in order to stabilize such compositions for therapeutic administration, for example, to improve the bioavailability and / or the pharmacodynamics .
  • Compounds or compositions according to the invention containing such compounds can be used nasally, orally, intraperitoneally, ocularly, topically, intravenously, intraarterially and / or subcutaneously.
  • the present invention further relates to methods for identifying cellular interaction partners of pip92, in particular proteins which are involved in the apoptotic signal transmission downstream of pip92, in particular proteins which are involved in the cleavage of, for example, PARP after activation of pip92.
  • direct (and also - as described below - indirect) interaction partners of pip92 can be identified, i.e. those proteins which have binding affinities specific to pip92.
  • Such a method according to the invention or the use of pip92 to carry out such methods is preferably carried out with the aid of a “yeast two hybrid” screening (y2h “screens”) alone or in combination with other biochemical methods (Fields and Song, 1989 , Nature, 340, 245-6).
  • yeast two hybrid screening y2h “screens” screening
  • Such screens can also be found in Van Aelst et al. (1993, Proc Natl Acad Sei U S A, 90, 6213-7) and Vojtek et al. (1993, Cell, 74, 205-14).
  • mammalian systems can also be used to carry out a method according to the invention, for example as in Luo et al. (1997, Biotechniques, 22, 350-2).
  • a so-called bait vector “in-frame” with the GAL4 binding domain for example pGBT10, from Clontech
  • a so-called “prey library” can preferably be searched for interacting proteins in a yeast strain according to the usual protocol.
  • interaction partners can also be co-immunoprecipitated with pip92- (or their native Variants) to use expression vectors from transfected cells in order to purify proteins which bind to them, and subsequently to identify the associated genes by means of protein sequencing methods (for example MALDI-TOF, ESI-tandem-MALDI).
  • protein sequencing methods for example MALDI-TOF, ESI-tandem-MALDI.
  • sequences are disclosed, as shown in FIGS. 6 to 14, including those sequences which are at least 90%, preferably at least 95% and even more preferably at least 97, with the sequences shown in FIGS. 6 to 14 % are homologous or, in the case of the DNA sequences, hybridize with the depicted DNA sequences under, for example, moderately stringent conditions.
  • sequences according to FIGS. 6, 7, 9, 10, 12 and 13 corresponding expression vectors and
  • HIV degenerative diseases
  • neurodegenerative diseases for example Alzheimer's or Parkinson's disease, Huntington's disease, epilepsy or muscular dystrophies, senility, GVHD (for example liver, kidney or heart), ischemic infarction, especially stroke or heart attack, hypoxia, Skull-brain trauma, spinobulbar muscular atrophy, Machoado-Joseph syndrome.
  • GVHD for example liver, kidney or heart
  • ischemic infarction especially stroke or heart attack, hypoxia, Skull-brain trauma, spinobulbar muscular atrophy, Machoado-Joseph syndrome.
  • the corresponding therapeutic methods of in vivo or ex vivo e.g. transfection of bone marrow cells
  • sequences shown in Figures 6 to 14, their homologs i.S. the above definition (or fragments thereof of at least 40 nucleotides or at least 25 AS in length) or the disclosed expression vectors or host cells are used in one of the methods according to the invention for the identification of interaction partners or for the identification of active substance substances.
  • Figure la shows a section of an RMDD gel on which the regulated sequence 13C5 was identified.
  • the nine lanes represent brain RNA from a model of stroke in mice, middle cerebral artery occlusion (MCAO).
  • the cerebral artery was occluded for 90 min (the left hemisphere is ischemic), followed by 2, 6 or 20 h reperfusion.
  • Order order left hemisphere (L), right hemisphere (R), and sham-operated animals (S, left hemisphere), each for the different reperfusion times.
  • FIG. 2 shows a Western blot of COS1 cells that were transfected with pip92 or the empty vector as a control.
  • a specific antibody for cleaved PARP protein clearly shows the apoptosis-inducing effect of pip92. Split PARP can also be observed without the addition of staurosporine.
  • FIG. 5 shows the results of experiments with the Annexin V-positive cell pool after staurosporine treatment of EGFP and EGFP / pip92-expressing cells.
  • COS-1 cells were transfected by electroporation with EGFP or with EGFP and pip92. 24 hours after the transfection, the cells were washed with PBS and for a further 24 hours with staurosporine
  • FIGS. 6 to 14 represent different pip92 sequences (DNA or AS sequences) of human origin or of mice.
  • FIG. 6 shows the cDNA sequence of pip92 of the mouse
  • FIG. 7 shows the open reading frame (ORF) of pip92 (see FIG. 6) the mouse
  • FIG. 8 the AS sequence of pip92 the mouse (221 AS) (see FIG. 7)
  • FIG. 9 the open reading frame of a shorter splice form of maus-pip92
  • FIG. 10 an alternative fragment from FIG. 7, the missing in Figure 9
  • 11 shows the AS sequence corresponding to ORF from FIG. 9
  • FIG. 12 shows the cDNA sequence of the human pip92
  • FIG. 13 shows the open reading frame (ORF) of the human pip92 sequence (see FIG. 12)
  • FIG. 14 shows the human pip92-AS Sequence (223 AS) corresponding to ORF from Figure 13.
  • the proapoptotic effects of pip92 after overexpression could also be demonstrated in primary 'cortical cultures using a ß-Gal assay ' .
  • 15 shows the proportion of living cells measured as the MU release. The values for cells transfected with an empty vector were set to 1.
  • bax a described proapoptotic protein, served as a positive control; pip92 reduced the proportion of living cells to 0.6 times the control transfected with the empty vector.
  • FIG. 16 shows the mapping of an in situ hybridization onto a horizontal section through a rat brain.
  • the expression of pip92 in the cerebellum, hippocampus, gyrus dentatus and in the cortex, in particular in the entorhinal cortex could be visualized.
  • mice After certain reperfusion times (2 h, 6 h and 20 h), the mice are anesthetized by intraperitoneal injection with Rompun / Ketanest, transcardially perfused with warm NaCl solution, and the brain is immediately prepared and frozen on dry ice.
  • the control animals (“sham-operated") were also subjected to inhalation anesthesia and opening of the surgical site. 2. Preparation of brain mRNA
  • RNA preparation with guanidinium isothiocyanate / acid phenol extraction according to Chomczynski & Sacchi (Anal. Biochem. 162, pp. 156ff., 1987). carried out.
  • the tissue was homogenized with an Ultra-Turrax (IKA Labortechnik, Germany). Then there was another.
  • RNA purification 100 ⁇ g) via silica columns (RNAeasy, Qiagen, Germany). RNA concentrations were determined by means of photometric measurements, and the samples were stored at -80 ° C.
  • PCR samples from the ischemic and contralateral hemisphere and control animals were applied to the gel in each case (2 h, 6 h, 20 h reperfusion). Bands of different intensities in the right or .left The hemisphere is cut out and the corresponding PCR product is reamplified. Amplified products obtained are cloned into the TOPO TA vector pcDNA 2.1 (Invitrogen) and sequenced with T7 and Ml3rev primers (ABI 3700 capillary electrophoresis sequencer). Sequences obtained are compared with the EMBL database. There was a strong similarity. to the sequences M59821 and M33756 (pip92).
  • primer pairs were used for the PCR reaction: cyc5, ACCCCACCGTGTTCTTCGAC; acyc300, CATTTGCCATGGACAAGATG (cyclophilin, the product is 300 bp long) pip92-s-newl, AAGCGGTCAGAGTTGCGTCAT; pip92-a-new-l, CACCGTGGGAAAAGTAAACAGA (13C5; the product is approximately 360 bp long).
  • the specificity of the PCR reaction was checked by means of melting point determination and by agarose gel electophoresis. The measured values were averaged from at least 3 dilutions per value. The results are shown in FIG. 1b, the error bars of which correspond to the standard deviation.
  • pip92_m_Bl 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTCTACCATGGAAGTACAGAAAGAAGCGCAGCG -3 '; pip92_m_B2: 5'-
  • the primers used contain so-called B sites at their ends (sense primer, Bl site: 5 '
  • COS-1 cells were transient with the expression construct for pip92 or the. Empty vector transfected. On the second day after the transfection, the cells were treated with 0 or 0.2 ⁇ M staurosporine for five hours
  • the membranes were first blocked with 5% skimmed milk powder (fela Reform, NEUFORM) in PBS / 0.02% Tween20, then washed 3x 5min with PBS / 0.02% Tween20 and incubated for one hour at room temperature with the first antibody (COS cells: " anti-cleaved PARP antibody, PROMEGA, 1: 800). After washing three times with PBS / Tween 20, the blots were incubated with the second antibody (anti-rabbit antibody HRP-coupled, Dianova, 1: 5000) for one hour at room temperature. The detection was carried out with the SuperSignal chemiluminescent system from PIERCE according to the manufacturer's instructions on Hyperfilm-ECL (AMERSHAM PHARMACIA BIOTECH).
  • COS-1 cells were dissolved with 3 ml trypsin from culture dishes. The cells were taken up in 30 ml of COS-1 medium and an aliquot diluted 1: 1 with trypan blue (Sigma). The cell number was determined with the help of a Neubauer counting chamber. The remaining cells were centrifuged off and resuspended in 300 ⁇ l electroporation buffer. and subsequently 7, 5 ⁇ l IM MgS0 4 solution added. Each 300 ⁇ l of this cell suspension was transferred with 1-5 ⁇ g plasmid DNA in 4mm electroporation cuvettes (PEQL ⁇ B). The
  • Electroporation was carried out using a Gene-Pulser II (BIORAD) at 500 ⁇ F / 230V.
  • the cells were plated in such a way that approx. 7500 cells with 100 ⁇ l of COS-1 medium were in a well of a 96-well plate (NUNC), and incubated at 37 ° C. in the incubator. The medium was changed 7-16 hours after the electroporation.
  • COS-1 cells were transiently transfected with the expression construct for pip92 (see exemplary embodiment 2) or an empty vector as a control.
  • the cells were stimulated for five hours with 0 or 0.2 ⁇ M staurosporine (CALBIOCEM) in the medium.
  • the Cell Death Detection ELISA PLUS R ⁇ CHE was carried out according to the manufacturer's instructions.
  • Plate reader platereader Fluostar; BMG
  • BMG Plate Reader Fluostar
  • Oligonucleosomes in the cytoplasm were determined according to the manufacturer's instructions, the values being normalized to 0 ⁇ M staurosporin-treated cells transfected with an empty vector.
  • COS-1 cells were co-transfected with the pip92 expression construct described in Example 2 and an expression construct for EGFP ("Enhanced Green Fluorescence " Protein "; pEGFP-NI). Controls were cotransfected accordingly with pEGFP-NI and an empty vector (pcDNA3.1). For this purpose, 3.5 ⁇ 10 6 cells after trypsinization were resuspended in 300 ⁇ l electroporation buffer (50 itiM K 2 HP0 4 , 20 mM CH 3 COOK, 20 mM KOH, pH 7.4) and the buffer solution with 25 ⁇ l MgS0 4 (1 M). / ml electroporation buffer added.
  • electroporation buffer 50 itiM K 2 HP0 4 , 20 mM CH 3 COOK, 20 mM KOH, pH 7.4
  • the cell suspension was then mixed with 5.25 ⁇ g DNA (0.2 ⁇ g / ⁇ l) of the respective plasmids and transferred into an electroporation cuvette (EquiBio cuvette; 0.4 cm electrode).
  • the electroporation was carried out by means of a Gene Pulser II (BioRad) at 500 ⁇ F and a voltage of 230 V.
  • the electroporated cell suspension was with a cell density of 1-10 6 cells on 6 cm culture dishes with full COS medium (high-glucose DMEM (Sigma) , 10% FCS, penicillin / streptomycin).
  • an empty vector (pcDNA3.1) was co-transfected together with pEGFP-Nl instead of the construct for pip92.
  • the cells were washed with PBS and stimulated with staurosporine (0.2-1.0 ⁇ M; Calbioche) in complete medium. Controls were given full medium without staurosporine.
  • the medium was removed, transferred to a 15 ml Falcon tube and the Wash cells lx with PBS. The wash solution was combined with the medium. After trypsinization, the cells were also transferred to the Falcon tube and counted after mixing.
  • the cell suspension was incubated for 15 min in the dark at room temperature and then centrifuged for 5 min at 250 g.
  • the cell sediments were resuspended in 3.00 ⁇ l ice-cold Annexin V binding buffer with 5 ⁇ l propidium iodide (PI; 30 ⁇ g / ⁇ l; oncogene) and transferred into FACS tubes.
  • the FACS analysis was carried out immediately afterwards, the tubes being kept on ice until the measurement and stored in the dark. 1 ⁇ 10 5 cells per batch were analyzed with a FACSCalibur device (Becton Dickinson).
  • plasmid mixtures were prepared which contained a ⁇ -gal expression construct (CMV-LacZ; 50ng / well) and a) a background control (empty vector pDESTdelta), b) a positive control (bax expression construct) or c) the sample (pip92 expression construct) (450ng each / deepening).
  • CMV-LacZ ⁇ -gal expression construct
  • background control empty vector pDESTdelta
  • bax expression construct bax expression construct
  • c the sample (pip92 expression construct) (450ng each / deepening).
  • the transfection was carried out according to E.C. Ohki et al .; Journal of Neuroscience Methods 112 (2001) 95-99.
  • the localization of the transcript of pip92 was examined by in-situ hybridization with a radioactively labeled oligo probe.
  • 15 ⁇ m thick brain sections were cut with a cryostat at -20 °, slides mounted on poly-L-lysine and fixed in 4% paraformaldehyde in PBS (pH 7.4).
  • the oligo pip92-is-3as (5'-ttg ctt ggt acc agt ccg gca tca cta ctg tcg ctc aaa tcg ctg ctg ct-3 ') was transferred using terminal transferase
  • FIG. 15 shows a localization of pip92 transcript in the dentate gyrus and hippocampus.
  • CA1 region neurons are particularly susceptible to delayed neuronal death (apoptosis) after damage (eg (Hara, et al., Stroke, 31, 236-8, (2000)), and neurons in the CA4 region are also to a lesser extent.
  • the dentate gyrus on the other hand, seems more like one necrotic damage after ischemia affected.
  • the dentate gyrus is associated with new neuron formation after pathological stimuli (Takagi, et al., Brain Res, 831, 283-7, (1999)) (Parent, et al., J Neurosci, 11, 3727- 38, (1997 )).
  • the transcript is still detectable in the cerebellum and cortex, especially in the entorhinal cortex.
  • Information goes from the entorhinal cortex to the hippocampus and contributes to learning and memory. Damage to the entorhinal cortex often occurs in patients with traumatic brain damage, stroke or Alzheimer's disease. Such damage can lead to changes in behavior that include poor processing of sensory impressions or learning difficulties.” Davis et al., Nurs Res 50 (2) 77-85 (2001)).
  • This in-situ localization confirms a connection between pip92 and neuronal cell death, neurogenesis and plasticity.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

Procédés d'identification de substances actives qui sont impliquées dans la cascade de signal d'apoptose à médiation par la protéine pip92, et procédés qui peuvent être utilisés pour identifier des protéines ayant une interaction avec la protéine pip92.
PCT/EP2002/012212 2001-11-06 2002-10-31 Procedes d'identification de substances actives pour la modulation de l'apoptose a mediation pip92 WO2003040387A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE2001154399 DE10154399A1 (de) 2001-11-06 2001-11-06 Verfahren zur Identifizierung von Wirksubstanzen für die Modulation der pip92-vermittelten Apoptose
DE10154399.9 2001-11-06

Publications (1)

Publication Number Publication Date
WO2003040387A2 true WO2003040387A2 (fr) 2003-05-15

Family

ID=7704740

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/012212 WO2003040387A2 (fr) 2001-11-06 2002-10-31 Procedes d'identification de substances actives pour la modulation de l'apoptose a mediation pip92

Country Status (2)

Country Link
DE (1) DE10154399A1 (fr)
WO (1) WO2003040387A2 (fr)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE69619539T2 (de) * 1995-11-03 2002-08-08 Vertex Pharma In apoptosis beteiligte cysteine protease cmh-1 und dns-sequenzen dafür
KR20000075748A (ko) * 1997-02-26 2000-12-26 마빈 씨. 구트리 알츠하이머 병의 치료 또는 예방에 유효한 약물을 선별하기 위한 유전자 변형동물 및 세포계
WO1999059973A1 (fr) * 1998-05-15 1999-11-25 Guilford Pharmaceuticals Inc. Composes de carboxamide, compositions et methodes d'inhibition de l'activite de type poly(adp-ribose) polymerase (parp)
DE19936034C1 (de) * 1999-07-30 2001-01-25 Univ Leipzig Rekombiniertes, neuronalspezifisch aktiviertes, transkribierbares lineares DNA-Konstrukt
DE19952960A1 (de) * 1999-11-03 2001-05-10 Mark Andre Freyberg Verfahren zur Identifizierung von anti-apoptotisch wirksamen Verbindungen

Also Published As

Publication number Publication date
DE10154399A1 (de) 2003-05-15

Similar Documents

Publication Publication Date Title
Betzer et al. Alpha‐synuclein aggregates activate calcium pump SERCA leading to calcium dysregulation
CN109219439B (zh) 内耳支持细胞的扩增和分化及其使用方法
Faraco et al. High mobility group box 1 protein is released by neural cells upon different stresses and worsens ischemic neurodegeneration in vitro and in vivo
Cai et al. Syntabulin-mediated anterograde transport of mitochondria along neuronal processes
Bang et al. Myopalladin, a novel 145-kilodalton sarcomeric protein with multiple roles in Z-disc and I-band protein assemblies
Gorla et al. Ndfip proteins target Robo receptors for degradation and allow commissural axons to cross the midline in the developing spinal cord
Botzolakis et al. The effect of HSP-causing mutations in SPG3A and NIPA1 on the assembly, trafficking, and interaction between atlastin-1 and NIPA1
Abouward et al. Walking the line: mechanisms underlying directional mRNA transport and localisation in neurons and beyond
Li et al. Up-regulation of NFATc4 involves in neuronal apoptosis following intracerebral hemorrhage
Sharif et al. The expression of PEA-15 (phosphoprotein enriched in astrocytes of 15 kDa) defines subpopulations of astrocytes and neurons throughout the adult mouse brain
da Rocha et al. APP binds to the EGFR ligands HB-EGF and EGF, acting synergistically with EGF to promote ERK signaling and neuritogenesis
Akkaya et al. Roles of developmentally regulated KIF2A alternative isoforms in cortical neuron migration and differentiation
Mitroshina et al. Brain-derived neurotrophic factor (BDNF) preserves the functional integrity of neural networks in the β-amyloidopathy model in vitro
WO2006098520A1 (fr) Procede de criblage
Sampedro-Castañeda et al. Epilepsy-linked kinase CDKL5 phosphorylates voltage-gated calcium channel Cav2. 3, altering inactivation kinetics and neuronal excitability
Gardzinski et al. The role of synaptotagmin I C2A calcium‐binding domain in synaptic vesicle clustering during synapse formation
WO2003040387A2 (fr) Procedes d'identification de substances actives pour la modulation de l'apoptose a mediation pip92
EP1436327B1 (fr) Famille de proteines ee3 et sequences d'adn correspondantes
DE19941039A1 (de) gamma-Sekretase in vitro Testsystem
EP1023445B1 (fr) Facteur de croissance derive de la cadherine et son utilisation
EP1526382B1 (fr) Procédé de criblage pour différentes indications à l'aide de la proteine DNPI
JP4488720B2 (ja) アポトーシス関連蛋白質およびその用途
JP4799837B2 (ja) スクリーニング方法
Woitecki Functional characterization of the synaptic-activity regulated gene Synaptotagmin10
Veltman Characterization of novel potential binding partners of Plastin 3, a protective modifier of Spinal Muscular Atrophy

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP