WO2003040387A2

WO2003040387A2 - Methods for identifying active substances for pip92-mediated apoptosis modulation

Info

Publication number: WO2003040387A2
Application number: PCT/EP2002/012212
Authority: WO
Inventors: Armin Schneider; Daniela Spielvogel; Sigrid Scheek
Original assignee: Basf-Lynx Bioscience Ag
Priority date: 2001-11-06
Filing date: 2002-10-31
Publication date: 2003-05-15
Also published as: DE10154399A1

Abstract

The invention concerns methods for identifying active substances involved in the signal cascade of protein pip92-mediated apoptosis, and methods which can be used to identify proteins interacting with the pip92 protein.

Description

applicant:

BASF-Lynx Bioscience AG

In Neuenheimer Feld 515 D-69120 Heidelberg

Process for the identification of active substances for the modulation of pip92-mediated apoptosis

The present invention relates to methods for identifying active substance substances which intervene in the apoptotic signal cascade mediated by the protein pip92 as well as methods which can be used for identifying proteins interacting with pip92.

Stroke is the third leading cause of death and the main cause of disabilities in western industrialized nations. Every year around 250,000 people in Germany suffer a stroke, a third die within the first month, and 60% keep it Disabilities back. So far, there is no effective therapy for the majority of these patients. In the prior art, extensive studies of the molecular mechanisms underlying the pathophysiology of the stroke can be found. For example, it has long been known that a nuclear enzyme that is highly conserved in higher eukaryotes, poly (ADP-ribose) polymerase (EC 2.3.2.30, PARP), is involved in both DNA repair and the apoptotic cell response. The inactivation of PARP is accompanied by a proteolytic cleavage of the active precursor form. In addition, it is known that an upregulation of the PARP mRNA at the molecular level and an increased cleavage of the protein PARP are related to the consequences of a stroke.

For the protein pip92 (a hydrophilic, slightly basic protein with a length of 221 AS), the cellular function of which has not been conclusively clarified, results are available in the prior art which suggest an association with the processes of differentiation and apoptosis. Coleclough et al. (PNAS, Vol. 87, 1990, 1753ff.) An upregulation of pip92-mRNA (referred to there as chxl) was observed after addition of cycloheximide to activated T-lymphocytes, and Shimizu et al. (J. biol. Che., 1991, Vol. 266, No. 19, pp. 12157ff.) Were able to show that pip92 is induced by stimulation with TPA in a human promyeloid leukemia cell line. In addition, it can be seen from the prior art that anisomycin-induced cell death in the fibroblast cell line NIH3T3 is based on the activation of a signal transduction chain which proceeds via an activation of MAP kinases, such as, for example, JNK and p38. The subsequent induction of pip92 is essentially due to the induction of the pip92 promoter attributed (Chung et al, Eur. J. Biochem., 267, 2000, p. 4676 ff.).

At the same time, it can be seen from the prior art that pip92 after stimulation with substances that have a

Trigger cell differentiation is regulated. Chung et al. prove (Mol. Cell Biol. 1998, 18 (4), p. 2272ff.) that the

Differentiation factors bFGF or activated Raf-1 in hippocampal rat neurons lead to induction of the pip92 mRNA. Furthermore, they show that the mechanism of

Regulation both via mitogen-activated protein kinase

(MAPK-) independent as well as via MAPK-dependent signal paths takes place.

In addition, it has been reported in the prior art that systemic administration of NMDA induces pip92 in the hippocampus (Chung et al., J. Neurochem., Vol. 75, No. 1, 2000). NMDA can trigger neuronal cell death. For these reasons, Chung et al. Speculate that pip92 is associated with apoptotic processes. Nevertheless, numerous genes are induced by pleitrope stimuli, for example NMDA, or by MAP-, kinases, of which a priori no statement about a pro-apoptotic effect can be made. The results are interpreted to mean that cell death induced by glutamate (and the corresponding ion channel glutamate receptors) on neuronal cells could be associated with neurodegenerative diseases.

However, it is completely unknown in the prior art how apoptotic signals, which ultimately lead to the morphology of the apoptotic cell, are passed on after induction of pip92. Task of the present The invention is therefore to clarify the signal cascade further downstream and in this way to make available in vitro methods which allow the identification of corresponding active substances. The provision of corresponding pharmaceuticals is therefore also an object of the present invention.

The present invention solves this problem by the subject matter of claims 1 and 7 ... Advantageous embodiments are described in the respective subclaims.

The present invention is based on the one hand on the knowledge that changes in the gene expression of pip92 could be registered in an established animal model system for cerebral ischemia, the most pronounced form of which is stroke, which are functionally related to the extent of brain damage. In this animal model ("filament model"), a coated nylon thread that closes the branch of the A. cerebri media is introduced. By pulling back the thread, a re-circulation of the infarct area is possible. From the analysis of the transcriptome at different post-ischemic times, according to the invention pip92 could be identified and verified for the first time as a therapeutic target molecule for the indication stroke. On the other hand, the present invention is based on the further finding that there is a causal relationship between the overexpression of the protein pip92 known in the prior art and the cellular phenotype of apoptosis and that overexpression of pip92 leads to an activation of the poly (ADP-ribose) polymerase ( PARP), that is, to their cleavage. In this way, according to the invention a member of the signal transduction cascade triggered by pip92 can be identified.

The present invention therefore relates to test methods (assay methods) which, on the one hand, for in vitro diagnostic purposes and, on the other hand, for a scalable "screening" for active substance substances which interfere with the signal cascade mediated by pip92, in particular also for a therapeutic treatment of ischemic Cause infarcts.

According to claim 1 of the present invention, methods are disclosed which allow the apoptosis-modulating, in particular apoptosis-inhibiting, in particular the treatment of ischemic infarct effects of test substances on pip92 to be investigated, that is to say a method which is used to identify pharmaceutically active compounds serves, whereby (a) a suitable host cell system is made available and (b) one for observing the pip92-mediated function, in particular one for observing apoptosis, after adding a test compound in comparison to the control without adding a test compound for the according to (a ) obtained host cell system is measured in a suitable test system. Host cell systems from mammals, especially neuronal cell lines, in particular human, mouse or rat cell lines (for example COS-1 cells, H19-7 cells, Raji cells, HEK cells, PC12 cells, THP-1- Cells, or primary cells such as neurons, astrocytes, micro- and astroglia etc.). Basically, other immortalized and primary cell lines (e.g. astrogliomas, SY-5Y) can also be considered as required. Since the induction of apoptosis may If cell type is specific, a plurality of cell lines and primary cells are preferably examined using a method according to the invention.

Such host cell systems can also be modified by transfection, for example by transfection with an expression vector which is suitable for the protein pip92 (with a human sequence or for example the sequence from the genome of another mammal) or a fragment thereof or a variant with at least 90% , advantageously at least 95% sequence homology. Such an expression vector can contain the pip92 gene together with its native or an alternative, in particular an externally regulatable (inducible, in particular by temperature variation or activator (repressor) addition) regulatory sequence (promoter sequence). Advantageous regulatory sequences for the pip92 gene in the context of the method according to the invention are, for example, the bacterial promoters of cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, laclq, T7, T5, T3, gal, trc, ara, SP6, 1-PR or 1-PL promoter, or yeast promoters from ADC1, MFa, AC, P-60, CYC1, GAPDH or mammalian promoters from CaM-Kinasell, CMV, Nestin, L7, BDNF, NF, MBP, NSE, beta-globin, GFAP, GAP43, tyrosine hydroxylase, kainate receptor subunit 1 or the glutamate receptor subunit B. In principle, all natural promoters can with their regulatory sequences, such as those mentioned above, for an expression vector according to the invention.

Possibly . the expression vector can also code for at least one further gene, for example for a reporter gene (for example EGFP) or a resistance gene (for example an antibiotic resistance gene)). Alternatively, such additional genes however, they can also be introduced into the host cell system on at least one further separate expression vector.

As an alternative to such host cell systems, the method described above can also be carried out with cell extracts. For this purpose, cell extracts are provided according to methods familiar to the person skilled in the art; if necessary, the cell disruption will be connected to a cell fractionation, for example isolation of the cytosolic fraction and / or a fraction of the cell nucleus. In a further alternative embodiment of the method according to the invention, for example, a signal cascade can also be reconstituted in vitro, so that neither host cells nor cell extracts are used. In a further alternative embodiment of method step (a), particularly suitable for cell death detection in method step (b), a nematode which expresses pip92 or variants, for example fragments of pip92, can be made available as a host organism and according to method step (b) Changes in cell death in this transgenic host organism compared to the control is detected. Here, for example, the nematode C. elegans allows the examination of every single cell in the host organism.

The test system provided according to method step (a) of the method according to the invention (screening method) allows the identification of a compound which could be considered as an active ingredient, for example for the indication of ischemic infarction, in particular stroke, in a preferred embodiment by the detection of a biological Signal that indicates apoptotic events. Any structural or functional signal can be used as a signal Modification of proteins which are triggered by a pip92 (over) expression can be considered according to the invention. In particular, these are proteins that are further downstream in the signal cascade mediated by pip92. Structural or functional changes include: proteolytic cleavage of proteins, activation of proteins by covalent or non-covalent changes (e.g. addition of phosphate groups, glycosylation, addition of additional protein ligands to form

Protein complexes, homodi- or oligomerization),

Change in the expression pattern of downstream

Proteins, change in cell localization of proteins

(For example, from the cytoplasm into the cell nucleus, for example. GADPH, into the ER or secretion) and / or changes in the protein structure (for example structural rearrangements by so-called “hinge” regions).

In this context, detection of proteolytically cleaved proteins of the pip92-mediated signal cascade as a “marker” for corresponding apoptotic events, for example PARP cleavage or the detection of DNA histone fragments (for example by “cell death "ELISA, ^' particularly through the system from Röche Diagnostics, (Mannheim, DE)). In the case of PARP cleavage, in particular the presence and / or the intensity of the cleavage products is detected. A signal which is absent or weak in comparison to the control for a PARP cleavage product indicates the effectiveness of a test compound when carrying out a method according to the invention. The detection of a cleavage product, preferably an approximately 89 kDa cleavage product from PARP (or, depending on the species, other corresponding cleavage products) can For example, by using specific antibodies that recognize the cleavage product or products, in particular an antibody that recognizes the PARP binding domain, especially its C terinus.

The following methods are particularly preferred as detection methods for cleaved PARP or cleavage products from other proteins based on anti (PARP) cleavage product antibodies for the quantitative or qualitative detection of cleavage products in a sample within the scope of the method according to the invention.

The biological sample is preferably carried out on a solid phase support, such as. B. nitrocellulose or on another carrier material, so that the cells, cell parts, cell fractions or soluble proteins are immobilized. The carrier can then be washed one or more times with a suitable buffer, with subsequent treatment with a detectably labeled antibody according to the present invention. The solid phase support can then be washed with the buffer a second time to remove unbound antibody. The amount of bound label on the solid phase support can then be determined using a conventional method.

Glass, polystyrene, polypropylene, polyethylene, dextran, nylon amylases, natural or modified celluloses, polyacrylamides and magnetite are particularly suitable carriers. The carrier can be either partially soluble or insoluble in character to the conditions as appropriate of the present invention. The carrier material can take any shape, e.g. B. in the form of beads, or cylindrical or spherical, with polystyrene beads are preferred as a carrier.

Detectable antibody labeling can be done in different ways. For example, the antibody can be bound to an enzyme, which enzyme can finally be used in an immunoassay (EIÄ). The enzyme can then react later with a corresponding substrate, so that a chemical compound is formed which can be detected in a manner familiar to the person skilled in the art and, if necessary, quantified, e.g. B. by spectrophotometry, fluorometry or other optical methods. The enzyme can be malate dehydrogenase, staphylococcal nuclease, delta-5 steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, aspartic acid, galactosidase, glucose oxidase Act, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase or acetylcholinesterase. The detection is then enabled via a chromogenic substrate that is specific for the enzyme used for the labeling and can finally be e.g. by visual comparison of the substrate converted by the enzyme reaction compared to control standards.

Furthermore, the detection can be ensured by other immunoassays, for example by radioactive labeling of the antibodies or antibody fragments (i.e. by a radioimmunoassay (RIA; Laboratory Techniques and Biochemistry in Molecular. Biology, Work, T. et al. North Holland Publishing Company, New York (1978). The radioactive isotope can by using

Scintillation counters or by autoradiography can be detected and quantified.

Fluorescent compounds can also be used for labeling, for example compounds such as fluorescinisothiocyanate, rhodamine, phyoerythrin,

Phycocyanin, allophycocyanin, b-phthaldehyde and

Fluorescamin. Also fluorescent-emitting metals, such as. B. ¹⁵² E or other metals from the lanthanide group can be used. These metals are attached to the antibody via chelate groups, such as. B.

Diethylenetriaminepentaacetic acid (ETPA) or EDTA coupled. Furthermore, the antibody according to the invention can be coupled via a compound acting with the aid of chemiluminescence. The presence of the chemiluminescence-labeled antibody is then detected via the luminescence which arises in the course of a chemical reaction. Examples of such compounds are luminol, isoluminol, acridinium ester, imidazole, acridinium salt or oxalate ester. Similarly, bioluminescent compounds can also be used. Bioluminescence is a subspecies of chemiluminescence found in biological systems, where a catalytic protein increases the efficiency of the chemiluminescent reaction. The bioluminescent protein is in turn detected via luminescence, with luciferin, luciferase or aequorin, for example, being suitable as the bioluminescent compound.

An antibody of the invention can be used in an immunometric. Assay, also known as a "two-site" or "sandwich" assay. Typical immunometric assay systems include so-called "forward" assays, which are characterized in that antibodies according to the invention are bound to a solid phase system and in that the antibody is brought into contact with the sample being examined. In this way, the antigen is isolated from the sample by the formation of a binary solid phase-antibody-antigen complex from the sample. After an appropriate incubation period, the solid support is washed to remove the remainder of the liquid sample, including any unbound antigen, and then contacted with a solution containing an unknown amount of the labeled detection antibody. The labeled antibody serves as a so-called reporter molecule. After a second incubation period that allows the labeled antibody to associate with the antigen bound to the solid phase, the solid phase support is washed again to remove unreacted labeled antibodies.

In an alternative assay form, a so-called "sandwich" assay can also be used. A single incubation step can be sufficient if the antibody bound to the solid phase and the labeled antibody are both applied to the sample to be tested at the same time. After the incubation is complete, the solid phase support is washed to remove residues of the liquid sample and the non-associated labeled antibodies. The presence of labeled antibody on the solid phase support is determined in the same way as in the conventional "forward" sandwich assay. In the so-called reverse assay, a solution of the labeled antibody is first gradually added to the liquid sample, followed by from the addition of unlabeled antibody bound to a solid phase support after a suitable incubation period. After a second incubation step, the solid phase support is washed in a conventional manner in order to free it from sample residues and from labeled antibody which has not reacted. Determination of the labeled antibody with. the solid phase carrier has reacted, is then carried out as described above.

Western blot techniques for identifying cleavage products, in particular PARP cleavage products, are particularly preferred, all of the aforementioned detection options including all methods which are based exclusively on molecular weight determinations

(e.g. by gel electrophoresis without the use of antibodies,

Gel filtration, if necessary chromatographic methods) to

Can come into play. Alternatively, mass spectrometric methods can also be used (for example MALDI-TOF), the signal intensity of the corresponding cleavage product (with known molecular weight), for example also of the PARP cleavage product, being determined in relation to the signal intensity of the uncleaved protein.

However, morphological changes associated with apoptosis can also be used as a biological signal in an assay according to the invention, in order in this way to be able to serve as a “marker” for the effectiveness for the pip92-mediated apoptotic signal cascade. Changes in the cell membrane, for example, can , cell morphology, DNA morphology, in particular changes in the chromatin structure (for example also DNA fragmentation) can be detected via the following systems: Production of a virus, with which, for example, neurons can be infected, and thus an mRNA, which is coded pip92 and is channeled into neurons. The detection of the nuclear condensation after such an overexpression of pip92 in neurons can be done via DAPI staining, DNA fragmentation using TUNEL staining and PARP cleavage using specific antibodies for cleaved PARP.

Another possibility of determining apoptotic events and using these as systems as markers for candidate substances in a method according to the invention is staining with annexin (for example by the method from Röche Diagnostics, Mannheim, DE). Correspondingly, a measurement of apoptotic events can also be carried out via FACS analysis ("Fluorescence Activated Cell Sorting"), for example by fractionation either by staining the affected cells, by reaction with fluorescence-labeled antibodies or by cotransfection with, for example, GFP be made by cells.

A method of the type according to the invention can also be designed as a so-called high-throughput (HTS) screening method for identifying corresponding connections. The test systems described therefore allow chemical libraries to be searched for substances which have inhibitory or activating effects on pip92, for example by acting on its transcription, its translation, its biological function (for example on its DNA or protein binding capacity or its enzymatic properties), to have. The identification of such substances represents the first step on the way to Identify new types of drugs that act specifically on pip92-mediated signal transduction, in particular to trigger apoptosis, but also, for example, with regard to any pip92-mediated cell growth, cell proliferation and / or cell plasticity.

Since the induction of apoptosis may also be stimulus-specific, in a method according to the invention, several stress situations are preferably used as external stimuli, for example heat shock, hypoxic conditions and / or cytokine treatments (for example 11-1, 11-6, TNF) -alpha, staurosporine, H ₂ 0 ₂ treatment). In this way, candidate compounds can be tested for their effectiveness in several parallel approaches according to the invention.

In a preferred embodiment of the present method, in a process step (c) the binding site of the pharmaceutically active compound on pip92 according to the method according to the invention is determined by a suitable biochemical or structural biological method (rational drug design (Böhm, Klebe, Kubinyi, 1996, drug design, Spectrum publishing house, Heidelberg)).

After identification of selective active substances according to the aforementioned method according to the invention, the binding sites of these substances on pip92 can be determined biochemically or structurally, for example with the aid of the two-hybrid system or other assays, ie the amino acids responsible for the interaction are limited. In this way it is also possible to find substances with which the interaction between pip92 and any native intracellular interaction partners thereof can be influenced, in particular inhibited. such Processes are typically carried out in process step (c). In this way, a method for finding substances with specific binding affinity for the protein pip92 is disclosed according to the invention.

As an alternative to or in addition to the biochemical methods disclosed above, the structure or a partial structure of pip92 after the addition of the candidate compound, i.e. complexed with this, via NMR or X-ray crystallography methods (according to the corresponding

Crystallization or cocrystallization (e.g. after the

Method of "hanging drop" or "soaking" techniques "

(Addition of the candidate compound to the pip92 crystal) can be determined. If the 3D structure of pip92 is already available after X-ray crystallization, after the diffraction pattern of the crystal and candidate compound in the complex has been recorded, the phase information of the 3D structure of pip92 can be used solely for structure calculation. With the support of molecular modeling programs / methods (SYBIL program package, 0, X-PLORE), after clarifying the interactions between the candidate compound and pip92, the compounds acting as agonists or antagonists can be modified so that, for example, an even higher affinity of the modified candidate connection to pip92 should result. In this way, for example, the chemical characteristics of the test compound can be changed by changing the steric arrangement of functional groups, modifying the functional groups, changing the hydrophobicity profile of the compound and / or its hydrogen bonding potential, etc. by using silico methods, in particular in one process step (i.e. ), can be modified. The compound modified to this extent can again be subjected to the method according to the invention with method steps (a), (b), (c) and / or (d) and can be iteratively optimized in this way, the objective function in particular being an optimization of the biological properties of the test compound the inhibition of pip92-mediated apoptosis.

After structural optimization of the original lead structure of the candidate compound, it can be tested in further in vitro assays or in an animal model for its effectiveness, for example against stroke, before appropriate clinical tests can be carried out.

A preferred method according to the invention will preferably be preceded by a ligand binding assay before the provision of a method according to claim 1. In a primary assay of this kind, the binding ability of candidate substances, for example obtainable from substance libraries or synthesis processes in combinatorial chemistry, to pip92 is examined, in particular the binding constant is determined. Such binding assays can be carried out according to all methods familiar to the person skilled in the art, for example with the aid of BIACORE devices, the mass increase which results when a ligand (for example the test substance) being measured being measured by means of a sensor chip which contains, for example, pip92 immobilized ) flows through the flow cell past the sensor chip. The binding constant can also be determined calorimetrically, for example with the aid of differential “scanning” calorimeters. Alternatively, the binding of ligands can also be simulated in silico, in that the binding capacity is more appropriate Candidate substances, the spatial structure of which has been elucidated or calculated by semi-quantum mechanical methods, to which the pip92-3D structure is investigated using corresponding “docking” programs (for example “Dock, Kuntz et al. 1982 J. Mol. Biol. 161, P. 269 ff .; Sybyl / Base program "FLEX-X" of the TRIPOS program package, see Rarey et al., J. Mol. Biol. 261, p. 470 ff., 1996). Suitable candidates are identified in a silico primary assay (e.g. substances from a database: CCDC (Cambridge Crystal Data Center, 12 Union Road, Cambridge, GB; or also the databases available from TRIPOS (e.g. Derwent WORLD Drug Index)) and then examined according to the invention for their biological properties.

According to the invention, further biological tests can also be carried out upstream or downstream of a method according to the invention, for example cell toxicity, membrane permeability or metabolism properties can be measured.

Methods according to the invention are used in particular in in vitro diagnostics, diseases, disorders or pathological conditions which are characterized by cell death events, in particular ischemic infarcts (for example also a stroke or heart attack), being able to be diagnosed. Based on the activity of pip92

(Overexpression of pip92) (for example detectable by pip92 mRNA or the protein) or on the basis of an activation of the downstream proteins of the signal cascade, for example the proteolytic cleavage, in particular the PARP cleavage, a diagnostic assay can be designed. All of the detection possibilities for a mentioned above within the scope of the disclosure of methods for the identification of ligands biological signals can also be used in the course of an in vitro process. In principle, overexpression of pip92 as a diagnostic marker for diseases based on hyperapoptotic disorders, for example ischemic infarction, is disclosed according to the invention. According to the invention and the method, the risk factor for the manifestation of degenerative diseases, ischemic infarcts, for example stroke, etc., which is caused by pip92 overexpression, can already be determined. However, the method according to the invention can also be used post-traumatically to support a clinical diagnosis, for example a stroke diagnosis. In principle, therefore, methods according to the invention for in vitro diagnosis of diseases based on pip92-mediated incorrect control of signal cascades, in particular apoptotic signal cascades, are disclosed, with (a) a patient sample, for example in the form of a tissue sample obtained by biopsy, being taken and / or removed cells from patients are cultivated in vitro, and (b) a parameter suitable for observing the pip92-mediated function, in particular one for observing apoptosis, cell growth, cell proliferation and / or cell plasticity in comparison to the control for the according to (a ) sample obtained is measured in a suitable test system. Methods are preferred in which in step (b) the cleavage of the protein PARP, the staining of cells with annexin and / or an apoptosis signal is detected by FACS analysis.

The present invention furthermore relates to those compounds which are obtained or obtainable with the aid of a process according to the invention, their Suitability as a medicament or method for the therapeutic use of such compounds, in particular for the treatment of the indications mentioned according to the invention.

These compounds to be tested in the context of the present method according to the invention will preferably be organic chemical compounds with a molecular weight of <5000, in particular <3000, especially <1500, which is typically physiologically well tolerated and preferably the blood brain Barrier can pass, in particular also have at least unilateral hydrophilic groups. An organic molecule will be particularly preferred as a candidate substance in a method according to the invention if the binding constant (which is determined in the context of a primary ligand binding assay) for the binding to pip92 is at least 10 ⁷ mol ^-1 . The compound according to the invention will preferably be such that it can pass through the cell membrane, be it by diffusion or via (intra) membranous transport proteins, if appropriate after appropriate modification (for example glycosylation). In particular, such process and compounds selected according to the invention will occupy positions on the surface of pip92 (and thereby block its binding or enzymatic activity, for example) or cause a local conformational change in pip92, so that the binding of a native binding partner of pip92 is prevented. In addition to the transcriptional regulation, ie regulation of the mRNA amount of pip92 in the cell, a pharmaceutically active compound according to the invention can also intervene in other control processes of the cell, which can influence, for example, the expression rate of the protein pip92 (eg translation, splicing processes, native derivatization of pip92, for example phosphorylation, or regulation of the degradation of pip92). In particular, the effect of the candidate compound can also be brought about by binding to the regulatory sequence of the pip92 gene or by binding to a transcription factor controlling the pip92 gene.

Finally, the mechanism of action of substances according to the invention can also be based on a modulation of the PARP cleavage, for example substances according to the invention can inhibit the PARP cleavage, for example by adding a non-native oligopeptide (peptidomimetic) which contains the cleavage sequence (proteolytic interface) of PARP , for example, a decamer with (at least) 5 AS N-terminal and (at least) 5 AS C-terminal from the cleavage site or as a peptidomimetic, this image.

As an alternative to the previously disclosed organic chemical compounds, in another preferred embodiment of the present invention a compound according to the invention, for example obtainable from a method according to the invention, an antibody, preferably an antibody directed against pip92, an antibody directed against the underlying pip92 mRNA, or also be an antibody directed against a transcription factor of pip92, which is preferably introduced ex vivo into retransplanted host cells or by gene therapy in vivo procedures into host cells and is not secreted there as "intrabody", but can develop its effect intracellularly. By means of such “intrabodies” as compounds, the cells can be protected against a misdirected apoptotic reaction, for example by overexpression of the pip92 protein. Such The procedure will typically be considered for cells of those tissues that show pathophysiologically exaggerated apoptotic behavior in the patient, especially in neurons. To carry out a method according to the invention for testing such antibodies, the host cell systems are simultaneously transfected with an appropriate expression vector for an antibody described above (preferably coupled to an inducible promoter) and its effectiveness for the observation or non-observation of a biological signal (as described above) , for example the PARP cleavage. Other potential compounds which can be tested in a method according to the invention are: anti-sense oligonucleotides (for example against pip92 mRNA) or ribozymes which can cut for example pip92 mRNA.

In a further alternative of the compounds identified according to the invention, it can be an inhibitory variant of pip92, for example a fragment or a biologically inactive variant

(Mutant, with substitutions or deletions in biologically active areas of pip92) or a peptidomimetic, the mechanism of action being based on co-petition with native pip92 in cells.

Overall, compounds which are obtainable or obtained from a process according to the invention can be used as medicaments. Here, all of the aforementioned variants are included as compounds, that is to say, for example, organic chemical compounds or anti-sense oligonucleotides or “intrabody” antibodies. In particular is a compound of the invention (for the manufacture of a medicament) for the treatment of diseases for which at least tw. a pathological hyperapoptotic or hypernecrotic or possibly also inflammatory reactions is causal or symptomatic. A substance identified according to the invention, for example an inhibitor of the pip92-mediated signal cascade, for example the apoptotic reaction, can thus be used as a medicament and very particularly in the treatment of the following diseases or for the manufacture of a medicament for the treatment of the following diseases: tumor diseases , Autoimmune diseases, especially diabetes, psoriasis, multiple sclerosis, rheumatoid arthritis or asthma, viral infectious diseases (e.g. HIV), degenerative diseases, especially neurodegenerative diseases, e.g. Alzheimer's or Parkinson's disease, epilepsy or muscular dystrophies, GvHD, e.g. liver or heart), ischemic infarction, especially stroke or heart attack, hypoxia, traumatic brain injury.

The abovementioned apoptosis-inhibiting substances identified according to the invention can also be part of a pharmaceutical composition which can contain further pharmaceutical excipients and / or additives in order to stabilize such compositions for therapeutic administration, for example, to improve the bioavailability and / or the pharmacodynamics , Compounds or compositions according to the invention containing such compounds can be used nasally, orally, intraperitoneally, ocularly, topically, intravenously, intraarterially and / or subcutaneously. The present invention further relates to methods for identifying cellular interaction partners of pip92, in particular proteins which are involved in the apoptotic signal transmission downstream of pip92, in particular proteins which are involved in the cleavage of, for example, PARP after activation of pip92.

Accordingly, direct (and also - as described below - indirect) interaction partners of pip92 can be identified, i.e. those proteins which have binding affinities specific to pip92. Such a method according to the invention or the use of pip92 to carry out such methods is preferably carried out with the aid of a “yeast two hybrid” screening (y2h “screens”) alone or in combination with other biochemical methods (Fields and Song, 1989 , Nature, 340, 245-6). Such screens can also be found in Van Aelst et al. (1993, Proc Natl Acad Sei U S A, 90, 6213-7) and Vojtek et al. (1993, Cell, 74, 205-14). Typically, instead of yeast systems, mammalian systems can also be used to carry out a method according to the invention, for example as in Luo et al. (1997, Biotechniques, 22, 350-2). For a y2h screen, the open reading frame of pip92 (or its variants, for example fragments) is cloned, for example, into a so-called bait vector “in-frame” with the GAL4 binding domain (for example pGBT10, from Clontech) a so-called “prey library” can preferably be searched for interacting proteins in a yeast strain according to the usual protocol.

According to the invention, interaction partners can also be co-immunoprecipitated with pip92- (or their native Variants) to use expression vectors from transfected cells in order to purify proteins which bind to them, and subsequently to identify the associated genes by means of protein sequencing methods (for example MALDI-TOF, ESI-tandem-MALDI).

Furthermore, according to the present invention, sequences are disclosed, as shown in FIGS. 6 to 14, including those sequences which are at least 90%, preferably at least 95% and even more preferably at least 97, with the sequences shown in FIGS. 6 to 14 % are homologous or, in the case of the DNA sequences, hybridize with the depicted DNA sequences under, for example, moderately stringent conditions. With the disclosure of the DNA sequences according to FIGS. 6, 7, 9, 10, 12 and 13, corresponding expression vectors and

Host cells that are transfected with these DNA sequences or with corresponding expression vectors are also disclosed. Both for the aforementioned DNA sequences or protein sequences as well as for expression vectors and host lines, their use for the (production of a medicament for) treatment of tumor diseases, autoimmune diseases, in particular diabetes, psoriasis, multiple sclerosis, rheumatoid arthritis or asthma, viral infectious diseases (e.g. HIV), degenerative diseases, in particular neurodegenerative diseases, for example Alzheimer's or Parkinson's disease, Huntington's disease, epilepsy or muscular dystrophies, senility, GVHD (for example liver, kidney or heart), ischemic infarction, especially stroke or heart attack, hypoxia, Skull-brain trauma, spinobulbar muscular atrophy, Machoado-Joseph syndrome. In particular, the corresponding therapeutic methods of in vivo or ex vivo (e.g. transfection of bone marrow cells) gene therapy.

In addition, the sequences shown in Figures 6 to 14, their homologs i.S. the above definition (or fragments thereof of at least 40 nucleotides or at least 25 AS in length) or the disclosed expression vectors or host cells are used in one of the methods according to the invention for the identification of interaction partners or for the identification of active substance substances.

The present invention is explained in more detail by the following figures:

Figure la shows a section of an RMDD gel on which the regulated sequence 13C5 was identified. The nine lanes represent brain RNA from a model of stroke in mice, middle cerebral artery occlusion (MCAO). The cerebral artery was occluded for 90 min (the left hemisphere is ischemic), followed by 2, 6 or 20 h reperfusion. Order order: left hemisphere (L), right hemisphere (R), and sham-operated animals (S, left hemisphere), each for the different reperfusion times.

The result shows a regulation at all 3 points in time, the specificity of the regulation on the ischemic side increasing with increasing reperfusion time. The protein 13C5 (pip92) shares this behavior with a number of so-called “immediate early genes” in this model. Figure 1b confirms the upregulation of 13C5 by quantitative PCR using the LightCycler system. The expression of 13C5 (relative to the standard cyclophilin) was measured against sham-operated animals (1 / sham, shaded in gray) and in comparison of the two hemispheres with each other (1 / r, black). Here too, the initial observation from the RMDD membrane (see FIG. 1 a) of an increasingly more specific regulation in the observed time window is confirmed. The effect is particularly clear after 20 h of reperfusion.

FIG. 2 shows a Western blot of COS1 cells that were transfected with pip92 or the empty vector as a control. A specific antibody for cleaved PARP protein clearly shows the apoptosis-inducing effect of pip92. Split PARP can also be observed without the addition of staurosporine.

Figure 3 gives the result of an analysis of cultured cells using an ELISA, the mono- and oligonucleosomes in the

Detects cytoplasm of apoptotic cells in the form of a

Bar chart again. Cells that expressed pip92

(right bar), have more mono- and oligonucleosomes in the

Cytoplasm on stimulated cells transfected with the empty vector (left bar, not shown due to the relative indication on the y-axis). Similar effects can be seen when staurosporine (0.2μM) is administered to cells that have been transfected with the empty vector (middle bar).

4 shows the Annexin V binding of EGFP and EGFP / pip92 expressing cells. COS-1 cells were through

Electroporation with EGFP or with EGFP and pip92 and 48 h after transfection the proportion of apoptotic (Annexin V-PE positive and Pl negative) Cells (shaded hatched) and already dead (Annexin V-PE and Pl positive) cells (shaded hatched) for the EGFP positive cell pool determined by FACS analysis. The result clearly shows that both fractions (Annexin V-PE positive and (i) Pl negative or (ii) Pl positive) increased significantly in the case of pip92 overexpression (right bar) compared to the control (left bar) are.

5 shows the results of experiments with the Annexin V-positive cell pool after staurosporine treatment of EGFP and EGFP / pip92-expressing cells. COS-1 cells were transfected by electroporation with EGFP or with EGFP and pip92. 24 hours after the transfection, the cells were washed with PBS and for a further 24 hours with staurosporine

(0.2-1.0 μM) stimulated in complete medium. Received controls

Complete medium without staurosporine. 24 hours after the addition of staurosporine, the proportion of apoptotic (Annexin V-PE-positive and Pl-negative) cells and already dead (Annexin V-PE and Pl-positive) cells for the EGFP-positive cell pool was determined by FACS analysis , Here, too, the proportion of dying cells from the pool of EGFP-expressing cells in the case of expression of pip92 is significantly increased compared to the control.

FIGS. 6 to 14 represent different pip92 sequences (DNA or AS sequences) of human origin or of mice. FIG. 6 shows the cDNA sequence of pip92 of the mouse, FIG. 7 shows the open reading frame (ORF) of pip92 (see FIG. 6) the mouse, FIG. 8 the AS sequence of pip92 the mouse (221 AS) (see FIG. 7), FIG. 9 the open reading frame of a shorter splice form of maus-pip92, FIG. 10 an alternative fragment from FIG. 7, the missing in Figure 9, 11 shows the AS sequence corresponding to ORF from FIG. 9, FIG. 12 shows the cDNA sequence of the human pip92, FIG. 13 shows the open reading frame (ORF) of the human pip92 sequence (see FIG. 12) and FIG. 14 shows the human pip92-AS Sequence (223 AS) corresponding to ORF from Figure 13.

The proapoptotic effects of pip92 after overexpression could also be demonstrated in primary 'cortical cultures using a ß-Gal assay ^' . 15 shows the proportion of living cells measured as the MU release. The values for cells transfected with an empty vector were set to 1. In this experiment, bax, a described proapoptotic protein, served as a positive control; pip92 reduced the proportion of living cells to 0.6 times the control transfected with the empty vector.

FIG. 16 shows the mapping of an in situ hybridization onto a horizontal section through a rat brain. Using the radioactively labeled probe, the expression of pip92 in the cerebellum, hippocampus, gyrus dentatus and in the cortex, in particular in the entorhinal cortex, could be visualized.

The present invention is characterized in more detail by the following exemplary embodiments:

embodiments

Embodiment 1

A) Identification of 13C5 (pip92)

1. Establishing the thread model in mice

To induce a transient focal cerebral

Ischemia in c57 / bl6 mice 3 month old mice were used. After induction of inhalation (70%

N20, 30% 02, 0.8-1% halothane) became a 5-0 prolene thread

(From Ethicon), which was coated with 0.1% poly-L-lysine, advanced over the external carotid artery into the internal carotid artery until the exit of the cerebral media. The correct position of the thread is indicated by a drop in the laser Doppler signal (from Perimed) to 10-20% of the output signal. After performing this operation and, if necessary, determining additional physiological parameters (blood pressure, pulse, blood gases, blood glucose), the mice awake from anesthesia. After an occlusion time of 90 min, the mice are subjected to anesthesia again and the thread is withdrawn. This causes tissue reperfusion. After certain reperfusion times (2 h, 6 h and 20 h), the mice are anesthetized by intraperitoneal injection with Rompun / Ketanest, transcardially perfused with warm NaCl solution, and the brain is immediately prepared and frozen on dry ice. The control animals ("sham-operated") were also subjected to inhalation anesthesia and opening of the surgical site. 2. Preparation of brain mRNA

After the cerebellum and brain stem had been removed, the brain halves were separated and an RNA preparation with guanidinium isothiocyanate / acid phenol extraction according to Chomczynski & Sacchi (Anal. Biochem. 162, pp. 156ff., 1987). carried out. The tissue was homogenized with an Ultra-Turrax (IKA Labortechnik, Germany). Then there was another. RNA purification (100 μg) via silica columns (RNAeasy, Qiagen, Germany). RNA concentrations were determined by means of photometric measurements, and the samples were stored at -80 ° C.

3. Implementation of the RMDD protocol

The procedure followed was essentially as described in EP 0 743 367 A2 and US 5,876,932, which form part of the present disclosure, with the change that 10 μg of RNA were used for the first-strand synthesis. After performing first strand synthesis, second strand synthesis and restriction digestion, adapter ligation with adapters is carried out. After PCR amplification with adapter and cDNA primers, the amplification products are loaded onto a denaturing gel and blotted onto a nylon membrane (GATC). The biotin-labeled bands are visualized using a common streptavidin-peroxidase reaction (Röche Molecular Biochemicals). PCR samples from the ischemic and contralateral hemisphere and control animals were applied to the gel in each case (2 h, 6 h, 20 h reperfusion). Bands of different intensities in the right or .left The hemisphere is cut out and the corresponding PCR product is reamplified. Amplified products obtained are cloned into the TOPO TA vector pcDNA 2.1 (Invitrogen) and sequenced with T7 and Ml3rev primers (ABI 3700 capillary electrophoresis sequencer). Sequences obtained are compared with the EMBL database. There was a strong similarity. to the sequences M59821 and M33756 (pip92).

The results of the gel electophoretic analysis are shown in Figure la.

B) Verification of the regulation

The regulation of 13C5 was in cDNA from MCAO samples

(middle cerebral artery occlusion, stroke model) verified by quantitative PCR. For this, cDNA was made

20 µg total RNA using Superscript II reverse

Transcriptase (Gibco Life Technologies) and oligo-dT primers synthesized and purified using PCR cleaning columns

(Qiagen, Germany). The quantitative PCR was carried out using the

LightCycler Systems carried out (Röche Diagnostics,

Mannheim, Germany), as already described (Brambrink et al., J. Cereb. Flow Metab. 20, 2000, p. 1425 ff.). The formation of double-stranded products is measured by real-time fluorescence detection of intercalated SYBR-green. cDNAs were serially diluted 3-fold to obtain 4 concentrations for a standard curve. The concentration of 13C5 in various cDNA samples was normalized to the standard gene cyclophilin. 60 ° C was chosen as the annealing temperature. Cyclophilin and 13C5 were measured at 84 ° C to identify possible primer dimers from the Exclude measurement. The following primer pairs were used for the PCR reaction: cyc5, ACCCCACCGTGTTCTTCGAC; acyc300, CATTTGCCATGGACAAGATG (cyclophilin, the product is 300 bp long) pip92-s-newl, AAGCGGTCAGAGTTGCGTCAT; pip92-a-new-l, CACCGTGGGAAAAGTAAACAGA (13C5; the product is approximately 360 bp long).

The specificity of the PCR reaction was checked by means of melting point determination and by agarose gel electophoresis. The measured values were averaged from at least 3 dilutions per value. The results are shown in FIG. 1b, the error bars of which correspond to the standard deviation.

Embodiment 2

1. Cloning of an expression construct: The coding region of the pip92 cDNA was determined using specific primers (pip92_m_Bl: 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTCTACCATGGAAGTACAGAAAGAAGCGCAGCG -3 '; pip92_m_B2: 5'-

GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGAAGGCCACCACAGCTCGC-3 ') amplified by means of a PCR from mouse cDNA. The primers used contain so-called B sites at their ends (sense primer, Bl site: 5 '

GGGGACAAGTTTGTACAAAAAAGCAGGCTCT-3 'antisense primer, B2 site: 5'-GGGGACCACTTT GTACAAGAAAGCTGGGTC-3') to convert the PCR products into the vector pcDNAGEN (INVITROGEN) using the gateway system (INVITROGEN; implementation according to manufacturer's instructions).

2. Electroporation of COS-1 cells: COS-1 cells were removed from the culture dishes with trypsin, centrifuged and the cell pellets resuspended in 300μl electroporation buffer and then mixed with 7.5μl IM MgS0 ₄ solution. Each 300μl of this cell suspension was transferred with 1-5μg plasmid DNA in 4mm electroporation cuvettes (PEQLÄB). The electroporation was carried out using a Gene-Pulser II (BIORAD) at 500μF / 230V. The cells were incubated with 5 ml of COS-1 medium in the incubator.

3. Detection of the PARP cleavage

To detect the cleavage of PARP, COS-1 cells were transient with the expression construct for pip92 or the. Empty vector transfected. On the second day after the transfection, the cells were treated with 0 or 0.2 μM staurosporine for five hours

(CABIOCEM) stimulated in the medium. After the time had elapsed, the supernatant was removed and the remaining cells by means of

Scrapped from the plates and dissolved in chilled (4 ° C) PBS with inhibitors (pepstatin [2.5 mg / ml] and aprotinin, both SIGMA; 1: 1000). The cells were centrifuged off (4 min, 4000 rpm) and washed again with 1 ml PBS with inhibitors. The pellets obtained were taken up in a volume of 2% SDS and 5 .mu.l of benzonase solution (40 .mu.lOOmM MgCl ₂ + 9 .mu.l benzonase, BOEHRINGER) were added. After the pellets had dissolved at room temperature, a volume of PBS was added to the samples. 1 μl of each sample was used for a protein determination (BCA test, PIERCE, implementation according to the manufacturer's instructions). For subsequent Western blot analyzes, 100 μg protein were used and 5 μl 4x loading buffer (Laemmli) were added. The samples were denatured for 5 min at 95 ° C. and then using 8% denaturing SDS-polyacrylamide gels at 20 mA per Gel separated. The proteins were transferred using a semi-dry blotting chamber (BIOMETRA) in transfer buffer (25mM Tris-HCl, 150mM glycine, 10% methanol, pH 8.3) to nitrocellulose membranes (Protan BA79, SCHLEICHER & SCHÜELL) for 60min (approx. 150mA / gel). The membranes were first blocked with 5% skimmed milk powder (frema Reform, NEUFORM) in PBS / 0.02% Tween20, then washed 3x 5min with PBS / 0.02% Tween20 and incubated for one hour at room temperature with the first antibody (COS cells: ^" anti-cleaved PARP antibody, PROMEGA, 1: 800). After washing three times with PBS / Tween 20, the blots were incubated with the second antibody (anti-rabbit antibody HRP-coupled, Dianova, 1: 5000) for one hour at room temperature. The detection was carried out with the SuperSignal chemiluminescent system from PIERCE according to the manufacturer's instructions on Hyperfilm-ECL (AMERSHAM PHARMACIA BIOTECH).

In the COS-1 cells, which were transfected with the cDNA for pip92, an increased cleavage of PARP could be detected compared to cells which were only transfected with the empty vector, both without and after stimulation with 0.2μM staurosporin ( CALBIOCEM). (see Figure 2)

Embodiment 3

Detection of DNA fragmentation using cell death detection

ELISA ^PLÜS (RÖCHE)

COS-1 cells were dissolved with 3 ml trypsin from culture dishes. The cells were taken up in 30 ml of COS-1 medium and an aliquot diluted 1: 1 with trypan blue (Sigma). The cell number was determined with the help of a Neubauer counting chamber. The remaining cells were centrifuged off and resuspended in 300 μl electroporation buffer. and subsequently 7, 5μl IM MgS0 ₄ solution added. Each 300μl of this cell suspension was transferred with 1-5μg plasmid DNA in 4mm electroporation cuvettes (PEQLÄB). The

Electroporation was carried out using a Gene-Pulser II (BIORAD) at 500μF / 230V. The cells were plated in such a way that approx. 7500 cells with 100 μl of COS-1 medium were in a well of a 96-well plate (NUNC), and incubated at 37 ° C. in the incubator. The medium was changed 7-16 hours after the electroporation.

To detect the DNA fragmentation, COS-1 cells were transiently transfected with the expression construct for pip92 (see exemplary embodiment 2) or an empty vector as a control. On the second day after the transfection, the cells were stimulated for five hours with 0 or 0.2 μM staurosporine (CALBIOCEM) in the medium. After the time, the Cell Death Detection ELISA ^PLUS (RÖCHE) was carried out according to the manufacturer's instructions.

The absorption was measured in one

Plate reader (platereader Fluostar; BMG) at 390 nm and 485 nm. The enrichment factor at mono- and

Oligonucleosomes in the cytoplasm were determined according to the manufacturer's instructions, the values being normalized to 0 μM staurosporin-treated cells transfected with an empty vector.

Cells that expressed pip92 showed a significantly higher proportion of mono- and oligonucleosomes in the cytoplasm. Comparable values could be achieved by administering 0.2 μM staurosporine, an apoptosis trigger (see FIG. 3). Embodiment 4

Annexin-V-phycoerythrin binding of pip92-transfected COS-1 cells

COS-1 cells were co-transfected with the pip92 expression construct described in Example 2 and an expression construct for EGFP ("Enhanced Green Fluorescence ^" Protein "; pEGFP-NI). Controls were cotransfected accordingly with pEGFP-NI and an empty vector (pcDNA3.1). For this purpose, 3.5 × 10 ⁶ cells after trypsinization were resuspended in 300 μl electroporation buffer (50 itiM K ₂ HP0 ₄ , 20 mM CH ₃ COOK, 20 mM KOH, pH 7.4) and the buffer solution with 25 μl MgS0 ₄ (1 M). / ml electroporation buffer added. The cell suspension was then mixed with 5.25 μg DNA (0.2 μg / μl) of the respective plasmids and transferred into an electroporation cuvette (EquiBio cuvette; 0.4 cm electrode). The electroporation was carried out by means of a Gene Pulser II (BioRad) at 500 μF and a voltage of 230 V. The electroporated cell suspension was with a cell density of 1-10 ⁶ cells on 6 cm culture dishes with full COS medium (high-glucose DMEM (Sigma) , 10% FCS, penicillin / streptomycin).

As a control, an empty vector (pcDNA3.1) was co-transfected together with pEGFP-Nl instead of the construct for pip92. After 24 h of cultivation, the cells were washed with PBS and stimulated with staurosporine (0.2-1.0 μM; Calbioche) in complete medium. Controls were given full medium without staurosporine. 24 h after the addition of staurosporine, the medium was removed, transferred to a 15 ml Falcon tube and the Wash cells lx with PBS. The wash solution was combined with the medium. After trypsinization, the cells were also transferred to the Falcon tube and counted after mixing. 3 × 10 ⁵ cells each were centrifuged at 250 g for 5 min, resuspended in 300 μl Annexin V binding buffer (10 mM HEPES pH 7.4; 150 mM NaCl; 2.5 mM CaCl ₂ , ImM MgCl ₂ , 4% BSA) and transferred into a 1.5 ml Eppendorf tube. The mixture was then centrifuged for 5 min at 4 ° C. with 250 g. The supernatant was discarded and the cells were resuspended in 300 μl Annexin V binding buffer with 15 μl phycoerythrin conjugated Annexin V (Annexin V-PE; PharMingen). The cell suspension was incubated for 15 min in the dark at room temperature and then centrifuged for 5 min at 250 g. The cell sediments were resuspended in 3.00 μl ice-cold Annexin V binding buffer with 5 μl propidium iodide (PI; 30 μg / μl; oncogene) and transferred into FACS tubes. The FACS analysis was carried out immediately afterwards, the tubes being kept on ice until the measurement and stored in the dark. 1 × 10 ⁵ cells per batch were analyzed with a FACSCalibur device (Becton Dickinson).

As a result, the proportion of Annexin V-PE positive and at the same time PI negative cells for the EGFP positive cell fraction was determined (see FIGS. 4 and 5).

Embodiment 5

Evidence of the cell death promoting effect of pip92 in primary neuronal cultures using a ß-Gal assay 10-12 cortices were prepared from stage E18 embryos. The tissue was dissociated using trypsin [10mg / ml] / EDTA / DNase [5mg / ml] (Röche) in HBSS (BioWithakker), the reaction with 4 parts medium (neurobasal medium + 1ml 50x B-27 supplement (both invitrogenic) + 0 , 5mM L-glutamine + 25μM glutamate) stopped and then centrifuged at room temperature for 5min at 800g. The pellet was taken up in 5 ml of medium and the cell number was determined using a Neubauer counting comb. The cells were plated so that 250,000 cells per well of a 24-hole plate coated with poly-L-lysine came to rest.

On the second day after the preparation, 250 μl were removed from the medium and 250 μl of the same medium without glutamate were added to the cells. The cells were transfected another 24 hours later.

For this purpose, plasmid mixtures were prepared which contained a β-gal expression construct (CMV-LacZ; 50ng / well) and a) a background control (empty vector pDESTdelta), b) a positive control (bax expression construct) or c) the sample (pip92 expression construct) (450ng each / deepening). The transfection was carried out according to E.C. Ohki et al .; Journal of Neuroscience Methods 112 (2001) 95-99.

On the third day after the transfection, the medium was aspirated and the cells were washed once with PBS. 500μl ß-Gal buffer (20mM TrisHCl, pH 8; 100mM NaCl, ImM MgCl ₂ ; 0.2% Triton X-100; 10MM DTT, ImM MUG = 4-methylumbelliferyl-ß-D-galactopyranoside) was applied to the well Give cells and shake at 4 ° C for 10min, then at 30min

Incubated at 37 ° C. The reaction was carried out with 500 μl 0.4M Na ₂ CO ₃ each

(4 ° C) stopped. Then the Amount of released 4-methylumbelliferone measured (excitation 364nm, emission 440nm), which is a measure of the number of living cells.

These experiments have shown that Pip92 leads to increased cell death in neurons after overexpression. (see Figure 15)

Embodiment 6

Distribution of pip92 in the brain

The localization of the transcript of pip92 was examined by in-situ hybridization with a radioactively labeled oligo probe. For this purpose, 15 μm thick brain sections were cut with a cryostat at -20 °, slides mounted on poly-L-lysine and fixed in 4% paraformaldehyde in PBS (pH 7.4). The oligo pip92-is-3as (5'-ttg ctt ggt acc agt ccg gca tca cta ctg tcg ctc aaa tcg ctg ctg ct-3 ') was transferred using terminal transferase

(Röche) radioactively labeled with a- ³⁵ S-dATP. Labeling and subsequent hybridization were carried out according to a protocol by Wisden & Morris {In situ Hybridization Protocols for the brain, Academic Press 1994)

FIG. 15 shows a localization of pip92 transcript in the dentate gyrus and hippocampus. CA1 region neurons are particularly susceptible to delayed neuronal death (apoptosis) after damage (eg (Hara, et al., Stroke, 31, 236-8, (2000)), and neurons in the CA4 region are also to a lesser extent. The dentate gyrus, on the other hand, seems more like one necrotic damage after ischemia affected. The dentate gyrus is associated with new neuron formation after pathological stimuli (Takagi, et al., Brain Res, 831, 283-7, (1999)) (Parent, et al., J Neurosci, 11, 3727- 38, (1997 )).

The transcript is still detectable in the cerebellum and cortex, especially in the entorhinal cortex. Information ^" goes from the entorhinal cortex to the hippocampus and contributes to learning and memory. Damage to the entorhinal cortex often occurs in patients with traumatic brain damage, stroke or Alzheimer's disease. Such damage can lead to changes in behavior that include poor processing of sensory impressions or learning difficulties." Davis et al., Nurs Res 50 (2) 77-85 (2001)).

This in-situ localization confirms a connection between pip92 and neuronal cell death, neurogenesis and plasticity.

Claims

claims

1. A method for identifying a pharmaceutically active compound, characterized in that

(a) a suitable, in particular neuronal, host cell system, a host organism or a

Cell extract, in particular an extract from neuronal cells, is provided, and

(b) one for observing the pip92-mediated function, in particular one for observing the

Apoptosis, cell growth, cell proliferation and / or cell plasticity of suitable parameters after adding a test compound compared to the control without adding a test compound for the host cell system obtained according to (a) or

Cell extract is measured in a suitable test system.

2. The method according to claim 1, characterized in that in step (b) the cleavage of the protein

PARP, staining of cells with annexin and / or an apoptosis signal is detected by FACS analysis.

3. The method according to claim 1 or 2, characterized in that the binding constant of

Test compound on pip92 is determined in vivo, in vitro or in silico.

4. The method according to any one of the preceding claims, characterized in that the binding site of the pharmaceutically active compound on the protein pip92 is determined by a suitable biochemical and / or structural biological method, in particular in a process step (c).

5. The method according to any one of the preceding claims, characterized in that ^" the 3-dimensional spatial structure of the compound identified according to process step (b) in the complex with the protein pip92 is determined and subsequently the chemical characteristics, in particular the steric arrangement of functional groups, their hydrophobicity , the hydrogen bond potential, etc., of this compound can be modified by in silico methods, in particular in a process step (d).

6. The method according to claim 5, characterized in that the process steps (a), (b), (c) and / or (d) are carried out iteratively, the objective function in particular being an optimization of the biological properties of the test compound.

7. The method according to any one of the preceding claims, characterized in that according to the method step

(a) a suitable host cell system, in particular neuronal host cells, is made available which is transfected with a pip92-expressing expression vector and, if appropriate, at least one expression vector which codes for at least one reporter gene.

8. The method according to any one of claims 1 to 6, characterized in that according to method step (a) a nematode that expresses pip92 or variants, for example fragments of pip92, is made available as a host organism and according to method step (b)

Changes in cell death in this transgenic host organism compared to the control can be detected.

9. Method for in vitro diagnosis of diseases that are caused by pip92-mediated malfunctioning

Signal cascades, especially apoptotic

Signal cascades are based, characterized in that

(a) a patient sample, for example in the form of a

Tissue sample obtained biopsy is taken and / or cells taken from patients are cultured in vitro

(b) one to observe the pip92-mediated

Function, in particular a parameter suitable for observing apoptosis, cell growth, cell proliferation and / or cell plasticity in comparison to the control for the sample obtained in (a) is measured in a suitable test system.

10. The method according to claim 9, characterized in that in step (b) the cleavage of the protein PARP, the staining of cells with annexin and / or an apoptosis signal is detected by FACS analysis.

11. A compound, characterized in that it is obtainable from a process according to one of the preceding claims 1 to 8.

12. A compound according to claim 11, characterized in that it modulates, in particular inhibits, the intracellular function of the pip92 protein, in particular the pip92-mediated apoptosis.

13. A compound according to claim 11 or 12, characterized in that it is an organic chemical compound with a molecular weight of preferably <3000, an antisense RNA, in particular an antisense RNA for the pip92 mRNA, an intrabody directed against pip92 or a ribozyme, in particular with activity against the pip92 mRNA.

14. Connection according to one of claims 11 to 13, characterized in that it passes through the cell membrane by diffusion or via membrane transport proteins.

15. A compound according to any one of claims 11 to 14 as a medicament.

16. Use of a compound according to any one of claims 11 to 14 for the treatment of (or for the manufacture of a medicament for the treatment of) tumor diseases, autoimmune diseases, in particular diabetes, psoriasis, multiple sclerosis, rheumatoid arthritis or asthma, viral infectious diseases (for example HIV) , degenerative diseases, in particular neurodegenerative diseases, for example Alzheimer's disease or Parkinson's disease, epilepsy or Muscular dystrophy, GvHD (e.g. liver, kidney or heart), ischemic infarction, especially stroke or heart attack, hypoxia and / or traumatic brain injury.

17. A composition containing at least one compound according to any one of claims 11 to 14, including pharmaceutically acceptable auxiliaries, carriers or additives.

18. A method for identifying a cellular interaction partner of the pip92 protein or a native allele, fragment or derivative thereof, using a so-called "yeast-two-hybrid" system or immunoprecipitation methods.