WO2003033737A1

WO2003033737A1 - Gene detection method using human mitochondrial dna

Info

Publication number: WO2003033737A1
Application number: PCT/JP2002/010640
Authority: WO
Inventors: Masashi Tanaka
Original assignee: Gifu International Institute Of Biotechnology
Priority date: 2001-10-17
Filing date: 2002-10-15
Publication date: 2003-04-24
Also published as: JP2003116576A

Abstract

It is intended to provide a gene detection method whereby an amino acid substitution advantageous or disadvantageous in the prolonged survive of humans is confirmed in mtDNA. A gene detection method with the use of human mitochondrial DNA characterized by, in a human mitochondrial DNA base sequence encoding cytochrome b, detecting substitution of a base with at least one amino acid substitution selected from among T2A, T2I, H16R, A39T, T47K, T61A, I78T, L82F, Y109H, T158A, D159N, I164V, D171N, A190T, A191T, A193T, F245L, P247A, G251S, N260D, L296M, I300T, I306V, I338V, V343M, S344N, A354T, I369V, I372V and A380T.

Description

0210640

Specification

Gene detection method using human mitochondrial DNA

The present invention relates to a method for detecting human mitochondrial DNA genes. Background art

Mitochondria are subcellular organelles found in eukaryotic cells that use the oxidative phosphorylation system within them to supply most of the energy needed for cell activity. In this mitochondria, it was revealed that there was a mitochondrial DNA independent of nuclear DNA (hereinafter abbreviated as “mt DNAj”). Has determined the entire base sequence of 16 and 569 base pairs of human mt DNA (Anderson, S., Bankier, AT, Barrell, Β. G., de Brui jn, Μ. Η. L. , Coulson, AR, Drouin, J., Eperon, IC, Nierlich, DP, Ror, BA, Sanger, F., Schreier, PH, Smith, AHH, Staden, R., & Young, IG: Sequence and organization of the Nature mitochondrial genome.Nature 290, 457-465, 1981. In this human mtDNA, a gene unique to mitochondria exists, and its correspondence has been clarified so far (Fig. 1). See).

On the other hand, it has been revealed from the results of molecular biological research that mutations in mt DNA are linked to specific diseases (Masatsugu Tanaka, molecular biology of mitochondrial electron transfer enzyme deficiency, biochemistry, 63 (3), 169-187, 1991, Wataru Sato, Kiyoshi Hayasaka, Yutaka Shoji, Tsutomu Takahashi, Goro Takada, Masahiro Saito, Osamu Fukuwa, and Eiko Wachi: A mitochondria 丄 tRNA mutation at 3, 256 associated with mitochondrial myopathy , encephalopathy, lactic acidesis, and stroke-like episodes (MELAS). BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL 33 (6), 1055-1061, 1994). For example, the present inventor thought that there might be a correlation between mt DNA mutations and adult diseases, and as a result of intensive studies, found that there was a certain correlation between specific mutations and adult diseases. The invention disclosed in Japanese Unexamined Patent Application Publication No. 11-11397 was made. By the way, in one of the four books, "Medium," Confucius (55 1-47, 79 BC) argues that "Medium of Kimiko, anti-medium of dwarfs." Aristotle (384-32-22 BC) also discusses such a concept of mediumness in Nicomachus ethics. On the other hand, population genetic analysis of the amino acid sequence of the protein defined by mt DNA suggests that most isolated amino acid substitutions within a species of an organism are weakly deleterious mutations. (Weinreich DM, & Rand DM Contrasting patterns of nonneutral evolution in proteins encoded in nuclear and mitochondrial genomes. Genetics 2000; 156: 385-99.).

However, there is not much data specifically analyzed in detail about the site and frequency of mutation of mtDNA.

The present invention has been made in view of the above circumstances, and an object of the present invention is to provide a gene detection method for confirming amino acid substitution in mtDNA. Disclosure of the invention

In the following description, unless defined otherwise, all technical and scientific words have the same meaning as is well understood by those skilled in the art to which this invention belongs. .

The inventor of the present invention has stated that, among centenarians (those who have a life expectancy of 99.1 years or older at full age), mitochondrial mutations are low, that is, centuries have genetically moderate. In order to test this hypothesis and to test this hypothesis, 64 people from 100 years old, 96 patients with Parkinson's disease, and 6 young adults (from 20 to 30 years old) 9 The following facts were clarified by determining the nucleotide sequence of the cytochrome b (cytochrome b) gene in mt DNA for each group of 6 people, comparing and examining the position and frequency of amino acid substitutions between each group. Basically, the present invention has been completed.

(1) A large number of individuals (49 people per 100 people, 75 young adults, 7 Parkinson's disease patients)

0), so-called “Revised Cambridge Standard Sequence” (Andrews RM, Kubacka I., Chinnery P. F. Lightowlers RN, Turnbull DM, Howell N. Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat. Genet 1999; 23: 147.) I didn't.

(2) However, nine different amino acid substitutions (H16R, A39T, I78T, I164V, A191T, N260D, I306V, V343M, and I369V) were confirmed in the centenarian group.

In this specification, two amino acids sandwiching a number mean one amino acid substitution. In that case, the first letter indicates the amino acid before substitution, and the second letter indicates the amino acid after substitution. The numbers indicate the positions at which the amino acid substitutions were made in the amino acid sequence of cytochrome b. For example, I306V means that the mutation is obtained by replacing isoleucine at position 306 with valine.

In the Parkinson's disease patient group, 21 different amino acid substitutions ² T2I, T47K, T61A, I78T, T158A, I164V, D171N, A190T, A193T, F245L, P247A, G251S, N260D, I300T, I306V, I338V , S344N, A354T, I369V, I372V). In the young adult group, 15 different amino acid substitutions (T2A, I78T, L82F, Y109H, D159N, I164V, A193T, G251S, N260D, L296M, I306V, I338V, I369V, I372V, A380T) were confirmed. Was done.

Of these, five amino acid substitutions (I78T, I164V, N260D, I306V, I369V) were commonly identified in all groups.

(3) Amino acid substitutions not detected in the 100-year-old group and commonly observed in the young adult group and the Parkinson's disease group were T2A + I338V and A193T + G251S + I372V ( When multiple amino acid substitutions are linked by "+", it means that those amino acid substitutions are concentrated in one human.) Only found in the Parkinson's disease patient group Amino acid substitutions were T2I, T47K, T61A, T158A, D171N, A190T, F245L, P247A, I300T, S344N, and A354T.

(4) N260D was found at a frequency of 6.25% (4/64) in the 100-year-old group, whereas it was 1 in both the young adult group (1/96) and the Parkinson's disease group (1/96). . Found at a frequency of 04%. The frequency of N260D (4/64) in the centenarian group was significantly higher than that of the other two groups (2/192) (odds ratio = 6.33, p = 0.036, Fisher's Direct method). (5) In contrast, the frequency of G251S replacement in the Parkinson's disease group (6/96) was significantly higher than that in the centenarian group (0/64) (p = 0.044, Fisher's direct method). The frequency of G251S replacement in other disease control groups (heart disease patients 19/593, 3.2%) was intermediate between that in the Parkinson's disease group (6.9%) and that in the centenarian group (0.0%).

From these results, the first invention for achieving the above object is a method for detecting a gene using human mitochondrial DNA, wherein the base sequence of the human mitochondrial DNA is encoded by its base sequence. It is characterized by detecting that a protein has been substituted with a base accompanied by amino acid substitution.

In the present invention, the “base sequence” often determines the base sequence of mt DNA as it is, but becomes 錄 type by determining the base sequence of complementary DNA or mRNA. It is also possible to determine the base sequence of mt DNA. It is also known to those skilled in the art that the genetic code of mt DNA includes non-universal codes (for example, UGA, a common stop codon, encodes tryptophan, and AUA (often encodes isoloisin). Note that) encodes Mechiyun.)

In the present invention, “base substitution” means that a specific base is substituted as compared with the so-called “revised Cambridge standard sequence”. However, it should be noted that base substitution does not necessarily involve amino acid substitution. In the genetic code, multiple types of triplets (three consecutive base sequences) encode one type of amino acid (or stop codon), so even if a base substitution occurs, the triplet after substitution will be This is because it may encode the same amino acid as before. In addition, in this specification, amino acids are represented by one-letter codes in principle.

According to a second aspect, in the first aspect, the base sequence encodes cytochrome b (SEQ ID NO: 1), wherein the amino acid substitution is T2A, T2I, H16R, A39T, T47K, T61A, I78T, L82F. , Y109H, T158A, D159N, I164V, D171N, A190T, A191T, A193T, F245L, P247A, G251S, N260D, L296M, I300T, I306V, I338V, V343M, S344N, A354T, I369V, I372V, and A380T Is unique And The amino acid substitutions described here are all the amino acid substitutions confirmed by the present inventors in the above three groups.

In a third aspect, in the first aspect, the base sequence encodes cytochrome b (SEQ ID NO: 1), wherein the amino acid substitution is T2A, T2I, T47K, T61A, L82F, Y109H, T158A, D159N. , D171N, A190T, A193T, F245L, P247A, G251S, L296M, I300T, I338V, S344N, A354T, I372V, and A380T. The amino acid substitutions described here exclude all 9 amino acid substitutions found in the 100-year-old group.

In a fourth aspect, in the first aspect, the nucleotide sequence encodes cytochrome b (SEQ ID NO: 1), wherein the amino acid substitution is T2I, T47K, T61A, ΤΙδδΑ, D171N, A190T, F245L, P247A. , I300T, S344N, and A354T. The amino acid substitutions described here are amino acid substitutions specifically found only in the Parkinson's disease patient group.

According to a fifth aspect, in the first aspect, the base sequence encodes cytochrome b (SEQ ID NO: 1), and the amino acid substitution is at least one of A193T, G251S, and I372V. It is characterized by being. The amino acid substitutions described here are characteristic of the amino acid substitutions commonly found in the young adult group and the Parkinson's disease patient group.

According to the present invention, it is possible to detect whether or not a base substitution for substituting an amino acid sequence at a specific site of a cytochrome b gene in mtDNA has occurred. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a genetic map of mtDNA.

FIG. 2 is a conceptual diagram showing a sequence method of mtDNA.

FIG. 3 is a diagram showing a molecular phylogenetic network of amino acid substitutions of cytochrome b in centenarians, young adults, and patients with Parkinson's disease. The lightly shaded circles in the figure indicate the number of individuals having a standard amino acid sequence or a common amino acid substitution. Open circles indicate amino acid substitutions found in centenarians, and filled circles indicate amino acid substitutions detected in Parkinson's disease patients or young adults. Circle face The product is proportional to the number of individuals (in parentheses), and the length of the bar is proportional to the value of Grantham.

FIG. 4 is a diagram showing a molecular phylogenetic network of amino acid substitutions of cytochrome b in centenarians, young adults, and patients with Parkinson's disease. Compared to FIG. 3, those having the same amino acid substitution in the three groups are shown as parameters (thin circles). Others are the same as in FIG. BEST MODE FOR CARRYING OUT THE INVENTION

Next, an embodiment of the present invention will be described in detail with reference to the drawings. However, the technical scope of the present invention is not limited by the following embodiment, and the gist thereof is not changed. However, various modifications can be made. The technical scope of the present invention extends to an equivalent range.

M t D by polymerase chain reaction (hereinafter referred to as “PCR method”)

The determination of the base system IJ of NA is performed, for example, by Masashi Tanaka, Mika Hayakawa, and Takayuki Ozawa, Automated Sequencing of Mitochondrial DNA, Methods in Enzymology,

Volume 264, 407-421, 1996. In this method, as shown in FIG. 2, after performing the PCR method twice, the second PCR product is directly sequenced by the PCR method.

In the first PCR method, L 1391 (SEQ ID NO: 3) and H 609 (SEQ ID NO: 4) using mtDNA as a template were used as templates.

GCCCGTCTAAACATTTTCAG) is used to amplify about 300 bp of DNA. This first PCR product contains the cytochrome b gene.

Next, using the first PCR product as a template, FL 2 (FL 1 4 5 5 9 (SEQ ID NO: 5: GTAAAACGACGGCCAGTCGACCACACCGCTAACAATC), FL 1 4 8 3 7 (SEQ ID NO: 6: GTAAAACGACGGCCAGTTGAAACTTCGGCTCACTCCT), FL 1 5 1 2 6 (SEQ ID NO: 7: GTAAAACGACGGCCAGTCCTTCATAGGCTATGTCCTC), FL 1 5 4 0 5 (SEQ ID NO: 8 GTAAAACGACGGCCAGTTCCACCCTTACTACACAATC), FL 1 5 6 9 6 (SEQ ID NO: 9 GTAAAACGACGGCCAGTTTCGCCCACTAAGCCAATCA), FL 1 5 0 8 GTAAAACGACGGCCAGTAGGACAAATCAGAGAAAAAG)) and H2 (H15162 (SEQ ID NO: 11: TACTGTGGCCCCTCAGAATG)), H15340 (SEQ ID NO: 12: ATCCCGTTTCGTGCAAGAAT), H155575 (SEQ ID NO: 13: ACTGGTTGTCCTCCGCAT) A second PCR method was performed using two primers, 1 60 16 (SEQ ID NO: 14: CCCATGAAAGAACAGAGAAT) and H81 (SEQ ID NO: 15: CAGCGTCTCGCAATGCTATC), and a DNA of about 500 bp to about 1 000 bp was obtained. Is amplified. Finally, the PCR method is used to determine the nucleotide sequence using the second PCR product as a template. The combination of the primers and the base sequence of the primer DNA when performing the PCR method are shown in Examples described later.

The obtained base sequence is compared and analyzed by, for example, a computer. In many cases, multiple base substitutions are found in the mtDNA sequences of centenarians, young adults, and patients with Parkinson's disease. However, not all of these base substitutions are accompanied by amino acid substitutions. For this reason, in particular, only base substitutions involving amino acid substitutions will be extracted and summarized for each group of centenarians, young adults, and Parkinson's disease patients. Further, sites where amino acid substitution in each group occurs particularly remarkably are specified. After the base substitution site that causes a specific amino acid substitution has been identified, a known method such as the Southern plot method, FISH method, RIGS method, CGH method, LOH method, direct sequence method, PCR-SSCP Gene detection can be performed by using the MASA method, MASA method, ASO probe method, PCR method, OPA method, etc. (BIOCLinica 10 (9), 1995, 18-23). Example

Next, the present invention will be described with reference to examples, but the present invention is not limited to these examples.

Example 1: Extraction of total DNA sample

All DNAs used Takara Shuzo's “Ge n Toru-kun”. A brief description of the method is as follows. To a 1.5 ml microtube, 11 1 Ge 1 solution in a 500 zl kit and 100 / xl of blood were added and immediately stirred for several seconds. After standing at room temperature for 10 minutes or more, centrifugation was performed at room temperature at 12, OOOx g or more for 5 minutes. Take the supernatant And 1 ml of Gen TLE solution II in the kit was added to the precipitate. After inverting and mixing the microtube, the mixture was centrifuged at room temperature over 12, OOOx g for 2 minutes, and the supernatant was removed. To the precipitate, 500 // I Gen TLE solution III in the kit was added and stirred for 10 seconds. The mixture was centrifuged at room temperature at 12, OOOxg or more for 5 minutes, and the supernatant was transferred to a new microtube. Add 500 / zl of isopropanol to the supernatant, mix by inversion, centrifuge at 4 ° C, 12, OOOxg for 5 minutes, remove the supernatant, wash the precipitate with 70% ethanol, and dry in a vacuum dryer. And dried. Total DNA was dissolved in 50 μl of TE buffer (10 mM Tris-HC1 ρΗ 8.0, 1 mM EDTA).

Example 2: Confirmation of the nucleotide sequence of the gene encoding cytochrome b in mtDNA of centenarians, young adults and patients with Parkinson's disease

The nucleotide sequence of the gene encoding cytochrome b was confirmed in the mtDNA of centenarians (64), young adults (96), and patients with Parkinson's disease (96). For those who live in Tokyo, Aichi and Gifu, blood cells or mucosal cells are collected from the people who have given their consent, and the total DNA is extracted. The sequence was confirmed. The DNA sequence was performed as follows based on the method reported in the above-mentioned Methods in Enzymology, Volume 264, 407-421, 1996. Table 1 shows the combinations of the primers DNA used in the first and second PCR methods.

—Second PCR Second PCR readable area

L 1 H 1 chain length FL 2 H 2 chain length start end

L13901 H609 3297 FL14559 H15162 641 14580 14979

FL14837 H15340 541 14858 15257

FL15126 H15745 667 15147 15546

FL15405 H16016 649 15426 15825

FL15696 H81 992 15717 161 16

FL15948 H81 740 15969 16368 In the first PCR, total DNA was used as a template, and L1 and HI were used as primers. Used as The composition of the reaction solution is as follows. 1 1 total DNA (lOng /, 1), 51 L1 (10 / Μ), 51 H1 (10 / zM), 41 2.5 mM dNTPs, 0.25 x 1 5 units // ζ 1 Taq DNA polymerase, 5 / z 1 10x PCR buffer (100 mM Tris-HC1, pH 8.3, 500 mM KC1, 15 raM MgCl ₂ ), add 29.75 / il purified water to make a total volume of 50 μΐ. Mix in a 0.2-ml MicroAmp tube. This reaction solution was subjected to a PCR method using GeneAmp PCR system Model 9600 manufactured by PerkinElmer Inc. The reaction conditions were: denaturation at 94 ° C for 15 seconds, annealing at 60 ° C for 15 seconds, 72. The cycle of elongation for 185 seconds at C was defined as one cycle, and 40 cycles were repeated. After adding 5 μl of 3M sodium acetate ( _Ρ 7.4) and 100 AiL of ethanol to the reaction solution, the mixture was allowed to stand on ice for 10 minutes, and centrifuged at 13,000 × g at 4 ° C. for 10 minutes. Precipitate 150 µl of 70 ° /. After washing with ethanol, the mixture was centrifuged at 13,000 xg for 5 minutes at 4 ° C. After the precipitate was dried for 10 minutes, it was dissolved in 50 // 1 purified water or TE (10 mM Tris-HCl, pH 8.0, 1 raM EDTA).

In the second PCR, the first PCR product was used as a template, and FL 2 and H 2 were used as primers. The composition of the reaction solution is as follows. 1 μl of the first PCR product solution, 2 μl of FL2 (10 μΜ), 2 μl of Η2 (10 μΜ) ヽ 1.6 1 of 2.5 mM dNTP, 0.1 μ1 of 5 units / μ1 rTaq DNA The polymerase and 2 μl of 10 × PCR buffer were mixed with 11.3 / zl of purified water to make a total volume of 20/1 in a 0.2-ml MicroAtnp tube. The reaction conditions of the PCR method were as follows: thermal denaturation (94 ° C-15 seconds), annealing ( ⁶⁰ ° C-I ⁵ seconds), extension reaction (72 ° C-3 minutes), and 40 cycles. . The final extension reaction was performed at 72 ° C for 10 minutes. After adding 1.5 / X 1 of 3 M sodium acetate (pH 7.4) and 30 / xl of ethanol to the reaction solution, the mixture was allowed to stand on ice for 10 minutes, and centrifuged at 13,000 xg for 10 minutes at 4 ° C. The precipitate was washed with 451 70% ethanol and centrifuged at 13,000 xg for 5 minutes at 4 ° C. After the precipitate was dried for 10 minutes, it was dissolved in 10 / il of purified water.

The sequence reaction was performed as follows.

(1) Purification of template

The primer and dNTP were removed by an ultrafiltration method using PCR Screen (for Millipore 96iell). 280 μl of sterile water was added to the second PCR product (20 μΐ) to make 300 μL, and the mixture was dispensed into MultiScreen_PCR Plate. PCR plate to multi-stareenba The sample was attached to a vacuum manifold, aspirated at 24 inches Hg for 10 minutes, and subjected to ultrafiltration. 100 L of sterile water was dispensed into a PCR plate, shaken vigorously with a mixer for 5 minutes, and then transferred to a new PCR tube.

(2) Sequence reaction

A premix optical terminator (DNA Sequencing Kit, BigDye ™ Terminator Cycle Sequencing Ready Reaction, ABI PRISM, PE Applied Biosystems, Japan) was used. A second time of the PCR product 2 _mu 1 after ultrafiltration, 2 / zl of Pretnix μ ΐ, - 21M13 Forward Primer (0.8 pmol / μ 1) 4 z 1, 5 X Sequence Buff er 2 1, sterile water 8 mu ΐ was added to bring the total volume to 20 l. After the first heat denaturation (96 ° C-10 minutes), one cycle of heat denaturation (96 ° C-10 seconds), annealing (50 ° C-5 seconds), and extension reaction (60 ° C-4 minutes) This was repeated 25 cycles.

(3) DyeTerminator removal

Gel filtration (for 96iell) dried Sephadex G50 Superfine was packed into the well of a multi-screen HV plate using a 45 L column loader. To swell the Sephadex, sterile water at 300 / zL was added to the wells and left at room temperature for 3 hours. ^The multi-screen HV plate was placed on the ⁹⁶ -well plate and centrifuged at 740 Xg for 6 minutes. The Sequence reaction solution was gently added to the center of the well. The Ma / ReciScreen HV plate was placed on top of eight GeneAmp Strip Tubes (8-tubes / strip) and centrifuged at 740X for 6 minutes. Eight GeneAmp Strip Tubes were dried in a centrifugal vacuum drier for 50 minutes. The dried sample was stored frozen, protected from light by an aluminum wheel or the like.

(4) DNA Sequencing

Twenty one Template Suppression Reagent (TSR) was added to eight GeneAmp Strip Tubes containing Sequence Reaction Product S and left at room temperature for 10 minutes. Vortex mixer was applied well and spun down. After heating at 95 ° C for 2 minutes, the sample was immediately quenched on ice (10 minutes). Samples in eight GeneArap tubes were run on ABI PRISM ™ 310 Genetic Analyzer to determine the nucleotide sequence.

Example 3: Analysis of amino acid substitution in each group of centenarians, young adults, and Parkinson's disease patients

The gene encoding cytochrome b in mt DNA was obtained by the method described in Example 2. After determining the nucleotide sequence of the offspring, the nucleotide substitution and amino acid substitution were analyzed. Tables 2 and 3 show the presence or absence of the confirmed base substitution and amino acid sequence substitution. The meaning of the table is as follows. For example, the substitution on the first line in Table 2 shows that the adenylate (A) at position 14750 of mitochondrial DNA is replaced with guanine (G), and that the base substitution is made with the threonine of the second amino acid of cytochrome b. It means that it is an amino acid substitution to be replaced with an araen (ie, “T 2 A” described above).

Table 2

i 14,7 e50 t A j TS Cytb 2 Thr Ala nsyn con

14,751 C T TS Cytb 2 Thr lie nsyn con

—One

14,793 A G TS Cytb 16 His Arg nsyn var

14 86) G A TS Cytb 39 Ala Thr nsyn var

】 4 886 C A TV Cytb 47 Thr Lys nsyn con

14,927 A G TS Cytb 61 Thr A, lansyn con

14,979 T C TS Cytb 78 lie Thr nsyn var

14,990 c T 1 S Cytb o eu rne nsyn var

1 Cytb nn Tyr HIS nsyn var

A C Q

VJ then Onr Ala.nsyn con

1 Δ Δ 150 A en Asn n mcvyfl var

15,236 A G TS Cytb 164 lie Val nsyn con

15,257 G A TS Cytb 171 Asp Asn nsyn con

15,314 G A TS Cytb 190 Ala Thr nsyn var

15,323 G A TS Cytb 193 Ala Thr nsyn var

15,479 T C TS Cytb 245 Phe Leu nsyn con

15,485 C G TV Cytb 247 Pro Ala nsyn con

15,497 G A TS Cytb 251 Gly Ser 'nsyn con

15,524 A G TS Cytb 260 Asn Asp nsyn con

15,632 C A TV Cytb 296 Leu Met nsyn var

15,645 T C TS Cytb 300 lie Thr nsyn var

15,662 A G TS Cytb 306 lie Val nsyn var

15,758 A G TS Cytb 338 lie Val nsyn con

15,773 G A TS Cytb 343 Val Met nsyn con

15,777 G A TS 344 Ser Asn nsyn var

15,806 G A TS Cytb 354 Ala Thr nsyn con

15,851 A G TS Cytb 369 He Val nsyn var

15,860 A G TS Cytb 372 He Val nsyn var

15,884 GA TS Cytb 380 Ala Thr nsyn var

ε

Zl

0l790l / Z0df / X3d FIGS. 3 and 4 visually show the amino acid substitutions in each group. Of these, Fig. 3 shows the amino acid substitutions confirmed in each of all groups, while Fig. 4 shows the amino acid substitutions confirmed in all three groups in the population. ing. Therefore, it is convenient to refer to Fig. 4 to confirm the amino acid substitution characteristic of each group.

As shown in Fig. 3 (A), nine different amino acid substitutions were found in the centenarian group, whereas the young adult group (Fig. 3 (B)) and the Parkinson's disease group In Figure 3 (C), 15 and 21 amino acid substitutions were found, respectively. The majority of the individuals (49/64 in the 100-year-old group, 75/96 in the young adult group, 70 in the Parkinson's disease group and Z96) compared with the so-called “revised Cambridge Standard Sequence”. And had no amino acid substitutions.

In addition, five amino acid substitutions (I78T, I164V, N260D, I306V, I369V) were commonly observed in three groups. H16R, A39T, A191T, and V343M were found individually in the 100-year-old group. In the young adult group, seven amino acid substitutions were found that were not detected in the centenarian group. T2A + I338V, Y109H, D159N, L296M and A380T were found in one individual, A193T + G251S + L82F in one individual, and A193T + G251S + I372V in two individuals.

In order to quantify the degree of deviation from the standard amino acid sequence, the standard amino acid was changed according to the value reported by Grantham (Grantham R. Amino acid difference formula to help explain protein evolution. Science 1974; 185: 862-4.). The sum of physicochemical differences between amino acids was calculated for each individual. However, amino acid substitutions commonly found in the three groups were excluded from this calculation. The deviation from the standard amino acid sequence in the 100-year-old group (Grantham values: 58, 58, 29, and 21 was 1 for each individual and ^{60 for 60} individuals) was the deviation ⁴³ , 143, 136, and 87 for the young adult group. , 83, 58, 23, and 15 were statistically significantly less than 0 for one individual and 88 individuals (P <0.0001, Wald-Wolfowitz run test).

Not detected in centenarians group, and Amino acid substitutions observed in common have you young adults group and a Parkinson's disease patient group T2A + I338V and A193T + G ² 51S + I372V der ivy. Amino acid substitutions found only in the Parkinson's disease group were T2I, {47}, T61A, T158A, D171N, A190T, F245L, P247A, I300T, S344N, and A354T. Degree of deviation from the standard amino acid sequence in the Parkinson's disease patient group (Grantham value: 143 for 5 individuals, 114, 89, 89, 87, 78 for 1 individual, 58 for 5 individuals, 46, 29, 27, 27, 23, 22 is 1 for each individual and 0 for 75 individuals) is statistically significantly larger than the deviance in the centenarian group (p <0.0001, Wald-Wowowitz run test p = 0.000). ⁵⁸ , Mann-Whitney's U test), and was greater than the deviance in the young adult group (p <0.0001, Wald-Wolfowitz's run test and p = 0.0097, Mann-Whitney's U test).

Next, the amino acid substitution found in each group at a frequency of 5% or more was statistically analyzed. N260D was found at a frequency of 6.25% (4/64) in the 100-year-old group, whereas it was found in both the young adult group (1/96) and the Parkinson's disease group (1/96). Found at a frequency of 04%. N260D frequency in centenarians group (4/64) was significantly higher than the frequency (2/192) in the other two groups (Ozzu ratio ^{^{= 6. 3 3, p =}} 0. 036, direct method of Fisher) . These observations suggest that having the N260D substitution can lead to longevity, but its functional effects require further investigation.

In contrast, the frequency of G251S replacement in the Parkinson's disease group (6 /%) was significantly higher than the frequency in the perpetual group (0/64) (p = 0.044, Fisher's direct method). The frequency of G251S replacement in other disease control groups (heart disease patients 19/593, 3.2%) was the frequency in the Parkinson's disease group (6.9%) and the frequency in the centenarian group (0.0%). Was in between.

Deviations from the standard amino acid sequence, such as the G251S substitution, are associated with increased production of reactive oxygen species from mitochondria, which can lead to age-related diseases. The amino acid residue Gly251 is highly conserved in mammalian species. Gly251 is located at the outer binding site (Qo site) of ubiquinone in cytochrome b protein, and is located near Glu271 residue, which plays an important role in binding to ubiquinone. When Gly251 is replaced by Ser, Ser may form a hydrogen bond with Glu271. If this restricts the movement of Glu271, it is assumed that the binding of ubiquinone to the Qo site will change. These findings suggest that G251S substitution is disadvantageous for long-term survival. The present inventors have already reported that genotype Mt5178A is found at high frequency in Japanese centenarians (Tanaka M, Gong JS, Zhang J, Yoneda M, Yagi K. Mitochondrial genotype assoc iated with longevity Lancet 1998; 351: 185-6.) ₀ On the other hand, Ivanova et al. (Ivanova R, Lepage V, Charron D, Schachter F. Mitochondrial genotype associated with French Caucasian centenarians. Gerontology 1998; 44: 349.) has the genotype Mt9055A. It reports that it was found frequently in the centenarians in France. Low deviations from the standard amino acid sequence may be a common phenomenon among Asian and European centenarians who differ in genotype. In conclusion, gaining at least a moderate level of cytochrome b amino acid sequence is an important genetic factor for longevity.

At least the following two points can be inferred from the research in this specification. First, the variety of amino acid substitutions found in the young adult population means that these substitutions have little effect on the survival of the individual until maturity and the transmission of its genome to the next generation. ing. Second, the fact that certain amino acid substitutions are absent in centenarians and present in Parkinson's patients has the effect that these amino acid substitutions are disadvantageous for long-term survival and predispose to adult-onset disease. It has to have.

Claims

The scope of the claims

1. Gene detection using human mitochondrial DNA, characterized by detecting that the base sequence of human mitochondrial DNA has been replaced by a base with amino acid substitution in the protein encoded by the base sequence. Method.

2. The nucleotide sequence encodes cytochrome b (SEQ ID NO: 1), wherein the amino acid substitution is T2A, T2I, H16R, A39T, T47K, T61A, I78T, L82F, Y109H, T158A, D159N, I164V, D171N, A190T, A191T, A193T, F245L, P247A, G251S, N260D, L296M, I300T, I306V, I338V, V343M, S344N, A354T, I369V, I372V, and A380T A method for detecting a gene using the human mitochondrial DNA according to claim 1.

3. The nucleotide sequence encodes cytochrome b (SEQ ID NO: 1), wherein the amino acid substitution is T2A, T2I, T47K, T61A, L82F, Y109H, T158A, D159N, D171N, A190T, A193T, F245L, P247A. 2. The method for detecting a gene using human mitochondrial DNA according to claim 1, wherein the gene is at least one of G, S251, L296M, I300T, I338V, S344N, A354T, I372V, and A380T.

4. The base sequence encodes cytochrome b (SEQ ID NO: 1), and the amino acid substitution is selected from T2I, T47K, T61A, T158A, D171N, A190T, F245L, P247A, I300T, S344N, and A354T. 2. The method for detecting a gene using human mitochondrial DNA according to claim 1, wherein the method is at least one of the following.

5. The base sequence encodes cytochrome b (SEQ ID NO: 1), and the amino acid substitution is at least one of A193T, G251S, and I372V. 2. The method for detecting a gene using the human mitochondrial DNA according to 1.