WO2003020745A2 - Generic, parallel and scaleable protein purification - Google Patents

Abstract

The present invention relates to a method of separating a ligand comprised within a mixture comprising the steps of: (a) immobilizing a fusion protein on a matrix, said fusion protein comprising (i) an antibody fragment moiety having a specificity for said ligand and (ii) an affinity domain moiety that attaches to the matrix to form a matrix-fusion protein complex; (b) contacting said mixture with said matrix-fusion protein complex; (c) removing components of said mixture not binding to the antibody fragment moiety of said matrix-fusion protein complex; and (d) eluting said ligand from said matrix-fusion protein complex. The invention furthermore relates to fusion proteins comprising two or more chitin-binding domains, to uses thereof, and to affinity chips and their application.

Description

Generic, Parallel and Scaleable Protein Purification

The present invention relates to a method of separating a ligand

comprised within a mixture comprising the steps of: (a) immobilizing a fusion protein

on a matrix, said fusion protein comprising (i) an antibody fragment moiety having a

specificity for said ligand and (ii) an affinity domain moiety that attaches to the

matrix to form a matrix-fusion protein complex; (b) contacting said mixture with said

matrix-fusion protein complex; (c) removing components of said mixture not binding

to the antibody fragment moiety of said matrix-fusion protein complex; and (d)

eluting said ligand from said matrix-fusion protein complex.

The invention furthermore relates to fusion proteins comprising two or

more chitin-binding domains, to uses thereof, and to affinity chips and their

application.

Because of its high affinity and selectivity, immunoaffinity chromatography

(IAC; Cutler, 1996; Jack, 1996; Jones, 1995; Sii & Sedana, 1991) could be in

principle of great value in the rapid purification of proteins to high degrees of purity.

The antibody could be used as an affinity matrix in a one-step purification of natural

proteins or be used in conjunction with methods based on peptide tags for the

isolation of recombinant proteins (Ford et al., 1991; Nilsson et al., 1997). Further,

the antibody may be directed against the peptide tag itself, thereby using the same

tag twice in an orthogonal manner, as each column will remove other impurities.

However, because of the large investment of time and effort and, thus, cost in

generating monoclonal antibodies (mAb) and producing them at the scale required,

IAC has only rarely been used in the purification of proteins on mg scales. As the mAb will normally be covalently coupled to expensive chemically activated column material, the use of a fresh column for each experiment, even though desirable,

would be prohibitive in terms of labor and cost.

Recently, progress in display technologies such as phage display (Smith &

Scott, 1993; Winter et al., 1994), ribosome display (Hanes et al., 2000; Plϋckthun et

al., 2000), the protein fragment complementation assay (PCA; Mόssner et al., 2001)

as well as the availability of antibody libraries (Knappik et al., 2000; Vaughan et al.,

1996) as a source for virtually all antibodies has solved the problem of obtaining

recombinant antibodies with the desired specificity. Therefore, IAC with antibody

fragments, e.g. scFv fragments, which take advantage of modern library

technologies and which can be easily expressed and purified in E coli in large

amounts, would be particularly attractive for the parallel purification of proteins for

proteomics projects. However, no convenient method has been described for

immobilizing the recombinant antibody fragments. Random crosslinking (Arnold-

Schield et al., 2000; Berry et al., 1991; Berry et al., 1993; Molloy et al., 1995) to the

columns may obstruct the binding site, and the smaller the fragment, the larger the

chance that the most reactive group may be positioned by chance such that it

interferes with antigen binding. The directed immobilization strategies of mAbs

(Turkova, 1999) rely on their Fc parts, e.g. coupling via their carbohydrate moieties

or coupling by first binding to protein A or protein G columns, followed by crosslinking. Evidently, these methods cannot be applied to recombinant antibody fragments.

There are several approaches for immobilizing recombinant antibody

fragments reported in the literature. Most of them use chemically activated matrices (Arnold-Schield et al., 2000; Berry et al., 1991; Berry et al., 1993; Molloy et al.,

1995), with all the problems described above for mAbs. Streptavidin matrices

(Kleymann et al., 1995; Weiss et al., 1994), which are rather expensive, as

streptavidin itself has to be purified and chemically coupled to an activated matrix,

have been used either with a tag which is biotinylated in vivo, but only 15% of the

Fab fragment was biotinylated, leading to a low yield of immobilized molecules. If

instead a weak-binding purely peptidic tag (Strep tag) is used (Kleyman et al., 1995),

more functional molecules can be immobilized, but the whole complex of Fv fusion

protein and antigen is eluted by biotin, thus requiring a second purification step,

dramatically adding to the cost of using such columns on a large scale.

Thus, the technical problem of the present invention is to provide a

general approach for quickly purifying a protein from a complex mixture in a one-

step procedure.

The solution to this technical problem is achieved by providing the

embodiments characterized in the claims. The technical approach of the present

invention, an affinity chromatography method wherein the ligand of interest can be

eluted from the ligand-antibody complex in a one-step procedure, is neither provided

nor suggested by the prior art.

Thus, the present invention relates to a method of separating a ligand

comprised within a mixture comprising the steps of: (a) immobilizing a fusion protein on a matrix, said fusion protein comprising (i) an antibody fragment moiety having a

specificity for said ligand and (ii) an affinity domain moiety that attaches to the

matrix to form a matrix-fusion protein complex; (b) contacting said mixture with said matrix-fusion protein complex; (c) removing components of said mixture not binding to the antibody fragment moiety of said matrix-fusion protein complex; and (d)

eluting said ligand from said matrix-fusion protein complex.

Accordingly, the present invention relates to the use of the fusion protein

in the purification of a ligand. Preferably the present invention relates to the use of

said fusion protein in the method of separating a ligand from a mixture according to

the present invention. In a preferred embodiment of the present invention, the

fusion protein is expressed in E coll

The term "mixture" refers to a situation wherein the ligand of interest is

not present in pure form, but associated with one or more other molecules,

compounds or impurities, for example in a solution or in solid form.

The term "antibody" is used as a synonym for immunoglobulin. Antibody

fragments according to the present invention may be Fv (Skerra & Plϋckthun, 1988),

scFv (Bird et al., 1988; Huston et al., 1988), disulfide-linked Fv (Glockshuber et al.,

1992; Brinkmann et al., 1993), Fab, (Fab')₂ fragments, single V_H domains or other

fragments well-known to the practitioner skilled in the art, which comprise at least

one variable domain of an immunoglobulin or immunoglobulin fragment and have

the ability to bind to a target. Particularly preferred is the scFv fragment format.

In the context of the present invention, the term "binding specificity"

refers to the ability of an antibody or antibody fragment to discriminate between a

ligand of interest and one or more control molecules. Thus, "binding specificity" is

not an absolute, but relative parameter. One way of determining "binding

specificity" is to compare binding of an antibody fragment to the ligand of interest

with binding to a set of unrelated controls, such as BSA, KLH, milk powder, albumin

and lysozyme. However, "binding specificity" may also relate to the ability of an antibody or antibody fragment to discriminate between a ligand of interest and a

closely related homologous molecule as control. The assays used for determining

"binding specificity" may have different formats well-known to one of ordinary skill in

the art. For example, conventional ELISA techniques may be employed, wherein an

optical density read-out for binding to the ligand of interest, which is greater by more

than the standard deviation than the read-out for binding to the control, may be

considered to represent "binding specificity". Preferably, the optical density is at

least two times, or more preferably at least five times, greater than the mean optical

density of binding to the control. Other assays known in the art may also be used to

determine specific binding.

In the context of the present invention, the choice of an appropriate

"binding specificity" of the antibody fragment will depend on the complexity of the

mixture being used. For separation of a given ligand from a mixture containing a

whole variety of unrelated molecules, an antibody fragment may be used which

exhibits "binding specificity" when compared to a set of unrelated control molecules.

When a separation of closely related molecules is required, the antibody fragment

being used preferably exhibits "binding specificity" for the ligand of interest when

compared to these closely related molecules. The successful use of an antibody

fragment with appropriate "binding specificity" can be determined by analyzing the

purity of the ligand being obtained, which should preferably exceed 80%, more

preferably 90%, and most preferably 95%.

In the context of the present invention, the term "antibody fragment

moiety" refers to a moiety, or part, of the fusion protein, which comprises at least a

functional fragment of an antibody. A "functional fragment" refers to a fragment of an antibody comprising at least a variable domain having the ability to bind to a

corresponding binding partner. Such a corresponding binding partner may be called

antigen. In the context of the present invention, the corresponding binding partner

for the antibody fragment moiety may be the ligand, or it may be a part of the

ligand..

In the context of the present invention, the term "ligand" describes a

molecule of interest, at least part of it being a corresponding binding partner for the

antibody fragment moiety. A ligand according to the invention can be a protein,

wherein the antibody fragment moiety has specificity for that protein. As a further

example, a ligand according to the present invention can be a protein comprising an

affinity tag, such as a his-tag, wherein the antibody fragment moiety has specificity

for the affinity tag. A his-tag is a peptidic tag comprising at least five consecutive

histidine residues (Hochuli et al., 1988; Lindner et al., 1992).

In a preferred embodiment, the antibody fragment is a single chain Fv

(scFv) fragment.

In another preferred embodiment, the antibody fragment is a

miniantibody. In the context of the present invention, the term "mini-antibody"

refers to multimeric antibody fragments, e.g. dimers, comprising two or more

antibody fragments, each fused to a self-associating domain (Pack & Plϋckthun,

1992; Pack et al., 1993; Pack, 1994).

In the context of the present invention, the term "affinity domain moiety" refers to

another moiety, or part, of the fusion protein, comprising a (poly)peptide/protein

that is able to tightly interact with a matrix.

Examples for such an affinity domain moiety include, but are not limited to, maltose binding protein (MBP), protein A, cellulose binding domain, a polypeptide including a

His-Tag, or a sufficiently long portion of a polypeptide such that affinity binding

characteristics of the affinity domain can be used to immoblize the fusion protein to

the matrix via said affinity domain. Examples of affinity domains and suitable

matrices that can be used as a solid support for the immobilization of a fusion

protein are known to one of ordinary skill in the art and can be found, e.g. in various

reviews occurring in the Journal of Biochemical and Biophysical Methods (J Biochem

Biophys Methods 2001 Oct 30; 49, (1-3). The fusion protein may contain an affinity

domain as a first moiety and, for example, an antibody fragment as a second moiety.

In this context, "tightly interact" means, that the affinity of said affinity domain

moiety to the matrix, as described by its K_D, is < 10^"6, preferably < 10^"7, more

preferably < 10^~8, and most preferably < 10^"9. K_D is measured in units of moles per

liter. The smaller the value of the dissociation constant K , the stronger is the

binding between two molecules, e.g. the affinity domain to the matrix.

In yet a further preferred embodiment, the affinity domain comprises one

or more carbohydrate-binding domains. Thereby, one is able to bind such fusion

proteins to, e.g., cellulose or chitin and to immobilize the fusion proteins to matrices

comprising such carbohydrates. Up to now, these methods have been used only to

purify the fusion with the protein of interest on a carbohydrate column with

subsequent cleavage of the partners (Chong et al., 1997; Shpigel et al., 1998), or

simply to immobilize proteins (Ramirez et al., 1993; Shpigel et al., 1999).

Preferably, the carbohydrate-binding domain is a chitin-binding domain

and wherein said matrix consists of immobilized chitin. The chitin-binding domain can be a modified variant of a wild type chitin-binding domain, wherein a free cysteine is exchanged by an alanine or a serine. In a yet further preferred

embodiment, the affinity domain of the present invention is part of a chitinase from

Bacillus circulans WL-12.

In yet another preferred embodiment, the affinity domain moiety of the

fusion protein comprises two or more chitin-binding domains. Most preferably the

present invention relates to a fusion protein comprising 2 to 4 chitin-binding

domains.

Preferably, the fusion protein is immobilized to said matrix directly out of a

crude extract. In the context of the present invention, the term "crude extract"

refers to an extract obtainable by whole cell lysis. Further preferred, the fusion

protein is purified prior to immobilization to said matrix. In the context of the

present invention, the term "matrix" refers to a stationary phase, such as a solid

phase material, which provides the structural support and the affinity domain

interaction sites for the immobilization of the fusion proteins.

In a preferred embodiment of the present invention, the elution of said

ligand from said matrix-fusion protein complex is achieved by a pH shift. The "pH" is

a measure of acidity and alkalinity of a solution that is a number on a scale on which

a value of 7 represents neutrality and lower numbers indicate increasing acidity and

higher numbers increasing alkalinity and on which each unit of change represents a

tenfold change in acidity or alkalinity and that is the negative logarithm of the

effective hydrogen-ion concentration or hydrogen-ion activity in gram equivalents per

liter of the solution. pH shift, accordingly, refers to an experimental step, wherein a

change of the pH is achieved by either the addition of solutions with a higher or lower pH as compared to the conditions employed in the "mixture-matrix contacting"

and "non-bound component removing" (i.e., washing) steps, so that the specific

interaction between the antibody fragment and the ligand is destroyed, and the

interaction of the affinity domain with the matrix remains intact.

The specific elution of the ligand from the matrix-fusion protein complex

can be achieved under alkaline or acidic conditions. For alkaline elutions, the pH is

preferably around 10. Most preferably the pH is at 10. For acidic elutions, the pH is

preferably around 3.2 or around 2, depending on interaction between the ligand and

the antibody fragment.

In another aspect, the present invention relates to an affinity chip for the

identification of one or more ligands from a mixture. A chip may comprise a

substrate and a set of immobilized fusion proteins, as described herein. Each fusion

protein may contain an antibody fragment moiety out of a set of different antibody

fragments with specificities for a set of different ligands. The other moiety of the

fusion protein can be an affinity domain moiety. In this regard, the fusion protein is

attached to the substrate of said chip via said affinity domain moiety.

In the context of the present invention, the term "affinity chip" refers to a

substrate upon which at least one, and often a plurality of, probe chemicals such as

oligonucleotides or antibody fragments, are adherent. The terms "affinity chip" and

"biochip" are used as synonyms. A biochip is useful for analysis of sample fluids

using a method according to the invention. Target components of the sample fluid that react with complementary probes on the biochip can thereby be detected;

biochips with an array of probe chemicals thereupon allow simultaneous screening of

samples for a variety of target components. The possibility of specific elution of the ligand bound to the matrix-fusion

protein complex does not only enable the recovery of the ligand according to the

method of the present invention, but additionally allows the recovery of the matrix-

fusion protein complex for further use. In the case of an affinity chip according to

the present invention, this leads to the possibility of being able to reuse the chip

after specific elution of the ligands, thus reducing the cost of using such biochips on

a large scale.

Particularly preferred is an affinity chip having a set of fusion proteins,

wherein each member of said set of fusion proteins is coupled to the chip at a

spatially addressable position. By knowing the position of every specific fusion

protein and its binding specificity, a simple read-out can be performed after having

determined those positions on the affinity chip, where specific binding to the fusion

protein have occurred.

In another aspect, the invention relates to a method for the parallel

detection of one or more ligands in a mixture by using an affinity chip according to

the present invention, comprising the steps of:

a) contacting said mixture with said affinity chip, wherein said affinity chip

comprises a set of fusion proteins, and wherein said each of said fusion proteins

comprise an antibody fragment moiety;

b) removing the components of said mixture not binding to the antibody

fragment moiety of said fusion proteins; and

c) identifying one or more ligands bound to said affinity chip. The present invention relates to a fusion protein comprising two or more chitin-

binding domains.

The present invention also relates to a nucleic acid sequence encoding a

fusion protein according to the present invention. The term "nucleic acid molecules"

refers to RNA or DNA molecules, either single stranded or double stranded. In

another aspect, the present invention relates to a vector comprising a nucleic acid

sequence according to the present invention.

Furthermore, the present invention relates to host cells comprising a

nucleic acid sequence according to the present invention, or a vector according to

the present invention. A host cell may be any of a number systems commonly used

in the production of proteins, including but not limited to bacteria, such as E. coli

(see. e.g., Ge et al, 1995) or Bacillus subtilis (Wu et al., 1993); fungi, such as yeasts

(Horwitz et al., 1988; Ridder et al., 1995) or filamentous fungus (Nyyssδnen et al.,

1993); plant cells (Hiatt, 1990, Hiatt & Ma, 1993; Whitelam et al., 1994); insect cells

(Potter et al., 1993; Ward et al., 1995), or mammalian cells (Trill et al., 1995).

Although the present invention has been described for the use of antibody

fragments for the separation of a ligand from a mixture, the invention is not limited

to antibodies, but additionally can be used with any molecule with binding

specificities for a ligand, provided that the interaction between such molecule and its

ligand allows the specific elution of said ligand as described in the present invention.

Examples for molecules include, but are not limited to, receptors or functional

fragments thereof, ankyrin-type repeat molecules, leucine-rich repeat (LRR) molecules or lipocalins.

The present invention can be further understood with reference to the following examples. These examples are illustrative and, hence, are not intended to

limit the scope of the invention.

Example

In the following example, all molecular biology experiments are performed according

to standard protocols (Ausubel et al., 1999).

Construction and expression of CBD-fusion proteins

Plasmid construction

The plasmids for the periplasmic expression of scFv-CBD fusion proteins (Fig. 5) are

based on the pAK-sehes (Krebber et al., 1997). The dHLX-part of ρAK500 was replaced

by a linker-CBD-fragment via EccRl and Hindlll. The linker-CBD-fragment was

amplified out of the plasmid pTYBl using the primers CBD5' _Avήl and CBD3'_/V 7eI.

CBD5^*_^iI: 5'-

CATCCGGAATTCGGCGGTGGCTCCGAAGGCGGTGGCAGCGAAGGTGGCGGCCTAGGCACCAC

AAATCCTGGTG-3' contained the linker sequence (SGAEFGGGSEGGGSEGGGLG)

including an EccRl- and an Avrll-stie. CBD3'_/VΛeI: 5'-

GTACCCAAGCTTAGCTAGCTTGAAGCTGCCACAAG-3' introduced a Mfel-site and a

zTdlll-site. The /ΞcϋRI-site was used to clone a mIgG3hinge-dHLX fragment (derived

from pACKdHLX (Pack & Plϋckthun, 1992) for dimerization (Fig. 5). The Nhel site

allowed cloning of a second CBD fragment also amplified out of pTYBl, including the

linker sequence. The primers CBD ¹ _EccRV. 5'-CCGG TTCGα CGGTGGCCTGACC-3'

and CDB3'_V7eI were used to introduce -sites at both ends. The resulting plasmids

were called pKB100_wt (one CBD), pKB100dHLX_wt (dimeric miniantibody - two CBDs),

pKB100_wtilwt (tandem CBDs) and pKB100dHLX_wtilwt (dimeric miniantibody - two

tandem CBDs). The ribosome binding site (RBS) was exchanged for the stronger T7G10 RBS of pAK400 (Krebber et al., 1997) and the gene for coexpression of Skp was

introduced (Bothmann & Pluckthun, 1998) resulting in the pKB200-series (Fig. 5). The

exchange of cysteine at position 30 (amino acid 30 of the isolated CBD, according to

the numbering of NEB's pTYB-vector series; amino acid 677 in whole chitinase Al, see

PDB code 1ED7; Ikegami et al., 2000) to serine and to alanine was performed by site

directed mutagenesis of all CBD fragments. The gene for the anti-his tag scFv fragment

(mutl2) was cloned as Sfi cassette replacing the tet-resistance cassette. The scFv

fragments directed against FkpA (6B1, 7B2 9B3 and 11B4), as well as the scFvs K14G2

(anti-gpD scFv) and N7A9 (anti-SHP scFv) were selected out of the HuCAL (Knappik et

al., 2000) by two rounds of automated phage display (Krebs et al., 2001). Non

symmetrical S/7l-sites (Krebber et al., 1997) were attached to the scFv cassettes of the

HuCAL series by PCR and cloned into a pKB200 derivative containing glllpss (Krebber

et al., 1997) as stuffer, necessary to supply the EcoRI site. All HuCAL scFvs described

here were introduced as Mfell EccRl fragments, thus removing the second 5 zI-site. The

stuffer fragment was then exchanged for the CBDilCBD-cassette by EccRll Hindlll

cloning (Fig. 5).

Expression of scFv-CBD fusions

The plasmids encoding the 12 different anti-his tag-CBD fusion proteins (Fig. 1 and

2; pKB2Hmutl2-series, see Fig. 5) were transformed in the £ coli K12 strain SB536

(Bass et al., 1996) (F, WG1, AfhυA (tonA), AhhoAB (SacII), 5/7/7). Small scale

expressions were performed at 25 °C using 50 ml of SB-medium (20 g/l tryptone, 10

g/l yeast extract, 5 g/l NaCI, 50 mM K₂HP0₄) containing 30 μg/ml chloramphenicol.

Cultures were inoculated from a 5 ml preculture to OD₅₅₀=0.1. Expression was

induced with 1 mM IPTG at an OD₅₅₀ between 1.0 and 1.5. Cells were harvested 3 hours after induction by centrifugation. Cell pellets were resuspended in MBS buffer

(20 mM Mes/NaOH pH 6.5, 500 mM NaCI, 0.1 mM EDTA), normalized to their end

OD5₅₀ using 2.5 ml of MBS per 1 unit OD₅₅₀. Whole cell extracts were prepared by

French Press lysis at 10,000 psi and 1 ml of crude extract was centrifuged in an

Eppendorf tube for 60 min at maximum speed and 4 °C. The supernatants containing

the soluble material and the pellets were analyzed in an anti-FLAG blot. Large scale

expressions of the scFv-CBD fusion proteins were carried out in culture volumes from

750 ml to 1 1 in 5 I baffled shake flasks as described for the small cultures.

Expression of antigens

The expression of the antigens FkpA (Ramm & Plϋckthun, 2000), GpHD (Forrer &

Jaussi, 1998), GpHDL-cCrk (Forrer & Jaussi, 1998) and SHP (Yang et al., 2000) was

carried out exactly following published protocols. His-tagged proteins (scFv 4D5-his,

GroES-his, PhoA-his, CS-his and GFP-his) were expressed in the £ coli strain JM83

(F^", aral, A(/ac-prcAB), rpsl (Str^R), #7/1, φ80, Δ(/<3cZ)M15). Cultures (1 I) were grown

at 25 °C in 5 I baffled shake flasks using dYT-medium (16 g/l tryptone, 10 g/l yeast

extract, 5 g/l NaCI) and were induced at OD₅₅₀ = 1 with 1 mM IPTG (Lindner et al.,

1997). Cells were harvested 5 h after induction.

The chitin binding domain (CBD; Chong et al., 1997; Ikegami et al., 2000; Watanabe

et al., 1994) of Bacillus circulans WL-12 chitinase Al (Swiss Prot. Nr. P20533) was

used. Preliminary tests of a fusion consisting of one CBD and a mutated version of

the anti-his tag scFv 3D5 (Lindner et al., 1997) showed bleeding from the column,

suggesting that the binding of one CBD to chitin must be very weak. This

observation is in contrast to expectations raised in the literature (Chong et al., 1997;

Shpigel et al., 1998; Ramirez et al., 1993; Shpigel et al., 1999), but consistent with quantitative determinations of the affinity of a cellulose binding domain from

Trichoderma reesei to cellulose (Under et al., 1996; Under et al., 1998).

Consequently, stable binding to the beads, which is observed under many conditions,

relies on the high molar concentration of chitin on the beads, and is dynamic in

nature (Under et al., 1998; Carrard et al., 2000).

Therefore two CBDs in tandem were fused, dimerized the scFv to a miniantibody CBD fusion or combined both strategies to generate a protein with 4 CBDs (Fig. 1).

While all of these constructs showed better binding (Fig. 2B - wt-constructs),

periplasmic expression was decreased compared to the original scFv-CBD construct

(Fig. 2A - wt-constructs). As the CBD used contains a single unpaired cysteine, the

periplasmic production of the fusion proteins is impaired. Therefore the cysteine

residue was replaced by serine or alanine, and indeed both mutations lead to much

better expression of all constructs possessing two or four CBDs. Two constructs

(scFv-C30S-C30S and scFv-C30A-C30A) showed about the same expression level

than the simple scFv-CBD fusion.

Batch binding experiment

Cell pellets of the anti-his tag fusion proteins were resuspended in TBST buffer (50

mM Tris/HCI pH 8, 1 M NaCI, 0.1 mM EDTA, 1 % Triton X-100) using 1 ml of buffer

per 1 g of cells. DNase I was added and cell disruption was achieved by French-Press

lysis. After centrifugation the supernatant was passed through a 0.22 μm filter. To

compensate for differences in expression levels of the constructs, estimated from

Western-Blot analysis, crude extracts were diluted with TBST buffer to different

extents. For the binding experiment those diluted crude extracts, now containing the same amount of fusion protein, were shaken with equilibrated chitin beads.

Equilibrated chitin beads were prepared by using 100 μl of beads in an ethanol

suspension and washing them 3 times with 1 ml of TBST buffer in a 2 ml tube. To

these beads 500 μl of diluted crude £ coll extract containing the scFv-CBD fusion

proteins was added. The mixture was shaken at 4 °C for 1 h. The beads were

washed 3 times with 1 ml of TBST buffer. An aliquot was taken and analyzed by

SDS-PAGE to ensure that the same amount of each fusion protein had bound to the

beads. The dissociation from the beads was ^"determined by shaking the beads in 200

μl elution buffer (50 mM Caps/NaOH pH 10, 500 mM NaCI, 0.1 mM EDTA) for 1 h at

4 °C. The beads were sedimented and the supernatant containing dissociated

molecules was analyzed by an anti-FLAG blot.

SDS-PAGE analyses were carried out under reducing conditions according to

standard protocols using 12 % and 15 % polyacrylamide gels. Western-Blots with

the monoclonal anti-FLAG antibody Ml were carried out as described (Ge et al., 1995; Knappik & Plϋckthun, 1994).

For their use as affinity ligands stable binding of the fusion proteins to the column

material is decisive. Therefore the dissociation of all constructs from the chitin beads

was investigated under elution conditions (used for the anti-his tag scFv fragment).

The same amount of fusion protein was bound to the beads for all constructs. After

shaking the beads for one hour under elution conditions, the supernatant containing

the dissociated molecules was analyzed by an anti-FLAG blot (Fig. 2B). The results

suggest that both mutations result in weaker binding of the single CBDs, but there is

almost no dissociation detectable for the scFv-CBD-CBD and the miniAb-CBD-CBD

fusion proteins. Even though miniantibody-CBD fusions contain two CBDs as do the scFv-CBD-CBD constructs, they showed more leakage from the chitin beads. This may be due to some dissociation of the miniantibody over time. The scFv-C30A-C30A

and the scFv-C30S-C30S fusion proteins show the highest expression level and

sufficiently stable binding to the column material. Based on homology to other non-

cysteine containing CBDs (Ikegami et al., 2000) the scFv-C30A-C30A construct was

used as affinity ligand for further experiments.

To demonstrate the general applicability of the method, scFv-C30A-C30A fusion

proteins of six further scFv fragments were constructed. All of them were selected

out of the Human Combinatorial Antibody Library (HuCAL; Knappik et al., 2000), a

naϊve fully synthetic scFv-library with a diversity of 210⁹, by two rounds of phage

display (Krebs et al., 2001). Four scFv fragments with different frameworks for V_H

and V_L as well as different CDR3s were selected as recognizing the £ coll protein

FkpA (Bothmann & Plϋckthun, 2000; Ramm & Plϋckthun, 2000). Using similar

procedures, an scFv fragment specifically recognizing either the λ-phage coat protein

gpD (Forrer & Jaussi, 1998; Yang et al., 2000) or the homologous protein SHP from

phage 21 were selected.

Affinity purification

Preparation of crude extracts for chromatography experiments

Cell pellets expressing the fusion proteins (scFv-C30A-C30A constructs) used for

chromatography experiments were resuspended in TBST buffer using 5 ml of buffer

per 1 g of cells. After addition of DNase I, cell disruption was achieved by French-

Press lysis. The suspension was clarified by centrifugation at maximum speed for 60

min and 4 °C and filtration through a 0.22 μm filter. The same procedure was

performed with antigen cell pellets, but using MBS buffer (20 mM Mes/NaOH pH 6.5, 500 mM NaCI, 0.1 mM EDTA).

Column chromatography

Chromatography experiments were performed using SPE columns, usually mounted

in a positive pressure manifold. Empty SPE-columns were filled with 1.5 ml ethanol

suspension of chitin beads (corresponding to approximately 1 ml settled beads) and

after sedimentation a porous PTFE-filter disc was placed on top of the settled

column bed. Columns were equilibrated with 20 ml of TBST buffer. For equilibration

a pressure of 0.4 bar was applied to the columns. Next, between 1.5 ml and 6 ml of

scFv-C30A-C30A crude extract was loaded containing between 0.4 mg and 2 mg of

fusion protein. No pressure was applied to the columns during loading of CBD-

fusions containing crude extracts. The columns were washed at 0.2 bar with 2 ml (2

column volumes, cv) of TBST buffer and equilibrated with 8 ml (8 cv) of MBS buffer

also at 0.2 bar. In the next step 2-3 ml crude extract containing the antigen was

loaded without applying any pressure. The columns were washed with 20 ml (20 cv)

MBS at 0.2 bar. For the anti-FkpA fusions an additional washing step at pH 3.2 (100

mM glycine/HCI pH 3.2, 500 mM NaCI, 0.1 mM EDTA; 10 ml of buffer at 0.2 bar)

was included. Elution of the different antigens was performed with 2 ml of elution

buffer as follows: Elution from the anti-his tag columns could be achieved at pH 10

(50 mM Caps/NaOH pH 10, 500 mM NaCI, 0.1 mM EDTA). All 4 different anti-FkpA

columns were eluted at pH 2 (100 mM glycine/HCI pH 2, 500 mM NaCI, 0.1 mM

EDTA). SHP could be either eluted at pH 3.2 or pH 10, while the elution of GpD or

GpD-fusion proteins was more effective at pH 3.2. Eluted fractions at pH 3.2 were

neutralized with 17 μl 1 M Tris per ml, for the fractions eluted at pH 2 100 μl of 1 M Tris was required per ml. Immobilized metal ion affinity chromatography

For the second purification step of the his-tagged proteins Ni-NTA Superflow was

used. As for the IAC runs, all IMAC experiments were performed using the positive

pressure manifold. The reservoirs were filled with 0.5 ml sedimented Ni-NTA

material. The gel bed was covered with a PTFE disc and equilibrated with 20 ml of

binding buffer (50 mM Tris/HCI pH8, 500 mM NaCI, 20 mM imidazole). The pHlO-

eluted fractions of the anti-his tag affinity columns were directly loaded. The

columns were washed with 20 ml of binding buffer. Elutions were carried out with 2

ml of elution buffer (50 mM Tris/HCI pH 8, 500 mM NaCI, 200 mM imidazole).

Most of the chromatography experiments were carried out using a positive pressure

manifold. Sample processing without any detector became possible after some

preliminary tests to determine buffer volumes necessary for washing and elution of

the columns. The low overpressure applied to the columns lead to a more uniform

flow rate than under gravity flow.

To demonstrate the performance of the immobilized scFv-C30A-C30A fusion proteins

as affinity ligands, three different series of chromatography experiments were

shown. One series demonstrates purifications with the anti-gpD and anti-SHP ligands

(Fig. 3A). gpD by itself and the his tagged kinase fusion protein gpHD-cCrk (Forrer &

Jaussi, 1998) bind to the anti-gpD column and can be eluted either at pH 3.2 or pH

10, whereas for this scFv fragment elution at pH 3.2 is more effective. SHP binds to

its scFv fragment and can be eluted at pH 3.2 and pH 10 with the same recovery.

In a second series of experiments the performance of four different anti-FkpA scFv fragments 6B1, 7B2, 9B3 and 11B4 was investigated. The screening for elution

conditions showed that elution of the antigen was only possible at pH 2, independent of the scFv immobilized. This tight binding made it possible to introduce

an additional washing step at pH 3.2, removing some further contaminants. The

same defined amount of the scFv fusion proteins (0.4 mg) was immobilized on the

columns and overloaded them with FkpA. After washing the columns most FkpA

from the 7B2 and 11B4 columns could be eluted. While there was one additional

band visible when the 11B4 scFv fragment was used all other columns yielded pure

protein (Fig. 3B). The experiments in Fig. 3A and 3B also show that the antibody

itself is the most crucial determinant of purification quality and that with suitable

antibodies, highly pure protein is obtained and no significant contaminants are

introduced by the immobilization strategy.

The above examples have been carried out to investigate the range of

applications of the immobilization concept described, the influence of the scFv

chosen and to demonstrate that IAC can be easily standardized for parallel

purification of different samples. A model system - anti-his tag scFv and his-tagged

GFP (Crameri et al., 1996) - has been used to develop the protocol at different

scales and in particular optimize the buffers applied for the purifications described

above. Binding experiments with the anti-his tag-C30A-C30A fusion protein in

different buffers showed that the fusion proteins bound completely in most buffers,

including pH-values between 3 and 10, NaCI concentrations between 0 M and 1 M,

and some additives such as 1 % Triton X-100, 0.4 M arginine, 0.1 % SDS. These

results are in accordance with results described in the literature (Chong et al., 1997)

and suggest that the equilibrium binding constant is not influenced much by the

buffer components mentioned above. As the CBD is a very hydrophobic domain

(Ikegami et al., 2000), membrane components associated with the CBDs initially

clogged the columns and appeared as contaminants in the eluted fractions. This problem could be reduced to a minimum by addition of 1 % Triton X-100 to the buffer. Additionally, a high concentration of NaCI (> 1 M) reduces unspecific ionic

interactions. In conclusion, TBST buffer was found as the optimal binding buffer for

all scFv-C30A-C30A fusion proteins. Further experiments showed that in the antigen

loading step Triton X-100 was not necessary and that 500 mM NaCI was sufficient to

reduce protein binding to chitin.

In addition the capacity of the column for scFv-C30A-C30A fusion proteins and for

the desired antigen was determined. Batch ^"binding experiments suggested that the

capacity of chitin for CBD fusions is extremely high. Indeed, 100 μl of sedimented

chitin beads bound approximately 5 mg of the anti-his tag-C30A-C30A fusion

protein. Nevertheless, dynamic conditions are different, since some binding sites will

not be accessible under flow conditions because of diffusion limitation, and bound

molecules will dissociate from their binding sites and will be transported by the

buffer flow resulting in a slow migration of the ligands over the column. Therefore,

loading more than 2 mg of scFv-C30A-C30A fusion proteins per 1 ml of settled chitin

beads is not recommended. This "dynamic capacity" is still in the upper range

described for conventional affinity columns with monoclonal antibodies (Jack & Beer,

1996)². To determine the capacity of antigen, batch binding experiments with the

GFP/anti-his tag model system were carried out, which demonstrated that the ratio

of bound GFP to the scFv-C30A-C30A fusion is approximately 1:1.

20 mg his-tagged GFP were purified on 17 ml beads with 27 mg scFv-fusion (Fig.

3C). This procedure should be directly scaleable to multi-gram amounts with any

scFv fragment. Two-step purification of his-tagged proteins.

The above results demonstrate that IAC with the scFv fragments described could

provide a tool for the one-step purification of the respective antigen to a high degree

of purity (Fig. 3), which might be sufficient for many applications. However, a

generic technology to obtain high purity proteins with as simple a procedure as

plasmid purification should also be provided. Thus, a coupled anti-his tag/IMAC

procedure was provided, in which the same tag is recognized twice but by totally

different physical principles, and different contaminants should thus be removed. To

avoid any dialysis steps and allow direct coupling of the columns, the elution

conditions without imidazole for the anti-his tag affinity column were investigated,

and found that elution of his-tagged GFP was complete at pH 10 and resulted in a

sharp peak. This convenient elution behavior is the result of this scFv fragment

recognizing a protonated, C-terminally located his tag (Lindner et al., 1997), which

becomes deprotonated when the pH value is increased. To demonstrate the

generality of the method, the following proteins were tested: GroES-his (Lindner et

al., 1997; Nieba et al., 1997) (7 his tags), the scFv fragment 4D5-his (Carter et al.,

1992) (1 his tag), citrate synthase (Lindner et al., 1997) (CS-his, 2 his tags), GFP-his

(1 his tag) and £ coll alkaline phosphatase (Inouye et al., 1981) (PhoA-his, 2 his

tags). Even though there are a different numbers of his tags on the different

antigens, no differences in the elution behavior of the antigens could be detected, as

most antigen was found in the first 2 ml fraction of the elution. The eluted fractions

again show a very high degree of purity (Fig. 4, lanes A). They were directly loaded

on the Ni-NTA column equilibrated with binding buffer containing 20 mM imidazole to

reduce unspecific binding. With the coupled IMAC step the contaminants could be further reduced (Fig. 4, lanes B).

Figure legends

Fig. 1. Schematic representation of the fusion proteins containing one, two or four

CDBs. Each of the constructs was cloned with wt-CBDs and with CBDs, where the

single cysteine was mutated to serine (C30S) or alanine (C30A), resulting in 12

different constructs. The scFv-CBD constructs have one CBD, while the dimeric

molecules miniAb-CBD bind via two CBDs. The scFv-CBD-CBD constructs represent a

tandem CBD. The combination of the dimerization motif and the tandem CBDs

results in functional units possessing four CBDs, "miniantibodies, miniAbs".

Fig. 2. Anti-FLAG blot showing the different expression levels and binding

characteristics of the 12 different anti-his tag scFv-CBD fusion proteins. A.

Comparison of the expression level. 5 denotes the soluble fraction of the fusion

protein; P the pellet fraction. B. Binding of the different constructs to chitin beads.

Blots detecting the dissociated molecules are shown. Constructs suited as affinity

ligands should therefore contain no band or only a weak band in the supernatant

shown here. An independent blot (not shown) had verified that equal amounts of the

constructs were initially incubated with the beads. Stable binding was found for all

scFv-CBD-CBD and all miniAb-CBD-CBD constructs. The bands that are visible in the

corresponding lanes (7-12) are proteolytic digestion products carrying only one CBD

(of the size of the molecules in Fig. 1), as can also be seen from Fig. 2A.

Fig. 3. SDS-PAGE analysis demonstrating the performance of purifications with different antibodies and elution conditions. The gels (15 %) were run under reducing

conditions and stained with Coomassie brilliant blue R250. A. Eluted fractions of the

anti-gpD and anti-SHP affinity columns: (M) molecular weight marker, (1) SHP eluted

at pH 3.2, (2) SHP eluted at pH 10, (3) His-tagged gpD (gpHD) fusion protein eluted

at pH 3.2 (gpHDL-cCrk), (4) gpHD eluted at pH 3.2, (5) gpHD eluted at pH 10. B.

Purification of FkpA with four different scFv fragments 6B1, 7B2, 9B3 and 11134. (M)

molecular weight marker, (1) wash at pH 3.2 where some further contaminants can

be eluted, (2) elution at pH 2, (3) affinity beads after the elution of bound FkpA. The

affinity bead fractions show that approximately the same amount of each scFv

fragment was bound to the column. Therefore, the different amounts of eluted FkpA

are the result of different binding characteristics of the scFv fragments. C.

Purification of his-tagged GFP at different scales. (1) Small scale (2 mg) using the

positive pressure manifold and (2) large scale purification, where approximately 20

mg have been purified using a FPLC system. Both purifications show the same

degree of purity. The smaller band observed in the GFP-his purification (about 25

kDa) is a N-terminal proteolytic digestion product of GFP, still containing the C-

terminal his tag.

Fig. 4. Two-step purification of different his-tagged proteins. Lanes A show the

eluted fractions of the anti-his tag affinity column, lanes B the fractions after the

anti-his tag affinity column coupled with IMAC. (M) molecular weight marker, (1)

scFv 4D5-his, (2) GroES-his, (3) PhoA-his, (4) CS-his and (5) GFP-his.

Fig. 5. Starting plasmid pKB2scFvCBD for cloning and expression of scFv-CBD fusion

proteins. The plasmid is a derivative of the pAK-series (Krebber et al., 1997): The plasmid has a /ac-promoter and the RBS of pAK400 (Krebber et al., 1997). Fusion

proteins are expressed in the periplasm coexpressing the periplasmic folding factor

Skp (Bothmann & Plϋckthun, 1998) regulated by its own promotor. Also represented

are the restriction sites used for cloning of the dHLX-fragment (Pack & Plϋckthun,

1992) - EccRl - and for the second linker-CBD fragment - Nhel.

References

Arnold-Schild, D. et al. One-step single-chain Fv recombinant antibody- based

purification of gp96 for vaccine development. Cancer Res. 60, 4175-4178

(2000).

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Sedman, J. G., Smith, J. A.,

& Struhl, K. eds. (1999). Current Protocols in Molecular Biology. New York:

John Wiley and Sons.

Bass, S., Gu, Q. & Christen, A. Multicopy suppressors of pre mutant Escherichia coli

include two HtrA (DegP) protease homologs (HhoAB), DksA, and a truncated

RlpA. J. Bacte ol. 178, 1154-1161 (1996).

Berry, M.J. & Pierce, J.J. Stability of immunoadsorbents comprising antibody

fragments. Comparison of Fv fragments and single-chain Fv fragments. J.

Chromatogr. 629, 161-168 (1993).

Berry, M.J., Davies, J., Smith, C.G. & Smith, I. Immobilization of Fv antibody

fragments on porous silica and their utility in affinity chromatography. J.

Chromatogr. 587, 161-169 (1991).

Bird, R. E., Hardman, K. D., Jacobson, J. W., Johnson, S., Kaufman, B. M., Lee, S.

M., Lee, T., Pope, S. H., Riordan, G. S. & Whitlow, M. (1988). Single-chain

antigen-binding proteins. Science 242, 423-426.

Blake, M.S., Johnston, K.H., Russel-Jones, G.J. & Gotschlich, E.C. (1984). A rapid,

sensitive method for detection of alkaline phosphatase-conjugated

antiantibody on Western blots. Anal. Biochem. 136, 175-179. Bothmann, H. & Plϋckthun, A. Selection for a periplasmic factor improving phage

display and functional periplasmic expression. Nat. Biotechnol. 16, 376-380.

(1998).

Bothmann, H. & Plϋckthun, A. The periplasmic Escherichia coli peptidylprolyl

cis,trans-isomerase FkpA. I. Increased functional expression of antibody

fragments with and without cis-prolines. J. Biol. Chem. 275, 17100-17105.

(2000).

Brinkmann, U., Reiter, Y., Jung, S., Lee, B. & Pastan, I. (1993). A recombinant

immunotoxin containing a disulfide-stabilized Fv fragment. Proc. Natl. Acad. Sci.

U.S.A. 90, 7538-7542.

Carrard, G., Koivula, A., Soderlund, H. & Beguin, P. Cellulose-binding domains

promote hydrolysis of different sites on crystalline cellulose. Proc. Natl. Acad.

Sci. U. S. A. 97, 10342-10347 (2000).

Carter, P. et al. High level Escherichia coli expression and production of a bivalent

humanized antibody fragment. Biotechnology. (N. Y). 10, 163-167. (1992).

Chong, S. et al. Single-column purification of free recombinant proteins using a self-

cleavable affinity tag derived from a protein splicing element. Gene 192, 271-

281 (1997).

Crameri, A., Whitehorn, E.A., Tate, E. & Stemmer, W.P. Improved green fluorescent

protein by molecular evolution using DNA shuffling. Nat. Biotechnol. 14, 315-

319 (1996).

Cutler, P. Affinity chromatography. Methods Mol. Biol. 59, 157-168 (1996).

Ford, C.F., Suominen, I. & Glatz, C.E. Fusion tails for the recovery and purification of

recombinant proteins. Protein Expression & Purification 2, 95-107 (1991). Forrer, P. & Jaussi, R. High-level expression of soluble heterologous proteins in the

cytoplasm of Escherichia coli by fusion to the bacteriophage lambda head

protein D. Gene 224, 45-52 (1998).

Ge, L, Knappik, A., Pack, P., Freund, C. & Plϋckthun, A. Expressing antibodies in

Escherichia coli. In Antibody Engineering, 2nd. Edn. (ed. Borrebaeck, C.A.K.)

229-266 (Oxford University Press, New York, NY; 1995).

Glockshuber, R., Malia, M., Pfitzinger, I. & Plϋckthun, A. (1992). A comparison of

strategies to stabilize immunoglobulin Fv-fragments. Biochemistry 29, 1362-

1367.

Hanes, J., Schaffitzel, C, Knappik, A. & Plϋckthun, A. Picomolar affinity antibodies

from a fully synthetic naϊve library selected and evolved by ribosome display.

Nat. Biotechnol. 18, 1287-1292. (2000).

Hochuli, E., Bannwarth, W., Dόbeli, H., Gentz, R. & Stϋber, D. Genetic approach to

facilitate purification of recombinant proteins with a novel metal chelate

adsorbent. Biotechnology 6, 1321-1325 (1988).

Hopp, T.P., Prickett, K.S., Price, V.L, Libby, R.T., March, C.J., Cerretti, D.P.,Urdal,

D.L & Conlon, P.J. (1988). A short polypeptide marker sequence useful for

recombinant protein identification and purification. Bio/Technology 6, 1204-

1210.

Huston, J. S., Levinson, D., Mudgett-Hunter, M., Tai, M. S., Novotny, J., Margolies,

M. N., Ridge, R. J., Bruccoleri, R. E., Haber, E., Crea, R. & Oppermann, H.

(1988). Protein engineering of antibody binding sites: recovery of specific

activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli.

Proc. Natl. Acad. Sci. USA 85, 5879-5883. Ikegami, T. et al. Solution structure of the chitin-binding domain of Bacillus circulans

WL-12 chitinase Al. J. Biol. Chem. 275, 13654-13661 (2000).

Inouye, H., Michaelis, S., Wright, A. & Beckwith, J. Cloning and restriction mapping

of the alkaline phosphatase structural gene (phoA) of Escherichia coli and

generation of deletion mutants in vitro. J. Bacteriol. 146, 668-675. (1981).

Jack, G.W. & Beer, D.J. Immunoaffinity chromatography. Methods Mol. Biol. 59, 187-

196 (1996).

Jones, C. et al. Current trends in molecular recognition and bioseparation. J.

Chromatogr. A 707, 3-22 (1995).

Kleymann, G., Ostermeier, C, Ludwig, B., Skerra, A. & Michel, H. Engineered Fv

fragments as a tool for the one-step purification of integral multisubunit

membrane protein complexes. Bio/Technology 13, 155-160 (1995).

Knappik, A. & Plϋckthun, A. An improved affinity tag based on the FLAG peptide for

the detection and purification of recombinant antibody fragments.

Biotechniques 17, 754-761. (1994).

Knappik, A. et al. Fully synthetic human combinatorial antibody libraries (HuCAL)

based on modular consensus frameworks and CDRs randomized with

trinucleotides. J. Mol. Biol. 296, 57-86. (2000).

Krebber, A. et al. Reliable cloning of functional antibody variable domains from

hybridomas and spleen cell repertoires employing a reengineered phage display

system. J. Immunol. Methods 201, 35-55. (1997).

Krebs, B. et al. High-throughput generation and engineering of recombinant human

antibodies. J. Immunol. Methods 254, 67-84. (2001). Lanio, T., Jeltsch, A. & Pingoud, A. Automated purification of His6-tagged proteins

allows exhaustive screening of libraries generated by random mutagenesis.

Biotechniques 29, 338-342. (2000).

Under, M., Nevanen, T., Soderholm, L., Bengs, 0. & Teeri, T.T. Improved

immobilization of fusion proteins via cellulose-binding domains. Biotechnology &

Bioengineering 60, 642-647 (1998).

Under, M., Salovuori, I., Ruohonen, L. & Teeri, T.T. Characterization of a double

cellulose-binding domain. Synergistic high affinity binding to crystalline

cellulose. J. Biol. Chem. 271, 21268-21272 (1996).

Lindner, P. et al. Purification of native proteins from the cytoplasm and periplasm of

Escherichia coli using IMAC and histidine tails: a comparison of proteins and

protocols. Methods: A Companion to Methods in Enzymology 4, 41-56. (1992).

Lindner, P. et al. Specific detection of his-tagged proteins with recombinant anti-His

tag scFv-phosphatase or scFv-phage fusions. Biotechniques 22, 140-149.

(1997).

Molloy, P., Brydon, L, Porter, A.J. & Harris, W.J. Separation and concentration of

bacteria with immobilized antibody fragments. J. Appl. Bacteriol. 78, 359-365

(1995).

Mδssner, E., Koch, H. & Plϋckthun, A. Fast selection of antibodies without antigen

purification: adaptation of the protein fragment complementation assay to

select antigen- antibody pairs. J. Mol. Biol. 308, 115-122. (2001).

Nieba, L. et al. BIACORE analysis of histidine-tagged proteins using a chelating NTA

sensor chip. Anal. Biochem. 252, 217-228. (1997). Nilsson, J., Stahl, S., Lundeberg, J., Uhlen, M. & Nygren, P.A. Affinity fusion

strategies for detection, purification, and immobilization of recombinant

proteins. Protein Expression & Purification 11, 1-16 (1997).

Pack, P. & Plϋckthun, A. Miniantibodies: use of amphipathic helices to produce

functional, flexibly linked dimeric Fv fragments with high avidity in Escherichia coli. Biochemistry 31, 1579-1584. (1992).

Pack, P., Kujau, M., Schroeckh, V., Knϋpfer, U., Wenderoth, R., Riesenberg D. &

Plϋckthun, A. (1993). Improved bivalent miniantibodies, with identical avidity as

whole antibodies, produced by high cell density fermentation of in Escherichia

coli. Bio/Technology 11, 1271-1277.

Pack, P. (1994). Mini-Antikδrper: Bivalente, tetravalente und bispezifische

Immunglobuline aus E. coli. Ph.D. thesis, Ludwig-Maximilians-Universitat

Mϋnchen.

Plϋckthun, A., Schaffitzel, C, Hanes, J. & Jermutus, L. In vitro selection and

evolution of proteins. Adv. Protein Chem. 55, 367-403 (2000).

Ramirez, C. et al. A bifunctional affinity linker to couple antibodies to cellulose.

Bio/Technology 11, 1570-1573 (1993).

Ramm, K. & Plϋckthun, A. The periplasmic Escherichia coli peptidylprolyl cis,trans-

isomerase FkpA. II. Isomerase-independent chaperone activity in vitro. J. Biol.

Chem. 275, 17106-17113. (2000).

Shpigel, E. et al. Immobilization of recombinant heparinase I fused to cellulose-

binding domain. Biotechnology & Bioengineering 65, 17-23 (1999).

Shpigel, E., Elias, D., Cohen, I.R. & Shoseyov, O. Production and purification of a

recombinant human hsp60 epitope using the cellulose-binding domain in

Escherichia coli. Protein Expression & Purification 14, 185-191 (1998). Sii, D. & Sadana, A. Bioseparation using affinity techniques. J. Biotechnol. 19, 83-98.

(1991).

Skerra, A. & Plϋckthun(1988). Assembly of a functional immunoglobulin Fv fragment

in Escherichia coli. Science 240, 1038-1041.

Smith, G.P. & Scott, J.K. Libraries of peptides and proteins displayed on filamentous

phage. Methods Enzymol. 217, 228-257 (1993).

Turkova, J. Oriented immobilization of biologically active proteins as a tool for

revealing protein interactions and function. Journal of Chromatography. B,

Biomedical Sciences & Applications 722, 11-31 (1999).

Vaughan, T.J. et al. Human antibodies with sub-nanomolar affinities isolated from a

large non-immunized phage display library. Nat. Biotechnol. 14, 309-314

(1996).

Watanabe, T. et al. The roles of the C-terminal domain and type III domains of

chitinase Al from Bacillus circulans WL-12 in chitin degradation. J. Bacteriol.

176, 4465-4472 (1994).

Weiss, E., Chatellier, J. & Orfanoudakis, G. In vivo biotinylated recombinant

antibodies: construction, characterization, and application of a bifunctional Fab-

BCCP fusion protein produced in Escherichia coli. Protein Expression &

Purification 5, 509-517 (1994).

Winter, G., Griffiths, A.D., Hawkins, R.E. & Hoogenboom, H.R. Making antibodies by

phage display technology. Annu. Rev. Immunol. 12, 433-455 (1994).

Yang, F. et al. Novel fold and capsid-binding properties of the lambda-phage display platform protein gpD. Nat. Struct. Biol. 7, 230-237. (2000).

Claims

Claims

1. A method of separating a ligand from a mixture comprising the steps of:

a) immobilizing a fusion protein on a matrix, said fusion protein comprising

(i) an antibody fragment moiety having a specificity for said ligand,

and

(ii) an affinity domain moiety that attaches to the matrix to form a

matrix-fusion protein complex;

b) contacting said mixture with at least the antibody fragment moiety of the

matrix-fusion protein complex;

c) removing components of said mixture not binding to the antibody fragment

moiety of said matrix-fusion protein complex; and

d) eluting said ligand from said matrix-fusion protein complex.

2. A method according to claim 1, wherein said elution is achieved by a pH shift.

3. A method according to claim 1 or 2, wherein said antibody fragment moiety is

a single-chain Fv (scFv).

4. A method according to claim 1 or 2, wherein said antibody fragment moiety is

a mini-antibody.

5. A method according to any one of claims 1-4, wherein said ligand is a protein

comprising a his-tag and wherein said antibody fragment moiety has binding

specificity for said his-tag.

6. A method according to any one of claims 1-5, wherein said affinity domain

moiety comprises one or more carbohydrate-binding domains and wherein the

matrix comprises immobilized carbohydrate.

7. A method according to claim 6, wherein said one or more carbohydrate-

binding domains are chitin-binding domains, and wherein said matrix

comprises immobilized chitin.

8. A method according to claim 7, wherein said chitin-binding domains comprise

chitinase or a fragment thereof from Bacillus circulans WL-12.

9. A method according to any one of claims 1-8, wherein said fusion protein is

expressed in an £ cσ//cell.

10. A method according to any one of claims 1-9, wherein the fusion protein is

immobilized to said matrix out of a crude extract.

11. A method according to any one of claims 1-9, wherein the fusion protein is

purified prior to immobilization to said matrix.

12. A fusion protein comprising two or more chitin-binding domains fused to a

fusion partner.

13. A fusion protein according to claim 12, wherein said chitin-binding domain is a

modified variant of a wild-type chitin-binding domain, wherein a free cysteine

is exchanged by an alanine or a serine.

14. A fusion protein according to claims 12 to 13 comprising 2 to 4 chitin-binding

domains.

15. A fusion protein according to claims 12 to 14, wherein said fusion partner is an

antibody fragment.

16. A nucleic acid sequence encoding the fusion protein of any one of claims 12 to

15.

17. A vector comprising a nucleic acid sequence according to claim 18.

18. A host cell comprising a nucleic acid sequence according to claim 18, or a

vector according to claim 19.

19. An affinity chip for the identification of one or more ligands from a mixture,

comprising: a substrate and a set of fusion proteins immobilized thereon,

wherein each of said fusion proteins comprises (i) an antibody fragment

moiety that has a specificity for a ligand, and (ii) an affinity domain moiety for immobilization to said substrate.

20. An affinity chip according to claim 21, wherein each member of said set of

fusion proteins is coupled to the substrate of the chip at a spatially

addressable position.

21. A method for the parallel detection of one or more ligands out of a mixture by

using an affinity chip according to claim 22 or 23, comprising the steps of:

a) contacting said mixture with said affinity chip;

b) removing the components of said mixture not binding to the antibody

fragment moiety of said affinity chip; and

c) identifying one or more ligands bound to an antibody fragment moiety

contained on said affinity chip.