WO2003016505A2 - Kgf polypeptide compositions - Google Patents

Kgf polypeptide compositions Download PDF

Info

Publication number
WO2003016505A2
WO2003016505A2 PCT/US2002/026929 US0226929W WO03016505A2 WO 2003016505 A2 WO2003016505 A2 WO 2003016505A2 US 0226929 W US0226929 W US 0226929W WO 03016505 A2 WO03016505 A2 WO 03016505A2
Authority
WO
WIPO (PCT)
Prior art keywords
kgf
amino acid
inclusive
desl
amount
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2002/026929
Other languages
English (en)
French (fr)
Other versions
WO2003016505A3 (en
Inventor
Denis J. Gospodarowicz
W. Michael Kavanaugh
Kenneth Crawford
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Chiron Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=23217561&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2003016505(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Chiron Corp filed Critical Chiron Corp
Priority to AU2002326742A priority Critical patent/AU2002326742B2/en
Priority to CA002457781A priority patent/CA2457781A1/en
Priority to MXPA04001526A priority patent/MXPA04001526A/es
Priority to JP2003521814A priority patent/JP2005500390A/ja
Priority to EP02761479A priority patent/EP1429799A4/en
Publication of WO2003016505A2 publication Critical patent/WO2003016505A2/en
Publication of WO2003016505A3 publication Critical patent/WO2003016505A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/50Fibroblast growth factor [FGF]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18Growth factors; Growth regulators
    • A61K38/1825Fibroblast growth factor [FGF]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention relates generally to polypeptide growth factors. Specifically, the invention relates to compositions comprising keratinocyte growth factor polypeptides and methods of using the same.
  • Keratinocyte growth factor belongs to the family of fibroblast growth factors ("FGFs"), the prototypes of which are represented by basic FGF and acidic FGF. KGF is also known as FGF-7. KGF, like FGFs, binds heparin and is generally capable of stimulating the proliferation and differentiation of a variety of cell types derived from the primary or secondary mesoderm as well as from neuroectoderm. For example, KGF, like FGFs, has the ability to induce the differentiation and proliferation of ventral as well as dorsal mesoderm in early blastulae. See, e.g., Gospodarowicz et. al. Cell. Biol. Rev. (1991) 25:307-314; and Basilico et al. Adv. Cancer Res. (1992) 59:115-165.
  • KGF is a heparin-binding protein, but unlike other FGFs, it has a unique target cell specificity. Particularly, KGF is similar to other FGFs in its ability to stimulate epithelial cell proliferation, but is dissimilar to other FGFs in its inability to stimulate endothelial cells or fibroblast proliferation. See, e.g., Finch, et. al. Science (1989) 245: 752-755. Mature, full-length KGF, designated herein as KGF 163 , is a polypeptide with 163 amino acid residues, and possesses a potential N-glycosylation site that extends from amino acid residue 14 to 16 at the N-terminus. Finch, et. al.
  • KGF desl One particular molecule, with an N- terminal deletion of 23 amino acid residues, termed KGF desl . 23 , demonstrates enhanced mitogenic activity as compared to mature, full-length recombinant KGF 163 .
  • the present invention is based on the discovery that various N-terminally truncated KGF polypeptides, and analogs thereof, display enhanced biological activity on a per molecule basis relative to native, full-length KGF 163 .
  • compositions containing these molecules have increased potency for the treatment of conditions where epithelialization is required, such as for the treatment of wounds, burns, ophthalmic disorders, gastrointestinal diseases and any disorder where stimulation of epithelial cell proliferation or regeneration is desired.
  • PDGF platelet derived growth factor
  • EGF epidermal growth factor
  • IGF insulin-like growth factor
  • IGFBPs insulin-like growth factor binding proteins
  • KGF molecules can be conjugated to toxin molecules in order to target these toxins to epithelial cells in order to treat hyperproliferative diseases.
  • the subject invention is directed to a method of stimulating epithelial cell proliferation.
  • the method comprises contacting epithelial cells with a composition comprising:
  • KGF polypeptide (a) a therapeutically effective amount of a KGF polypeptide, wherein the KGF polypeptide is selected from the group consisting of:
  • KGF desl . 15 consisting of the contiguous amino acid sequence depicted at amino acid residues 16-163, inclusive, of Figure 1;
  • KGF desMg consisting of the contiguous amino acid sequence depicted at amino acid residues 19-163, inclusive, of Figure 1
  • KGF desl.19 consisting of the contiguous amino acid sequence depicted at amino acid residues 20-163, inclusive, of Figure 1;
  • KGF desl.20 consisting of the contiguous amino acid sequence depicted at amino acid residues 21-163, inclusive, of Figure 1;
  • KGF desl.21 consisting of the contiguous amino acid sequence depicted at amino acid residues 22-163, inclusive, of Figure 1;
  • KGF desl.22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1;
  • KGF desl _ 24 consisting of the contiguous amino acid sequence depicted at amino acid residues 25-163, inclusive, of Figure 1
  • KGF desl.25 consisting of the contiguous amino acid sequence depicted at amino acid residues 26-163, inclusive, of Figure 1;
  • the biologically active analog has at least 80% or 90% sequence homology to (i), (ii), (iii), (iv), (v), (vi), (vii), (viii) or (ix).
  • the invention is directed to a method as described above wherein the KGF polypeptide is KGF desl.22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1, or a biologically active analog thereof wherein the biologically active analog consists of 141 amino acids and has at least 70% sequence homology thereto, and wherein the therapeutically effective amount is 50% or less of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response.
  • KGF polypeptide is KGF desl.22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1, or a biologically active analog thereof wherein the biologically active analog consists of 141 amino acids and has at least 70% sequence homology thereto, and wherein the therapeutically effective amount is 50% or less of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response.
  • the invention is directed to a method as described above wherein the KGF polypeptide is KGF desl _ 24 consisting of the contiguous amino acid sequence depicted at amino acid residues 25-163, inclusive, of Figure 1, or a biologically active analog thereof wherein the biologically active analog consists of 139 amino acids and has at least 70% sequence homology thereto, and wherein the therapeutically effective amount is 50% or less of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response.
  • KGF polypeptide is KGF desl _ 24 consisting of the contiguous amino acid sequence depicted at amino acid residues 25-163, inclusive, of Figure 1, or a biologically active analog thereof wherein the biologically active analog consists of 139 amino acids and has at least 70% sequence homology thereto, and wherein the therapeutically effective amount is 50% or less of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response.
  • the invention is directed to a method of stimulating epithelial cell proliferation which comprises contacting epithelial cells with a composition comprising: a) a therapeutically effective amount of a KGF polypeptide, wherein the KGF polypeptide is (i) KGF desl _ 22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1, or (ii) a biologically active analog of (i) which consists of the same number of amino acids as (i) and has at least 70% sequence homology thereto, wherein the KGF polypeptide exhibits an increase in bioactivity relative to mature, full-length, KGF (KGF 163 ) as determined by the Balb/MK bioactivity assay and specifically stimulates epithelial cell proliferation, and further wherein the therapeutically effective amount is 10% to 75% of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response; and
  • the biologically active analog has at least 80% or 90% sequence homology to (i) or (ii).
  • the biologically active analog consists of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1 with the N-terminal arginine residue substituted with an alanine residue.
  • the therapeutically effective amount is 10% to 20%, or 10%) to 25%, or 10% to 50% ⁇ of tlie amount on a per molecule basis, or any percentage within these ranges, of the amount of full-length KGF needed to elicit an equivalent therapeutic response.
  • the invention is directed to a method of stimulating epithelial cell proliferation comprising contacting epithelial cells with a composition comprising: a) a therapeutically effective amount of a KGF polypeptide, wherein the KGF polypeptide is (i) KGF desl _ 24 consisting of the contiguous amino acid sequence depicted at amino acid residues 25-163, inclusive, of Figure 1, or (ii) a biologically active analog of (i) which consists of the same number of amino acids as (i) and has at least 70% sequence homology thereto, wherein the KGF polypeptide exhibits an increase in bioactivity relative to mature, full-length, KGF (KGF 163 ) as determined by the Balb/MK bioactivity assay and specifically stimulates epithelial cell proliferation, and further wherein the therapeutically effective amount is 5% to 75%> of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response; and
  • the biologically active analog has at least 80% or at least 90% sequence homology to (i) or (ii).
  • the therapeutically effective amount is 5% to 10%, 10% to 20%, 10% to 25%, or 10% to 50%, or any percentage within these ranges, of the amount on a per molecule basis of the amount of full-length KGF needed to elicit an equivalent therapeutic response.
  • epithelial cells may be contacted with the KGF polypeptides in vitro or in vivo.
  • the invention is directed to a method of treating wounds comprising applying a KGF polypeptide composition to an area of a wound to be treated and allowing the wound to heal.
  • the composition comprises:
  • KGF polypeptide (a) a therapeutically effective amount of a KGF polypeptide, wherein the KGF polypeptide is selected from the group consisting of:
  • KGF desl . 15 consisting of the contiguous amino acid sequence depicted at amino acid residues 16-163, inclusive, of Figure 1;
  • KGF de-Mg consisting of the contiguous amino acid sequence depicted at amino acid residues 19-163, inclusive, of Figure 1;
  • KGF desl . 19 consisting of the contiguous amino acid sequence depicted at amino acid residues 20-163, inclusive, of Figure 1;
  • KGF de-1 _ 20 consisting of the contiguous amino acid sequence depicted at amino acid residues 21-163, inclusive, of Figure 1;
  • KGF desl . 21 consisting of the contiguous amino acid sequence depicted at amino acid residues 22-163, inclusive, of Figure 1;
  • KGF de-1 _ 22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1;
  • KGF de- ⁇ _ 24 consisting of the contiguous amino acid sequence depicted at amino acid residues 25-163, inclusive, of Figure 1;
  • KGF desl.25 consisting of the contiguous amino acid sequence depicted at amino acid residues 26-163, inclusive, of Figure 1; (ix) a biologically active analog of (i), (ii), (iii), (iv), (v), (vi), (vii) or (viii), wherein the biologically active analog consists of the same number of amino acids as (i), (ii), (iii), (iv), (v), (vi), (vii) or (viii), respectively, and has at least 70% sequence homology thereto, wherein the KGF polypeptide exhibits an increase in bioactivity relative to mature, full-length, KGF (KGF 163 ) as determined by the Balb/MK bioactivity assay and specifically stimulates epithelial cell proliferation, and further wherein the therapeutically effective amount is 75% or less of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response; and (b) a pharmaceutically acceptable excipient.
  • the biologically active analog has at least 80% or 90% sequence homology to (i), (ii), (iii), (iv), (v), (vi), (vii), (viii) or (ix).
  • the KGF polypeptide is KGF d-sl _ 22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1, or a biologically active analog thereof wherein the biologically active analog consists of 141 amino acids and has at least 70% sequence homology thereto, and wherein the therapeutically effective amount is 50% or less of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response.
  • the KGF polypeptide is KGF desl _ 24 consisting of the contiguous amino acid sequence depicted at amino acid residues 25-163, inclusive, of Figure 1, or a biologically active analog thereof wherein the biologically active analog consists of 139 amino acids and has at least 70% sequence homology thereto, and wherein the therapeutically effective amount is 50%> or less of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response.
  • the invention is directed to a method of treating wounds comprising applying a KGF polypeptide composition to an area of a wound to be treated and allowing the wound to heal, said composition comprising: a) a therapeutically effective amount of a KGF polypeptide, wherein the KGF polypeptide is (i) KGF desl _ 22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1, or (ii) a biologically active analog of (i) which consists of the same number of amino acids as (i) and has at least 10% sequence homology thereto, wherein the KGF polypeptide exhibits an increase in bioactivity relative to mature, full-length, KGF (KGF 163 ) as determined by the Balb/MK bioactivity assay and specifically stimulates epithelial cell proliferation, and further wherein the therapeutically effective amount is 10% to 75% of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response; and
  • the biologically active analog has at least 80% sequence homology or at least 90% sequence homology to (i) or (ii).
  • the biologically active analog consists of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1 with the N-terminal arginine residue substituted with an alanine residue.
  • the therapeutically effective amount for use in the methods above is 10% to 20%, or 10% to 25%, or 10% to 50% of the amount on a per molecule basis, or any percentage within these ranges, of the amount of full-length KGF needed to elicit an equivalent therapeutic response.
  • the invention is directed to a method of treating wounds comprising applying a KGF polypeptide composition to an area of a wound to be treated and allowing the wound to heal, said composition comprising: a) a therapeutically effective amount of a KGF polypeptide, wherein the KGF polypeptide is (i) KGF desl.24 consisting of the contiguous amino acid sequence depicted at amino acid residues 25-163, inclusive, of Figure 1 , or a biologically active analog of (i) which consists of the same number of amino acids as (i) and has at least 70% sequence homology thereto, wherein the KGF polypeptide exhibits an increase in bioactivity relative to mature, full-length, KGF (KGF 163 ) as determined by the Balb/MK bioactivity assay and specifically stimulates epithelial cell proliferation, and further wherein the therapeutically effective amount is 5% to 75% of the amount on a per molecule basis of KGF 163 needed to elicit an equivalent therapeutic response; and
  • the biologically active analog has at least 80% sequence homology or at least 90% sequence homology to (i) or (ii).
  • the therapeutically effective amount for use in the method above is 5% to 10%, or 10% to 20%, or 10% to 25%, or 10% to 50% of the amount on a per molecule basis, or any percentage within these ranges, of the amount of full-length KGF needed to elicit an equivalent therapeutic response.
  • the composition may be contacted with the wound in vitro or in vivo.
  • the invention is directed to a composition
  • a composition comprising: (a) a therapeutically effective amount of a KGF polypeptide, wherein the KGF polypeptide is selected from the group consisting of: (i) KGF desl.15 consisting of the contiguous amino acid sequence depicted at amino acid residues 16-163, inclusive, of Figure 1;
  • KGF desl.18 consisting of the contiguous amino acid sequence depicted at amino acid residues 19-163, inclusive, of Figure 1;
  • KGF desl . 19 consisting of the contiguous amino acid sequence depicted at amino acid residues 20-163, inclusive, of Figure 1;
  • KGF desl _ 20 consisting of the contiguous amino acid sequence depicted at amino acid residues 21-163, inclusive, of Figure 1;
  • KGF desl . 21 consisting of the contiguous amino acid sequence depicted at amino acid residues 22-163, inclusive, of Figure 1
  • KGF desl _ 22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1;
  • KGF desl _ 24 consisting of the contiguous amino acid sequence depicted at amino acid residues 25-163, inclusive, of Figure 1;
  • KGF desl . 25 consisting of the contiguous amino acid sequence depicted at amino acid residues 26-163, inclusive, of Figure 1; (ix) a biologically active analog of (i), (ii), (iii), (iv), (v), (vi), (vii) or (viii), wherein said biologically active analog consists of the same number of amino acids as (i), (ii), (iii), (iv), (v), (vi), (vii) or (viii), respectively, and has at least 70% sequence homology thereto; and (x) an analog of (i), (ii), (iii), (iv), (v), (vi), (vii), (viii) or (ix), consisting of the amino acid sequence of (i), (ii), (iii), (iv), (v), (vi), (vii), (viii) or (ix), respectively, and an additional N-terminal methionine, wherein the KGF polypeptide exhibits an increase in bioactivity relative to mature, full-length
  • the biologically active analog has at least 80% sequence homology or at least 90% sequence homology to (i), (ii), (iii), (iv), (v), (vi), (vii), (viii) or
  • Figure 1 depicts the DNA sequence and corresponding amino acid sequence for mature, full-length KGF (KGF ⁇ 63 ).
  • Figures 2 A and 2B show a comparison of the biological activity of various N- terminally truncated KGF polypeptides.
  • Figure 2A compares activity of KGF desl _ 22 ( ⁇ ), GF desl.23 ( ⁇ ), KGF desI.24 (A) KGF desl . 26 (X) and KGF desl . 30 (double X), while Figure 2B shows a comparison of KGF des ⁇ .23 ( ⁇ ), KGF desl _ 26 (X) and KGF desl .
  • FIG. 30 double X with acidic FGF (aFGF, ⁇ , middle line) and full-length KGF (FL-KGF, ( ⁇ , second to the top line).
  • Figure 3 shows the results of experiments where various truncated KGF molecules were tested on vascular endothelial cells derived from either the bovine aortic arch (adult bovine aortic endothelial cells (ABAE), left side of figure) or from the bovine adrenal gland capillaries (adrenal cortex-derived capillary endothelial cells (ACE), right side of figure).
  • the histograms show the final cell density of cultures exposed to saturating concentrations of the various KGF polypeptides, or basic FGF (bFGF), after seven days in culture.
  • Figure 4 shows the amount of soluble KGF de-1 _ 24 (A) and KGF desM5 (•), determined by SDS-PAGE as a function of time of incubation at 37°C.
  • Figure 5 shows the amount of soluble KGF desl _ 23 ( ⁇ ) and native KGF (FL, ⁇ ) determined by SDS-PAGE as a function of time of incubation at 37°C.
  • Figure 6 depicts the results of the thermal and acid stability test described in the examples.
  • FL-KGF represents KGF 163 .
  • T-KGF represents KGF desl _ 23 .
  • the histograms represent the final cell density of the cultures after seven days when exposed to saturating concentrations of either KGF des ⁇ _ 23 or KGF 163 .
  • Figure 7 shows the effect of increasing concentrations of native KGF (FL, ⁇ ) and KGF desl.ls (•), KGF desl.23 ( ⁇ ) and KGF desl.25 (A) on the proliferation of Balb/Mk cells when added only once.
  • Figure 8 shows the DNA sequence and corresponding amino acid sequence for KGF desl _ 22 , with the N-terminal arginine residue substituted with an alanine residue.
  • Cysteine Cys (C) Glutamine: Gin (Q)
  • Threonine Thr (T) Tryptophan: Trp (W)
  • polypeptide and protein refer to a polymer of amino acid residues and are not limited to a minimum length of the product. The terms also include, unless otherwise indicated, modifications of the polypeptide that do not change the sequence of amino acids, for example, glycosylated, acetylated and phosphorylated forms.
  • a polypeptide or protein, for purposes of the present invention may be synthetically or recombinantly produced, as well as isolated from natural sources.
  • KGF keratinocyte growth factor
  • keratinocyte growth factor refers to a member of a group of the FGF family of proteins which is capable of binding to FGFR-2, lacks significant activity on fibroblasts, is uniquely specific for epithelial cells and is particularly active on keratmocytes.
  • KGF may be synthetically or recombinantly produced.
  • KGF may be isolated from natural sources, such as from any of several tissues of any mammalian source, for example from human tissues.
  • KGF 163 refers to the mature polypeptide that contains 163 amino acid residues, as shown in Figure 1.
  • KGF fragment refers to a polypeptide derived from
  • KGFi 63 that does not include the entire sequence of KGF 163 .
  • Such a fragment may be a truncated version of the full-length molecule, as well as an internally deleted polypeptide.
  • a KGF fragment may have KGF bioactivity as determined by the Balb/MK bioactivity assay, described in Example 4 herein.
  • the Balb/MK cell line (Weissman, B. E. and Aaronson, S. A. Cell (1983) 32:599-606) is a clonal Balb/c mouse keratinocyte cell line.
  • KGF fragments and analogs are measured by determining the ED 50 value using Balb/Mk cells, said value defined by the concentration of KGF fragment that causes half maximal stimulation of cell proliferation. Additionally, the KGF fragments of the invention specifically stimulate epithelial cell proliferation.
  • DNA synthesis stimulation expressed as the ratio of stimulated synthesis over background incorporation of thymidine in the absence of added test sample, is compared to analogous stimulation observed in cells other than keratmocytes under the same assay conditions.
  • the activity of the KGF fragments and analogs can also be tested on endothelial cells, such as adult bovine aortic endothelial cells (ABAE) or adrenal cortex-derived capillary endothelial cells (ACE), as described in Example 5 herein.
  • endothelial cells such as adult bovine aortic endothelial cells (ABAE) or adrenal cortex-derived capillary endothelial cells (ACE), as described in Example 5 herein.
  • a KGF polypeptide or analog that "specifically stimulates epithelial cell proliferation” may be a molecule that, at saturating concentrations, (i) in the Balb/Mk assay described in Example 4 herein, can stimulate the final cell number per well after 7 days in culture to a level at least 4-fold higher than the cell number achieved in wells receiving no KGF; and (ii) in the ABAE or ACE assay described in Example 5 herein, does not significantly stimulate the final cell number per well after 7 days in culture to a level higher than the cell number achieved in wells receiving no KGF.
  • U.S. Patent No. 5,731,170 incorporated by reference herein in its entirety, reports that certain molecules display KGF mitogenic activity with marked specificity for keratinocytes as opposed to fibroblasts.
  • the fragments of the present invention will display enhanced activity on a per molecule basis relative to KGF 163 , such as anywhere from 10%o or more activity, such as
  • the KGF fragments of the present invention may be used in compositions in lesser amounts than would be necessary using KGF 163 .
  • the inventors herein recognize that truncations produce molecules of lower molecular weight than full-length KGF. As shown below in the Examples, these species are more active when compared on a per molecule basis (i.e., when activity is adjusted for the molecular weight). Particular KGF fragments are described in detail below.
  • analog refers to derivatives of the reference molecule.
  • the analog may retain biological activity, as described above.
  • analog refers to compounds having a native polypeptide sequence and structure with one or more amino acid additions, substitutions (generally conservative in nature) and/or deletions, relative to the native molecule, so long as the modifications do not destroy activity.
  • the analog has at least the same biological activity as the parent molecule, and may even display enhanced activity over the parent molecule.
  • amino acids are generally divided into four families: (1) acidic ⁇ aspartate and glutamate; (2) basic — lysine, arginine, histidine; (3) non-polar — alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and
  • the polypeptide of interest may include up to about 1-70 conservative or non-conservative amino acid substitutions, such as I, 2, 3, 4, 5-50, 15-25, 5-10, or any integer between 1-70, so long as the desired function of the molecule remains intact.
  • conservative or non-conservative amino acid substitutions such as I, 2, 3, 4, 5-50, 15-25, 5-10, or any integer between 1-70, so long as the desired function of the molecule remains intact.
  • regions of the molecule of interest that can be modified with a reasonable likelihood of retaining biological activity as defined herein.
  • Fragments which retain portions of the N-terminal sequence are more tolerable to amino acid additions, deletions and substitutions.
  • Preferred deletions include deletions of the first 22, 23 and 24 amino acids, as described further below.
  • One of skill in the art can readily determine other regions that will tolerate change based on the known structure of KGF (see, e.g., Osslund et al.
  • KGF Protein Sci. (1998) 7:1681-1690), as well as the known stracture/function relationships between KGF and related molecules such as acidic FGF, basic FGF and kaposi FGF (see, e.g., Gospodarowicz et al., J Cell. Physiol. (1990) 142:325-333).
  • purified and isolated is meant, when referring to a polypeptide or polynucleotide, that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type.
  • purified as used herein preferably means at least 75% by weight, more preferably at least 85% by weight, more preferably still at least 95%) by weight, and most preferably at least 98% by weight, of biological macromolecules of the same type are present in the sample.
  • isolated polynucleotide which encodes a particular polypeptide refers to a nucleic acid molecule which is substantially free of other nucleic acid molecules that do not encode the subject polypeptide; however, the molecule may include some additional bases or moieties which do not deleteriously affect the basic characteristics of the composition.
  • a “recombinant polypeptide” is intended a polypeptide which has been prepared by recombinant DNA techniques as described herein.
  • the gene coding for the desired polypeptide is cloned and then expressed in transformed organisms, as described further below.
  • the host organism expresses the foreign gene to produce the polypeptide under expression conditions.
  • the promoter controlling expression of an endogenous polypeptide can be altered to render a recombinant polypeptide. It is particularly advantageous to produce polypeptides recombinantly as recombinant production generally allows for higher yields from less starting material, and renders a far purer product.
  • the polypeptides of the invention can be produced in the absence of other molecules normally present in cells.
  • human polypeptide compositions free of any trace of human protein contaminants can be readily obtained because the only human protein produced by a recombinant non-human host cell is the recombinant human polypeptide.
  • Potential viral agents from natural sources and viral components pathogenic to humans are also avoided.
  • polynucleotide or "nucleic acid molecule” as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule and thus includes double- and single-stranded DNA and RNA.
  • modifications for example, labels which are known in the art, methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example proteins (including for e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelates (e.g., metals, radioactive metals, boron, oxida- tive metals, etc.), those containing alkylators, those with modified linkages (e.g., labels which are known
  • recombinant DNA molecule or “recombinant polynucleotide” are used herein to refer to a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation: (1) is not associated with all or a portion of a polynucleotide with which it is associated in nature, (2) is linked to a polynucleotide other than that to which it is linked in nature, or (3) does not occur in nature.
  • the term encompasses “synthetically derived” nucleic acid molecules.
  • a "coding sequence” is a nucleic acid molecule which is translated into a polypeptide, usually via mRNA, when placed under the control of appropriate regulatory sequences.
  • control sequences refer to nucleic acid sequences which are necessary to effect the expression of coding sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence; in eukaryotes, generally, such control sequences include promoters and transcription termination sequences.
  • control sequences is intended to include, at a minimum, all components necessary for expression of a coding sequence, and may also include additional components, for example, leader sequences and fusion partner sequences.
  • a control element such as a promoter "directs the transcription" of a coding sequence in a cell when RNA polymerase will bind the promoter and transcribe the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.
  • operably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
  • a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
  • the control elements need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter and the coding sequence and the promoter can still be considered “operably linked" to the coding sequence.
  • expression cassette refers to a molecule comprising at least one coding sequence operably linked to a control sequence which includes all nucleotide sequences required for the transcription of cloned copies of the coding sequence and the translation of the mRNAs in an appropriate host cell.
  • Such expression cassettes can be used to express eukaryotic genes in a variety of hosts such as bacteria, blue-green algae, plant cells, yeast cells, insect cells and animal cells.
  • expression cassettes can include, but are not limited to, cloning vectors, specifically designed plasmids, viruses or virus particles.
  • the cassettes may further include an origin of replication for autonomous replication in host cells, selectable markers, various restriction sites, a potential for high copy number and strong promoters.
  • vector any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences between cells.
  • vector includes cloning and expression vehicles, as well as viral vectors.
  • a cell has been "transformed" by an exogenous polynucleotide when the polynucleotide has been introduced inside the cell membrane.
  • the exogenous polynucleotide may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
  • the exogenous DNA may be maintained on an episomal element, such as a plasmid.
  • a stably transformed cell is one in which the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication.
  • a "host cell” is a cell which has been transformed, or is capable of transformation, by an exogenous nucleic acid molecule.
  • Homology refers to the percent similarity between two polynucleotide or two polypeptide moieties.
  • Two DNA, or two polypeptide sequences are "substantially homologous" to each other when the sequences exhibit at least about 50% , preferably at . least about 70% to 75%, more preferably at least about 80%-85%, preferably at least about 90%, and most preferably at least about 95%-98% sequence homology, or any percent homology between the specified ranges, over a defined length of the molecules.
  • substantially homologous also refers to sequences showing complete identity to the specified DNA or polypeptide sequence.
  • identity refers to an exact nucleotide-to-nucleotide or amino acid-to- amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100.
  • Naturally or non-naturally occurring protein variants have amino acid sequences which are at least 70%, 80%, 85%), 90%) or 95%> or more homologous to the particular KGF fragment derived from Figure 1. More preferably, the molecules are 98% or 99%) homologous. Percent homology is determined using the Smith- Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. The Smith- Waterman homology search algorithm is taught in Smith and Waterman, Adv. Appl. Math. 2:482-489 (1981).
  • homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments.
  • DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid
  • an effective amount refers to a nontoxic but sufficient amount of the agent to provide the desired biological result. That result can be reduction and/or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system.
  • an effective amount of a pharmaceutically effective amount refers to a nontoxic but sufficient amount of the agent to provide the desired biological result. That result can be reduction and/or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system.
  • an effective amount of a pharmaceutically effective amount refers a nontoxic but sufficient amount of the agent to provide the desired biological result. That result can be reduction and/or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system.
  • an effective amount of a pharmaceutically effective amount refers to a nontoxic but sufficient amount of the agent to provide the desired biological result. That result can be reduction and/or alleviation of the signs, symptoms, or causes of a disease, or any other desired
  • KGF fragment for use with the present methods is an amount sufficient to stimulate epithelial cell stimulation or proliferation, and preferably an amount sufficient to cause increased healing of wounds and/or bums, and other disorders where epithelial cell proliferation is desired. Such amounts are described below. An appropriate "effective" amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.
  • pharmaceutically acceptable or “pharmacologically acceptable” is meant a material which is not biologically or otherwise undesirable, i.e., the material may be administered to an individual without causing any undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.
  • physiological pH or a “pH in the physiological range” is meant a pH in the range of approximately 7.0 to 8.0 inclusive.
  • Preferred physiological pH is in the range of approximately 7.2 to 7.6 inclusive.
  • the term "subject” encompasses mammals and non-mammals.
  • mammals include, but are not limited to, any member of the Mammalia class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like.
  • non-mammals include, but are not limited to, birds, fish and the like. The term does not denote a particular age or gender.
  • compositions and methods similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein.
  • the present invention is based on the discovery that certain KGF polypeptide fragments and analogs of these fragments, which retain only a portion of the full-length sequence, show enhanced bioactivity relative to the full-length sequence.
  • smaller amounts of the polypeptide may be used in compositions than would be necessary with the full-length molecule.
  • the present invention particularly relates to compositions comprising KGF fragments which exhibit an increase in bioactivity relative to KGF ⁇ 63 as determined by the Balb/MK bioactivity assay specified herein and which specifically stimulate epithelial cell proliferation.
  • activity of the KGF fragments and analogs is measured by determining the ED 50 value using Balb/Mk cells, said value defined by the concentration of KGF fragment that causes half maximal stimulation of cell proliferation.
  • the cells are cultured for 7 days, as described below in the examples.
  • the bioactivity of the KGF fragments herein is preferably at least about 1.2 to 1.5-fold, preferably, about 2-fold and, more preferably, about 2- to 10-fold greater or more than that of the full-length KGF protein, when compared in the cell proliferation assay, and may be as much as 10- to
  • the polypeptides of the subject invention allow the use of 90% or less, such as 5%- 90%, or 10%-50%, or any number therebetween, on a per molecule basis (i.e., adjusted for the molecular weight) of the amount of KGF I63 that would be necessary in corresponding compositions to achieve the same biological results.
  • polypeptides for use herein include but are not limited to the following:
  • KGF desl.15 consisting of the contiguous amino acid sequence depicted at amino acid residues 16-163, inclusive, of Figure 1; an analog of KGF desM5 consisting of the contiguous amino acid sequence depicted at amino acid residues 16-163, inclusive, of Figure 1 and having an additional N-terminal methionine;
  • KGF desl.18 consisting of the contiguous amino acid sequence depicted at amino acid residues 19-163, inclusive, of Figure 1; an analog of KGF desM8 consisting of the contiguous amino acid sequence depicted at amino acid residues 19-163, inclusive, of
  • KGF desl . I9 consisting of the contiguous amino acid sequence depicted at amino acid residues 20-163, inclusive, of Figure 1; an analog KGF desM9 consisting of the contiguous amino acid sequence depicted at amino acid residues 20-163, inclusive, of Figure 1 with an additional N-terminal methionine;
  • KGF desl.20 consisting of the contiguous amino acid sequence depicted at amino acid residues 21-163, inclusive, of Figure 1; an analog of KGF desl.20 consisting of the contiguous amino acid sequence depicted at amino acid residues 21-163, inclusive, of Figure 1 with an additional N-terminal methionine;
  • KGF des ⁇ _ 21 consisting of the contiguous amino acid sequence depicted at amino acid residues 22-163, inclusive, of Figure 1; an analog of KGF desl . 21 consisting of the contiguous amino acid sequence depicted at amino acid residues 22-163, inclusive, of Figure 1 with an additional N-terminal methionine;
  • KGF desl _ 22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1; an analog of KGF desl _ 22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1 with an additional N-terminal methionine; an analog of KGF desl.22 consisting of the contiguous amino acid sequence depicted at amino acid residues 23-163, inclusive, of Figure 1 with the N-terminal arginine residue substituted with an alanine residue; KGF desl _ 24 consisting of the contiguous amino acid sequence depicted at amino acid residues 25-163, inclusive, of Figure 1; an analog of KGF desl _ 24 consisting of the contiguous amino acid sequence depicted at amino acid residues 25-163, inclusive, of Figure 1 with an additional N-terminal methionine; and KGF desl _ 25 consisting of the contiguous amino acid sequence depicted at amino acid residues 26-163, inclusive, of Figure 1
  • biologically active analogs of the above-specified fragments wherein the biologically active analogs consist of the same number of amino acids as the above fragments and have at least about 50% , preferably at least about 70%>, preferably at least about 75%, preferably at least about 80%, preferably at least about 85%>, preferably at least about 90%, preferably at least about 95%, and preferably at least about 98% sequence homology thereto, as determined as described above.
  • the biologically active analog may be an analog of KGF des.15 that consists of 148 amino acids and has at least 70% sequence homology thereto; an analog of KGF des.18 that consists of 145 amino acids and has at least 70% sequence homology thereto; an analog of KGF des.19 that consists of 144 amino acids and has at least 70% > sequence homology thereto; an analog of KGF des.20 that consists of 143 amino acids and has at least 70% sequence homology thereto; an analog of KGF des.21 that consists of 142 amino acids and has at least 70%> sequence homology thereto; an analog of KGF des.22 that consists of 141 amino acids and has at least 70% sequence homology thereto; an analog of KGF des _ 24 that consists of 139 amino acids and has at least 70% sequence homology thereto; and an analog of KGF des _ 25 that consists of 138 amino acids and has at least 10% sequence homology thereto.
  • compositions will vary depending on the particular fragment of interest. In general, compositions will comprise about 90%>, or less, even 75%), or less, 50%o, or less, 35%, or less, 25%, or less, or 10%) or less, on a per molecule basis (i.e., adjusted for molecular weight), of the amount of KGF, 63 in a corresponding composition that would be necessary to achieve the desired result, such as to promote epithelial cell division and/or proliferation.
  • compositions described herein may include 5%-90%, or 10%-90%, or 10%-75%, or 10%-50%, or 10%-25%, or 10%-20% on a per molecule basis, of the amount of KGF 163 in a corresponding composition that would be necessary to achieve the desired result. It is to be understood that particular percentages between these ranges are also contemplated herein.
  • the KGF fragment is KGF des 5 , KGF desM8 , KGF desM9 , KGF desl.20 , KGF desl.2 together KGF desl _ 22 , KGF desl _ 24 , KGF desl . 25 , or polypeptides derived from these molecules, the amount may be 75%, or less, such as 10% to 75%. If the KGF fragment is KGF desl _ 22 or KGF desl _ 24 , or polypeptides derived from these molecules, the amount used may 50%, or less, or even 25%, or 20%, or less, such as 5%> to 50%.
  • the amount may be 10%, or less, such as 2% to 10%> of the amount required of KGF 163 to achieve an equivalent therapeutic response. Appropriate amounts are discussed in detail below.
  • the KGF fragments of the present invention are produced by recombinant technology, particularly in the case of large-scale commercial production. Recombinant DNA molecules and expression vectors encoding the polypeptides of the present invention can be made and the genes expressed by conventional gene expression technology using methods well-known in the art, as discussed in more detail below. Analogs of particular KGF fragments may also be made recombinantly, for example, by site-directed mutagenesis. Thus, all references to embodiments of the present invention as they relate to particular KGF fragments apply equally to analogs of the fragments.
  • the KGF fragment can be made by isolating native, mature KGF from cells producing the same, such as M426 human embryonic fibroblasts (Aaronson, S. A. and Todaro, G. J. Virology (1968) 36:254-261), using techniques described in, e.g., U.S. Patent No. 5,731,170. N-terminal amino acid residues can then be deleted from the recovered molecule. Such deletion can be performed by any conventional techniques known in the art.
  • polypeptides for use in the subject compositions can be synthesized chemically, by any of several techniques that are known to those skilled in the peptide art. See, e.g., J. M. Stewart and J. D.
  • polypeptides of the present invention can also be chemically prepared by the method of simultaneous multiple peptide synthesis. See, e.g., Houghten Proc. Natl.
  • the KGF fragments can be made by isolating the coding sequence of native KGF 163 , deleting the codons that encode the amino acid residues to be deleted, inserting the modified coding sequence into an expression vector, transforming host cells with the expression vector to produce the recombinant KGF fragments and analogs, and isolating the recombinant KGF fragment using conventional purification techniques.
  • the coding sequence of the KGF fragment can be obtained by conventional techniques, including the isolation of the coding sequence of KGF 163 from a cDNA library known to contain such, and deleting therefrom the sequence encoding the portion of amino acid residues to be deleted. Deletion of the coding sequence of the N-terminal amino acids can be accomplished in vivo or in vitro. The former can be achieved, for example, by expression of the KGF 163 coding sequence in an appropriate expression system. The latter can be achieved by known PCR techniques using primers that exclude the N-terminal sequences.
  • polypeptides for use in the present compositions are produced recombinantly, by expression of a polynucleotide encoding the same.
  • Methods for the recombinant production of KGF fragments are well known. See, e.g., U.S. Patent Nos. 5,611,218, 5,773,586, 5,843,883, 5,863,767 and 6,074,848, all to Gospodarowicz et al.; International Publications WO 96/11951 and WO 96/11949; and Osslund et al. Protein Sci. (1998) 7:1681-1690.
  • the molecules for use with the present invention can be made using standard techniques of molecular biology.
  • polynucleotide sequences coding for the above-described molecules can be obtained using recombinant methods, such as by screening cDNA and genomic libraries from cells expressing the gene, or by deriving the gene from a vector known to include the same.
  • the desired gene can be isolated directly from cells and tissues containing the same, using standard techniques, such as phenol extraction and PCR of cDNA or genomic DNA. See, e.g., Sambrook et al., supra, for a description of techniques used to obtain and isolate DNA.
  • the gene of interest can also be produced synthetically, rather than cloned.
  • the molecules can be designed with appropriate codons for the particular sequence.
  • nucleotide sequences can be obtained from vectors harboring the desired sequences or synthesized completely or in part using various oligonucleotide synthesis techniques known in the art, such as site-directed mutagenesis and polymerase chain reaction (PCR) techniques where appropriate. See, e.g., Sambrook, supra.
  • PCR polymerase chain reaction
  • one method of obtaining nucleotide sequences encoding the desired sequences is by annealing complementary sets of overlapping synthetic oligonucleotides produced in a conventional, automated polynucleotide synthesizer, followed by ligation with an appropriate DNA ligase and amplification of the ligated nucleotide sequence via PCR. See, e.g., Jayaraman et al.
  • Suitable vectors include, but are not limited to, plasmids, phages, transposons, cosmids, chromosomes or viruses which are capable of replication when associated with the proper control elements.
  • the coding sequence is then placed under the control of suitable control elements, depending on the system to be used for expression.
  • the coding sequence can be placed under the control of a promoter, ribosome binding site (for bacterial expression) and, optionally, an operator, so that the DNA sequence of interest is transcribed into RNA by a suitable transformant.
  • the coding sequence may or may not contain a sequence coding for a signal peptide or leader sequence which can later be removed by the host in post-translational processing. See, e.g., U.S. Patent Nos. 4,431,739; 4,425,437; 4,338,397. If a signal sequence is present, it can either be the native sequence or it may be a heterologous signal sequence.
  • regulatory sequences which allow for regulation of the expression of the sequences relative to the growth of the host cell.
  • Regulatory sequences are known to those of skill in the art, and examples include those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
  • Other types of regulatory elements may also be present in the vector.
  • enhancer elements may be used herein to increase expression levels of the constructs. Examples include the SN40 early gene enhancer (Dijkema et al. (1985) EMBO J. 4:761), the enhancer/promoter derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus (Gorman et al.
  • the expression cassette may further include an origin of replication for autonomous replication in a suitable host cell, one or more selectable markers, one or more restriction sites, a potential for high copy number and a strong promoter.
  • An expression vector is constructed so that the particular coding sequence is located in the vector with the appropriate regulatory sequences, the positioning and orientation of the coding sequence with respect to the control sequences being such that the coding sequence is transcribed under the "control" of the control sequences (i.e., RNA polymerase which binds to the DNA molecule at the control sequences transcribes the coding sequence).
  • control sequences i.e., RNA polymerase which binds to the DNA molecule at the control sequences transcribes the coding sequence.
  • Modification of the sequences encoding the molecule of interest may be desirable to achieve this end. For example, in some cases it may be necessary to modify the sequence so that it can be attached to the control sequences in the appropriate orientation; i.e., to maintain the reading frame.
  • the control sequences and other regulatory sequences may be ligated to the coding sequence prior to insertion into a vector.
  • the coding sequence can be cloned directly into an expression vector which already contains the control sequences and an appropriate restriction site.
  • Mutants or analogs may be prepared by the deletion of a portion of the sequence encoding the KGF fragment, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence.
  • Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, and the like, are well known to those skilled in the art. See, e.g., Sambrook et al., supra; Kunkel, T.A. (1985) Proc. Natl. Acad. Sci. USA (1985) 82:448; Geisselsoder et al. (1987) BioTechniques 5:786; Zoller and Smith (1983) Methods Enzymol. 100:468; Dalbie-McFarland et al. (1982) Proc. Natl.
  • the molecules can be expressed in a wide variety of systems, including insect, mammalian, bacterial, viral and yeast expression systems, all well known in the art.
  • insect cell expression systems such as baculovirus systems, are known to those of skill in the art and described in, e.g., Summers and Smith, Texas Agricultural
  • mammalian cell lines are known in the art and include immortalized cell lines available from the American Type Culture Collection (ATCC), such as, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human embryonic kidney cells, human hepatocellular carcinoma cells (e.g., Hep G2), Madin-Darby bovine kidney (“MDBK”) cells, as well as others.
  • ATCC American Type Culture Collection
  • CHO Chinese hamster ovary
  • HeLa cells HeLa cells
  • BHK baby hamster kidney
  • COS monkey kidney cells
  • human embryonic kidney cells e.g., Hep G2
  • MDBK Madin-Darby bovine kidney
  • bacterial hosts such as E. coli, Bacillus subtilis, and Streptococcus spp., will find use with the present expression constructs.
  • Yeast hosts useful in the present invention include inter alia, Saccharomyces cerevisiae, Candida albicans, Candida maltosa, Hansenula polymorpha, Kluyveromyces fragilis, Kluyveromyces lactis, Pichia guillerimondii, Pichiapastoris, Schizosaccharomyces pombe and Yarrowia lipolytica.
  • Insect cells for use with baculovirus expression vectors include, inter alia, Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster, Spodopterafi'ugiperda, and Trichoplusia ni.
  • Intracellular expression of the truncated KGF polypeptides and analogs thereof in yeast is particularly desirable. Such systems avoid problems which may arise with purification from bacteria, such as E. coli, including the presence of large amounts of DNA, endotoxins, and protein contaminants. Moreover, naturally occurring yeast enzymes efficiently cleave the N-terminal methionine which may be present when the molecules are recombinantly produced and there is no need to overexpress the enzyme when a yeast system is used. Additionally, although KGF is a naturally secreted protein, when native and truncated KGF, and analogs thereof, are produced internally in yeast without secretion, they are soluble, properly folded and active.
  • Nucleic acid molecules comprising nucleotide sequences of interest can be stably integrated into a host cell genome or maintained on a stable episomal element in a suitable host cell using various gene delivery techniques well known in the art. See, e.g., U.S. Patent No. 5,399,346.
  • the molecules are produced by growing host cells transformed by an expression vector described above under conditions whereby the protein is expressed. The expressed protein is then isolated from the host cells and purified. If the expression system secretes the protein into growth media, the product can be purified directly from the media. If it is not secreted, it can be isolated from cell lysates. The selection of the appropriate growth conditions and recovery methods are within the skill of the art.
  • the KGF fragments are then formulated into pharmaceutical compositions, described further below, for delivery to a subject.
  • polynucleotides encoding the polypeptide of interest may be delivered directly to the subject and expressed in vivo.
  • retroviruses provide a convenient platform for gene delivery systems.
  • a selected nucleotide sequence encoding the desired polypeptide can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to a subject.
  • retroviral systems have been described (U.S. Patent No. 5,219,740; Miller and Rosman (1989) BioTechniques 7:980-990; Miller, A.D. (1990) Human Gene Therapy 1:5- 14; Scarpa et al. (1991) Virology 180:849-852; Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-8037; and Boris-Lawrie and Temin (1993) Cur. Opin. Genet. Develop. 3:102-109.
  • adenovirus vectors A number of suitable adenovirus vectors have also been described. Unlike retroviruses which integrate into the host genome, adenoviruses persist extrachromosomally thus minimizing the risks associated with msertional mutagenesis (Haj-Ahmad and Graham (1986) J Virol. 57:267-274; Bett et al. (1993) J. Virol. 67:5911- 5921; Mittereder et al. (1994) Human Gene Therapy 5:717-729; Seth et al. (1994) J Virol.
  • AAV vector systems have been developed recently for gene delivery. Such systems can include control sequences, such as promoter and polyadenylation sites, as well as selectable markers or reporter genes, enhancer sequences, and other control elements which allow for the induction of transcription.
  • AAV vectors can be readily constructed using techniques well known in the art. See, e.g., U.S. Patent Nos. 5,173,414 and 5,139,941; international Publication Nos.
  • Additional viral vectors which will find use for delivering the nucleic acid molecules encoding the molecules of the present invention by gene transfer include those derived from the pox family of viruses, such as vaccinia virus and avian poxvirus. See, e.g., International Publication Nos. WO 91/12882; WO 89/03429; and WO 92/03545.
  • Alphavirus genus such as but not limited to vectors derived from the Sindbis and Semliki Forest viruses, will also find use as viral vectors for delivering the gene of interest.
  • vectors derived from the Sindbis and Semliki Forest viruses will also find use as viral vectors for delivering the gene of interest.
  • Sinbus-virus derived vectors useful for the practice of the instant methods, see, Dubensky et al, J. Virol. (1996) 70:508-519; and International
  • the gene of interest can also be delivered without a viral vector.
  • the gene can be packaged in liposomes prior to delivery to the subject or to cells derived therefrom, with or without the accompanying antigen.
  • Lipid encapsulation is generally accomplished using liposomes which are able to stably bind or entrap and retain nucleic acid.
  • liposomes as carriers for delivery of nucleic acids, see, Hug and Sleight, Biochim. Biophys. Ada. (1991) 1097:1-17: Straubinger et al., in Methods ofEnzymology (1983), Vol. 101, pp. 512-527.
  • the KGF fragments of the present invention can be used for identification of receptor recognition sites as well as for the design of peptide agonists or antagonists.
  • the truncated molecules and analogs thereof are a preferred agent of choice for wound healing applications, particularly where there is a desire to promote re- epithehalization of the skin.
  • the truncated KGF molecules are also particularly useful in corneal epithelial repair. Other uses of the molecules include applications that utilize the specificity for epithelial cells found in the gastrointestinal tract.
  • the fragments of the present invention may be conjugated to other molecules suitable for its intended use.
  • the KGF polypeptides can be conjugated to a toxin molecule, such as ricin A, diphtheria toxin, or saporin for destruction of its target cell, i.e., epithelial cells, particularly, keratmocytes.
  • a toxin molecule such as ricin A, diphtheria toxin, or saporin for destruction of its target cell, i.e., epithelial cells, particularly, keratmocytes.
  • Such KGF toxin conjugates suitable for use herein can be produced by methods known in the art, for example, U.S. Pat. Nos. 4,771,128, 4,808,705, and 4,894,443 and International Publication No. WO 92/04918.
  • compositions of the invention comprise the molecules described above, together with one or more pharmaceutically acceptable excipients or vehicles, and optionally other therapeutic and/or prophylactic ingredients.
  • excipients include liquids such as water, saline, glycerol, polyethyleneglycol, hyaluronic acid, ethanol, etc. Suitable excipients for nonliquid formulations are also known to those of skill in the art.
  • Pharmaceutically acceptable salts can be used in the compositions of the present invention and include, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
  • mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like
  • organic acids such as acetates, propionates, malonates, benzoates, and the like.
  • a biological buffer can be virtually any solution which is pharmacologically acceptable and which provides the formulation with the desired pH, i.e., a pH in the physiologically acceptable range.
  • buffer solutions include saline, phosphate buffered saline, Tris buffered saline, Hank's buffered saline, and the like.
  • compositions are those which are applied topically, such as ointments, pastes, powders, dressings, creams and plasters.
  • topical compositions may also include topical anesthetics, such as but not limited to, benzocaine, lidocaine, dibucaine, dyclonine hydrochloride, pramoxine hydrochloride, proparacaine hydrochloride, tetracaine, benoxinate hydrochloride, butamben picrate, clove oil and eugenol, as well as combinations and derivatives of the above.
  • Ophthalmic compositions for direct delivery for the eye are also of particular use with the KGF fragments of the invention. See, e.g., Remington's Pharmaceutical Sciences, 18th Edition (Easton,
  • compositions of the invention are generally administered topically or ophthalmically.
  • other modes of administration include parenteral administration, for example, intravenously, intra- arterially, intra-articularly (e.g., into the knee), subcutaneously, intradermally, intramuscularly, transdermally, intranasally, mucosally, and by aerosol administration.
  • the composition can be administered by inhalation, e.g., as a nasal or mouth spray or aerosol.
  • the compositions may also be delivered in situ, e.g., by implantation. A pharmaceutically or therapeutically effective amount of the composition will be delivered to the subject.
  • the precise effective amount will vary from subject to subject and will depend upon the species, age, the subject's size and health, the nature and extent of the condition being treated, recommendations of the treating physician, and the therapeutics or combination of therapeutics selected for administration. Thus, the effective amount for a given situation can be determined by routine experimentation.
  • a therapeutic amount if administered topically will be in the range of about 0.1 ⁇ g/cm 2 of wound to approximately 500 ⁇ g/cm 2 of wound, preferably about 1 ⁇ g/cm 2 of wound to approximately 100 ⁇ g/cm 2 of wound, more preferably about 1-10 ⁇ g/cm 2 of wound to approximately 50 ⁇ g/cm 2 , or any integer between these values, such as 21, 22, 23, 24...30, 31, 32, 33, 34...40, 41, 43...50...60..., and so on.
  • typical doses will be in the range of about 0.01 ⁇ g/kg body weight/day to about 100 ⁇ g/kg/day, more preferably about 0.1 ⁇ g/kg/day to about 80 ⁇ g/kg/day, more preferably 1 ⁇ g/kg/day to about 40 ⁇ g/kg/day in one or more doses.
  • the doses will be at least an order of magnitude lower.
  • the subject may be administered as many doses as is required to reduce and/or alleviate the signs, symptoms, or causes of the disorder in question, or bring about any other desired alteration of a biological system.
  • the amount of KGF fragment present in the subject composition is an amount less than the amount of KGF 163 necessary in order to obtain an equivalent response. This amount is readily determined by comparing the bioactivity of the fragment in question to that of KGF 163 , as described above.
  • Enzymes were purchased from commercial sources, and used according to the manufacturers' directions. Radionucleotides and nitrocellulose filters were also purchased from commercial sources.
  • the expression vectors included the particular truncated KGF coding sequence under the control of the ADH2/GAPDH promoter, a hybrid yeast promoter.
  • two oligos were used (see below), a top strand and a bottom strand.
  • the oligos were annealed and then placed in a ligation reaction.
  • the ligation reactions included the plasmid pSI3, cut at Nco and Sal sites, a Kpn/Sal fragment, encoding a truncated KGF and one of the annealed oligo pairs.
  • Plasmid pSI3 is a derivative of pYASIl, which was deposited with the ATCC, Manassas, VA, on
  • the various oligos for the completed truncated KGFs were as follows.
  • the "X" in the oligo sequences represents a 5' phosphate group.
  • SGEdesl-22 5' XCATGAGAAGTTATGATTACATGGAAGGAGGGGATATAAGAGTGAGAAGA CTCTTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:l 1)
  • KGF d es l - 35 5' XCATGAGAAGACTCTTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:21)
  • KGF mature, full-length KGF
  • KGF desl _ 23 a truncated KGF molecule with a deletion of the first 23 N-terminal amino acids
  • Transformants were incubated overnight in 5 ml of leucine-deficient media with 5% glucose at 30°C in a shaking apparatus.
  • the culture for production of the recombinant truncated molecules was a 20 ml culture, seeded with the overnight culture in YEP medium with 2% glucose for approximately 72 hours.
  • Example 3 Purification of the Truncated Recombinant KGF Molecules The cultures from above were centrifuged to form a yeast cell paste and cells were lysed in 10 mM MgCl 2 , 50 mM Tris, pH 8.0, 0.1 M dithiothrietol (DTT), using standard techniques. The cell lysate was generated as a batch, using glass beads in a Dynomill
  • HS Heparin Sepharose
  • the lysed product was allowed to run for approximately 30 minutes at 4°C through a 30 ml bed of HS resin.
  • the column was equilibrated in a buffer containing 0.5 M NaCl, 0.1 M DTT and 10 mM Tris-HCl at pH 7.3. Once the cell lysate was loaded, the column was washed extensively with the equilibration buffer until the absorbance at 280 mn returned to baseline. Protein was eluted from the HS column with an increasing step-wise NaCl gradient.
  • the NaCl concentrations were 1 M and 2 M NaCl, in 10 mM Tris-HCl at pH 7.3, 0.1 M DTT.
  • the flow rate of the column during elution was approximately 90 ml/hr and 4 ml size fractions were collected.
  • the fractions were tested for KGF bioactivity utilizing Balb/Mk cells. The assay is described below. The fractions with the highest bioactivity were eluted with 1 M NaCl and were pooled. Before the pooled fractions were loaded onto the next column, the fractions were dialyzed overnight against 0.2 M NaCl, 10 mM Tris-HCl at pH 7.3.
  • the pooled fractions eluted from the HS column were loaded with a Super loop onto a Mono S column linked to a fast high pressure liquid chromatography (FPLC) system (Pharmacia, Piscataway, N.J.).
  • FPLC fast high pressure liquid chromatography
  • the Mono S cation exchange column was equilibrated with 10 mM Tris at pH 7.3.
  • the column was washed extensively at a flow rate of 1 ml/min. with the equilibration buffer until the absorbance returned to baseline.
  • protein was eluted from the column with a linear NaCl gradient, 0.2 M to 1 M NaCl in 10 mM Tris, at pH 7.3 at a flow rate of 1 ml/min., and 1 ml fractions were collected.
  • a major protein peak eluted at about 0.6 M NaCl. Fractions across the protein peak were assayed for bioactivity and active fractions were pooled and subjected to SDS-PAGE analysis. The protein concentration of the pooled fractions was determined by Bradford assay according to instructions accompanying the protein assay kit from BioRad (Richmond, Calif, USA).
  • stock cultures of Balb/Mk cells were grown and maintained in low calcium Dulbecco's modified Eagle medium (DMEM) supplemented with 10%> fetal bovine serum, 0.25 ⁇ g/ml fungizone, and 10 ng/ml acidic FGF (aFGF). The cells were incubated at 37°C in a 10% CO 2 atmosphere with 99% humidity.
  • DMEM Dulbecco's modified Eagle medium
  • aFGF acidic FGF
  • the cells were seeded in 12-well plates at a density of 5 xlO 3 cells per well in 1 ml of medium as described above for the stock cultures (except that the seeding medium contained no aFGF), and as described in Gospodarowicz et al. J.
  • the cells were trypsinized and the final cell density was determined using a CoulterTM counter (Coulter Electronics, Hialeah, Fla., USA).
  • the cells were released from the plates by replacing the culture medium with a solution containing
  • the cells were incubated in this solution for 5-10 minutes at 37°C and then the stock culture medium was added to the cells. The cells were then counted using a CoulterTM counter. The final cell density was graphed as a function of column fraction protein concentration. The protein concentration was graphed on a log scale.
  • the ED 50 was calculated by (a), dividing in half the difference between the lowest and highest cell density value of the curve; and (b), determining from the graph what protein concentration corresponds to that cell density number obtained in (a).
  • aFGF acidic FGF
  • FL-KGF full-length KGF
  • KGF desl _ 35 which retained only 2-3% of the biological activity of the native form, was as active as aFGF when tested on Balb/Mk cells. Since this form is more homologous to aFGF than any of the other truncations, the question was raised as to whether this truncated form of KGF might have lost the target cell specificity peculiar to KGF. As explained above, KGF only stimulates cells of epithelial origin in contrast to other forms of FGF which have a wide range of target cells, and endothelial cells in particular.
  • KGF Bioactivity on ABAE or ACE Cells KGF can be characterized by its lack of activity on vascular endothelial cells derived from large vessels (adult bovine aortic endothelial cells, ABAE) or capillary cells (adrenal cortex-derived capillary endothelial cells, ACE) as compared with other forms of FGF, such as basic FGF (bFGF) or acidic FGF (aFGF). To analyze whether the various truncated forms of FGF retained this cell specificity, their biological activity on endothelial cells was tested.
  • ABAE adult bovine aortic endothelial cells
  • capillary cells adrenal cortex-derived capillary endothelial cells
  • FGF acidic FGF
  • ABAE and ACE cells Stock cultures of ABAE and ACE cells were grown and maintained in Dulbecco's modified Eagle medium supplemented with 10%» bovine serum, 0.25 ⁇ g/ml fungizone, and 2 ng/ml bFGF. The cells were incubated at 37°C with a 10% CO 2 concentration and 99% humidity. In the mitogenic assay, either 5 x 10 3 ABAE or ACE cells were plated per well in
  • Example 6 Thermal Stability Studies The ability of native KGF and various N-terminally truncated KGF polypeptides to withstand elevated temperatures was examined. Samples containing 0.1 mg/ml protein were prepared in Ca ⁇ Mg ++ -free PBS and 100 ⁇ l of each sample was aliquoted into 1 ml plastic vials. The vials were sealed and placed in a 37°C incubator. At predetermined time intervals, vials were withdrawn and analyzed for the loss of soluble proteins.
  • SDS-PAGE was performed on an electrophoresis system (Novex, San Diego, California, U.S.A.) using
  • Tris-glycine precast gels (5% to 20% acrylamide, according to the method of Laemmli Nature (1970) 227:680-685). Samples were mixed with reducing or non-reducing SDS sample buffer without heating before loading.
  • the proteins were detected by Coomassie blue staining.
  • the stained gels were scanned by densitometry using a BioRad Model GS 700 Imaging densitometer (Richmond, Calif, USA).
  • the amount of soluble protein was determined by integrating the stained-band area and plotting the result as a function of time of incubation at 37°C.
  • the half-life for the loss of soluble monomeric protem was then estimated from these kinetic curves.
  • the biological activity of the samples at various time intervals was also determined using the Balb/Mk cell proliferation assay as described above.
  • the half-life for biological activity of the various samples was determined by plotting the ED 50 of the samples as a function of time of incubation at 37°C.
  • KGF and 138 ⁇ g/ml KGF desl _ 23 were diluted in PBS) for periods ranging from 0 to 8 days at 37 °C. Aliquots were taken daily and their potency assessed on Balb/Mk cells, while oligomer formation was assessed by SDS-PAGE. When analyzed by SDS-PAGE, native KGF formed dimers readily. Dimerization was far less evident for KGF desl.23 . Also striking was the decrease in staining as a function of time for the monomeric form of native KGF. Again, this was far less evident for KGF desl.23
  • the cell proliferation assay indicated that under these conditions, the biological half-life of native KGF was 2 days while that of KGF desl _ 23 was 7 days.
  • KGF desl.15 , KGF desl.18 , KGF desl _ 19 , KGF desl . 20 , KGF desl . 21 , KGF desl . 22 , KGF desl . 24 , KGF desl.25 , KGF desl . 26 , KGF desl.30 and KGF desl.35 were more stable than the full-length KGF, although by varying degrees.
  • a typical stability study which lasted 24 days with samples taken every 3 days is shown in Figure 4.
  • KGF desl _ 24 and KGF desM5 100 ⁇ g/ml were diluted in PBS and incubated at 37°C. Samples were analyzed under non-reducing conditions by SDS-PAGE. Gels were then stained and scanned by densitometry.
  • native KGF 28 ⁇ g/ml
  • KGF desl _ 23 36 ⁇ g/ml
  • RP-HPLC reverse phase high pressure liquid chromatography
  • KGF was one-third that of KGF desl _ 23 .
  • the decrease in mass of native KGF was associated with a drastic decrease in biological activity.
  • native KGF had become inactive.
  • KGF desl _ 23 still retained 50% of its original biological activity (Figure 6).
  • Example 9 Is Protease Contamination Responsible for the Rapid Disappearance of Native KGF To rule out the possibility that protease contamination of the native KGF preparation, absent from the KGF desl _ 23 preparation, was responsible for the rapid disappearance of native KGF, the following experiment was done. Native KGF and
  • KGF desl.23 (100 ⁇ g/ml) were diluted in PBS and incubated at 37°C either alone or mixed at an equal ratio (v/v). Samples were taken on day 3, 6, 9 and 12 and analyzed by SDS- PAGE, as described above. After staining, the gels were scanned by densitometry. If the native KGF disappeared and KGF desl _ 23 did not, protease contamination would be ruled out.
  • KGF desl _ 23 could still be seen after 12 days, eliminating the possibility of protease contamination as a reason for the disappearance of native KGF. Surprising however, was the difference in the band-staining intensity when KGF des ⁇ .23 was incubated alone versus incubated in combination with native KGF. The staining intensity of the KGF desl.23 band was far greater when incubated alone than when mixed with the native KGF. It is possible that when KGF desl _ 23 is incubated with native KGF, complexes form and KGF desl.23 is taken out of solution.
  • KGF desl.24 had comparable thermal stability but KGF desl.24 was 10- fold more potent than native KGF while KGF desM5 was 1.5-fold more active. Therefore other mechanisms likely exist which contribute to the increased potency of the most potent molecules, KGF desl _ 22 , KGF desl _ 23 , and KGF deslstick 24 . It is also remarkable that the domain conferring maximum increase in potency is limited, consisting of three residues. These three residues may therefore provide optimum conformation of KGF in its interaction with the receptor.
  • Truncation confirms that the potency of native KGF can be changed to that of aFGF without changing cell specificity.
  • Acidic FGF is a known mitogen for Balb/Mk cells and it is 10-fold less active than KGF. This is due to its lower binding affinity for the KGF receptor. Removal of the first 30 to 35 amino acids led to a strong decrease in biological activity of the truncated polypeptides (28.5%> and 3%, respectively, of native KGF).
  • the longer deletions increase the degree of homology between aFGF and KGF and increase cell structural determinants for interacting with the FGF receptor.
  • the longer the deletions the more like aFGF the truncated KGF polypeptides behave.
  • KGF I63 Full-length KGF
  • KGF desl _ 23 an N-terminally truncated molecule
  • KGF formulations containing 5 mg/ml KGF 163 or 1 mg/ml KGF des ⁇ .23 were administered intraperitoneally to rats.
  • Colonic crypt depth in ⁇ m
  • busting pressure in mm mercury a measure of strength of the healed wound
  • 1 mg/ml of the truncated molecule was as effective or more effective than 5 mg/ml of full-length KGF in promoting wound healing. Smaller doses of the truncated molecule were also effective. Based on these results, it is likely that other N- terminally truncated KGFs, particularly KGF desl . 22 and KGF desl _ 24 , are also as effective, if not more effective, for wound healing using smaller doses than that required using KGF 163 .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Dermatology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2002/026929 2001-08-21 2002-08-21 Kgf polypeptide compositions Ceased WO2003016505A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2002326742A AU2002326742B2 (en) 2001-08-21 2002-08-21 KGF polypeptide compositions
CA002457781A CA2457781A1 (en) 2001-08-21 2002-08-21 Kgf polypeptide compositions
MXPA04001526A MXPA04001526A (es) 2001-08-21 2002-08-21 Composiciones de polipetidos kgf.
JP2003521814A JP2005500390A (ja) 2001-08-21 2002-08-21 Kgfポリペプチド組成物
EP02761479A EP1429799A4 (en) 2001-08-21 2002-08-21 KGF POLYPEPTIDE COMPOSITIONS

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US31388101P 2001-08-21 2001-08-21
US60/313,881 2001-08-21

Publications (2)

Publication Number Publication Date
WO2003016505A2 true WO2003016505A2 (en) 2003-02-27
WO2003016505A3 WO2003016505A3 (en) 2004-01-08

Family

ID=23217561

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/026929 Ceased WO2003016505A2 (en) 2001-08-21 2002-08-21 Kgf polypeptide compositions

Country Status (8)

Country Link
US (2) US7265089B2 (https=)
EP (1) EP1429799A4 (https=)
JP (2) JP2005500390A (https=)
AU (1) AU2002326742B2 (https=)
CA (1) CA2457781A1 (https=)
MX (1) MXPA04001526A (https=)
PL (1) PL374269A1 (https=)
WO (1) WO2003016505A2 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011008904A1 (en) 2009-07-17 2011-01-20 Tabor Aaron T Compositions and methods for genetic modification of cells having cosmetic function to enhance cosmetic appearance
WO2015063613A2 (en) 2013-11-01 2015-05-07 Spherium Biomed S.L. Inclusion bodies for transdermal delivery of therapeutic and cosmetic agents

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW201613622A (en) * 2014-10-14 2016-04-16 Bionet Corp Composition for skincare and pharmaceutical composition and preparation method thereof
CN109402130A (zh) * 2018-11-23 2019-03-01 成都中医药大学附属医院 一种重组人角质细胞生长因子-1及其制备方法和用途
KR20230127721A (ko) * 2022-02-25 2023-09-01 한국해양과학기술원 온도안정성을 향상시킨 fgf7 폴리펩타이드 및 그 용도

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2153816T3 (es) 1989-01-31 2001-03-16 Jeffrey S Rubin Adn que codifica un factor de crecimiento especifico contra celulas epiteliales.
US5194596A (en) 1989-07-27 1993-03-16 California Biotechnology Inc. Production of vascular endothelial cell growth factor
US5350836A (en) 1989-10-12 1994-09-27 Ohio University Growth hormone antagonists
GB2293590B (en) * 1993-03-01 1997-03-26 Kawasaki Steel Co A Stacker Crane having a Fork-lift Apparatus
US5965530A (en) 1993-03-26 1999-10-12 Amgen Inc. Therapeutic uses of keratinocyte growth factor
KR960703433A (ko) 1993-06-29 1996-08-17 로버트 피. 블랙버언 증가된 생물학적 활성을 갖는 끝이 잘린 케라틴세포성장인자(kgf) (a truncated keratinocyte growth factor(kgf) having increased biological activity)
IL115605A (en) 1994-10-13 2003-06-24 Amgen Inc Method for purifying keratinocyte growth factors
HUT78069A (hu) 1994-10-13 1999-08-30 Amgen Inc. Keratinocita növekedési faktor analógok
DE69530403T2 (de) 1994-10-13 2003-10-30 Amgen Inc., Thousand Oaks Analogen des keratinozytenwachstumfaktors
US5841605A (en) * 1996-11-06 1998-11-24 Iomega Corporation Caddy for cartridge and disk drive accomodating a caddy
EP1012186B1 (en) 1996-12-06 2002-07-17 Amgen Inc., Use of a kgf protein product(s) and a glp-2 protein product(s) for the preparation of a medicament

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011008904A1 (en) 2009-07-17 2011-01-20 Tabor Aaron T Compositions and methods for genetic modification of cells having cosmetic function to enhance cosmetic appearance
CN102471769A (zh) * 2009-07-17 2012-05-23 亚伦·T.·塔波尔 用于具有美容功能的细胞的遗传修饰以提高美容外观的方法和组合物
EP2454368A4 (en) * 2009-07-17 2013-01-09 Aaron Thomas Tabor COMPOSITIONS AND METHOD FOR THE GENETIC MODIFICATION OF COSMETIC FUNCTION CELLS FOR IMPROVING THE COSMETIC APPEARANCE PICTURE
EP4219708A3 (en) * 2009-07-17 2023-10-11 Aaron Thomas Tabor Compositions and methods for genetic modification of cells having cosmetic function to enhance cosmetic appearance
WO2015063613A2 (en) 2013-11-01 2015-05-07 Spherium Biomed S.L. Inclusion bodies for transdermal delivery of therapeutic and cosmetic agents

Also Published As

Publication number Publication date
EP1429799A4 (en) 2005-12-21
MXPA04001526A (es) 2004-05-31
PL374269A1 (en) 2005-10-03
JP2005500390A (ja) 2005-01-06
US20030109439A1 (en) 2003-06-12
AU2002326742B2 (en) 2007-05-31
US7265089B2 (en) 2007-09-04
EP1429799A2 (en) 2004-06-23
CA2457781A1 (en) 2003-02-27
JP2009221207A (ja) 2009-10-01
US20080200378A1 (en) 2008-08-21
WO2003016505A3 (en) 2004-01-08

Similar Documents

Publication Publication Date Title
EP1751184B1 (en) Fgf-21 fusion proteins
AU2005283025B2 (en) Muteins of fibroblast growth factor 21
JP6181752B2 (ja) 線維芽細胞増殖因子21変異体
US20070265200A1 (en) Glycol Linked Fgf-21 Compounds
WO2006065582A2 (en) Muteins of fibroblast growth factor 21
CA2232749C (en) Truncated glial cell line-derived neurotrophic factor
PT99565B (pt) Processo para a preparacao de factores de crescimento de fibroblastos quimerico s
US5736363A (en) IGF-II analogues
US20080200378A1 (en) KGF polypeptide compositions
AU2002326742A1 (en) KGF polypeptide compositions
EP1961821B1 (en) Erythropoietin fusion protein
AU2007214362B2 (en) KGF polypeptide compositions
CN1065875C (zh) 成纤维细胞生长因子-2结构类似物,其生产方法及应用
JPWO2009116529A1 (ja) ポリペプチドおよび当該ポリペプチドを含む医薬組成物

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VC VN YU ZW

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CH CN CU CZ DE DK EE ES FI GB GD GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MD MK MN MW MX NO NZ PL PT RO RU SE SG SI SK SL TJ TM TR TT UA UG UZ VC VN YU

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2457781

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: PA/a/2004/001526

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 374269

Country of ref document: PL

WWE Wipo information: entry into national phase

Ref document number: 2003521814

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2002326742

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2002761479

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2002761479

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 2002326742

Country of ref document: AU