WO2003004528A1

WO2003004528A1 - Human g protein-coupled receptors and uses thereof

Info

Publication number: WO2003004528A1
Application number: PCT/EP2002/000021
Authority: WO
Inventors: Frank Wattler; Sigrid Wattler; Paul Trommler; Michael C. Nehls
Original assignee: Ingenium Pharmaceuticals Ag
Priority date: 2001-07-02
Filing date: 2002-01-03
Publication date: 2003-01-16

Abstract

Novel human G protein-coupled receptor (GPcR) proteins, IGPcR18 and IGPcR32, are identified and characterized. Nucleotides encoding these GPcRs, the GPcR proteins and fusion proteins, antibodies to the receptors, host cell expression systems, animal models in which the GPcR gene is mutated, recombinant knock-out animals that do not express the GPcRs and transgenic animals that express the transgene are encompassed by the invention, as are andcompounds that modulate gene expression or receptor activity of the GPcRs, their use for drug screening and diagnosis or treatment of diseases and disorders, particularly pain, cancer and disorders of reproductive tissues.

Description

Human G protein-coupled receptors and uses thereof

Field of the Invention

The present invention relates to the field of cellular and molecular biology, protein biochemistry, and pharmacology. The invention relates particularly to the identification of the polypeptide sequence of novel G protein-coupled receptor (GPcR) proteins and the characterization of nucleic acids that encode these G protein-coupled receptors (GPcRs). GPcRs encompassed by the invention are referred to herein as IGPcRlδ and IGPcR32. The invention further relates to animal orthologues of the human gene encoding, respectively, IGPcRl 8 and IGPcR32, to expression of both human and corresponding animal proteins, to the function of the gene products and to uses for the receptor and its ligands in drug screening and in diagnosing, preventing and treating disease, particularly pain, cancer, and cardiovascular disease, metabolic and inflammatory disorders and also reproductive disorders and infertility, especially those related to dysfunctions of the uterus and cervix. Animal models of such diseases and dysfunctions, in which the gene for IGPcRlδ or IGPcR32 is mutated, knocked-out or present in the form of a transgene, are also incorporated within the invention.

Background of the Invention

It is well established that many medically significant biological processes are mediated by proteins that participate in signal transduction pathways involving G proteins and second messengers; e.g. cAMP, diacylglycerol and inositol phosphates (Lefkowitz, 1991, Nature, 351:353-354). Herein these proteins are referred to as proteins participating in pathways with G protein-coupled receptors, either as the receptors themselves, such as those for adrenergic agents and dopamine ( obilka, BK, et al, 1987, P.N.A.S., USA, 84:46-50; Kobilka BK et al, 1987, Science, 238:650-656; Bunzow JR, et al, 1988, Nature, 336:783-787), or as the G proteins to which the receptors are coupled, or as effector proteins, e.g. adenylate cyclase, protein kinase A and protein kinase C (Simon MI, et al, 1991, Science, 252:802-

808).

Upon hormone binding to a GPcR the receptor interacts with the heterotrimeric G protein and induces the dissociation of GDP from the guanine nucleotide-binding site. At normal cellular concentrations of guanine nucleotides, GTP fills the site immediately. Binding of GTP to the alpha subunit of the G protein causes the dissociation of the G protein from the receptor and the dissociation of the G protein into alpha and beta-gamma subunits. The GTP-carrying form then binds to the generator of an intracellular second messenger: in one common form of signal transduction, activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the intrinsic GTPase activity of the G protein alpha subunit, returns the G protein to its basal, inactive form. The GTPase activity of the alpha subunit determines the time period during which the G protein is active. The GDP-bound form of the alpha subunit (alpha. GDP) has high affinity for the beta-gamma subunit complex and subsequent re-association of G protein subunits alpha. GDP with beta-gamma returns the G protein to the basal state. Thus the G-protein serves a dual role: as an intermediate that relays the signal from receptor to effector (in this example adenylate cyclase), and as a timer that controls the duration of the signal.

Examples of members of the G protein-coupled receptor family gene family include acetylcholine, adenosine, adrenergic, bradykinin, cAMP, calcitonin, capsaicic, CCK, CGRP, CRF, cytomegalovirus, dopamine, endothelial differentiation gene-1, endothelin, FSH, galanin, histamine, kinin, motilin, muscarinic, neurokinin, neuropeptideY, neurotensin, nociceptin, odorant, opsin, rhodopsin, serotonin, somatostatin, thrombin, TSH and VIP receptors. Alteration of GPcR genes and gene products can cause medical disorders, dysfunctions, or diseases hereafter generally referred to as "diseases". The mechamsm of disease may be due to a loss of receptor function or by constitutive receptor activation (reviewed by Coughlin et al, 199 , Curr. Opin. Cell Biol., 6:191-197). For example, activating mutations of rhodopsin receptor have been found in retinitis pigmentosa and congenital night blindness (Rao et al, 1994, Nature 367:639-642); mutations of TSH receptor have been detected in sporadic and inherited hyperthyroidism (Parma et al, 1993, Nature 365:649-651) and nephrogenic diabetes insipidus (Holtzman et al, 1993, Hum. Mol. Genet. 2:1201- 1204); mis-sense mutations in the luteinizing hormone receptor (LHR) gene, leading to constitutive activation of the LHR, have been shown to be associated with a condition in boys called familial male-limited precocious puberty (Cocco et al,

1996, Hum. Mut, 7:164-166; Kosugi et al, 1995, Hum. Mol. Genet, 4:183-188). Moreover, dopamine receptors are known to bind neuroleptic drugs used for treating disorders of the central nervous system (CNS).

As a characteristic feature, G protein-coupled receptors exhibit seven transmembrane domains which are connected by three hydrophilic extracellular loops alternating with three intracellular loops. Most G protein-coupled receptors have single conserved cysteine residues in each of the first two extracellular loops which form disulfide bonds that are believed to stabilize functional protein structure. The seven transmembrane domains or regions are designated as TM1, TM2, TM3, TM4, TM5,

TM6 and TM7. The cytoplasmic loop which connects TM5 and TM6 may be a major component of the G protein binding domain.

Most G protein-coupled receptors contain potential phosphorylation sites within the third cytoplasmic loop and or the carboxyl terminus. For several GPcRs, such as the beta-adrenergic receptor, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization.

It has also been shown that certain G protein-coupled receptors, e.g. the calcitonin receptor-like receptor, might interact with small single pass membrane proteins called receptor-activity-modifying-proteins (RAMPs). This interaction of the GPcR with a certain RAMP determines which natural ligands have relevant affinity for the GPcR-RAMP combination and regulate the functional signaling activity of the complex (McLathie LM, et al, 1998, Nature, 393:333-339).

For some receptors, the ligand binding sites of the G protein-coupled receptors are believed to comprise hydrophilic sockets formed by several GPcR transmembrane domains, said sockets being surrounded by hydrophobic residues of the G protein- coupled receptors. The hydrophilic side of each GPcR transmembrane helix is thought to face inward and form a polar ligand-binding site. TM3 has been implicated in several G protein-coupled receptors as having a ligand-binding site, such as the TM3 aspartate residues. TM5 serine residues, and TM6 asparagine and TM6 or TM7 phenylalanine or tyrosine residues are also implicated in ligand binding. G-protein coupled receptors bind to a variety of ligands ranging from small biogens to peptides, small proteins and large glycoproteins (Strader CD, et al, 1994, Annu. Rev. Biochem., 63:101-132).

G protein-coupled receptors can be coupled intracellularly by heterotrimeric G proteins to various intracellular enzymes, ion channels and transporters (see Johnson et al, 1989, Endoc. Rev., 10:317-331). Different G protein alpha-subunits preferentially stimulate particular effectors to modulate various biological functions in a cell. Phosphorylation of cytoplasmic residues of G protein-coupled receptors has been identified as an important mechanism for the regulation of G protein coupling of some G protein-coupled receptors. G protein-coupled receptors are found in numerous sites within animal, and particularly mammalian hosts.

Evolutionary analyses suggest that the ancestor of G protein-coupled receptors originally developed in concert with complex body plans and nervous systems. With the exception of the visual opsins, the genes for the GPcR family have, in most instances, been characterized by a lack of introns within their coding sequences thus precluding the generation of receptor diversity through alternative splicing. Recent data support the idea that dimerization of G protein-coupled receptors is important in different aspects of receptor biogenesis and function. When considering, for example, the nervous system, the existence of homodimers and heterodimers of neurotransmitter G protein-coupled receptors offers an attractive explanation of the great diversity and plasticity that is characteristic of such a highly organized and complex system (see Bouvier M, 2001, Nature Rev. Neuroscience, 2:274-286).

In order to understand the role of particular G protein-coupled receptors in normal physiology and disease, knock-out mice have been generated in which the endogenous genes encoding these receptors have been individually targeted. Studies of mas-protooncogene knock-out mice indicate that this GPcR is a determinant of heart rate and blood pressure variability (Walther et al, 2000, Braz J, Med. Biol. Res., 33:1-9). Male mice showed increased anxiety, indicating a function for Mas, which is an angiotensin receptor acting in the central nervous system (CNS) (Walther T et al, 1998, J. Biol. Chem., 273:11867-11873). Incerti et al, (2000, Hum. Molec. Genet., 9:2871-2788) generated and characterized mice deficient in Oal (ocular albinism)-deficient mice by gene targeting. Ophthalmologic examination showed hypo-pigmentation of the ocular fundus in mutant animals compared with wildtype. Also demonstrated was a misrouting of the optic fibers at the chiasm and the presence of giant melanosomes in retinal pigment epithelium, as observed in OA1 patients. Prostaglandin E2 receptor knock-out mice show a mild change in renal water handling, while EP2 receptor knock-out mice display salt-sensitive hypertension (Breyer et al, 2000, Curr. Opin. Nephrol. Hypertens., 9:23-29).

Based on malfunctions discovered in signaling pathways several drugs have been developed; for example, a compound that blocks the farnesylation of ras as a tumour inhibitor, a JAK-2 blocker as an inhibitor of recurrent pre-B cell acute lymphoblastic leukemia, and a platelet-derived growth factor receptor kinase as a blocker of restenosis (Reviewed in Levitzki A, 1996, Curr. Opin. Cell Biol., 8:239-244). G protein-coupled receptors have been identified and successfully used as targets for several existing drugs; for example, dopamine and serotonin G protein-coupled receptors have been targeted for CNS diseases, angiotensin, muscarinic and adrenergic receptor G protein-coupled receptors have been targeted for cardiovascular diseases, histaminic G protein-coupled receptors have been targeted for respiratory diseases, the prostaglandin GPcR has been targeted for opthalmic purposes, and calcitonin and estrogen for treatment of arthritis.

The following information relating to mammalian reproductive function is provided in relation to the G protein-coupled receptors that are disclosed by the present invention.

GPcR expression in primary sexual organs, male and female

Several G protein-coupled receptors have been described as being expressed in primary sexual organs. The expression of DAXl, an orphan nuclear hormone GPcR (Zanari E, et al, 1994, Nature, 372:635-641) in Sertoli cells of the testis is regulated during spermatogenesis and may have influence on the development of spermatogenic cells in response to steroid and pituitary hormones (Ta ai KT, et al, 1996, Molec. Endocr., 10:1561-1569). Loss of DAXl results in adrenal hypoplasia and hypogonadotropic hypogonadism; increased DAXl leads to dosage-sensitive reversal and a female phenoptye or ambiguous genitalia in XY-genotypic males (see McCabe ERB, 1996, J. Clin. Invest., 98:881-882). A lutotropin-choriogonadotropin

G protein-coupled receptor, LHCGR, is expressed in testis, placenta and ovary. In males, loss of LHCGR function causes pseudo-hermaphroditism associated with Leydig cell hypoplasia, which supports the concept that a functional receptor is necessary for the early development of Leydig cells (see Kremer et al, 1999, J. Clin. Endocr. Metab., 84:1136-1140).

In males, the testis is composed of many multiply-coiled seminiferous tubules in which the spermatozoa are formed. In the interstices between the seminiferous tublues, lie the interstitial cells of Leydig (Leydig cells), which account for approximately 20% of the mass of adult human testes and whose primary activity is the secretion of testosterone. The spermatozoa proceed from the seminiferous tubules into the epididymis, another coiled tube, of 6 to 7 metres in length, which secretes hormones, enzymes and special nutrients. Within the epididymis the spermatozoa mature over a period of 18 hours to 10 days, becoming motile and developing the ability to fertilize the ovum. From the epididymis the spermatozoa are emptied into the vas deferens, which enlarges into the ampulla of the vas deferens and opens into the body of the prostate gland. Storage of sperm occurs in the vas deferens and also in the ampulla of the vas deferens, although these spermatozoa are dormant due to the paucity of nutrients and the acidic environment in the vas deferens that results from the respiratory end products generated by the spermatozoa themselves.

The prostate gland and the seminal vesicles both generate secretions that are added to the ejaculate, contributing significantly to the bulk of the semen. The secretion of the seminal vesicles is mucoid and supplies fructose and other nutrients, whereas that of the prostate is alkaline and probably counteracts the inactivating acidity of the spermatozoa stored in the vas deferens and the acidity of the female's vaginal secretions.

In females, the uterus is a muscular, pear-shaped organ at the top of the vagina, the cervix being the lower part of the uterus. The lining of the uterus is shed each month in humans: menstruation stops temporarily during pregnancy and will normally continue until a woman undergoes menopause.

Before the age of menopause, many women seem to be partially protected from coronary heart disease, heart attack and stroke in comparison to men, even in comparison to those men exposed to similar risk factors. As menopause approaches, a woman's risk of heart disease and stroke begins to rise and continues rising as she ages. Several population studies show that the loss of natural estrogen as women age may contribute to this higher risk of heart disease and stroke after menopause. Surgery removing the uterus and ovaries increases this risk sharply. If menopause occurs naturally, the risk rises more slowly. Pelvic inflammatory disease (PID; salpingitis) is an infection of the female reproductive organs, particularly the fallopian tubes, but also the cervix (cervicitis), uterus (endometritis) or ovaries (oophoritis). Normally, the cervix prevents bacteria present in the vagina from spreading up into the internal organs. However, the cervix is susceptible to infection when exposed, for example, to a sexually transmitted disease (STD) such as gonorrhea (Neisseria gonorrhoeae) or chlamydia (Chlamydia trachmatis). Rarely, normal bacteria in the vagina may spread into the uterus, fallopian tubes and abdomen, causing PID. If the infection invades the internal organs, they can also become inflamed: peritonitis, from infection of the pelvic peritoneum, is common. PID can damage the fallopian tubes, making subsequent pregnancy difficult or impossible. Untreated PID can cause permanent damage to internal organs with scar tissue forming in the fallopian tubes and around the abdomen. Such scar tissue can prevent pregnancy or cause a tubal or ectopic pregnancy and sometimes necessitates surgical removal of the scar tissue or damaged organs.

GPcRs and Pain Modulation

Dong, X. et al. described a family of highly related mouse GPcRs, expressed in specific subsets of nociceptive sensory neurons (Dong X. et al, 2001, Cell 106(5): 619-631). Several human orthologues were also described. Nociceptive neurons are cutaneous afferent sensory neurons. Nociceptive neurons include such neurons that respond to a variety of noxious thermal, mechanical or chemical stimuli that cause acute pain. In addition such nociceptive neurons mediate chronic pain associated with inflammatory responses or nerve-injury. Further diversification of nociceptive neurons is described, including C-fibers innervating a variety of peripheral targets including the skin, gut, vasculature, and muscle.

IGPcR32, an embodiment of the present invention, is more than 85% identical to a

MrgF, a family member of mas 1 -related genes, called Mrg. All GPcRs described by Dong et al. are highly related to the masl proto-oncogen (Young et al, 1986, Cell 45 (5): 711-719) and were named Mas-related genes (Mrgs). According to similarity in the amino acid sequence and the neural expression pattern three major subfamilies, MrgA, MrgB, and MrgC have been described. A number of additional Masl -related orphan GPcRs were listed, including MrgF, without providing expression data, functional data or the human orthologue sequence of MrgF (see supplement sequence data and supplement table SI which is available from Cell Press (Cambridge MA 02138, U.S.A.) in relation to Dong X. et al, 2001, Cell 106(5): 619-631; and also available at the following Cell Press web-page: http ://www.cell.com/cgi/conten/full/l 06/5/619/DC 1 ).

Calcium Imaging assays of in vitro expressed mouse MrgAl and MrgA4 receptors identified their ability of binding neuropeptides, like Rfamide peptides, including mammalian NPAF and NPFF, which are analgesic in vivo. Multiple pulses of neuropeptide stimuli indicated desensitization, a characteristic feature of GPcRs

(Kobilka B. 1992, Annu. Rev. Neurosci. 15:87-114).

The term "dysmenorrhea" describes menstruation in which associated pain requires medication. Dysmenorrhea is classified as primary or secondary. Primary dysmenorrhea frequently begins one to two years after a woman's first menstrual period and is also termed functional dysmennorrhea, referring to pain with menstruation during ovulatory cycles in which lesions affecting the reproductive cycle are absent. It is thought to result from prostaglandins causing the uterus to contract and expel menstrual flow, uterine contraction often being associated with a cramping pain. Most of the prostaglandin release occurs during the first 48 hours of menstruation, hence the pain is generally most intense during the first few days of the menstrual period and then lessens, usually lasting 1 to 3 days. Women reporting painful menstrual periods synthesize larger amounts of prostaglandins than those without these symptoms. Secondary dysmenorrhea (acquired dysmennorrhea; pain with menstruation caused by demonstrable pathology) refers to painful menstrual periods due to other conditions, and is most often seen in women over 20 years of age. Pain associated with secondary dysmenorrhea may begin several days before a woman's period, may worsen during a menstrual period, and may even persist after the period ends. Some of the common causes of secondary dysmenorrhea are endometriosis, fibroids — non-cancerous tumours in the uterus, pelvic inflammatory disease and cervical stenosis.

Dysmenorrhea is often relieved by over-the-counter pain medications termed nonsteroidal anti-inflammatory drugs (NSAIDs). Examples of NSAIDs that are very effective for the treatment of dysmenorrhea include ibuprofen and naproxen. NSAID drugs mainly inhibit the body's ability to synthesize prostaglandins. The common mechanism of action for all NSAIDs is the inhibition of the enzyme cyclooxgenase (COX). There are two known forms of COX: COX-1 which protects the stomach lining and intestine and COX-2 which plays an essential role in synthesizing the prostaglandins that are important in the process of inflammation. Most NSAIDs currently available inhibit both COX-1 and 2. The stomach irritation and ulcers that can occur with the use of these drugs occur because of the COX-1 inhibition. COX- 2 inhibitors prevent the formation of prostaglandins responsible for pain, fever and inflammation. Recently, newer drugs that inhibit only COX-2 have been approved by the FDA for acute pain, rheumatoid arthritis, osteoarthritis, and dysmenorrhea. Currently available NSAIDs can result in toxicity to the kidneys and also to the lining of the stomach, possibly causing ulcers.

GPcR expression in cancer / glioblastoma multiforme

An mRNA sequence of a human gene was released November 09, 2001 (GenBank

Accession No. BC016964) with the conceptual corresponding amino acid sequence (GenPept Accession No. AAH16964), having been directly submitted on November 05, 2001 by R. Strausberg, NTH, Mammalian Gene Collection (MGC), Cancer Genomics Office, National Cancer Institute, Bethesda, USA. The cDNA clone was isolated from a human brain anaplastic oligodendroglioma cDNA library. The NTH internal protein ID MGC21621 refers to the amino acid sequence described under GenPept accession no. AAH16964. This polypeptide sequence exhibits 100% amino acid identity to human IGPcR32, an embodiment of the present invention,

Forty to fifty percent of primary central nervous system tumours are gliomas. Approximately 50% of these are glioblastoma multiforme (GBM) and 7% are astrocytomas. GBM refers to a malignant neoplasm with abundant glial pleomorphism, numerous mitotic figures and giant cells, vascular hyperplasia, and focal areas of necrosis. Occurring most commonly in the fifth through seventh decades, GBM usually develops in the cerebral hemispheres but almost never in the cerebellum. It grows as an irregular mass in the white matter and infiltrates the surrounding parenchyma by coursing along white matter tracts, frequently involving the corpus callosum and crossing the midline to produce the characteristic "butterfly" appearance. The prognosis is very poor. Mean survival length after diagnosis is eight to ten months with less than 10% survival after two years. GBM is linked to loss of heterozygosity (allele losses), especially at chromosome 10 and 19.

GBM is the most common primary brain malignancy in adults but which can occur at virtually any age (Kleihues et al. 2000, Neuro-Oncology 1:44-51). The diagnosis of a GBM is made by histological diagnosis of tissue removed from the suspected lesion by stereotactic biopsy. No known etiology exists for GBM. Currently one potential molecular marker is present for GBM, although certain genetic abnormalities have been identified. By differential display-polymerase chain reaction (DD-PCR) technique Sehgal et al. isolated an gene GOV, that was over- expressed in GBM tissue in comparison to normal brain tissue and being over- expressed in other tumours also, thereby serving as a potential tumour marker

(Sehgal A. et al. 1997, Int. J. Cancer 71:565-572). Troy Loging described candidate brain tumour antigens in a database mining approach plus rapid screening by fluorescent-PCR expression comparison (F-PEC) in GBM. Several candidate tumour markers were identified (Sec61 gamma, NNMT, ABCC3, NMB, ANXA1, SPARC, GPNMB; Troy Loging et al, Genome Research 2000,10(9):1393-1402). Cancer of the cervix can take many years to develop, but well before the development of cancer, early changes take place in the cervix. Abnormal cells arising in the cervix which are not cancerous but which may lead to cancer are termed CDSf (cervical intra-epithelial neoplasia). The vast majority of women with abnormal cervical cells are not about to develop cancer. These abnormal cells are frequently the result of viral infection, usually by the human papillomavirus. The two main types of cancer of the cervix are squamous cell carcinoma and adenocarcinoma, the names indicating the type of cells in the cervix which grow abnormally. Surgery and chemotherapy are current methods for treatment of cancer of the cervix. Radiotherapy may also be used after surgery if there is a high risk that the disease may recur, for example if the lymph glands are affected (there being a collection of lymph nodes situated close to the cervix).

The prostate is a walnut-sized gland located in front of the rectum, at the outlet of the bladder. It contains gland cells that produce some of the seminal fluid, which protects and nourishes sperm cells in semen. Although several other cell types are found in the prostate, over 99% of prostate cancers develop from the glandular cells, called adenocarcinoma. Most prostate cancers grow very slowly. It is believed that prostate cancer begins with a condition called prostatic intraepithelial neoplasia (PIN). In this condition there are pre-cancerous changes in the microscopic appearance of prostate gland cells (i.e. in their size, shape, or the rate at which they multiply). Prostate cancer is the second leading cause of cancer death in men in the United States, exceeded only by lung cancer. Prostate cancer accounts for about 11% of male cancer-related deaths, being estimated at 31,500 in the U.S.A. for the year 2001 (American Cancer Society). Prostate cancer can often be found early by testing the amount of prostate-specific antigen (PSA) in blood. Methods of treatment include surgery, radiation therapy, and androgen suppression therapy.

Because of the vital role of G protein-coupled receptors in the communication between cells and their environment, such receptors are attractive targets for therapeutic intervention. G protein-coupled receptors have led to more than half of the currently known drugs (Drews, Nature Biotechnology, 1996, 14:1516). Mechanistically, approximately 50% to 60% of all clinically relevant drugs act by modulating the functions of various G protein-coupled receptors, as either agonist (activating activity) or antagonist (blocking activity) of a GPcR (Cudermann et al, 1995, J. Mol. Med., 73:51-63). This indicates that these receptors have an established, proven history as therapeutic targets.

In consequence, there is a continuing medical need for identification and characterization of further receptors that can play a role in diagnosis, preventing, ameliorating or correcting medical conditions such as dysfunctions, disorders, and diseases. Included among such medical conditions are particularly pain and cancer, especially pain and cancer related to disorders of the reproductive organs or of the CNS, with cancer of the cerebellum being particularly relevant to the latter. Such medical conditions also include cardiovascular disease, metabolic and inflammatory disorders and especially reproductive disorders and infertility (which may additionally be pain or cancer related). Particularly relevant medical conditions are those relating to dysfunctions of the uterus, ovary and cervix, and also of the epididymis, testis and prostate.

Summary of the Invention

The G protein-coupled receptors of the present invention are especially useful for diagnosis, prevention, amelioration or correction of diseases associated with signal processing in female reproductive tissues, such as infertility. In particular, the present invention satisfies a need in the art for identification and characterization of further receptors that can play an important role in diagnosis, preventing, ameliorating or treatment of, inter alia, pain, cancer, cardiovascular diseases, such as coronary heart disease, heart attack and stroke, inflammatory disorders and both metabolic disorders and reproductive disorders linked to female reproductive tissues such as uterus, placenta, and ovary, and to male reproductive tissues such as testis, epididymis and prostate.

Embodiments of the invention, the GPcR polypeptides IGPcRlδ and IGPcR32, participate in signal transduction in tissues containing smooth muscle cells, and in reproductive tissues of both male and female; functioning, inter alia, in the generation and control of temporary and chronic pain. These GPcR polypeptides play a role in disorders and diseases of tissues containing smooth muscle cells: e.g. cardiovascular diseases, such as coronary heart disease, heart attack and stroke, in disorders and diseases linked to reproductive tissues such as uterus, cervix, placenta, testis, epididymis and prostate. Expression and activity of these GPcR polypeptides are particularly relevant in those reproductive tissues containing smooth muscle cells, such as uterus. Embodiments of the present invention are particularly suited to

^' prevention, amelioration or correction of diseases combining such characteristics, such as endometriosis or the inflammatory responses of the uterus associated with pelvic inflammatory disease. Furthermore, the G protein-coupled receptor of the present invention, and its gene or transcript, may be used to detect tumours expressing the GPcR in tissues where it is not normally expressed (such as CNS related cancers, particularly tumours of the cerebellum), or may be used to detect tumours over-expressing the GPcR in tissues in which detection of normal expression is to be expected.

Embodiments of the invention include an isolated nucleic acid molecule, wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO:l or SEQ ID NO:3, or any unique fragment thereof, particularly wherein the nucleotide sequence of the fragment is greater than ten base pairs in length. Embodiments also include an isolated polynucleotide which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:4, or any unique fragment thereof, particularly wherein the amino acid sequence of the fragment is greater than ten amino acids in length. Embodiments of the invention include any isolated nucleic acid molecule or polynucleotide comprising an allelic variant of a nucleotide sequence or polynucleotide which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:2 or of SEQ ID NO:4, wherein said allelic variant retains at least 70% nucleic acid homology, or in increasing preference at least 80%, 85%, 90%, 95% or 98% nucleic acid homology and hybridizes to the complement of SEQ ID NO:l or to the complement of SEQ ID NO:3 under stringent conditions (Ausubel FM et al, eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green

Publishing Associates, Inc., and John Wiley & sons, Inc., New York): also included are such isolated nucleic acid molecules or polynucleotides that comprise a nucleotide sequence which encodes at least one of the group of polypeptides, peptides and fusion proteins, comprising an amino acid sequence at least 70% identical, or in increasing preference at least 75%, 80%, 85%, 90%, 95% or 98% identical, to SEQ ID NO:2 or to SEQ ID NO:4.

Vectors comprising an isolated nucleic acid molecule or polynucleotide of the invention as previously described are a further embodiment of the invention.

Additional embodiments include host cells genetically engineered to contain such a vector or genetically engineered to contain such a nucleic acid molecule or polynucleotide of the invention as described above, and particularly wherein the nucleic acid molecule or polynucleotide of the invention is operatively linked with a nucleotide regulatory sequence that controls expression of said nucleic acid molecule or polynucleotide in the host cell. Also included are host cells which are drawn from prokaryotic bacterial cells, or from eukaryotic cells, particularly or yeast, insect or mammalian cells, preferred embodiments employing a mammalian host cell being those in which the host cell is a CHO, BHK, COS, CV1, 293, fibroblast or VERO cell. Embryonic stem cells containing a disrupted endogenous IGPcR32 gene are also preferred embodiments of the invention, the most preferred embryonic stem cells being derived from mice.

Preferred embodiments of the invention include antibodies to the IGPcR32 protein, polypeptides, peptides, isolated domains and fusion proteins. Agonists and antagonists of IGPcRlδ or IGPcR32 are preferred embodiments of the invention, including: (a) 'small molecules' of molecular mass less than 6 kDa; (b) molecules of intermediate size, having molecular mass between 5 kDa to 15 kDa; and (c) large molecules of molecular mass greater than 12 kDa; the latter including mutant natural IGPcRl 8 or IGPcR32 ligand proteins that compete with native natural

IGPcRlδ or IGPcR32 ligand and which modulate IGPcRlδ or IGPcR32 gene expression or gene product activity. Preferred embodiments of the invention are those wherein such molecules bind specifically to the IGPcR18 or the IGPcR32 receptor or to the IGPcRlδ or the IGPcR32 gene. Further embodiments are methods of identifying such compounds which modulate the activity of the IGPcRlδ or

IGPcR32 receptor or of IGPcRlδ or IGPcR32 gene expression, such as anti-sense and ribozyme molecules that can be used to inhibit IGPcRlδ or IGPcR32 gene expression, or expression constructs that are capable of enhancing IGPcRlδ or IGPcR32 gene expression.

The non-human animal orthologues of the human sequence in SEQ ID NO:l or SEQ ID NO: 3 are preferred embodiments of the invention, particularly ungulate and rodent sequences, and especially those of rat and mouse, and also polynucleotides comprising these sequences or homologous or partially homologous sequences as indicated for the human nucleic acid and polynucleotide. Preferred embodiments include polynucleotides of such non-human animal orthologues comprising a nucleotide sequence which encodes a polypeptide comprising an amino acid sequence at least 70% identical, or in increasing preference at least 75%, 80%, 85%, 90%, 95% or 98% identical, to SEQ ID NO:2 or to SEQ ID NO:4; or being at least ten amino acid residues in length and bearing the stated identity to a unique part of

SEQ ID NO:2 or SEQ ID NO:4.

Embodiments of the invention include knock-out animals which are non-human animals and which do not express IGPcR18 or IGPcR32. Preferred embodiments are those wherein the endogenous animal orthologue is functionally disrupted by homologous recombination methods such as conditional knock-out and/or null allele knock-out of the IGPcRlδ or IGPcR32 gene. Mutated animals that express a nonfunctional or partially functional form of IGPcRlδ or IGPcR32 are further embodiments of the invention. Embodiments of the invention also include progeny of the non-human animals described as being embodiments of the invention, the term 'progeny' including both heterozygous and homozygous offspring. Further embodiments are non-human transgenic animal models expressing the human IGPcRlδ or IGPcR32 cDNA sequence as shown in SEQ ID NO:l or SEQ ID NO:3, respectively, or a modification thereof as described above, operatively linked to a nucleotide regulatory sequence that controls expression of the nucleic acid molecule in the host animal. Particularly preferred embodiments are those non-human animals

(also termed animal models) in which the human IGPcRl or IGPcR32 is encoded by a nucleic acid sequence which is homozygous in the animal model, each embodiment of the invention comprising a non-human animal, preferable embodiments are those wherein the non-human animal is a mammal, particularly ungulate or rodent, and preferably wherein the non-human animal is from a genus selected from the group consisting of Mus (e.g., mice), Rattus (e.g., rats), Oryctologus (e.g., rabbits) and Mesocricetus (e.g., hamsters), mouse being the most preferable of this group.

Embodiments of the invention include primary cells and cell lines derived from any of the non-human animals of the invention, particularly the non-human transgenic animal models of the invention. Further embodiments include the amino acid sequence of those non-human animal orthologues of IGPcRlδ or IGPcR32 that comprise an amino acid sequence at least 70% identical, or in increasing preference at least 75%, 80%, 85%, 90%, 95% or 98% identical, to SEQ ID NO:2 or SEQ ID

NO:4; or a part of said non-human animal sequence which is at least ten amino acid residues in length and bears the stated similarity to a unique part of SEQ ID NO:2 or SEQ ID NO:4.

The use of the non-human animal or animal model of the invention, as described above, for the dissection of the molecular mechanisms of the IGPcRlδ or IGPcR32 function or activity, particularly the signal transduction pathway of IGPcRlδ or IGPcR32, for the identification and cloning of genes able to modify, reduce or inhibit the phenotype associated with IGPcRlδ or IGPcR32 activity or deficiency, constitutes a further embodiment of the invention, as does the use of such non-human animal or animal model for the identification of gene and protein diagnostic markers for diseases, for the identification and testing of compounds useful in the prevention or treatment of symptoms associated with IGPcRlδ or IGPcR32 activity or deficiency, in particular but not limited to central nervous system disorders, including neurologic, psychiatric and behavioral disorders, metabolic disorders, visual and olfactory disorders, and especially in the case of IGPcRlδ or IGPcR32, particularly pain, cancer, and cardiovascular disease, metabolic and inflammatory disorders and also reproductive disorders and infertility, especially those related to dysfunctions of the uterus and cervix, testis, epididymis or prostate.

Additional embodiments of the invention include methods of identifying compounds suitable for modulating the activity of the protein or polypeptide of the invention, as described above, for treatment of diseases characterized by aberrant expression or activity of IGPcRlδ or IGPcR32. Preferred embodiments include methods of prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRlδ or IGPcR32, by the administration of compounds that bind specifically to the IGPcRlδ or IGPcR32 gene or protein and/or which modulate IGPcRlδ or IGPcR32 expression or IGPcRlδ or IGPcR32 activity; the compounds that that bind specifically to the IGPcRlδ or IGPcR32 gene or protein and/or which modulate IGPcRlδ or IGPcR32 expression or which modulate IGPcRlδ or IGPcR32 activity, for the prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRlδ or IGPcR32; and the use of compounds that that bind specifically to the IGPcRlδ or IGPcR32 gene or protein and/or which modulate IGPcRlδ or IGPcR32 expression or which modulate IGPcRlδ or IGPcR32 activity, for prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcR18 or IGPcR32.

Further preferred embodiments are gene therapy methods of prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRlδ or IGPcR32, by the administration of vectors and/or host cells containing a nucleotide sequence according to the foregoing description, that modulate IGPcRlδ or IGPcR32 expression or that modulate IGPcRlδ or IGPcR32 activity; the vectors and/or host cells containing a nucleotide sequence according to the foregoing description which modulate IGPcR18 or IGPcR32 expression or which modulate IGPcRlδ or IGPcR32 activity, for the prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRl 8 or IGPcR32; and the use of vectors and/or host cells containing a nucleotide sequence according to the foregoing description which modulate IGPcRl 8 or IGPcR32 expression or which modulate IGPcRl 8 or IGPcR32 activity, for prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRl 8 or IGPcR32.

Brief Description of the Figures

Figure 1 : Fig. 1 depicts the full-length coding DNA (cDNA) sequence of the human IGPcRlδ gene (SEQ ID NO:l).

Figure 2: Fig. 2 depicts the amino acid sequence of the human IGPcRl 8 protein (SEQ ID NO:2).

Figure 3: Fig. 3 depicts the full-length coding DNA (cDNA) sequence of the human IGPcR32 gene (SEQ ID NO:3).

Figure 4: Fig. 4 depicts the amino acid sequence of the human IGPcR32 protein

(SEQ ID NO:4).

Figure 5: Fig. 5 a depicts a comparison of the amino acid sequences of the human IGPcR32 and human IGPcRl 8 proteins. Fig. 5b depicts a comparison of the amino acid sequences of the human IGPcR32 and rat RTA proteins.

Fig. 5c depicts a comparison of the amino acid sequences of the human IGPcR32 and mouse MrgF proteins.

Fig. 5d depicts a comparison of the amino acid sequences of the rat RTA and mouse MrgF proteins.

Figure 6: Fig. 6a depicts hydropathy plots comparing the IGPcRlδ, rat RTA and mouse MrgF receptors.

Fig. 6b depicts hydropathy plots comparing the IGPcR32, rat RTA and mouse MrgF receptors.

Figure 7: Fig. 7 depicts fluorescence-detected 267 base pair DNA fragments after migration in an ethidium bromide stained agarose gel. DNA fragments were generated in an RT-PCR reaction of human tissues RNA with primers corresponding to SEQ ID NO:10 and SEQ ID NO:6.

Figure δ: Fig. δ depicts fluorescence-detected 349 base pair DNA fragments after migration in an ethidium bromide stained agarose gel. DNA fragments were generated in an RT-PCR reaction of human tissue RNAs with primers corresponding to SEQ ID NO:5 and SEQ ID NO:6.

Figure 9: Fig. 9 depicts an autoradiogram of human multi tissue Northern hybridized with a human IGPcR32 probe (SEQ ID NO: 11) for IGPcRlδ and IGPcR32.

Figure 10: Fig. 10 schematically outlines the construction of a targeting vector for the mouse orthologue of human IGPcR32 (mIGPcR32, or mMrgF). This construction is based on the method described by Wattler S. & Nehls, M, German patent application DE 100 16 523.0, "Klonierungssystem zur Konstruktion von homologen Rekombinationsvektoren", filed April 03, 2000, the major aspects of which are incorporated as Example 5. Figure 11: Fig. 11a depicts fluorescence-detected 363 base pair DNA fragments from the cDNA of mouse MrgF (SEQ ID NO:l ) after migration in an ethidium bromide stained agarose gel. DNA fragments were generated in an RT-PCR reaction of female mouse tissue RNAs with primers corresponding to SEQ ID

NO:16 and SEQ ID NO:17.

Fig. lib depicts fluorescence-detected 363 base pair DNA fragments from the cDNA of mouse MrgF (SEQ ID NO:lδ) after migration in an ethidium bromide stained agarose gel. DNA fragments were generated in an RT-PCR reaction of male mouse tissues RNA with primers corresponding to SEQ ID

NO:16 and SEQ ID NO:17.

Detailed Description of the Invention

The present invention relates to the discovery, identification and characterization of nucleic acids that encode the human G protein-coupled receptors, including those embodiments of the invention termed IGPcRl 8 and its variant, IGPcR32. The invention encompasses nucleotide sequences encoding mammalian forms of IGPcRl 8 or IGPcR32, including human IGPcRl 8 or human IGPcR32, nucleotides that encode some or all of its functional domains, such as extracellular domains (ECDs), the transmembrane domains (TMs), and the cytoplasmic domains (CDs); mutants of the IGPcRlδ or IGPcR32 sequences, and fusion proteins of IGPcRl 8 or IGPcR32. The invention also encompasses host cell expression systems expressing such nucleotides, the host cells and expression products. The invention further encompasses IGPcRl 8 or IGPcR32 proteins, fusion proteins, antibodies to the receptor, antagonists and agonists of the receptor, transgenic animals that express an IGPcRlδ or IGPcR32 transgene, recombinant knock-out animals that do not express IGPcRlδ or IGPcR32, and animal models in which the IGPcRl 8 or IGPcR32 gene is mutated. The invention also encompasses compounds that modulate IGPcRl 8 or

IGPcR32 gene expression or which modulate IGPcRl 8 or IGPcR32 receptor activity that can be used for drug screening, or for diagnosis, monitoring, preventing or treating disorders linked to such reproductive tissues as uterus, cervix, placenta, testis, epididymis and prostate, and reproductive disorders, besides pain, cancer, cardiovascular diseases, such as coronary heart disease, heart attack and stroke, inflammatory disorders and metabolic diseases.

The invention further encompasses the use of IGPcRl 8 or IGPcR32 nucleotides, IGPcRlδ or IGPcR32 proteins and peptides, as well as antibodies to IGPcRlδ or IGPcR32, antagonists that inhibit ligand binding, receptor activity or expression, or agonists that increase ligand binding, activate receptor activity, or increase its expression, for the diagnosis and treatment of disorders, including, but not limited to treatment of central nervous system disorders. In addition, IGPcRlδ or IGPcR32 nucleotides and proteins are useful, respectively, for the diagnosis of an abnormality of IGPcRlδ or IGPcR32, and for the diagnosis of an IGPcRlδ pathway or IGPcR32 pathway abnormality, and for the identification of compounds effective in the treatment of disorders based on the aberrant expression or activity of IGPcRlδ or IGPcR32. The invention also relates to host cells and animals genetically engineered to express the human IGPcRlδ or IGPcR32 (or mutants thereof) or to inhibit or knock-out expression of the animal's endogenous IGPcRlδ or IGPcR32 gene.

The newly identified G protein-coupled receptors of the invention, IGPcRl δ and the closely related polypeptide homologue IGPcR32 (74.3% amino acid sequence identity; see Examples 1 and 4), can play a role in diagnosis, preventing, ameliorating and correcting diseases. These diseases include, but are not limited to, psychiatric and CNS disorders, including schizophrenia, episodic paroxysmal anxiety

(EPA) disorders such as obsessive compulsive disorder (COD), post traumatic stress disorders (PTSD), phobia and panic, major depressive disorder, bipolar disorder, Parkinson's disease, general anxiety disorder, autism, delirium, multiple sclerosis, Alzheimer's disease/dementia and other neurodegenerative diseases, severe mental retardation, dyskinesias, Huntington's disease, Gille de la Tourette's syndrome, tics, tremor, dystonia, spasms, anorexia, bulimia, stroke, addiction/dependency/craving, sleep disorders, epilepsy, migraine, attention deficit/hyperactivity disorder (ADHD), cardiovascular diseases, angina pectoris, including heart failure, angina pectoris, arrythmias, myocardial infarction, cardiac hypertrophy, hypertension, thrombosis, arteriosclerosis, cerebral vasospasm, subarachnoid hemorrhage, cerebral ischenia, thrombosis, arteriosclerosis, peripheral vascular disease, Raynaud's disease, kidney disease - e.g. renal failure; dyslipidemias, obesity, emesis, gastrointestinal disorders, including irritable bowel syndrome (IBS), inflammatory bowel syndrome (fl3D), diarrhoea, gastresophageal reflux disease (GERD), motility disorders and conditions of delayed gastric emptying, such as post operative or diabetic gastroparesis, and diabetic ulcers; other diseases including osteoporosis; inflammations; infections such as bacterial, fungal, protozoan and viral infections, particularly infections caused by HIV-1 or HIV-2; pain; cancers; chemotherapy induced injury; tumour invasion; ^' immune disorders; autoimmune diseases; urinary retention; asthma, allergies; arthritis; benign prostatic hypertrophy; endotoxin shock; sepsis; complication of diabetis mellitus; and gynaecological and reproductive disorders and male infertility.

In particular the new GPcRs of the present invention, IGPcRlδ and IGPcR32 satisfy a need in the art for identification and characterization of further receptors that can play an important role in diagnosis, preventing, ameliorating or correcting of, but not limited to pain, cancer, inflammatory disorders and metabolic disorders linked to reproductive tissues, particularly the uterus, cervix, placenta, the testis, epididymis and prostate. The GPcRs of the present invention, IGPcRl 8 and IGPcR32, are especially useful for diagnosis, preventing, ameliorating or correcting of reproductive disorders, especially female infertility; and for pain (particularly pain associated with primary or secondary dysmenorrhea, or with pregnancy or childbirth, or with inflammation or infection, such as that associated with PID); for cancer, particularly cancers in which tumours express or over-express the IGPcRlδ or IGPcR32 gene, such as cancers of the male or female reproductive organs, or cancers of the CNS, particularly cerebellum, and especially anaplastic oligodendroglioma; and cardiovascular diseases, such as coronary heart disease, heart attack and stroke. Definitions

As used herein, the following terms, whether used in the singular or plural, have the meanings indicated.

Agonist - a molecule, being a ligand and/or drug, that acts on one or more physiological receptors and mimics the effects of the endogenous regulatory compounds; generally these are compounds that activate the receptor.

Antagonist - a molecule, being a ligand and/or drug that inhibits a receptor, most acting by inhibiting the action of an agonist, for example by competing for agonist binding sites on a receptor. These are generally themselves devoid of intrinsic regulatory activity, but act to block receptor activation.

IGPcRlδ nucleotides, sequence or coding sequences - encompass DNA, including genomic DNA (e.g. the IGPcRlδ gene), cDNA, RNA and include nucleotide sequences encoding IGPcRlδ protein, peptide fragments, or fusion proteins.

IGPcR32 nucleotides, sequence or coding sequences - encompass DNA, including genomic DNA (e.g. the IGPcR32 gene), cDNA, RNA and include nucleotide sequences encoding IGPcR32 protein, peptide fragments, or fusion proteins.

IGPcRlδ - means natural, or mature, IGPcRlδ receptor protein. Polypeptides or peptide fragments of IGPcRlδ protein are referred to as IGPcRlδ polypeptides or

IGPcRl 8 peptides. Fusions of IGPcRlδ, or IGPcRlδ polypeptides or peptide fragments to an unrelated protein are referred to herein as IGPcRlδ fusion proteins. ECD - means "extracellular domain" of the receptor protein; TM - means "transmembrane domain" and CD - means "cytoplasmic domain". A functional IGPcRl 8 refers to a protein wliich binds natural IGPcRlδ ligand with high affinity and specificity in vivo or in vitro. IGPcR32 - means natural, or mature, IGPcR32 receptor protein. Polypeptides or peptide fragments of IGPcR32 protein are referred to as IGPcR32 polypeptides or IGPcR32 peptides. Fusions of IGPcR32, or IGPcR32 polypeptides or peptide fragments to an unrelated protein are referred to herein as IGPcR32 fusion proteins. ECD - means "extracellular domain" of the receptor protein; TM - means "transmembrane domain" and CD - means "cytoplasmic domain". A functional IGPcR32 refers to a protein which binds natural IGPcR32 ligand with high affinity and specificity in vivo or in vitro.

Knock-out or knock-out animal - a non-human animal wherein a transgene is inserted into the genome to create a partial or complete loss-of-function mutation of an endogenous gene. Endogenous genes are inactivated usually by homologous recombination, using replacement or insertion-type gene targeting vectors.

Ligand - a molecule that selectively binds to a receptor.

Receptor - a plasma membrane protein which binds one or more appropriate ligands and propagates their regulatory signals to target cells, either by direct intracellular effects, or by promoting the synthesis and/or release of another regulatory molecule known as a second messenger.

Transgenic animal - a non-human animal containing one or more additional, often foreign genes or "transgenes", integrated into its genome, that can be used as model systems to determine the phenotypic effects of expressing those genes.

Gene

Novel GPcR genes may be isolated using expression cloning, by synthesizing specific oligonucleotides based on the sequence of purified proteins, using low stringency hybridization (Ausubel FM et al, eds., 19δ9, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & sons, Inc., New York) and by degenerate PCR using known receptor sequences. GPcR genes may also be identified by large scale sequencing, as in the Human Genome Project, followed by analysis of expressed sequence tags (ESTs), or complete sequences present in databases. Known GPcR sequences or conserved regions thereof may be employed as query sequences to extract novel GPcR sequences from these databases.

The present invention provides IGPcRlδ, a novel G protein-coupled receptor protein described for the first time herein, and characterized as having seven hydrophobic domains which span the plasma membrane and which are connected by alternating extracellular and intracellular hydrophilic loops. IGPcRlδ encodes a protein of 323 amino acids (see Fig. 4; SEQ ID NO:2).

The present invention further provides a variant of IGPcRlδ, termed IGPcR32, newly-identified herein as a G protein-coupled receptor protein, and also characterized as having seven hydrophobic domains which span the plasma membrane and which are connected by alternating extracellular and intracellular hydrophilic loops. IGPcR32 encodes a protein of 343 amino acids (see Fig. 4; SEQ ID NO:4). The nucleotide sequences of IGPcRlδ and IGPcR32 are highly homologous , although as a result of reading frame shifts the homology of their amino acid sequences is substantially lower. Nucleotide homology is greater than 95% at the cDNA level; producing 74.3% homology in the resulting polypeptide sequences, within the comparable 327 amino acid residue stretch (Example 1).

Human IGPcRl 8 has 63% amino acid sequence identity and 69% homology (with conserved substitutions) to rat RTA amino acid sequences (GenPept Accession No. P23749; GenBank Accession No. M32098), which was isolated from a thoracic aorta cDNA library using Ml muscarinic acetylcholine receptor sequences (Ross et al, 1990, P.N.A.S. USA δ7:3052-3056). Human IGPcR32 has 85,1% amino acid sequence identity to rat RTA (rat thoracic aorta) amino acid sequences (Swissprot Accession No. P23749; GenBank Accession No. M32098 and M35297), which was isolated from a thoracic aorta cDNA library using Ml muscarinic acetylcholine receptor sequences (Ross et al, 1990, P.N.A.S. USA δ7:3052-3056).

Ml is one member of five distinct muscarinic acetylcholine receptors currently recognised, described as GPcRs with neurotransmitter function and termed Ml to M5. The muscarinic acetylcholine receptor Ml belongs to class 1 of G protein- coupled receptors and mediates various cellular responses, primarily by inhibition of adenylate cyclase, and the breakdown of phosphoinositides and modulation of potassium channels through the action of G proteins (Peralta et al, 1987, EMBO J., 6:3923-3929).

Peripheral M3 muscarinic acetylcholine receptors are thought to have a potential role in parasympathetic stimulation of smooth muscle contraction and glandular secretion (Brown, J. H. and Taylor, P., 1996 in The Pharmacological Basis of Therapeutics 9th edn (eds Hardman, J. G. et al.) 141-160 (McGraw-Hill, New York); Wess, J. et al, 1990, in Comprehensive Medicinal Chemistry, Vol. 3 (ed. Emmett, J .C.) 423-491 (Pergamon, Oxford); Caulfield, M. P., 1993, Muscarinic receptors - characterization, coupling and function. Pharmacol. Ther. 58, 319-379). M3 receptors are widely expressed in the CNS, although their physiological role remains unknown.

RTA encodes an orphan receptor of 343 amino acids. RTA is strongly expressed in rat cerebellum and tissues containing smooth muscle cells. In a limited number of tissues analyzed, Ross et al. described rat RTA mRNA expression in the following smooth muscle tissues vas deferens, uterus, small intestine, large intestine, stomach and aorta. No additional smooth muscle tissues have been tested by the authors therein. The native ligand is still unknown. (Ross et al, 1990, P.N.A.S. USA, 87:3052-3056.) Although angiotensin binding to rat RTA protein was not detected, RTA is closely related to the masl proto-oncogene, which has been suggested to be a forebrain angiotensin receptor, expressed in rat cerebral endothelial cells and rat hippocampus (Ross et al, 1990, P.N.A.S. USA, 87:3052-3056). Lack of masl in knockout mice has been shown to result in behavioural alterations, including anxiety (Walther et al, 1998, J. Biol. Chem., 273:11867-73). The masl proto-oncogene has also been implicated in heart rate and blood pressure variability (Walther et al, 2000, Braz. J. Med. Biol. Res., 33:1-9).

Human IGPcR32 receptor also has 86,5% amino acid identity in a 318 residue stretch when compared to mouse MrgF (NCBI protein Accession No. AAK91802; Genbank Accession No. AY042211), a family member of masl related GPcRs being expressed in sensory neurons and some of these GPcRs detect painful stimuli (Dong et al, 2001 Cell 106(5):619-632). The conceptual translation of the partial cDNA listed in Genbank Accession No. AY042211 generates a 319 amino acid peptide, lacking N-terminal amino acid sequences. Mouse MrgF mRNA expression is detected primarily in smooth muscle tissues (see Example 7; Fig 1 la, 1 lb).

In a BLASTP search human IGPcR32 exhibits highest homology to rat GPcR RTA and mouse GPcR MrgF, with 85.1% amino acid identity when compared to rat GPcR

RTA (Swissprot Accession No. P23749; GenBank Accession No. M32098 and

M35297), and with 86.5% amino acid identity in an 318 amino acid sequence stretch when compared to mouse GPcR MrgF (NCBI protein Accession No. AAK91802;

Genbank Accession No. AY042211), respectively, as seen in Figure 5b and Figure 5c. Rat RTA is an orphan GPcR of 343 amino acids, most closely related to the masl proto-oncogene. It was isolated from a rat thoracic aorta cDNA library using Ml muscarinic acetylcholine receptor sequences. Ml is one member of currently 5 distinct muscarinic acetylcholine receptors, described as GPcRs with neurotransmitter function. Mouse MrgF is a family member of masl proto-oncogene related GPcRs being expressed in sensory neurons detecting painful stimuli (Dong et al, 2001 Cell 106(5):619-632). The conceptual translation of the partial cDNA listed in Genbank Accession No. AY042211 generates a peptide sequence of 319 amino acid residues, lacking the 24 IGPcR32 N-terminal amino acid residues. Mouse GPcR MrgF exhibits 97.2% amino acid identity in a sequence stretch of 318 amino acid residues when compared to rat GPcR RTA, as depicted in Example 4, Figure 5d herein.

Ross et al. described RTA gene expression in such smooth muscle tissues as vas deferens, uterus, small intestine, large intestine, stomach and aorta and in the rat cerebellum, detecting a major 2.4 kilobase transcript in Northern analysis. Highest expression was detected in uterus, aorta and gut. No additional smooth muscle tissues have been analyzed for RTA expression. (Ross et al. 1990, P.N.A.S. USA 87:3052-3056)

Human IGPcR32 gene expression was detected herein by Northern analysis in smooth muscle tissues uterus, cervix, ovary, placenta, prostate, small intestine, and colon. IGPcR32 transcript was barely detectable in lung, spleen and testis. The transcript size was 2.4 kilo bases, as depicted in Example2, Figure 9 herein.

Careful consideration of similarities of transcript length, sequence homology, and the localisation of expression in smooth muscle and comparable tissues (reported in the literature cited above for the rodent GPcRs and disclosed herein for the human GPcRleads us to propose that mouse MrgF and rat RTA are, respectively, the mouse and rat orthologues for human IGPcR32.

The present invention's G protein-coupled receptors, the associated gene and transcripts, are especially useful for diagnosis, prevention, amelioration or correction of disorders and diseases associated with signal processing in both female and male reproductive tissues. Such disorders and diseases particularly include, but are not limited to, abnormally or excessively painful functioning or dysfunctioning of uterus or cervix, especially during menstruation, pregnancy or birth, ranging from minor discomfort through to severe incapacitation and to infertility. The GPcR of the invention, the associated gene and transcripts, and particularly the IGPcR32 gene and transcripts, satisfy a need in the art for identification and characterization of further receptors that can play an important role in diagnosis, prevention, amelioration or treatment of, inter alia, pain, cancer, cardiovascular diseases, such as coronary heart disease, heart attack and stroke, inflammatory disorders and metabolic disorders linked to reproductive tissues like uterus, placenta, ovary, testis, epididymis and prostate, and reproductive disorders. Embodiments of the invention are particularly suited to prevention, amelioration or correction of diseases combining such characteristics, such as endometriosis or the inflammatory responses of the uterus associated with pelvic inflammatory disease. Furthermore, the G protein-coupled receptor of the present invention, and its gene or transcript, may be used to detect tumours expressing the GPcR in tissues where it is not normally expressed (such as CNS related cancers, particularly tumours of the cerebellum), or over-expressing the GPcR in tissues in which detection is to be expected, as disclosed herein.

Dong X. et al. have described a family of approximately 50 GPcRs termed masl- related genes (Mrg), some of these functioning as nociceptive receptors in mouse (Dong X. et al, 2001, Cell 106(5):619-631). IGPcR32 exhibits 86.5% amino acid identity to MrgF in a 318 amino acid residues stretch compared, as depicted in Example 4, Figure 5c. MrgF mRNA expression is detected primarily in smooth muscle tissues. Since IGPcR32 mRNA was detected as being strongly expressed in cervix, uterus and epididymis and being weakly expressed in ovary, prostate, testis, placenta, lung, small intestine, colon and spleen by RT-PCR- and Northern-analysis, as shown in Example 2, Fig. 7 and in Example 3, Fig. 9 herein, a further embodiment of the invention employs the gene and/or receptor of the invention, and particularly the IGPcR32 gene and/or receptor, as a target for analgesic drugs especially in those smooth muscle tissues specified above.

As one embodiment of the present invention, IGPcR32 mRNA expression was detected by RT-PCR in uterus, cervix, testis, epididymis and prostate (as shown in

Example 2, Figure 7), and by Northern-analysis (as shown in Example 3, Figure 9), indicating that IGPcR32 has potential as a therapeutic target and/or marker in cancers of primary sexual organs, particularly cancers of uterus, cervix, testis, epididymis and prostate. Therefore IGPcR32 may be used in diagnostic methods to identify tumours expressing and/or over-expressing IGPcR32 (such methods as hybridization-based or ligand-based methods directed toward the gene, or ligand based methods directed toward the polypeptide expression product being familiar to those of skill in the art using, for example, a ligand of IGPcR32 wliich is an antibody or aptamer, generated by methods known in these arts). Also, IGPcR may be used for treatment using ligand-targeted chemical therapy, e.g. radiolabel, in which the ligand is, for example, an IGPcR32 antibody or aptamer. The tumours identified in such diagnostic methods include those associated with cancers of the reproductive tissues, and particularly of uterus, cervix, and prostate. IGPcR32. Similarly, the IGPcR32 gene, its corresponding antisense sequence or it's expression product (or a functional fragment of any of these entities, or a fragment of the antisense nucleotide sequence that binds to the IGPcR32 gene) may be used as a method of prevention, treatment or amelioration of any of the cancers or tumours indicated above.

An embodiment of the present invention, the IGPcR32 polypeptide, is 100% identical to the polypeptide predicted from a GPcR mRNA recently isolated from brain anaplastic oligodendroglioma. As the cDNA clone described by Strausberg

(GenBank Accession No. BC016964) was isolated from brain malignant tissue (brain anaplastic oligodendroglioma) and since RT-PCR data presented in Example 2 herein detect weak IGPcR32 expression in brain, concentrated in cerebellum, IGPcR32 has potential as a therapeutic target or marker in brain cancer.

From the results of tissue-specific mRNA expression studies described below in Examples 2 and 3, it is suggested that IGPcRlδ and IGPcR32 play a role in diseases of those tissues containing smooth muscle cells, e.g. cardiovascular diseases, such as coronary heart disease, heart attack and stroke, and in disorders and diseases linked to reproductive tissues such as uterus, placenta and prostate. In particular, the invention encompasses sequences coding for polypeptides of the GPcRs of the invention, i.e. IGPcRlδ or IGPcR32 polypeptides, or functional domains of the IGPcRlδ or IGPcR32 polypeptides, mutated, truncated or deleted forms of the IGPcRl 8 or IGPcR32 receptors, and IGPcRl 8 or IGPcR32 fusion proteins. The invention also encompasses nucleotide constructs that inhibit expression of the IGPcRl 8 or IGPcR32 gene, such as anti-sense and ribozyme constructs, or enhance expression of IGPcRl 8 or IGPcR32 in combination with regulatory sequences such as promoters and enhancers.

The cDNA sequence (SEQ ID NO:l) and deduced amino acid sequence (SEQ ID

NO:2) of human IGPcRl 8 of this invention are shown in Fig. 1 and Fig. 2. The IGPcRl 8 nucleotide sequences of the invention include the DNA sequence shown in Fig. 1, nucleotide sequences that encode the amino acid sequence shown in Fig. 2 and any nucleotide sequence that hybridizes to the complement of the DNA sequence shown in Fig. 1 under highly stringent conditions (Ausubel FM et al, eds., 1989,

Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, hie, and John Wiley & sons, Inc., New York). Functional equivalents of the IGPcRl 8 gene product include naturally occurring IGPcRl 8, mutant and degenerate variants present in humans and other species. Preferred IGPcRlδ nucleic acids encode polypeptides that are at least 55% identical to the amino acid sequence shown in Fig.

2. Nucleic acids which encode polypeptides which are at least 70%, and even more preferably, in increasing order of preference, at least δ0%, δ5%, 90%, 95%, or 9δ% identical. In a particularly preferred embodiment, the nucleic acid of the present invention encodes a polypeptide having an overall amino acid sequence identity of, in increasing order of preference, at least 70%, δ0%, δ5%, 90%, 95%, 98%, or at least 99% with the amino acid sequence shown in Fig. 2.

The cDNA sequence (SEQ ID NO:3) and deduced amino acid sequence (SEQ ID

NO:4) of human IGPcR32 of this invention are shown in Fig. 3 and Fig. 4. The IGPcR32 nucleotide sequences of the invention include the DNA sequence shown in

Fig. 3, nucleotide sequences that encode the amino acid sequence shown in Fig. 4 and any nucleotide sequence that hybridizes to the complement of the DNA sequence shown in Fig. 3 under highly stringent conditions (Ausubel FM et al, eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & sons, Inc., New York). Functional equivalents of the IGPcR32 gene product include naturally occurring IGPcR32, mutant and degenerate variants present in humans and other species. Preferred IGPcR32 nucleic acids encode polypeptides that are at least 55% identical to the amino acid sequence shown in Fig. 4. Nucleic acids which encode polypeptides which are at least 70%, and even more preferably, in increasing order of preference, at least 80%, 85%, 90%, 95%, or 98% identical. In a particularly preferred embodiment, the nucleic acid of the present invention encodes a polypeptide having an overall amino acid sequence identity of, in increasing order of preference, at least 70%, 80%, 85%, 90%, 95%, 9δ%, or at least 99% with the amino acid sequence shown in Fig. 4.

The invention also provides DNA molecules that are the complements of the nucleotide sequences described above and which may act as IGPcRl 8 anti-sense molecules or as IGPCR32 anti-sense molecules useful in gene regulation of IGPcRl 8 or IGPcR32, respectively. Orthologues of the human gene encoding IGPcRlδ or IGPcR32 that are present in other species can be identified and readily isolated. They can be useful for developing cell and animal model systems for purposes of drug discovery. For example, cDNA or genomic DNA libraries derived from the organism of interest can be screened by hybridization using the nucleotides described above, or by performing PCR using degenerate oligonucleotide primers. (See Sambrook et al, 1989, "Molecular Cloning, A Laboratory Manual', Cold Spring Harbor Press, New York, USA; and Ausubel FM et al, eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York). Additionally, expression libraries can be screened using standard antibody screening techniques or by doing database searches for homologues and then cloning them based on the sequence. The identified sequences may be sub-cloned and sequenced. The IGPcRl 8 or IGPcR32 gene sequences may additionally be used to isolate mutant IGPcRl 8 or IGPcR32 gene alleles, or to detect defects in the regulatory sequences of the IGPcRl 8 or IGPcR32 gene using DNA obtained from an individual suspected of or known to carry the mutant IGPcRl 8 or IGPcR32 allele. Mutant alleles may be isolated from individuals either known or proposed to have a genotype which contributes to the symptoms of disorders arising from the aberrant expression or activity of the IGPcRlδ or IGPcR32 proteins. The isolation of human genomic clones is helpful for designing diagnostic tests and therapeutics. For example, sequences derived from the human gene can be used to design primers for use in PCR assays to detect mutations for diagnostics.

The nucleotides of this invention are also preferred for use in mapping the location of the gene to the chromosome, in a process termed chromosomal mapping. Various techniques known to those skilled in the art, including but not limited to in situ hybridization of labeled probes to flow-sorted chromosomes, fluorescence in situ hybridization (FISH) and PCR mapping of somatic cell hybrids may be employed. This allows the physical location of gene regions to be associated with genetic diseases, based on a genetic map. Genetic linkage analysis can then be used to identify the relationship between genes and diseases (see Egeland et al, 19δ7, Nature, 325:783-787). Preferred uses of this map include diagnostic tests and reagents, in pharmacogenetic studies and in monitoring patient responses to drugs in clinical trials.

Proteins and polypeptides

Fig. 2 shows the amino acid sequence of the human IGPcRlδ protein. The amino acid sequence of IGPcRlδ contains hydrophilic domains located between the transmembrane domains, arranging an alternating location of the hydrophilic domains inside and outside the cell membrane. Polypeptides which are at least 70%, and even more preferably at least 80%, 85%, 90%, 95%, 98% or 99% identical or similar to the amino acid sequence represented by Fig. 2 are encompassed by this invention. Fig. 4 shows the amino acid sequence of the human IGPcR32 protein. The amino acid sequence of IGPcR32 contains hydrophilic domains located between the transmembrane domains, arranging an alternating location of the hydrophilic domains inside and outside the cell membrane. Polypeptides which are at least 70%, and even more preferably at least 80%, 85%, 90%, 95%, 98% or 99% identical or similar to the amino acid sequence represented by Fig. 4 are encompassed by this invention.

In particular, the invention encompasses both IGPcRl 8 and IGPcR32 polypeptides, functional domains of the IGPcRl 8 or IGPcR32 polypeptides, mutated, truncated or deleted forms of the IGPcRl 8 or IGPcR32 polypeptides, and host cell expression systems that can produce such IGPcRl 8 or IGPcR32 products. Any or all of the IGPcRl 8 proteins, polypeptides and peptides, can be prepared for the generation of antibodies, as reagents in diagnostic assays, in the identification of other cellular gene products involved in regulating IGPcRlδ, as reagents for screening for compounds that can be used in the treatment of conditions involving IGPcRlδ, and as pharmaceutical reagents useful in the treatment of related disorders. Any or all of the IGPcR32 proteins, polypeptides and peptides, can be prepared for the generation of antibodies, as reagents in diagnostic assays, in the identification of other cellular gene products involved in regulating IGPcR32, as reagents for screening for compounds that can be used in the treatment of conditions involving IGPcR32, and as pharmaceutical reagents useful in the treatment of related disorders. Similarly, proteins, polypeptides and peptides comprising those regions of overlapping structure, or antibodies or other reagents or ligands directed towards such regions of structural overlap between IGPcRlδ and IGPcR32, may be used in cross reactions for both of these GPcRs; and proteins, polypeptides and peptides that do not comprise regions of overlapping structure between these two GPcRs (or antibodies or ligands directed towards such proteins, polypeptides or peptides) may be used as reagents selective for either IGPcRlδ or for IGPcR32, as appropriate.

The invention also encompasses proteins that are functionally equivalent to the IGPcRl 8 and IGPcR32 encoded by the nucleotide sequences of the invention, as defined by the ability to bind, respectively, natural IGPcRl 8 or IGPcR32 ligand, or as defined by the resulting biological effect of, respectively, natural IGPcRl 8 ligand binding or natural IGPcR32 ligand binding, e.g., signal transduction, a change in cellular metabolism or change in phenotype. Such functionally equivalent IGPcRl 8 or IGPcR32 proteins include but are not limited to additions or substitutions of amino acid residues, which result in a silent change. Also preferred in this invention are mutant IGPcRl 8 proteins or mutant IGPcR32 proteins with increased function, and/or greater signalling capacity; or decreased function, and/or decreased signal transduction capacity which may be generated by random mutagenesis techniques and site-directed mutagenesis techniques well known to those skilled in the art. The same strategy can also be used to design mutant forms of IGPcRl 8 or IGPcR32 based on the alignment of, respectively, human IGPcRl 8 and IGPcRl 8 orthologues from other species or human IGPcR32 and IGPcR32 orthologues from other species. Highly preferred are other mutations to the IGPcRl 8 or IGPcR32 coding sequence that can be made to generate, respectively, IGPcRl 8 or IGPcR32 constructs that are better suited for expression, scale up, etc. in the host cells chosen. Host cells may be chosen depending on their varying capacity to modify synthesized proteins.

Peptides corresponding to one or more domains of the IGPcRlδ or IGPcR32 (e.g.,

ECD, TM or CD), truncated or deleted forms of IGPcRlδ or IGPcR32, as well as fusion proteins are also within the scope of the invention and can be designed on the basis of, respectively, the IGPcRlδ or IGPcR32 sequences disclosed above, from either the nucleotide or amino acid sequences. Such IGPcRlδ or IGPcR32 polypeptides, peptides and fusion proteins can be produced using techniques well known in the art for generating and expressing protein encoding sequences. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. (See Sambrook et al, 19δ9, "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Press, N.Y.; and Ausubel FM et al, eds., 19δ9, Current Protocols in Molecular Biology, Vol. I, Green

Publishing Associates, Inc., and John Wiley & Sons, hie, New York.). A variety of host-expression vector systems may be utilized to express the IGPcRlδ or IGPcR32 nucleotide sequences of the invention. The IGPcRl 8 or IGPcR32 peptide or polypeptide may be anchored in the cell membrane and purified or enriched from such expression systems using appropriate detergents and lipid micelles, and methods well known to those skilled in the art. Or, where the IGPcRlδ or IGPcR32 peptide or polypeptide is secreted by the cells, it may be isolated from the culture media. Such host cells themselves may be used to assess biological activity, e.g., in drug screening assays.

The expression systems that may be used for purposes of the invention include, but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis); yeast (e.g., Saccharomyces sp., Pichia sp.); insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus); plant cell systems infected with recombinant viral or plasmid expression vectors; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing mammalian promoters. Lower amounts of functional protein are expressible in E. coli and yeast, particularly as E. coli do not contain G proteins or effectors. G proteins may be added to E.coli expressing G protein-coupled receptors in cell membrane, in the cell-based assays. Yeast cells may be humanized by co- transfixing human G proteins. The yeast Pichia pastoris is preferred over

Saccharomyces cerevisiae for purification of G protein-coupled receptors for structural studies. The most preferred systems for expression are the baculovirus/insect cell and mammalian cell systems, as they can produce the largest quantities of G protein-coupled receptors in functional form for analysis. Mammalian cells are preferred because they express the necessary G proteins, and vaccinia and Semliki Forest virus are preferred as vectors. (See Tate et al, 1996, Tibtech 14:426-430).

Diagnostic and therapeutic reagents and kits

In one embodiment of the invention, the invention encompasses antibodies directed against IGPcRlδ proteins or peptides, or IGPcRlδ fusion proteins, as described above. Such antibodies include but are not limited to polyclonal antibodies, monoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, anti-idiotypic (anti-Id) antibodies, including Fab fragments. The antibodies may be generated and purified, or conjugated according to methods well known in the art. See for example Harlow E and Lane D, 19δδ, "Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

In another embodiment of the invention, the invention encompasses antibodies directed against IGPcR32 proteins or peptides, or IGPcR32 fusion proteins, as described above. Such antibodies include but are not limited to polyclonal antibodies, monoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, anti-idiotypic (anti-Id) antibodies, including Fab fragments. The antibodies may be generated and purified, or conjugated according to methods well known in the art. (See above)

In a further embodiment, the antibodies of the invention may be used, for example, as part of a diagnostic or a prognostic, and as a part of compound screening schemes, for the evaluation of the effect of test compounds on expression and/or activity of the

IGPcRlδ or IGPcR32 gene product. Preferably, antibodies may be used in therapeutic regimes as a method for the inhibition of abnormal IGPcRl 8 or IGPcR32 activity. Also preferred are antibodies directed against wild type or mutant IGPcRl 8 or IGPcR32 gene products or conserved variants or peptide fragments thereof to detect the pattern and level of expression, as well as distribution in tissues, of the

IGPcRl 8 or IGPcR32 in the body, also by in situ detection. The antibodies may be employed as part of an enzyme immunoassay (EIA), a radioimmunoassay, or as an antibody labeled with a chemiluminescent or a fluorescent compound.

In yet other embodiments of the invention, the IGPcRlδ proteins or peptides,

IGPcRlδ fusion proteins, IGPcRlδ nucleotide sequences, antibodies, antagonists and agonists can be useful for the detection of mutant forms of IGPcRl 8 or inappropriately expressed forms of IGPcRl 8, for the diagnosis of disorders including pain, cancer, cardiovascular diseases, such as coronary heart disease, heart attack and stroke, inflammatory disorders and metabolic disorders linked to reproductive tissues - particularly uterus, cervix, placenta, testis, epididymis and prostate - and reproductive disorders. Similarly the IGPcR32 proteins or peptides, IGPcR32 fusion proteins, IGPcR32 nucleotide sequences, antibodies, antagonists and agonists can be useful for the detection of mutant forms of IGPcR32 or inappropriately expressed forms of IGPcR32, for the diagnosis of the disorders indicated immediately above. DNA encoding IGPcRl 8 or IGPcR32 or parts thereof may be used in hybridization or amplification assays of biological samples to detect abnormalities involving IGPcRlδ or IGPcR32 gene structure, including point mutations, insertions, deletions and chromosomal rearrangements. Such genotyping assays may include, but are not limited to Southern analyses, single stranded conformational polymorphism analyses (SSCP), and PCR analyses (See Mullis KB, U.S. Pat. No. 4,6δ3,202), the use of restriction fragment length polymorphisms (RFLPs), of variable numbers of short, tandemly repeated DNA sequences between the restriction enzyme sites (see Weber, U.S. Pat. No. 5,075,217), and by detecting and measuring, respectively, IGPcRlδ or IGPcR32 transcription.

Also within the scope of the invention are the IGPcRlδ proteins or peptides, IGPcRl 8 fusion proteins, IGPcRl 8 nucleotide sequences, host cell expression systems, antibodies, antagonists, agonists and genetically engineered cells and animals, and the IGPcR32 proteins or peptides, IGPcR32 fusion proteins, IGPcR32 nucleotide sequences, host cell expression systems, antibodies, antagonists, agonists and genetically engineered cells and animals. These can be used for screening for drugs effective in the treatment of disorders. The use of engineered host cells and/or animals may offer an advantage in that both compounds that bind to the ECD of the GPcRs of the invention and compounds that affect the signal transduced by the activated GPcRs of the invention may be identified. Screening for receptor modulating agents

In another embodiment of the invention, the invention encompasses the pharmacological testing wherein the cloned IGPcRl 8 genes or the cloned IGPcR32 genes are expressed in yeast, insect or mammalian cells and screened for a response to cognate or surrogate agonists. The agonists may be present in, but are not limited to, biological extracts, peptide libraries and/or complex compound collections. The invention provides for screening which may utilize libraries of known compounds, including natural products or synthetic chemicals, and biologically active materials, including proteins, for compounds which are inhibitors or activators. Candidate test compounds include all kinds of combinatorial chemistry derived molecular libraries of amino acids, peptides, soluble peptides, modified peptides, antibodies, small organic and inorganic molecules.

In a further embodiment of the invention, a labeled test compound can be incubated with the receptor to determine whether one binds to the other. Functional assays including fibroblast and BM transformation assays, cell cycle analysis can be performed; as well as responses using signal transduction assays, including protein phosphorylation, guanylate cyclase activity, ion fluxes (e.g. calcium) and pH changes can be measured. High throughput drug screening systems are most preferred and may use assays including, but not limited to, the production of intracellular second messengers, such as cAMP, diacylglycerol and inositol phosphates; the activation of reporter gene transcription, such as luciferase and beta-galactosidase under for example the cAMP-responsive element; receptor-mediated actions on adenylyl cyclase and phospholipase C leading also for example to dispersion or aggregation of frog melanophores. (Reviewed in Tate et al, 1996, Tibtech 14:426-430; included in entirety herein).

In a highly preferred embodiment, a functional genomics approach for protein- protein interaction screening may be employed wherein the GPcR is produced in

"humanized yeast cells": expression in yeast along with endogenous or promiscuous mammalian or human G-alpha proteins. Transient expression of cDNA can also be carried out using mammalian CHO, HEK-293 cells or COS-7 cells and receptors can be analyzed for ligand binding and drug interactions (for example as described in Fraser et al, 1995, J. Nucl. Med., 36:17S-21S). Also preferred is site-directed mutagenesis to define regions of IGPcR32 that have functional importance. Site- directed mutagenesis may be used to map ligand-binding pockets and to identify residues important for receptor interaction and activation. Compounds that can be generated using modeling methods to bind these residues are also within the scope of this invention. For example, receptor down-regulation and the development of drug tolerance, such as seen in asthma patients who use bronchial dilators which are beta- adrenergic agonists leading to tachyphylaxis, can be studied in these cell systems. The expression of both intact and hybrid receptors is preferred. The number of receptors, as well as mRNA levels can be measured. Agents for radionuclide imaging to monitor level changes can be developed.

Some of the known receptors and their ligands defined by the techniques described above are shown below.

Ligand screening

The invention encompasses antagonists and agonists of IGPcRl 8, as well as compounds or nucleotide constructs that inhibit expression of the IGPcRl 8 gene (anti-sense and ribozyme molecules), or promote expression of IGPcRl 8 (wherein IGPcRl 8 coding sequences are operatively associated with promoters, enhancers, etc.). Highly preferred are the IGPcRlδ protein products (especially soluble derivatives of IGPcRlδ, or truncated polypeptides lacking the TM or CD domains) and fusion protein products, antibodies and anti-idiotypic antibodies, antagonists or agonists (including compounds that modulate signal transduction which may act on downstream targets in the IGPcRlδ signal transduction pathway) that can be used for therapy of such diseases, by inhibiting receptor activity.

The invention further encompasses antagonists and agonists of IGPcR32, as well as compounds or nucleotide constructs that inhibit expression of the IGPcR32 gene

(anti-sense and ribozyme molecules), or promote expression of IGPcR32 (wherein IGPcR32 coding sequences are operatively associated with promoters, enhancers, etc.). Highly preferred are the IGPcR32 protein products (especially soluble derivatives of IGPcR32, or truncated polypeptides lacking the TM or CD domains) and fusion protein products, antibodies and anti-idiotypic antibodies, antagonists or agonists (including compounds that modulate signal transduction which may act on downstream targets in the IGPcR32 signal transduction pathway) that can be used for therapy of such diseases, by inhibiting receptor activity.

Nucleotide constructs encoding functional forms of IGPcRlδ and mutant forms of IGPcRlδ and nucleotide constructs encoding functional forms of IGPcR32 and mutant forms of IGPcR32 are preferred embodiments of the invention, as their uses include employment in the genetic engineering of host cells. Other preferred embodiments of the invention are anti-sense and ribozyme molecules, preferred for use in "gene therapy" approaches in the treatment of disorders or diseases arising from the aberrant or altered activity of IGPcRl 8 or IGPcR32. The gene therapy vector alone or when incorporated into recombinant cells, may be administered in a suitable formulation for intravenous, intra-muscular, intra-peritoneal delivery, or may be incorporated into a timed release delivery matrix.

Transgenic and knock-out animal models

The animal-based and cell-based models can be used to identify drugs, biologicals, therapies and interventions which can be effective in treating disorders with aberrant expression or activity. IGPcRl 8 sequences can be introduced into, and over- expressed and/or can be disrupted in order to under-express or inactivate IGPcRl 8 gene expression. Similarly, IGPcR32 sequences can be introduced into, and over- expressed and or can be disrupted in order to under-express or inactivate IGPcR32 gene expression.

In further embodiments of the invention, the IGPcRlδ gene products or the IGPcR32 gene products can also be expressed in transgenic animals. Non-human animals of any species, including, but not limited to, mice, rats, rabbits, guinea pigs, sheep, cows, goats, may be used to generate IGPcRlδ or IGPcR32 transgenic animals. The present invention provides for transgenic animals that carry the IGPcRlδ transgene or the IGPcR32 transgene in all their cells, as well as animals which carry the transgene in some, but not all their cells, i.e., mosaic animals. The transgene may be expressed in all tissues of the animal, or may be limited to specific tissues. Any technique known in the art may be used to introduce the IGPcRlδ transgene or the

IGPcR32 transgene into animals to produce the founder lines of transgenic animals. Such techniques include, but are not limited to pronuclear microinj ection (Hoppe PC and Wagner TE, U.S. Patent No. 4,873,191); retrovirus mediated gene transfer into germ lines (Van der Putten et al, 1985, Proc. Natl. Acad. Sci., USA 82:6148-6152); gene targeting in embryonic stem cells (Thompson et al, 1989, Cell 56:313-321); electroporation of embryos (Lo, 1983, Mol. Cell. Biol., 3:1803-1814); and sperm- mediated gene transfer (Lavitrano et al, 1989, Cell 57:717-723); etc. For a review of such techniques, see Gordon, 1989, "Transgenic Animals", Intl. Rev. Cytol. 115:171-229, which is incorporated by reference herein in its entirety.

The present invention relates to knock-out animals engineered by homologous recombination to be deficient in the production of the IGPcR32. The present invention is directed to a knock-out animal having a phenotype characterized by the substantial absence of IGPcR32, otherwise naturally occurring in the animal, hi addition, the invention encompasses the DNA constructs and embryonic stem cells used to develop the knock-out animals and assays which utilize either the animals or tissues derived from the animals. Preferably, these cells, tissues and cell lines are characterized by the substantial absence of IGPcR32 that would otherwise be naturally occurring in their normal counterparts.

Gene targeting is a procedure in which foreign DNA sequences are introduced into a specific locus within the genome of a host cell. In other embodiments of the invention, endogenous IGPcRlδ gene expression can be reduced by inactivating or knocking out the IGPcRlδ gene or its promoter using targeted homologous recombination, or endogenous IGPcR32 gene expression can be reduced by inactivating or knocking out the IGPcR32 gene or its promoter using targeted homologous recombination (e.g., see Smithies et al, 1985, Nature 317:230-234; Thomas & Capecchi, 1987, Cell 51:503-512; Thompson et al, 1989, Cell 5:313- 321 ; each of which is incorporated by reference herein in its entirety). For example, a mutant, non-functional IGPcRlδ (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous IGPcRl 8 gene (either the coding regions or regulatory regions of the IGPcRl 8 gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express IGPcRl 8 in vivo; similarly, a mutant, non-functional IGPcR32 (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous IGPcR32 gene (either the coding regions or regulatory regions of the IGPcR32 gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express IGPcR32 in vivo. Insertion of the DNA construct, via targeted homologous recombination into the genome, results in abolishing IGPcR32 gene function.

One preferred technique for targeted mutagenesis in this invention is based on homologous recombination. The general methodologies of targeting mutations into the genome of cells, and the process of generating mouse lines from genetically altered embryonic stem (ES) cells with specific genetic lesions are well known (Bradley, 1991, Cur. Opin. Biotech. 2: 823-829). See also U.S. patents 5,557,032 by

Mak et al, and U.S. Patent No. 5,487,992 by Capecchi et al, included by reference herein. Preferred in this invention is a synthetic recombination vector which contains the genetic information of the targeted chromosomal locus recombines with the genomic DNA after introduction into a cell. A strategy of "positive/negative selection" can be used to enrich the cell population for cells in which targeting vectors have integrated into the host cell genome, and recombination has occurred at the desired gene locus (Mansour, et al, 1988, Nature 336:348). The vector usually contains a positive selection cassette which is flanked by the genetic information of the target locus to enrich for cells where the vector successfully recombines with the chromosomal DNA against the pool of non-recombinant cells. The likelihood of obtaining an homologous recombination event increases with the size of the chromosomal vector DNA and is further dependent on the isogenicity between the genomic DNA of the vector and the target cell (See te Reile et al, 1992, P.N.A.S. USA 89:512δ-5132; Deng et al, 1991, Mol. Cell. Biol, 12, 3365-3371). Also preferred in this invention are large stretches of genomic DNA flanking the

IGPcR32 gene orthologue in the target animal species. The cloning of large chromosomal fragments of the target gene, the sub-cloning of this DNA into a bacterial plasmid vector, the mapping of the gene structure, the integration of the positive selection cassette into the vector and finally, the flanking of one or both homologous vector arms by a negative selection marker are well described in the literature. Also preferred are replacement-type targeting vectors using yeast host cells are described by Storck et al, 1996, Nuc. Acids Res. 24:4594-4596. The use of other vectors such as bacteriophage λ and vectors for phage-plasmid recombination have been described by Tsuzuki et al, 1998, Nuc. Acids Res 26:9δδ-993; transposon-generated gene targeting constructs have also been described by

Westphal et al, 1997, Curr. Biol, 7:530-533 and are within the scope of the invention.

The most highly preferred method in this invention is described by Wattler S & Nehls M, German patent application DE 100 16 523.0, "Klonierungssystem zur

Konstruktion von homologen Rekombiationsvektoren", filed April 03, 2000, included by reference in whole herein,, and described in part in Example 9. This method reduces the time required for the construction of such vectors from 3-6 months to about 14 days. The vector includes a linear lambda vector (lambda-KO- Sfi) that comprises a sniffer fragment; an E. coli origin of replication; an antibiotic resistance gene for bacterial selection, two negative selection markers suitable for use in mammalian cells; LoxP sequences for cre-recombinase mediated conversion of linear Lambda phages into high copy plasmids. In a final targeting vector, the stuffer fragment is replaced by nucleotide sequences representing a left arm of homology, an ES cell selection cassette, and a right arm of homology. The transformation of mousel29 ES cells with the final vector construct is done according to standard procedures. The targetting vector is linearized and then introduced by electroporation into ES cells. Cell clones are positively selected with G41δ and negatively selected with GANC (ganciclovir, 0.2 μM). Targeted ES-cell clones with single integration sites are identified, confirmed by hybridization, and expanded in culture for injection.

The invention also encompasses embryonic stem (ES) cells derived from a developing mouse embryo at the blastocyst stage, that are modified by homologous recombination to contain a mutant IGPcR32 gene allele. The modified ES cells are reintroduced into a blastocyst by microinj ection, where they contribute to the formation of all tissues of the resultant chimeric animal, including the germ line (Capecchi, 1989, Trends Genet., 5:70; Bradley, et al, 1984, Nature, 309:255). Modified ES cells may also be stored before reimplantation into blastocysts. The chimeric blastocysts are implanted into the uterus of a pseudo-pregnant animal, prepared by mating females with vasectomized males of the same species. Typically chimeras have genes coding for a coat color or another phenotypic marker that is different from the corresponding marker encoded by the stem cell genes.

Also within the scope of the invention are chimeric male non-human animals and their heterozygous offspring carrying the IGPcRlδ or the IGPcR32 gene mutation, which are bred to obtain animals homozygous for the mutation of interest. A phenotype selection strategy may be employed, or chromosomal DNA may be obtained from the tissue of offspring, screened using Southern blots and/or PCR amplification for the presence of a modified nucleotide sequence at the appropriate gene locus, either IGPcRlδ or IGPcR32, as described in the above section regarding identification of positively targeted ES cells. Other means for identifying and characterizing transgenic knock-out animals are also available. For example, Northern blots can be used to probe mRNA obtained from tissues of offspring animals for the presence or absence of transcripts coding for (a) either the IGPcRl 8, or for the marker gene, or for both; or (b) either the IGPcR32, or for the marker gene, or for both, hi addition, Western blots might be used to assess IGPcRl 8 and/or IGPcR32 expression by probing with antibody specific for an epitope borne by both receptors or by probing the Western blot with an antibody specific for either one or the other receptor.

These animals are characterized by including, but not limited to: (a) a loss in the ability to bind ligands specific for IGPcRl 8 and/or IGPcR32; and/or (b) by a loss in expression from the gene locus of IGPcRl 8 or IGPcR32. Preferably, the animals produce no functional forms of IGPcRlδ and/or IGPcR32 at all. Once homozygous transgenic animals have been identified, they may preferably be interbred to provide a continual supply of animals that can be used in identifying pathologies dependent upon the absence of a functional IGPcRlδ and/or IGPcR32 and in evaluating drugs in the assays described above. Also highly preferred in this invention, are these animals as providing a source of cells, tissues and cell lines that differ from the corresponding cells, tissues and cell lines from normal animals by the absence of fully functional forms of IGPcRlδ and/or IGPcR32.

The methodology needed to make such animals can be adapted to a variety of species of non-human animal. In another embodiment, clones of the non-human transgenic animals can be produced according to methods described in Wilmut et al, 1997,

Nature, 385:810-813.

A further embodiment of the present invention is an isolated nucleic acid molecule, wherein said nucleic acid molecule comprises at least one of:

(a) the nucleotide sequence of SEQ ID NO: 1 ;

(b) a nucleotide sequence which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:2 or to SEQ ID NO:4, or any unique fragment thereof wherein the amino acid sequence of the fragment is greater than ten amino acids in length. A further embodiment of the present invention is an isolated nucleic acid molecule comprising an allelic variant of a nucleotide sequence which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:4, wherein said allelic variant contains at least 80% nucleic acid homology and hybridizes to the complement of SEQ ID NO:l or to the complement of SEQ ID NO: 3 under highly stringent conditions equivalent to hybridization in 42°C in a hybridization solution comprising 50% formamide, 1% SDS, 1M NaCl, 10% Dextran sulfate, and washing twice for 30 minutes in a wash solution comprising O.lxSSC and 1% SDS.

A further embodiment of the present invention is an isolated nucleic acid molecule of the invention, being any of the embodiments described above, comprising a nucleotide sequence which encodes at least one of the group of polypeptides, peptides and fusion proteins, comprising an amino acid sequence at least 70% similar to SEQ ID NO:2 or to SEQ ID NO:4.

A further embodiment of the present invention is the isolated nucleic acid molecule of the invention, being any of the embodiments described above, operatively linked with a nucleotide regulatory sequence capable of controlling expression of the nucleic acid molecule in a host cell or non-human animal.

A further embodiment of the present invention is a vector comprising the isolated nucleic acid molecule of the invention, wherein the nucleic acid molecule is any of the embodiments described above.

A further embodiment of the present invention is a host cell genetically engineered to contain at least one of: (a) the nucleic acid molecule of the invention that is any of the embodiments described above; or (b) the vector of the invention, described above.

A further embodiment of the present invention is the host cell of the invention as described above, wherein said host cell is a eucaryotic cell, being at least one of: (a) a yeast cell; (b) an insect cell; or (c) a mammalian cell.

A further embodiment of the present invention is the human IGPcRlδ protein of SEQ ID NO:2 or the human IGPcR32 protein of SEQ ID NO:4, or any unique fragment of either of these proteins, wherein the amino acid sequence of the fragment is greater than ten amino acids in length, including but not limited to polypeptides, peptides, isolated domains and fusion proteins.

Further embodiments of the present invention are antibodies to the IGPcRlδ or IGPcR32 proteins, polypeptides, peptides, isolated domains and/or fusion proteins.

Further embodiments of the present invention are agonists and antagonists of IGPcRl protein or IGPcR32 protein that compete selectively with native natural IGPcRlδ ligand and/or IGPcR32 ligand and which modulate IGPcRlδ gene expression or gene product activity and/or IGPcR32 gene expression or gene product activity, including: (a) 'small molecules' of molecular mass less than 6 kDa; (b) molecules of intermediate size, having molecular mass between 5 kDa to 15 kDa; and (c) large molecules of molecular mass greater than 12 kDa; the latter including mutant natural ligand proteins of IGPcRlδ and/or IGPcR32 that compete with native natural IGPcRlδ and/or IGPcR32 ligand and which modulate gene expression or gene product activity of IGPcRlδ and/or IGPcR32. Still further embodiments of the present invention are anti-sense, aptamer and ribozyme molecules that can be used to inhibit IGPcRlδ and/or IGPcR32 gene expression or expression constructs used to enhance IGPcRlδ and/or IGPcR32 gene expression. Additional embodiments of the present invention are methods of identifying compounds of the invention, as described above, which modulate the activity of IGPcRlδ and/or IGPcR32 or which modulate gene expression of IGPcRl and/or IGPcR32.

Further embodiments of the present invention are embryonic stem cells containing a disrupted endogenous IGPcRlδ gene and/or IGPcR32 gene. Further embodiments of the present invention are non-human knock-out animals that do not express IGPcRlδ and/or IGPcR32, wherein the endogenous animal orthologue of the IGPcRlδ gene and/or IGPcR32 gene is functionally disrupted.

Further embodiments of the present invention are these non-human knock-out animals, wherein the endogenous animal orthologue of the IGPcRlδ gene and/or IGPcR32 gene is functionally disrupted by an homologous recombination method.

Further embodiments of the present invention are mutated non-human animals that express a non-functional or partially functional form of IGPcRlδ and/or IGPcR32.

A further embodiment of the present invention is a non-human transgenic animal model expressing the human IGPcRlδ and/or IGPcR32 cDNA sequences as shown in SEQ ID NO:l or SEQ ID NO: 3 or a nucleic acid molecule of the invention.

A further embodiment of the present invention is the non-human animal model of the invention, whereby the human IGPcRlδ or human IGPcR32 is encoded by a nucleic acid sequence which is homozygous in said animal model.

Further embodiments of the present invention are progeny of the non-human animals of the invention, including both heterozygous and homozygous offspring.

Further embodiments of the present invention are non-human animals of the invention, wherein the animal is from a genus selected from the group consisting of Mus (e.g., mice), Rattus (e.g., rats), Oryctologus (e.g., rabbits) and Mesocricetus

(e.g., hamsters).

A further embodiment of the present invention is the use of the non-human animal of the invention for the dissection of the molecular mechanisms of the IGPcRlδ pathway or of the IGPcR32 pathway, for the identification and cloning of genes able to modify, reduce or inhibit the phenotype associated with IGPcRl and/or IGPcR32 activity or deficiency.

A further embodiment of the present invention is the use of the animal model of the invention for the identification of gene and protein diagnostic markers for diseases.

A further embodiment of the present invention is the use of the animal model of the invention for the identification and testing of compounds useful in the prevention, amelioration or treatment of diseases associated with IGPcRlδ and/or IGPcR32 activity or deficiency.

A further embodiment of the present invention is the use of the invention described above wherein the disease comprises a reproductive disorder associated with signal processing in a reproductive tissue selected from the group of uterus cervix, placenta, ovary, testis, epididymis and prostate.

A further embodiment of the present invention is a method of identifying compounds suitable for modulating the activity of the human IGPcRlδ protein and/or human IGPcR32 protein for treatment of diseases characterized by aberrant expression or activity of IGPcRl and/or IGPcR32, wherein said protein may also be any unique fragment of said protein wherein the amino acid sequence of the fragment is greater than ten amino acids in length, including but not limited to polypeptides, peptides, isolated domains and fusion proteins.

A further embodiment of the present invention is a method of prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRlδ and/or IGPcR32, by the administration of compounds that bind specifically to the IGPcRl 8 and/or IGPcR32 gene or protein and/or which modulate IGPcRlS and/or IGPcR32 expression or IGPcRl 8 andor IGPcR32 activity; the compounds that that bind specifically to the IGPcRl 8 and/or IGPcR32 gene or to the IGPcRl 8 and/or IGPcR32 protein and/or which modulate IGPcRl 8 and/or IGPcR32 expression or IGPcRl 8 and/or IGPcR32 activity for the prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRl 8 and/or IGPcR32; and the use of compounds that that bind specifically to the IGPcRl 8 and/or IGPcR32 gene or to the IGPcRl 8 and/or IGPcR32 protein and/or which modulate IGPcRlδ and or IGPcR32 expression or IGPcRl 8 and/or IGPcR32 activity for prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRl 8 and/or IGPcR32.

A further embodiment of the invention is a gene therapy method of prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRl 8 and/or IGPcR32, by the administration of vectors and/or host cells containing one or more nucleotide sequences of the invention, that modulate IGPcRl 8 and/or IGPcR32 expression or IGPcRl 8 and or IGPcR32 activity; the vectors and/or host cells containing one or more nucleotide ^• sequences of the invention which modulate IGPcRl 8 and/or IGPcR32 expression or IGPcRl 8 and/or IGPcR32 activity for the prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRl 8 and/or IGPcR32; and the use of vectors and/or host cells containing one or more nucleotide sequences of the invention which modulate IGPcRl 8 and/or IGPcR32 expression or IGPcRl 8 and/or IGPcR32 activity for prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRl 8 and/or IGPcR32.

A further embodiment of the invention is a method of the invention for prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcRl 8 and/or IGPcR32 wherein the disease comprises a reproductive disorder associated with signal processing in a reproductive tissue selected from the group of uterus, cervix, placenta, ovary, testis, epididymis and prostate. EXAMPLES

Example 1. Identification of full-length human cDNA coding for IGPcRl 8 and IGPcR32.

The identification strategy for IGPcRl 8 was to perform a screen of the EMBL alert HTGH (High Throughput Genome) database using the nucleotide sequences of known G protein-coupled receptors. A potential new GPcR sequence with a statistically significant score was returned and searched for open reading frames. Subsequently a putative coding region was assigned and used in primer design. The tracked human genomic IGPcRl 8 sequence contains a full-length cDNA sequence (SEQ ID NO:l). The IGPcRl 8 cDNA is single exon encoded. IGPcRl 8 sequences, comprising a nucleic acid sequence of 969 base pairs (bp) (SEQ ID NO:l) which encode a protein of 323 amino acids (SEQ ID NO:2) were described in U.S. Provisional Patent Application No. 60/215,879 and International Patent Application

PCT/EP01/07530.

Sequencing of cDNA clones has identified an additional coding sequence of 1032 base pairs (SEQ ID No:3) encoding a protein of 343 amino acids (SEQ ID No:4), named herein IGPcR32.

Compared to the IGPcRl 8 cDNA sequence, the IGPcR32 cDNA sequence contains an additional 48 nucleotides at the 5' end. As indicated in Figure 5a this IGPcR32 nucleotide sequence codes for a protein with an additional 16 amino acids at the protein N-terminus, labelled I in Fig. 5a. Moreover, in comparison with the

IGPcRl 8 cDNA sequence the IGPcR32 cDNA sequence contains a total of 12 additional nucleotides starting at cDNA position +416, thereby introducing reading- frame shifts in the amino acid encoding cDNA sequence. Figure 5a indicates that these cDNA reading-frame shifts cause significant differences between the amino acid sequences of the IGPcRlδ and IGPcR32 proteins in three regions (labelled H,

HI and IV in Fig. 5a) which are defined by the following amino acid positions relative to IGPcR32 amino acid sequence: (II) 140 to 189; (III) 227 to 232; and (IV) 297 to 338. Nevertheless, the overall identity between the amino acid sequences of the IGPcRl 8 and IGPcR32 proteins is 74,3% within the comparable 327 amino acid residues, as depicted in Fig. 5 a.

BLASTP searches (Basic Local Alignment Search Tool for Proteins, National Institutes of Health, Bethesda MD, U.S.A.) revealed that the human IGPcRl 8 receptor has 63% amino acid sequence identity and 69% homology with conserved substitutions to rat RTA amino acid sequences (GenPept Accession No. P23749; GenBank Accession No. M32098) and that the human IGPcR32 receptor has 85,1% amino acid sequence identity to the rat RTA amino acid sequence. Rat RTA had been isolated from a thoracic aorta cDNA library using Ml muscarinic acetylcholine receptor sequences (Ross et al, 1990, P.N.A.S. USA, 87:3052-3056). The muscarinic acetylcholine receptor belongs to GPcR class 1 and mediates various cellular responses, primarily by inhibition of adenylate cyclase, but also via the breakdown of phosphoinositides and modulation of potassium channels through the action of G proteins (Peralta et al, 1987, EMBO J., 6:3923-3929).

RTA encodes an orphan receptor of 343 amino acids and is highly expressed in rat cerebellum and tissues containing smooth muscle cells. RTA is most closely related to the masl proto-oncogene, which has been suggested to be a forebrain angiotensin receptor, expressed in rat cerebral endothelial cells and rat hippocampus. Angiotensin binding to the rat RTA protein was not detected, and the natural ligand is still unknown (Ross et al, P.N.A.S. USA, 87:3052-3056). Lack of masl in knock- out mice has been shown to result in behavioural alterations, including anxiety

(Walther et al, 1998, J. Biol. Chem., 273:11867-73). The mas protooncogene has also been implicated in heart rate and blood pressure variability (Walther et al, 2000, Braz. J. Med. Biol. Res., 33:1-9).

Human IGPcR32 also has δ6,5% amino acid identity in a stretch of 318 residues when compared to mouse GPcR MrgF (NCBI Protein Accession No. AAK91802; Genbank Accession No. AY042211), a family member of masl related GPcRs being expressed in sensory neurons, some of these GPcRs detecting painful stimuli (Dong X. et al, 2001, Cell 106(5):619-632). The conceptual translation of the partial cDNA listed in Genbank Accession No. AY042211 generates a 319 amino acid peptide, lacking the 24 N-terminal amino acid residues of IGPcR32. Mouse MrgF exhibits 97.2% amino acid identity in a sequence stretch of 318 amino acid residues, when compared to rat RTA, as depicted in Figure 5d herein, illustrating the close structural relationship between these two rodent proteins (see also Fig. 6, hydropathy plots of mouse MrgF, rat RTA, IGPcRlδ and IGPcR32 amino acid sequences).

The next highest amino acid identity detected for IGPcR32 is to human GPcR MrgXl (Genbank Accession No. AY042213; NCBI Protein Accession No. AKK91δ04.1) with only 36.7% identity in a 2δ3 amino acid overlap analyzed. MrgXl is another member of a family of masl related receptors, named Mrg (Dong

X. et al, 2001 Cell 106(5):619-632).

From the foregoing, we propose that mouse MrgF and rat RTA are rodent orthologues for human IGPcR32, being respectively, the mouse and rat orthologues for human IGPcR32.

Example 2. Tissue-specific expression of human IGPcR18 and IGPcR32; analysis by RT-PCR.

Expression of the present invention's GPcRs in a broad range of human tissues was determined by detecting mRNA of GPcRs of the invention in a reverse transcription- polymerase chain reaction (RT-PCR) assay.

The cDNA sequences of IGPcRlδ and IGPcR32 are identical within the first 415 nucleotides from the IGPcRlδ start codon, a region that includes transmembrane domains 1 and 2 of these two GPcRs. This region of the sequences of the present invention's GPcRs also incorporates the sequences of primers SEQ ID NO:6 and SEQ ID NO:10. The two primers (SEQ ID NO:6 and SEQ ID NO:10) were used to amplify a 267 bp product (SEQ ID NO: 11) which was then tested in a reverse transcription-polymerase chain reaction (RT-PCR) assay against a panel of cDNAs derived from total RNA from each of 29 human tissues (Clontech laboratories, Inc., Palo Alto CA, U.S.A.; Invitrogen Corp., Carlsbad CA, U.S.A.). The sequence of the primers used to amplify a 267 bp product (SEQ ID No: 11), which spans a region of both IGPcRlδ and IGPcR32 that includes transmembrane domains 1 and 2, is as follows:

5' - CTCTACAGCCGGGGCTTC (IGPcR32 coding sequence position 79-97; SEQ

ID NO: 10) 5' - GATGTAGTCGGCAAACGTGC (IGPcR32 coding sequence position 345-326; SEQ ID NO:6)

The conditions for the PCR were: denaturation at 94°C for 45 seconds, annealing at 56°C for 1 minute, and extension at 72°C for 30 seconds, for a total of 35 cycles, in a Thermocycler (MJ Research, Watertown MA, USA; type PTC-225). The PCR products were analyzed by electrophoresis through a 1.8% agarose gel and stained with ethidium bromide to visualize DNA by ultraviolet imaging, using standard techniques well known in the art. The 29 human tissues analyzed were: skin, whole brain, fetal brain, cerebellum, thymus, esophagus, trachea, lung, breast, mammary gland, heart, liver, fetal liver, kidney, spleen, adrenal gland, pancreas, stomach, small intestine, skeletal muscle, adipose tissue, uterus, placenta, bladder, prostate, testis, colon, rectum and cervix. Positive (human genomic DNA) and negative (water) controls were included.

PCR products of 267 bp in size were observed: positive signals for PCR products of this size were observed in cDNA prepared from uterus, placenta, adipose tissue, prostate, fetal liver; less intense but significant signals of the appropriate size were detected in cervix, cerebellum, and stomach; weaker signals were obtained in all other tissues, except for fetal brain where no product was detected (see Fig. 7). The correct identity of the sequence amplified was confirmed by sequencing of the PCR products.

These results, illustrated in Fig. 7, demonstrate tissue localisation of IGPcRl 8 and

IGPcR32 transcripts, but cannot distinguish between these two transcript types. Therefore, a second set of primers was selected for a further RT-PCR analysis, in order to demonstrate tissue localisation of IGPcR32 alone, without that of IGPcRl 8. These primers had the nucleotide sequences indicated as SEQ ID NO:5 and SEQ ID NO:6, respectively, and the analysis was performed as indicated below, the results being as illustrated in Fig. 8.

A panel of cDNAs derived from total RNA from 31 human tissues (Clontech

Laboratories, Inc., Palo Alto CA, USA; Invitrogen Corp., Carlsbad CA, USA) was tested in a reverse transcription-polymerase chain reaction (RT-PCR) assay. The sequence of the primers used to amplify a 349 bp product (SEQ ID NO:7), which spans a region of IGPcR32 including transmembrane domains 1 and 2, is as follows:

5' - GGAGATGGCTGGAAACTGC (position -4 to coding sequence position 15;

SEQ ID O:5) 5' - GATGTAGTCGGCAAACGTGC (coding sequence position 345-326; SEQ ID

NO:6)

PCR conditions, the analysis of PCR products, agarose gel electrophoresis and DNA visualisation were as described above. The 31 human tissues analyzed were: skin, bladder, adipose tissue, esophagus, breast, pancreas, prostate, adrenal gland, uterus, placenta, stomach, kidney, heart, cerebellum, mammary gland, spleen, pericardium, lung, trachea, fetal liver, testis, epididymis, skeletal muscle, thymus, small intestine, salivary gland, rectum, liver, brain, colon, cervix and, as positive control, a pool of all cDNAs tested. A negative (water) control was also included.

IGPcR32 PCR products of 349 bp in size were observed in cDNAs prepared from several human tissues, with strongest signals in uterus, cervix, cerebellum and epididymis. Weak positive PCR products were observed in, testis, placenta, kidney, heart, small intestine, colon, spleen, liver, trachea and total brain, as shown in Figure 8 herein. Most of the tissues testing positive represent smooth muscle tissues. Human ovary tissue is not represented in the panel tested. The correct identity of the sequence amplified was confirmed by sequencing of the PCR products.

Example 3. Tissue-specific expression of human IGPcRl 8 and IGPcR32, analysis by Northern Hybridization.

Northern hybridization of ρolyA+ RNAs from a selection of human tissues was carried out using a human DNA-probe specific for IGPcRl 8 and IGPcR32. This probe was generated by radiolabeling the purified and sequenced PCR product generated using primers described as follows. Primers SEQ ID NO:6 and SEQ ID

NO: 10 amplify a 267 bp cDNA fragment (SEQ ID NO: 11) spanning sequences coding for transmembrane regions 1 and 2 in both IGPcR32 cDNA (SEQ ID NO:3 herein) and IGPcRl 8 cDNA (SEQ ID NO:l). A set of commercially available Multiple Tissue Northern Blots (blots type I, II, V, VIII; BioChain Institute, Hayward CA, USA) containing 3 micrograms of human tissue poly A+ RNA per lane, was hybridized. Additionally, a commercially available Multiple Tissue Northern Blot (Clontech Laboratories, Palo Alto CA, USA) containing 2 micrograms of poly A+ RNA per lane, adjusted to provide a consistent beta-actin signal in each lane, was hybridized, following the manufacturer's instructions. The blot is optimized to give best resolution in the 1.0-4.0 kb range, and marker RNAs of 9.5,

7.5, 4.4, 2.4, 1.35 and 0.24 kb were run for reference. Membranes were prehybridized for 30 min and hybridized overnight at 68°C in ExpressHyb hybridization solution per the manufacturer's instructions. The cDNA probe used was labeled with [α³²P] dCTP using a random primer labeling kit (Megaprime DNA labeling system; Amersham Pharmacia Biotech, Piscataway NJ, USA) and had a specific activity of 1 x 10⁹ dpm/μg. The blots were washed several times in 2X SSC, 0.05% SDS for 30-40 minutes at room temperature, and were then washed in 0.1X SSC, 0.1% SDS for 40 minutes at 50°C (see Sambrook et al, 1989, "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Press, New York, USA). The blots were covered with standard domestic plastic wrap and exposed to X-ray film at -70°C with two intensifying screens for 36 hours.

The tissues represented in the BioCham Institute Multiple Tissue Northern Blots are as follows:

Blot #V Blot #VIII

Uterus Brain

Ovary Kidney

Cervix Spleen

Testis Intestine

Prostate Uterus

Lung Cervix

Placenta

Lung

The tissues represented in the Clontech Laboratories' Northern blot are as follows:

Blot #I

Spleen Thymus Prostate Testis Uterus Small Intestine Colon Peripheral blood leukocytes The results of this experiment indicate that IGPcRlδ and/or IGPcR32 are expressed most strongly in a 2.4 kb transcript in human uterus and cervix. Additional tissues expressing low levels of this transcript are ovary, placenta, prostate, small intestine, colon, lung, testis and spleen; most of these tissues represent smooth muscle tissues (see Fig. 9). Very weak expression is detected in brain after 36 hours exposure of the film.

Primers corresponding to SEQ ID NO:5 and SEQ ID NO:δ, which are specific for IGPcR32 and generate a 52 bp fragment (SEQ ID NO:9) without overlapping the IGPcRl 8 sequence, generate equivalent Northern hybridization results in that the following tissues provide strongly positive hybridization signals: uterus, cervix, prostate, small intestine, colon. The sequences of the primers are: 5* - GGAGATGGCTGGAAACTGC (position -4 to coding sequence position 15; SEQ ID NO:5) 5' - CCTGTTCCTGTTGCCGGG (coding sequence position 48-31; SEQ ID NO:8)

Minor differences in relative intensity of expression are noted between data obtained by the RT-PCR and Northern hybridization techniques. These differences occur because the RT-PCR procedure is in general more sensitive, being semi-quantitative under the conditions of use. The Northern hybridization analysis provides a unique set of parameters, including transcript size and presence or absence of splice variants, but is less quantitatively reliable when comparing different tissue samples and provides only qualitative evidence of the presence (or lack thereof) of a particular transcript.

Example 4. Characterization of human IGPcRl 8 and IGPcR32 proteins.

Human IGPcR32 has 74,3% amino acid identity to human IGPcRl 8, an orphan receptor described in U.S. provisional patent application no. 60/215,879 and international patent application PCT/EP01/07530. These GPcR proteins differ in their N-terminus sequences (indicated as region I in Fig. 5 a) and also exhibit amino acid sequence differences in three regions indicated as π, III and TV, in Figure 5 a.

The encoded proteins of 323 amino acid residues (IGPcRlδ) and 343 amino acid residues (IGPcR32) were compared individually to sequences present in public databases EMBL and Genbank. Human IGPcRlδ has 63% amino acid sequence identity and 69% similarity (which considers conservative replacement of amino acids in the sequence) to the rat RTA amino acid sequence. Human IGPcR32 has

85,1% amino acid sequence identity to the rat RTA amino acid sequence, which also encodes a receptor of 343 amino acids (Swissprot Accession No. P23749; GenBank

Accession No. M32098 and M35297). RTA is most closely related to the masl proto-oncogene. RTA is highly expressed in rat cerebellum and tissues containing smooth muscle cells. Angiotensin binding to the rat RTA protein has not been detected, the ligand remaining unknown. (Ross et al, 1990, P.N.A.S. USA, 87:3052- 3056).

Human IGPcR32 also has 86,5% amino acid identity in the 318 residue stretch of sequence directly comparable with mouse MrgF (NCBI Protein Accession No. AAK91802; Genbank Accession No. AY042211), a family member of masl related GPcRs that is expressed in sensory neurons, some of these GPcRs detecting painful stimuli (Dong et al, 2001 Cell 106(5):619-632). MrgF mRNA expression is detected primarily in smooth muscle tissues (see Example 7; Fig. 11a, lib.)

Hydrophobicity analysis of the predicted amino acid sequence showed seven hydrophobic regions corresponding to the seven transmembrane domains, a conserved structural feature of G protein-coupled receptors. Fig. 5b shows the amino acid sequence of IGPcR32 compared to the amino acid sequence of rat RTA as abstracted from the SWISSPROT database and analyzed using a BLASTP alignment program; the identity is 85,1% Fig. 5c shows the amino acid sequence of IGPcR32 compared to the amino acid sequence of mouse MrgF as abstracted from the NCBI

Protein Accession No. AAK91802 and analyzed using a BLASTP alignment program; the identity in a 318 amino acid stretch analyzed is 86.5%. The predicted transmembrane domains of IGPcRlδ are flanked by amino acids 30-47 (TM1), 62- 79 (TM2), 104-122 (TM3), 153-161 (TM4), 181-203(TM5), 224-24δ (TM6), 253- 271 (TM7). The predicted transmembrane domains of IGPcR32 are flanked by amino acids 56-68 (TM1), 79-102 (TM2), 119-137 (TM3), 161-178 (TM4), 200-

219(TM5), 241-260 (TM6), 275-292 (TM7), as underlined in Fig. 5a, 5b and 5c.

Fig. 5d shows the amino acid sequence of rat RTA compared to mouse MrgF, as abstracted from the SWISSPROT database and the NCBI accession number AKK91802, respectively, and analyzed using a BLASTP alignment program; the identity is 97,2%. The predicted transmembrane domains of rat RTA and mouse MrgF are underlined in Fig. 5b, Fig. 5c and Fig. 5d. The high degree of structural identity between IGPcR32, rat RTA and mouse MrgF proteins is illustrated in Fig. 5a, 5b and 5c, indicating that the genes encoding these proteins are orthologues.

Figure 6 shows a hydropathy plot for the predicted sequence of the human IGPcR32 protein compared to human IGPcRl 8, rat RTA and mouse MrgF (The analysis was performed using the method of Kyte and DooLittle (1982, J. Mol. Biol., 157:105- 32), with the DAMBE program (Data Analysis in Molecular Biology and Evolution; University of Hong Kong, version 3.7.49). Fig. 6 illustrates the high degree of structural identity between IGPcR32, rat RTA and mouse MrgF proteins, further indicating that the genes encoding these proteins are orthologues.

Example 5. Generation of ES cells with a modified IGPcRl 8 or IGPcR32 allele, produced by homologous recombination.

The most preferred method in this invention is described in Wattler S & Nehls M,

German patent application DE 100 16 523.0, "Klonierungssystem zur Konstruktion von homologen Rekombiationsvektoren", filed April 03, 2000. This method reduces the time required for the construction of such a vector from 3-6 months to about 14 days. The vector includes a linear lambda vector (lambda-KO-Sfi) that comprises a sniffer fragment; an E. coli origin of replication; an antibiotic resistance gene for bacteria selection, two negative selection markers suitable for use in mammalian cells; LoxP sequences for cre-recombinase mediated conversion of linear lambda phages into high copy plasmids. In a final targeting vector, the stuffer fragment is replaced by nucleotide sequences representing a left arm of homology, an ES cell selection cassette, and a right arm of homology.

To abolish the gene function of mouse IGPcRl 8 (mIGPcRlδ) and of mouse IGPcR32 (mIGPcR32) a deletion of approximately δδO bp of the coding region starting approximately 10 bp upstream of the ATG was performed (see Fig. 10). The left arm of homology (hereafter referred to as A/C) is PCR amplified with the primers C and A. The primers contain Sfi I restriction sites A and C in their 5 '-ends, respectively. Sfi recognizes and cuts the nucleotide sequence 5'- GGCCNNNNNGGCC-3'. By changing the nucleotides designated N, unique and non-compatible Sfi restriction sites are generated. The 3 '-end of primer A is homologous to 25 bp of mouse IGPcR32, ending with the 10 bp downstream of the ATG. The 3'-end (25 bp) of primer C is homologous to a position approximately 2500 base pairs upstream of the ATG. The right arm of homology (hereafter referred to as B/D) is PCR amplified with primers B and D: B is located approximately δδO bp downstream of the ATG, and D approximately 2000 bp downstream of the stop codon. Both primers contain ^-restriction sites B or D in their 5 '-ends, respectively. To avoid the introduction of point mutations the Expand high fidelity PCR-System, (Boehringer Mannheim / Roche Diagnostics, Basel CH) is used. A ligation of A C with B/D and a selection cassette leads to an approximately δδO bp deletion of the mIGPcR32 coding region, thereby creating a null allelle. Both PCR-products A/C and B/D are purified using Qiaquick PCR Purification Kit according to the manufacturer (Quiagen, Venlo, NL). The PCR-products are cleaved 3 hours at 50°C with 60 U Sfi and subsequently purified (Qiaquick PCR Purification kit). The final volume is 30 μl/product. The ES-cell selection cassette (IRES-β-lactamase-

MCSneo) contains Sfi-sit s A and B 5'- and 3'-, respectively (Wattler S, et al, 1999, Biotechniques, 26:1150-1159). A typical ligation is 50 ng lambda-KO-Sfi-arm (Sfi- cleaved), 10 ng selection cassette, 1 ng A/C, 1 ng B/D, 1 x ligation buffer and 1U T4 Iigase (Boehringer Mannheim / Roche Diagnostics, Basel CH). The ligation is carried out for 2 hours at room temperature. Two μl of the ligation are used for in vitro packaging ('Gigapack plus' from Stratagene, La Jolla CA, USA) for 1.5 hours at room temperature according to the manufacturer's instructions. Aliquots of 10 μl and 50 μl are used to infect C600 bacteria (Stratagene, La Jolla CA, USA) and infection is performed overnight. Single plaques in SM-buffer (Ausubel FM et al, 1994, "Current Protocols in Molecular Biology", John Wiley & Sons, New York) are taken to infect BNN 132 bacteria (30 min at 30°C) for plasmid conversion and infection. Bacteria are cultured over 16 hours at 30°C in TB media (Ausubel FM et al, 1994, "Current Protocols in Molecular Biology", John Wiley & Sons, New York), containing 100 μg/ml ampicillin (Amersham Pharmacia Biotech, Piscataway NJ, USA; cat. no. US 11259-25). Plasmids are harvested using the Qiagen plasmid kit (Qiagen cat. no. 12143) according to the manufacturer's instructions. To verify plasmid integrity, Sfi and Ecσ ?./ -digests are performed.

The transformation of mouse 129 ES cells with the final targeting vector is performed according to standard procedures. Electroporated 129 mouse ES cells are double-selected with G41δ (400 μg/ml) for 7 days and GANC (ganciclovir, 0.2 μM) for 3 days, starting on day 3 after electroporation, for positive and negative selection, respectively, thereby enriching for transformants having the neomycin resistance gene integrated into an endogenous IGPcRlδ or IGPcR32 allele. Single cell clones are propagated, frozen down and expanded for DNA isolation. To identify positively targeted clones, ES cell DNA is isolated from selected clones, incubated with an appropriate restriction enzyme, and the digestion products separated on an agarose gel. Southern blots are hybridized with a 5' external probe and positive targeted candidates are verified by hybridization with a 3' external probe. A single integration is confirmed by hybridization with a probe derived from the neomycin gene. Positive ES cells are isolated and expanded in culture. Example 6. Mice deficient in the expression of the IGPcRl 8 or IGPcR32 gene.

Male chimeric mice are generated by micro-injection of ES cells carrying a recombined allele into 129/SvEv mouse blastocysts, using standard methodology.

The chimeric blastocyst is implanted into the uterus of a pseudo-pregnant mouse, prepared by mating females with vasectomized males of the same species. The chimeras are bred to wild type animals. Tail DNA is isolated from the offspring of these chimeric mice and analyzed by incubation with appropriate restriction enzymes followed by Southern analysis, using the same strategy as outlined above to determine germline transmission. The blots demonstrate the transmission into the mouse genome of the mutation altering the IGPcRlδ or IGPcR32 allele in transformant ES cells. The chimeric male mouse and its heterozygous progeny (+/-) are bred to produce mice homozygous for the mutation (-/-).

Northern blots are used to probe mRNA obtained from tissues of offspring for the presence or absence of transcripts encoding either the IGPcRlδ or IGPcR32, their marker gene, or both. In addition, Western blots are used to assess IGPcRl and/or IGPcR32 expression, respectively, by probing with antibody specific for an epitope borne by both receptors or by probing with an antibody specific for either the

IGPcRlδ receptor or the IGPcR32 receptor, as required.

Example 7. Tissue-specific expression of mouse MrgF, analysis by RT-PCR.

Panels of cDNAs derived from fresh prepared RNA from 39 female mouse tissues and from 3 male mouse tissues plus ES cell RNA were tested in a reverse transcription-polymerase chain reaction (RT-PCR) assay. The sequence of the primers used to amplify a 363bp product (SEQ ID NO:lδ), which spans an MrgF coding region including transmembrane domains 6 and 7 plus 3'UTR non-coding sequences, is as follows: 5' - GTCTCTGTCTTCCTCGTATC (coding sequence position 662 - 681; SEQ ID No: 16)

5* - GCAGAGTGTCTCTGGAAGC (3'UTR, non-coding mRNA position 1024 - 1006 ; SEQ ID NO: 17)

The conditions for the PCR were: denaturation at 94°C for 45 seconds, annealing at 56°C for 1 minute, and extension at 72°C for 30 seconds, for a total of 35 cycles, in a Thermocycler (MJ Research, Watertown MA, USA; type PTC-225). The PCR products were analyzed on an 1.8% agarose gel and stained with ethidium bromide to visualize DNA by ultraviolet imaging. The tissues analyzed in the female cDNA panel were: total brain, olfactory lobe, cerebrum, cerebrum left hemisphere, cerebrum right hemisphere, cerebellum, pituitary gland, medulla oblongata, medulla spinalis, eye, nose epithelium, trachea, thyroid/trachea, lung, tongue, esophagus, salivary gland, stomach, pancreas, small intestine, large intestine, appendix, rectum, thymus, heart, mesenterium, liver, gall bladder, spleen, kidney, adrenal gland, bladder, uterus, ov ary, sternum, bone marrow, skin, aipose tissue, skeletal muscle, and a pool of all cDNAs tested. A negative (water) controle was included, as seen in Fig. 11a. The tissues analyzed in the male cDNA panel were: total brain, olfactory lobe, cerebrum, cerebrum left hemisphere, cerebrum right hemisphere, cerebellum, pituitary gland, medulla oblongata, medulla spinalis, eye, trachea, thyroid/trachea, lung, tongue, esophagus, salivary gland, stomach, pancreas, small intestine, large intestine, appendix, rectum, thymus, heart, mesenterium, liver, gall bladder, spleen, kidney, adrenal gland, bladder, uterus, ov ary, sternum, bone marrow, skin, aipose tissue, skeletal muscle, and a pool of all cDNAs tested. A negative (water) controle was included, as seen in Fig. 1 lb.

MrgF PCR products of 363 bp in size were observed in cDNAs prepared from mouse female tissues, with strongest signals in cerebellum, uterus, esophagus, bladder, ovary, small intestine, large intestine, apendix, thymus and kidney. Very weak positive PCR products were observed in almost all other tissues analyzed, as shown in Figure 11a herein. The correct identity of the sequence amplified was confirmed by sequencing of the PCR products.

MrgF PCR products of 363 bp in size were observed in cDNAs prepared from mouse male tissues, with strongest signals in cerebellum, prostate, bladder, esophagus, large intestine, apendix, rectum, thymus, testis, and epididymis. Very weak positive PCR products were observed in almost all other tissues analyzed, as shown in Figure 1 lb herein. The correct identity of the sequence amplified was confirmed by sequencing of the PCR products.

Comparing the RT-PCR based mRNA expression data of human IGPcR32 (Example

2, Figure 8) with mouse MrgF (Example 7, Figures 11a and l ib) shows strongest expression of human IGPcR32 and mouse MrgF, respectivelly, in cerebellum and in primary sexual organs, especially in uterus. Most of the other human or mouse tissues expressing human IGPcR32 or mouse MrgF, respectively, are smooth muscle tissues, support the hypothesis that human IGPcR32 and mouse MrgF are orthologue genes.

Those skilled in the art will be able to recognize, or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the invention.

Claims

1. An isolated polypeptide, wherein said polypeptide comprises at least one of: (a) the amino acid sequence of SEQ ID NO: 13; or (b) the amino acid sequence of SEQ ID NO: 15;

2. A ligand of the isolated polypeptide of claim 1, wherein said ligand does not cross react with the IGPcRl 8 protein, polypeptides, peptides, isolated domains or fusion proteins by binding to said IGPcRl 8 protein, polypeptides, peptides, isolated domains or fusion proteins.

3. A ligand of the IGPcR32 protein, IGPcR32 polypeptides, IGPcR32 peptides, isolated domains of IGPcR32 and IGPcR32 fusion proteins wherein the ligand does not cross react significantly with the IGPcRl 8 protein, polypeptides, peptides, isolated domains or fusion proteins by binding to said IGPcRlδ protein, polypeptides, peptides, isolated domains or fusion proteins.

4. The ligand of any one of claims 2 to 3, wherein said ligand binds to IGPcR32 protein with a binding coefficient at least 10-fold greater than it exhibits in binding to IGPcRl δ protein under the same conditions.

5. The ligand of any one of claims 2 to 4, wherein said ligand binds to IGPcR32 protein with a binding coefficient at least 100-fold greater than it exhibits in binding to IGPcRl protein under the same conditions.

6. The ligand of any one of claims 2 to 5, wherein said ligand binds to IGPcR32 protein with a binding coefficient at least 1000-fold greater than it exhibits in binding to IGPcRlδ protein under the same conditions.

7. The ligand of any one of claims 2 to 6, wherein said ligand is an agonist or antagonist of the IGPcR32 protein that competes selectively with native natural IGPcR32 ligand and which modulates IGPcR32 gene expression or gene product activity, including: (a) 'small molecules' of molecular mass less than 6 kDa; (b) molecules of intermediate size, having molecular mass between 5 kDa to 15 kDa; and (c) large molecules of molecular mass greater than 12 kDa; the latter including mutant natural IGPcR32 ligand proteins that compete with native natural

IGPcR32 ligand and which modulate IGPcR32 gene expression or gene product activity.

8. The ligand of any one of claims 2 to 7, wherein said ligand is an antibody.

9. The ligand of any one of claims 2 to 7, wherein said ligand is a polynucleotide, aptamer or ribozyme molecule that can be used to modulate IGPcR32 protein .

10. A method of inhibiting IGPcR32 gene expression, wherein said method uses an anti-sense polynucleotide or a ribozyme molecule to effect said inhibition of

IGPcR32 gene expression, and wherein the use of said anti-sense polynucleotide or a ribozyme molecule has no significant effect upon expression of IGPcRl 8.

11. A method of enhancing IGPcR32 gene expression, wherein said method uses an expression construct to effect said enhancement of IGPcR32 gene expression, and wherein the use of said expression construct has no significant effect upon expression of IGPcRl 8.

12. The method of claim 11 , wherein said expression construct is expressed within the cell undergoing said enhancement of IGPcR32 gene expression.

13. The method of any of claims 10 to 12, wherein expression of IGPcRl 8 is modulated less than 10% of the degree of modulation of IGPcR32 expression.

14. The method of any of claims 10 to 13, wherein expression of IGPcRl 8 is modulated less than 1% of the degree of modulation of IGPcR32 expression.

15. The method of any of claims 10 to 14, wherein expression of IGPcRl 8 is modulated less than 0.1% of the degree of modulation of IGPcR32 expression.

16. A method of identifying compounds of any of claims 2 or 9, for use in screening compounds for utility in preventing, treating or ameliorating a disease characterised by aberrant expression or activity of IGcR32, wherein said method comprises detecting the modulation of the activity of IGPcR32 or modulation of IGPcR32 gene expression.

17. An embryonic stem cell containing a disrupted endogenous IGPcR32 gene.

18. A non-human knock-out animal that does not express IGPcR32, wherein the endogenous animal orthologue of the IGPcR32 gene is functionally disrupted.

19. The non-human knock-out animal of claim 18, wherein the endogenous animal orthologue of the IGPcR32 gene is functionally disrupted by an homologous recombination method.

20. A mutated non-human animal that express a non-functional or partially functional form of IGPcR32, in which said IGPcR32 polypeptide has at least 90% homology to SEQ ID NO:4.

21. A non-human transgenic animal expressing the human IGPcR32 cDNA sequence as shown in SEQ ID NO:3 or the nucleic acid molecule of any of claims 1 to 4.

22. The non-human animal according to any one of claims 20 to 21, whereby said IGPcR32 is human IGPcR32 which is encoded by a nucleic acid sequence which is homozygous in said animal model.

23. Progeny of non-human animals of any of claims 18 to 22, including both heterozygous and homozygous offspring.

24. Non-human animals of any of claims 1 δ to 23, wherein the animal is from a genus selected from the group consisting of Mus (e.g., mice), Rattus (e.g., rats), Oryctologus (e.g., rabbits) and Mesocricetus (e.g., hamsters).

25. Use of the non-human animal according to any one of claims 18 to 24, for the dissection of the molecular mechanisms of the IGPcR32 pathway, for the identification and cloning of genes able to modify, reduce or inhibit the phenotype associated with IGPcR32 activity or deficiency.

26. Use of the animal model according to any of claims 18 to 25 for the identification of gene and protein diagnostic markers for diseases.

27. Use of the animal model according to any of claims 18 to 26 for the identification and testing of compounds useful in the prevention, amelioration or treatment of diseases associated with IGPcR32 activity or deficiency.

28. The use of any of claims 26 or 27 wherein the disease comprises a reproductive disorder associated with signal processing in a reproductive tissue selected from the group of uterus, cervix, placenta, ovary, testis, epididymis and prostate.

29. A method of identifying compounds suitable for preventing, treating or ameliorating diseases characterized by aberrant expression or activity of IGPcR32, wherein said method detects modulation of IGPcR32 gene expression or modulation of the activity of IGPcR32.

30. A method of prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcR32, by the administration of compounds that bind specifically to the IGPcR32 gene or protein and/or which modulate

IGPcR32 expression or IGPcR32 activity; the compounds that that bind specifically to the IGPcR32 gene or protein and/or which modulate IGPcR32 expression or IGPcR32 activity for the prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcR32; and the use of compounds that that bind specifically to the IGPcR32 gene or protein and/or which modulate IGPcR32 expression or IGPcR32 activity for prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcR32.

31. A gene therapy method of prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcR32, by the administration of vectors and/or host cells in which a polynucleotide modulates IGPcR32 expression or IGPcR32 activity for prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcR32.

32. The method of any of claims 29 to 31 wherein said disease comprises a reproductive disorder associated with signal processing in a reproductive tissue selected from the group of uterus, cervix, placenta, ovary, testis, epididymis and prostate.

33. The method of any of claims 29 to 32 wherein said disease comprises a cancer.

34. The use of vectors and/or host cells containing a polynucleotide which modulates IGPcR32 expression or IGPcR32 activity for prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcR32.

35. The use of vectors and/or host cells containing a polynucleotide which modulates IGPcR32 expression or IGPcR32 activity for prevention, amelioration or treatment of diseases characterized by aberrant expression or activity of IGPcR32.