WO2003002756A1 - Fkbp51/52 and cyp40-mediated mammalian hair growth - Google Patents

Fkbp51/52 and cyp40-mediated mammalian hair growth Download PDF

Info

Publication number
WO2003002756A1
WO2003002756A1 PCT/US2002/019948 US0219948W WO03002756A1 WO 2003002756 A1 WO2003002756 A1 WO 2003002756A1 US 0219948 W US0219948 W US 0219948W WO 03002756 A1 WO03002756 A1 WO 03002756A1
Authority
WO
WIPO (PCT)
Prior art keywords
fkbp51
hair growth
test compound
mammal
level
Prior art date
Application number
PCT/US2002/019948
Other languages
English (en)
French (fr)
Other versions
WO2003002756A9 (en
Inventor
Daniel Du
John Douglas Haley
Original Assignee
Anaderm Research Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anaderm Research Corporation filed Critical Anaderm Research Corporation
Priority to JP2003508720A priority Critical patent/JP2005501229A/ja
Priority to EP02744577A priority patent/EP1399579A4/en
Publication of WO2003002756A1 publication Critical patent/WO2003002756A1/en
Publication of WO2003002756A9 publication Critical patent/WO2003002756A9/en

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/14Drugs for dermatological disorders for baldness or alopecia
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6881Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from skin
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/20Dermatological disorders

Definitions

  • the invention relates to the fields of dermatology, cell biology, and molecular biology. More specifically, the present invention relates to drug screening assays designed to identify non-immunosuppressive agents that modulate hair growth and the use of such agents for modulation of hair growth. Summary of the Related Art
  • the immunosuppressant drugs FK506, rapamycin and cyclosporin A are well known T-cell specific immunosuppressants that are routinely used to prevent graft rejection in organ transplant patients.
  • FK506 and cyclosporin A prevent calcineurin from dephosphorylating the transcription factor NF/AT (nuclear factor of activated T-cells), thereby blocking its translocation into the nucleus and preventing the receptor-mediated increase in synthesis and secretion of cytokines, such as interleukin-2 and, hence, T-cell proliferation (Heitman, J. et al., 1992, The New Biologist 4:448-460).
  • FK506 and cyclosporin A act by binding to endogenous intracellular receptor proteins termed immunophilins. Based on their structure and binding affinity for specific drugs, immunophilins have been divided into two classes of proteins; those proteins having an affinity for FK506 are referred to as F 506-binding proteins (FKBPs), while those having an affinity for cyclosporin are referred to as cyclophilins. Both FKBPs and cyclophilins possess a similar peptidyl-prolyl isomerase activity resulting in cis-trans-isomerization of proteins, which is believed to be important for protein folding and trafficking. In addition, both FKBPs and cyclophilins are characterized by their ability to interact with a variety of different proteins involved in signal transduction.
  • FKBP-51 has also been shown to be a component of the progesterone receptor complex (Nair, S.C. et al., 1997, Mol. Cell Biol. 17:594-603).
  • FKBP52 was initially discovered as a component of the inactive steroid receptor complex (Smith, D.F. et al., 1993, J. Biol. Chem. 268:18365-71).
  • the N-terminal domain, residues 1-149 of FKBP52 shares 55% homology with FKBP12, however, it does not have imrnunosuppressant activity when complexed with FK506.
  • FKBP52 is phosphorylated by casein kinase II and has been found to have chaperone activity independent of isomerase activity (Miyata, Y. et al., 1997, Proc. Natl. Acad. Sci. USA 94:14500-14505). CyP40 has only a low affinity for cyclosporin A and is therefore capable of only slight reduction of the immunosuppressive effect of cyclosporin A.
  • Hsp90 is the most abundant of the heat shock proteins. A number of transcription factors and protein kinases involved in signal transduction are found complexed with hsp90 (Pratt, W.B. et al., 1999, Cell Signal 11:839-851; Pratt and Toft, 1997, Endocrine Rev. 18:306-360). When complexed with transcription factors, the hsp90 complexes are found to contain high molecular weight immunophilins with tetratricopeptide repeat (TPR) motifs (Duina, A.A. et al., 1996, Science 274:1713- 1715; Bose, S. et al., 1996, Science 274:1715-1717).
  • TPR tetratricopeptide repeat
  • immunophilins include FKBP52 and CyP40 (Owens-Grillo, J.K., 1995, J. Biol. Chem. 270:20479-20484; Miyata, Y. et al, 1997, Proc. Natl. Acad. Sci. USA 94:14500-14505; Silverstein, A.M. et al., 1999, J. Biol. Chem. 274:36980-36986).
  • causes of hair loss include aging, the action of male hormones, the loss of blood supply to hair follicles, and scalp abnormalities.
  • genetic disposition may account for hair loss.
  • androgenic alopecia is considered to be genetically determined.
  • a rare autosomal recessive form of hereditary alopecia referred to as atrichia with papular lesions, was found to result from mutations in the human "hairless" gene (Ahmad, W. et al., 1998, Science 279:720- 724).
  • hairs are typically absent from the scalp, and patients have very sparse eyebrows and eyelashes.
  • mice bearing a mutation in the hairless gene the hair matrix cells appear to undergo premature and massive apoptosis together with a concomitant decline in Bcl-2 expression indicating that the hairless gene product may play a role in regulating cell proliferation, differentiation and apoptosis in the hair follicle.
  • the human hairless gene has recently been isolated and is described in WO 99/38965.
  • FK506 and cyclosporin A stimulate hair growth in a dose dependent manner (Sainsbury, T.S.L. et al., 1991, Transplant. Proc. 23:3332-3334).
  • FK506 and cyclosporin A have been shown to stimulate hair growth in experimental animals, such as mice and rats (WO 98/55090; Maurer, M., 1997, Am. J. Path. 150:1433; Yamamoto, S. et al., 1993, J. Invest. Dermatol. 102:160).
  • the effects of FK506 and cyclosporin A and related agents have been described (Tsuji Y. et al., 1999, Exp. Dermatol.
  • Japanese patent application No. 11-174041 describes methods for identifying hair stimulating agents that can bind to immunosuppressive agent-bound proteins that can form a complex with steroid receptors, i.e., FKBP 52 or cyclophilin 40, but do not bind to FKBPs that cannot form complexes with steroid receptors, e.g., FKBP12.
  • the mechanism of mammalian hair growth stimulated by FK506 and cyclosporin A remains unknown. Despite their potential use as hair stimulating agents, immunosuppressive agents such as FK506 and cyclosporin A also exhibit toxic side effects such as immunosuppression. Thus, there is the need to identify and develop non-immunosuppressive agents that are useful as modulators of hair growth.
  • the present invention is based on the discovery of the signaling pathway by which the immunosuppressive agents FK506 and cyclosporin A modulate hair growth. This discovery provides drug screening assays for identification of non- immunosuppressive agents capable of modulating hair growth.
  • the present invention relates to drug screening assays designed to identify non-immunosuppressive agents that modulate hair growth and the use of such agents for modulation of hair growth.
  • the invention is based on the discovery of the signal transduction pathway by which specific immunophilins, namely FKBP51 and FKBP52, and CyP40, modulate hair growth.
  • specific immunophilins namely FKBP51 and FKBP52, and CyP40
  • the FKBP51/52 proteins are found to be expressed in hair follicle dermal papillae.
  • FKBP51/52 are found complexed with the hsp90, Gli3, AFX-1 and hairless protein within the cell.
  • the pathway of the invention serves as a basis for methods designed to identify non- immunosuppressive agents which can be used to modulate hair growth.
  • the invention relates to assays designed to screen for agents that modulate the components of the FKBP51/52 and CyP40 signal transduction pathway, i.e., agents that act as agonists or antagonists of such components, including FKBP51/52, CyP40, hsp90, Gli3, AFX-1 and/or the hairless protein.
  • agents that modulate the components of the FKBP51/52 and CyP40 signal transduction pathway i.e., agents that act as agonists or antagonists of such components, including FKBP51/52, CyP40, hsp90, Gli3, AFX-1 and/or the hairless protein.
  • a method is provided for rational drug design of agents which specifically modulate activity and/or the association of FKBP51/52 or CyP40 with the hsp90, hairless, AFX-1 and/or Gli3 protein.
  • the present invention further provides cell based and non-cell based assays for identifying agents which modulate the interaction and/or activity of the components of the inventive pathway, i.e., the FKBP51/52, CyP40, hsp90, Gli3 AFX-1 and hairless protein.
  • the invention provides a method for identifying a compound capable of modulating hair growth comprising:
  • preparation refers to a composition comprising at least one cellular component that has been isolated, extracted or partially purified either from a cell in which it is naturally expressed or from a cell which has been genetically engineered to express the component, or a component that has been synthetically prepared, which composition can be used to carry out the recited method.
  • preparations include, but are not limited to, cell fractions prepared by standard techniques, as well as aqueous, buffered solutions of cellular components prepared by combining together previously synthesized or purified components.
  • positive correlation with hair growth modulating activity refers to an observation of the biological activity of a test compound wherein the activity indicates that the test agent is capable of either stimulating or inhibiting hair growth.
  • a method for identifying a compound capable of modulating hair growth comprising:
  • the invention further provides a method for identifying a compound capable of promoting hair growth comprising:
  • test compound inhibits complex formation between the hairless, AFX-1 or gli3 gene product and a binding partner selected from the group consisting of FKBP51/52, CyP40, a nuclear hormone receptor, a hsp90 protein, and a combination thereof; wherein the ability of a test compound to both bind to the hairless, AFX-1 or gli3 gene product and inhibit complex formation has a positive correlation with hair growth promoting activity.
  • a binding partner selected from the group consisting of FKBP51/52, CyP40, a nuclear hormone receptor, a hsp90 protein, and a combination thereof
  • the invention further relates to a method for identifying a compound capable of modulating hair growth comprising:
  • Identified agents can be used to modulate hair growth. Such agents are particularly useful for treating baldness resulting from genetic factors, aging, local skin conditions and diseases that affect the body generally, i.e., systemic diseases. Such disorders include, but are not limited to, male pattern baldness, female pattern baldness, toxic baldness, alopecia areata and scarring alopecia. In addition, the agents can be used to treat subjects with hair loss associated with radiation or chemotherapy.
  • the invention encompasses a method for modulating hair growth in a mammal comprising administering to the mammal a compound that modulates complex formation between FKBP51/52, CyP40 or hsp90 and at least one protein selected from the group consisting of hairless, gli3, AFX-1, and hsp90.
  • the invention provides a method for modulating hair growth in a mammal comprising administering to the mammal a compound that modulates the nuclear translocation of a protein selected from the group consisting of the hairless, AFX-1 and gli3 protein.
  • a method for modulating hair growth in a mammal comprising administering to the mammal a compound that modulates hairless, AFX-1 -or gli-3 -mediated gene expression.
  • Figure 1 is a schematic representation depicting the proposed model of interactions between FKBP51/52, CyP40, steroid receptors, hsp 90 and other binding partners.
  • Figure 2 is a representation of RT-PCR analysis of human dermal papilla RNA, demonstrating that in cultured human dermal papilla cells, expression of FKBP51, FKBP52 and CyP40 is detected using RT-PCR.
  • Figure 3A is a graphic representation demonstrating stimulation of BMP4 transcription four days after FK506 and cyclosporin A treatment.
  • Figure 3B is a graphic representation demonstrating stimulation of HNF3 ⁇ transcription four days after FK506 and cyclosporin A treatment.
  • Figure 4 is a graphic presentation of the induction of TR mediated transcription by cyclosporin A or FK506.
  • the present invention is based on the discovery of the signal transduction pathway by which specific immunophilins, namely FKBP51, FKBP52 and CyP40, modulate hair growth.
  • specific immunophilins namely FKBP51, FKBP52 and CyP40.
  • the discovery of the pathway by which agents such as FK506 and cyclosporin A modulate hair growth provides screening targets for agents that can be used to promote hair growth while having a reduced effect on the immune system.
  • the present invention encompasses assays designed to identify agents that modulate the interaction and/or activity of the components of the signal transduction pathway.
  • Such components include, for example, the FKBP51/52,
  • CyP40, hsp90, Gli3, AFX-1 and hairless proteins can be used to identify agents that either increase or decrease the activity of the FKBP51/52 and CyP40 signal transduction pathway.
  • the present invention further provides for rational drug design of agents that specifically promote or inhibit association of FKBP51/52 or CyP40 with the hsp90, hairless, AFX- 1 and/or Gli3 proteins.
  • the present invention provides for agents designed or identified by the foregoing methods. Further, the present invention provides for the use of said agents for enhancement of hair growth. In particular, such agents can be used to treat baldness which can result from genetic factors, aging, and/or local skin conditions.
  • the present invention relates to screening assay systems designed to identify agents or compositions that modulate FKBP51/52 or CyP40 activity or
  • FKBP51/52 or CyP40 gene expression may be useful for modulation of hair growth.
  • the cDNA sequences and deduced amino acid sequences of FKBP51 and FKBP52 have been characterized (PubMed Accession Nos.U71321 and M88279) and are incorporated herein by reference.
  • FKB51/52 as used herein refers to either or both the FKBP51 and FKBP52 proteins.
  • the cDNA sequence and deduced amino acid sequences of CyP40 have been characterized (Accession No. D63861) and is incorporated herein by reference.
  • the cDNA sequences and deduced amino acid sequences of hsp90, Gli3, AFX-1 and hairless have also been characterized (PubMed Accession Nos. NMO18411 (hairless); NM000168 (Gli3) and NM005348 (hsp90); Accession No. U 10072 and are incorporated herein by reference.
  • recombinant expression is described below for FKBP51/52; however, the methods can also be utilized for recombinant expression of CyP40, hsp90, Gli3, AFX-1 and/or the hairless protein.
  • FKBP51/52 nucleotide sequences can be isolated using a variety of different methods known to those skilled in the art. For example, a cDNA library constructed using RNA from a tissue known to express FKBP51/52 can be screened using a labeled FKBP51/52 specific probe. Alternatively, a genomic library can be screened to derive nucleic acid molecules encoding the FKBP51 or FKBP52 protein. Further, FKBP51/52 nucleic acid sequences can be derived by performing a polymerase chain reaction (PCR) using two oligonucleotide primers designed on the basis of known FKBP51/52 nucleotide sequences. The template for the reaction can be cDNA obtained by reverse transcription of mRNA prepared from cell lines or tissue known to express FKBP51/52.
  • PCR polymerase chain reaction
  • FKBP51/52 protein, polypeptides and peptide fragments, mutated, truncated or deleted forms of FKBP51/52 and/or FKBP51/52 fusion proteins can be prepared for a variety of uses, including, but not limited to, the identification of other cellular gene products involved in the regulation of FKBP51/52-mediated hair growth, and the screening for agents that can be used to modulate hair growth.
  • FKBP51/52 fusion proteins include fusions to an enzyme, fluorescent protein, and a polypeptide tag or luminescent protein, all of which provide a marker function.
  • FKBP51/52 polypeptides and peptides can be chemically synthesized (e.g., see Creighton, 1983, Proteins: Structures and Molecular Principles. W.H. Freeman & Co., N.Y.), large polypeptides derived from FKBP51/52 and the full length FKBP51/52 proteins can be advantageously produced by recombinant DNA technology using techniques well known in the art for expressing nucleic acids containing FKBP51/52 gene sequences and/or other coding sequences. Such methods can be used to construct expression vectors containing the FKBP51/52 nucleotide sequences and appropriate transcriptional and translational control signals.
  • a variety of host-expression vector systems can be utilized to express the FKBP51/52 nucleotide sequences (See, e.g., U.S. Patent No. 5,763,590 for expression of FKBP 52).
  • the FKBP51/52 peptide or polypeptide is expressed as a soluble derivative and is not secreted, the peptide or polypeptide can be recovered from the host cell.
  • the FKBP51/52 peptide or polypeptide is secreted, the peptide or polypeptides can be recovered from the culture media.
  • the expression systems that can be used for purposes of the invention include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid or cosmid DNA expression vectors containing FKBP51/52 encoding nucleotide sequences, yeast transformed with recombinant yeast expression vectors containing FKBP51/52 encoding nucleotide sequences or mammalian cell systems, or insect cell systems containing FKBP51/52 recombinant expression constructs containing promoters derived from the genome of mammalian or insect cells or from mammalian or insect viruses.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid or cosmid DNA expression vectors containing FKBP51/52 encoding nucleotide sequences, yeast transformed with recombinant yeast expression vectors containing FKBP51/52 encoding nucleotide sequences or mammalian cell systems, or insect cell systems
  • Appropriate expression systems can be chosen to ensure that the correct modification, processing, and sub-cellular localization of the FKBP51/52 protein occurs.
  • eukaryotic host cells that possess the ability to properly modify and process the FKBP51/52 protein are preferred.
  • stable expression is preferred.
  • host cells can be transformed with DNA controlled by appropriate expression control elements and a selectable marker gene, e.g., tk, hgprt, dhfr, neo, and hygro genes, to name a few.
  • engineered cells may be allowed to grow for 1-2 days in enriched media, and then switched to a selective media.
  • Such engineered cell lines can be particularly useful in screening and evaluating agents that modulate the endogenous activity of the FKBP51/52 gene product.
  • it may be necessary to co-express interactive binding proteins such as the CyP40, hsp90, Gli3, AFX-1 and hairless proteins for use in the screening assays of the invention. Methods described above for expression of FKBP51/52 can be similarly used to co-express such binding proteins.
  • non-cell based assay systems can be used to identify agents that interact with, i.e., bind to, FKBP51/52 or CyP40, and regulate the activity of such proteins.
  • agents may act as antagonists or agonists of FKBP51/52 or CyP40 activity and can be used to regulate hair growth.
  • agents may function to disrupt or prevent the formation of a complex between FKBP51/52 or CyP40 and their binding partners, i. e. , the hsp90, Gli3 , AFX- 1 and/or hairless protein.
  • the non-cell based assays are described below for FKBP51/52; however, they can be similarly utilized for CyP40 as well.
  • Recombinant FKBP51/52 including peptides corresponding to different functional domains, or FKBP51/52 fusion proteins, can be expressed and used in assays to identify agents that interact with FKBP51/52.
  • soluble FKBP51/52 can be recombinantly expressed and utilized in non-cell based assays to identify agents that bind to FKBP51/52.
  • Recombinantly expressed FKBP51/52 polypeptides or fusion proteins containing one or more of the FKBP51/52 functional domains can be prepared as described above, and used in the non-cell based screening assays.
  • One such functional domain is the tetratricopeptide repeat (TPR) which is important for protein/protein interactions.
  • TPR tetratricopeptide repeat
  • the full length FKBP51/52, or a soluble truncated FKBP51/52, e.g., in which one or more domains is deleted from the molecule but the TPR is retained a peptide corresponding to the TPR motifs, or a fusion protein containing the FKBP51/52 TPR motif fused to a protein or polypeptide that affords advantages in the assay system (e.g., for labeling or isolating the resulting complex) can be utilized.
  • agents that interact with the TPR motif are sought to be identified, peptides corresponding to the FKBP51/52 TPR motif and fusion proteins containing the FKBP51/52 TPR motif can be used.
  • the FKBP51/52 protein can also be present as part of a crude or semi-purified extract.
  • the principle of the assays used to identify agents that bind to FKBP51/52 involves preparing a reaction mixture of FKBP51/52 and the test agent under conditions and for time sufficient to allow the two components to interact and bind, thus forming a complex which can be removed and/or detected in the reaction mixture. The identity of the bound test agent is then determined.
  • the screening assays are accomplished by any of a variety of commonly known methods.
  • one method to conduct such an assay involves anchoring the FKBP51/52 protein, polypeptide, peptide, fusion protein, or the test substance onto a solid phase and detecting FKBP51/52/test agent complexes adhered to the solid phase at the end of the reaction.
  • the FKBP51/52 reactant is anchored onto a solid surface, and the test agent, which is not anchored, may be labeled, either directly or indirectly.
  • microtitre plates conveniently can be utilized as the solid surface.
  • the anchored component is immobilized to the solid surface by non-covalent or covalent attachment.
  • the solid surfaces may be prepared in advance and stored.
  • the non-immobilized component is added to the solid surface coated with the anchored component.
  • unreacted components are removed (e.g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface.
  • the detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously non-immobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes have been formed. Where the previously non-immobilized component is not pre-labeled, an indirect label can be used to detect complexes on the solid surface, e.g., using a labeled antibody specific for the previously non-immobilized component.
  • a reaction is conducted in a liquid phase, the reaction products are separated from unreacted components using an immobilized antibody specific for FKBP51/52 protein, fusion protein or the test agent, and complexes are detected using a labeled antibody specific for the other component of the complex.
  • non-cell based assay systems can be used to identify agents that directly interfere with the interaction between FKBP 51/52 and one or more other proteins within the cell.
  • the proteins that interact with the FKBP51/52 are referred to, for purposes of this discussion, as "binding partners.” These binding partners are likely to be involved in the FKBP51/52 signal transduction pathway.
  • binding partners include, but are not limited to, the hsp90, Gli3, AFX- 1 and hairless protein. Therefore, it is desirable to identify agents that modulate the interaction of one or more of such binding partners with FKBP51/52. Such agents may interfere with or disrupt the interaction of one or more such binding partners with FKBP51/52 and may be useful in modulating hair growth. Alternatively, agents can be identified that increase the affinity or improve the interaction between the one or more binding partners and FKBP51/52.
  • the basic principle of the assay systems used to identify agents that interfere with the interaction between a FKBP51/52 moiety and one or more of its binding partners involves preparing a reaction mixture containing FKBP51/52 protein, polypeptide, peptide or fusion protein, and the one or more binding partner, and incubating the reaction mixture under conditions and for a time sufficient to allow the components to interact and bind, thus forming a complex.
  • the reaction mixture is prepared both in the presence and absence of the test agent.
  • the test agent may be initially included in the reaction mixture, or may be added at a time subsequent to the addition of the FKBP51/52 moiety with its binding partner(s). Control reaction mixtures are incubated without the test agent or with a placebo.
  • any complexes between the FKBP51/52 moiety and the binding partner(s) is then detected.
  • the formation of a complex in the control reaction, but not in the reaction mixture containing the test agent, indicates that the test agent interferes with the interaction of the FKBP51/52 and the interactive binding partner(s).
  • the assay for agents that interfere with the interaction of FKBP51/52 and binding partners can be conducted in a heterogeneous or homogeneous format.
  • Heterogeneous assays involve anchoring either the FKBP51/52 moiety product or the binding partner onto a solid surface and detecting complexes attached to the solid surface at the end of the reaction.
  • homogeneous assays the entire reaction is carried out in a liquid phase.
  • the order of addition of reactants can be varied to obtain different information about the agents being tested.
  • test agents that interfere with the interaction by competition can be identified by conducting the reaction in the presence of the test substance, i.e., by adding the test substance to the reaction mixture prior to or simultaneously with FKBP51/52 moiety and interactive binding partner.
  • test agents that disrupt preformed complexes e.g. agents with higher binding constants that displace one of the
  • components from the complex can be tested by adding the test agent to the reaction mixture after complexes have been formed.
  • the various formats are described briefly below.
  • an FKBP51/52 fusion can be prepared for immobilization.
  • the FKBP51/52 or a peptide fragment, e.g., corresponding to the TPR motif can be fused to a glutathione-S-transferase (GST) gene using a fusion vector, such as pGEX-5X-l, in such a manner that its binding activity is maintained in the resulting fusion protein.
  • GST glutathione-S-transferase
  • the interactive binding partner i.e., the hsp90, Gli3, AFX-1 or hairless protein, can be purified and used to raise a monoclonal antibody, using methods routinely practiced in the art.
  • the generation of monoclonal antibodies can be omitted if such antibodies exist and are publicly available.
  • This antibody can be labeled with the radioactive isotope 125 I, for example, by methods routinely practiced in the art.
  • the GST-FKBP51/52 fusion protein can be anchored to glutathione-agarose beads.
  • the interactive binding partner can then be added in the presence or absence of the test agent in a manner that allows interaction and binding to occur.
  • unbound material can be washed away, and the labeled monoclonal antibody can be added to the system and allowed to bind to the complexed components.
  • the interaction between the FKBP51/52 gene product and the interactive binding partner can be detected by measuring the amount of radioactivity that remains associated with the glutathione-agarose beads. A successful inhibition of the interaction by the test agent will result in a decrease in measured radioactivity.
  • the GST-FKBP51/52 fusion protein and the interactive binding partner can be mixed together in liquid in the absence of the solid glutathione- agarose beads.
  • the test agent can be added either during or after the species are allowed to interact. This mixture can then be added to the glutathione-agarose beads and unbound material is washed away. Again, the extent of inhibition of the FKBP51/52 binding partner interaction can be detected by adding the labeled antibody and measuring the radioactivity associated with the beads.
  • a homogeneous assay can be used.
  • a preformed complex of the FKBP51/52 moiety and the interactive binding partner is prepared in which either the FKBP51/52 or its binding partner is labeled, but the signal generated by the label is quenched due to formation of the complex.
  • the addition of a test substance that competes with and displaces one of the species from the preformed complex will result in the generation of a signal above background. In this way, test substances which disrupt FKBP51/52 binding partner interaction can be identified.
  • non-cell based assays can also be used to screen for agents that directly inhibit enzymatic activities associated with
  • FKBP51/52 activities include, but are not limited to, proline isomerase activity.
  • proline isomerase activity For example, a peptidyl-prolyl cis-trans isomerase assay performed according to Harrison and Stein (1980, Biochem. 29:3813-3816) with modifications described by Park et al. (1992, Biol. Chem. 267:3316-3324) can be used to measure the level of FKBP51/52 activity.
  • a reaction mixture of FKBP51/52 and a test agent is prepared in the presence of substrate, and the enzymatic activity of FKBP51/52 is compared to the activity observed in the absence of test agent.
  • a reaction mixture of FKBP51/52, a test agent and substrate is prepared and the enzymatic activity of FKBP51/52 is compared to the activity observed in the absence of the test agent, wherein a decrease in the level of FKBP51/52 enzymatic activity in the presence of the test agent indicates that an inhibitor of FKBP51/52 has been identified.
  • reaction mixture of FKBP51/52, a test agent and substrate is prepared and the enzymatic activity of FKBP51/52 is compared to the activity observed in the absence of the test agent, wherein an increase in the level of FKBP51/52 enzymatic activity in the presence of the test agent indicates that a FKBP51/52 agonist has been identified.
  • cell based assay systems can be used to identify agents that regulate the activity of FKBP51/52 or CyP40.
  • the FKBP51/52/hsp90/hairless/AFX-l/gli3 complex or CyP40/hsp90/hairless/AFX-l/gli3 is bound to nuclear hormone receptors within the cell.
  • the cell based assays may be performed using cells expressing a nuclear hormone receptor.
  • nuclear hormone receptors include, but are not limited to, androgen, vitamin D, retinoic acid, aryl hydrocarbon and thyroid hormone receptors.
  • the activity of a test agent can be tested in the presence or absence of a nuclear hormone receptor ligand.
  • Cell based assays are described below for identification of agents that regulate the activity of FKBP51/52 proteins; however, such cell based assays may be used to similarly identify agents that regulate the activity of CyP40.
  • the present invention provides methods for identifying an agent that activates FKBP51/52 enzymatic activity comprising (i) contacting a cell expressing FKBP51/52 with a test agent and measuring the level of FKBP51/52 enzymatic activity; (ii) in a separate experiment, contacting a cell expressing FKBP51/52 protein with a vehicle control and measuring the level of FKBP51/52 enzymatic activity where the conditions are essentially the same as in part (i), and then (iii) comparing the level of FKBP51/52 activity measured in part (i) with the level of FKBP51/52 activity in part (ii), wherein an increased level of FKBP51/52 enzymatic activity in the presence of the test agent compared to the level of FKBP51/52 enzymatic activity in the presence of vehicle control indicates that the test agent is a FKBP51/52 enzyme activator.
  • the present invention also provides methods for identifying an agent that inhibits FKBP51/52 enzymatic activity comprising (i) contacting a cell expressing FKBP51/52 with a test agent in the presence of FK506 and measuring the level of FKBP51/52 enzymatic activity; (ii) in a separate experiment, contacting a cell expressing FKBP51/52 in the presence of FK506 and measuring the level of FKBP51/52 enzymatic activity, where the conditions are essentially the same as in part (i); and then (iii) comparing the level of FKBP51/52 enzymatic activity measured in part (i) with the level of FKBP51/52 enzymatic activity in part (ii), wherein a decrease in the level of FKBP51/52 enzymatic activity in the presence of the test agent compared to the level of FKBP51/52 enzymatic activity in the presence of vehicle control indicates that the test agent is a FKBP51/52 enzyme inhibitor.
  • the cells expressing the FKBP51/52 protein are exposed to a test agent or to a vehicle control (e.g., placebo). After or during exposure, the cells can be assayed to measure the enzymatic activity of FKBP51/52 or the activity of the FKBP51/52 dependent signal transduction pathway itself.
  • a test agent e.g., placebo
  • the cells can be assayed to measure the enzymatic activity of FKBP51/52 or the activity of the FKBP51/52 dependent signal transduction pathway itself.
  • test molecule to modulate the enzymatic activity of FKBP51/52 can be measured using standard biochemical and physiological techniques, e.g., as measured by a chemical, physiological, biological or phenotypic change, induction of a host cell gene or reporter gene, change in host cell kinase activity, etc.
  • FKBP51/52 associated peptidyl-prolyl isomerase activity can be measured. Assays for such activity include those described in Harrison and Stein (1980, Biochem, 29:3813-3816); Park, S.T. et al., (1992, J. Biol. Chem. 267:3316-3324); and U.S. Patent No. 5,763,590.
  • the expression of genes known to be modulated by activation of the FKBP51/52 signal transduction pathway, such as BMP4 or HNF3 ⁇ can be assayed to identify modulators of FKBP51/52 or activity.
  • animal models can be utilized to identify agents capable of ameliorating hair loss.
  • Such animal models can be used as test substrates for the identification of drugs, pharmaceuticals, therapies and interventions that can be effective in treating such disorders.
  • animal models can be exposed to an agent suspected of exhibiting an ability to modulate hair growth at a sufficient concentration and for a time sufficient to elicit such hair growth in the exposed animals. The response of the animals to the exposure can be monitored by assessing the modulation of hair growth.
  • a C3H mouse model can be used to measure the capacity of a test compound to initiate hair growth. Typically, approximately seven-week-old female C3H mice are used for experiments. The lower back hair of mice are sheared with an electrical clipper, followed by administration of the test agent.
  • test animals Visual observation of the test animals' hair growth will result in a determination regarding the ability of a test agent to modulate hair growth.
  • the Dundee Bald rat model animal or chemotherapy treated mice can be used.
  • any treatments which reverse any aspect of disorder-like symptoms should be considered as candidates for human therapeutic intervention. Dosages of test agents may be determined by deriving dose-response curves, as discussed below.
  • RATIONAL DRUG DESIGN In an embodiment of the invention, computer modeling and searching technologies can be used for identification of agents that can modulate the protein interactions between FKBP51/52, CyP40, hsp90, Gli3, AFX-1 and/or hairless protein. For example, based on the knowledge of the FKBP51/52 or CyP40 binding sites and the study of complexes between FKBP51/52 or CyP40 and proteins such as hsp90, Gli3, AFX-1 and hairless, potential modulators of the FKBP51/52 or CyP40 signal transduction pathway can be identified.
  • the three dimensional geometric structure of binding sites can be determined using known methods, including X-ray crystallography, which can determine a complete molecular structure.
  • solid or liquid phase NMR can be used to determine certain intra-molecular distances. Any other experimental method of structure determination can be used to obtain partial or complete geometric structures.
  • the geometric structures may be measured with a complexed protein or agent, which may increase the accuracy of the active site stracture determined.
  • the methods of computer based numerical modeling can be used to complete the structure or improve its accuracy.
  • Any recognized modeling method may be used, including parameterized models specific to particular biopolymers such as proteins, molecular dynamic models based on computing molecular motions, statistical mechanics models based on thermal ensembles, or combined models.
  • standard molecular force fields representing the forces between constituent atoms and groups, are necessary, and can be selected from force fields known in physical chemistry.
  • the incomplete or less accurate experimental structures can serve as constraints on the complete and more accurate structures computed by these modeling methods.
  • candidate modulating agents can be identified by searching databases containing agents along with information on their molecular structure. Such a search seeks agents having structures that match the determined binding site structure and that interact with the groups defining the active site. Such a search can be manual, but is preferably computer assisted. Agents found from this search are potential hair growth modulating agents.
  • these methods can be used to modify known hair growth modulating agents to improve their activity.
  • a known agent can be modified and the structural effects of modification can be determined using the experimental and computer modeling methods described above.
  • the altered structure can then be compared to the active site structure of the agent to determine if an improved fit or interaction results.
  • systematic variations in composition such as by varying side groups, can be quickly evaluated to obtain modified modulating agents or ligands of improved specificity or activity, e.g., modifying cyclosporin A to increase its affinity to CyP40 while reducing its affinity to cyclosporin A or B.
  • CHARMm performs the energy minimization and molecular dynamics functions.
  • QUANTA performs the construction, graphic modeling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
  • FKBP51/52 bind to a number of known transcription factors, including, but not limited to, AFX-1, gli3 and hairless protein.
  • a cell based assay system can be used to screen for agents that modulate the expression of FKBP51/52 or CyP40 within a cell.
  • Assays can be designed to screen for agents that regulate FKBP51/52 or CyP40 expression at either the transcriptional or translational level.
  • the assays described below are designed for identification of agents capable of regulating FKBP51/52 gene expression; however, such assays can be similarly used to identify agents that regulate CyP40 gene expression.
  • DNA encoding a reporter molecule can be linked to a regulatory element of the FKBP51/52 gene and used in appropriate intact cells, cell extracts or lysates to identify agents that modulate FKBP51/52 gene expression.
  • Such reporter molecules include, but are not limited to, chloramphenicol acetyltransferase (CAT), luciferase, ⁇ -glucuronidase (GUS), growth hormone, or placental alkaline phosphatase.
  • CAT chloramphenicol acetyltransferase
  • GUS ⁇ -glucuronidase
  • growth hormone or placental alkaline phosphatase.
  • alkaline phosphatase assays are particularly useful in the practice of the invention where the enzyme is secreted from the cell, and tissue culture supernatant can then be assayed for secreted alkaline phosphatase.
  • alkaline phosphatase activity can be measured by calorimetric, bioluminescent or chemiluminescent assays such as those described in Bronstein, I. et al., 1994, Biotechniques 17:172-177. Such assays provide a simple, sensitive, easily automatable detection system for pharmaceutical screening.
  • test agents are assayed for their ability to modulate the translation of FKBP51/52 mRNA in in vitro translation extracts.
  • the level of FKBP51/52 expression can be modulated using antisense or ribozyme approaches to inhibit or prevent translation of FKBP51/52 mRNA transcripts, or triple helix approaches to inhibit transcription of the FKBP51/52 gene. Such approaches can be utilized to modulate hair growth.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to at least a portion of FKBP51/52 mRNA.
  • the antisense oligonucleotides bind to the complementary mRNA transcripts and prevent translation. Absolute complementarity, although preferred, is not required.
  • ribozyme molecules designed to catalytically cleave FKBP51/52 mRNA transcripts can be used to prevent translation of FKBP51/52 mRNA and expression of FKBP51/52.
  • endogenous FKBP51/52 gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the FKBP51/52 gene (i.e., the FKBP51/52 promoter and/or enhancers) to form triple helical structures that prevent transcription of the FKBP51/52 gene in targeted cells in the body.
  • deoxyribonucleotide sequences complementary to the regulatory region of the FKBP51/52 gene i.e., the FKBP51/52 promoter and/or enhancers
  • triple helical structures that prevent transcription of the FKBP51/52 gene in targeted cells in the body.
  • oligonucleotides of the invention i.e., antisense, ribozyme, and triple helix forming oligonucleotides
  • recombinant expression vectors can be constructed to direct the expression of the oligonucleotides of the invention.
  • Such vectors can be constructed by recombinant DNA technology methods standard in the art.
  • vectors such as viral vectors can be designed for gene therapy applications where the goal is in vivo expression of inhibitory oligonucleotides in targeted cells
  • assays can be developed to identify agents that modulate transcriptional activation mediated by FKBP51/52, CyP40, Gli3, AFX-1 and the hairless protein. While not being bound to any one particular theory, it is believed that the binding of FK506 to the FKBP51/52/hsp90 complex, or cyclosporin A to the CyP40/hsp90 complex, promotes the activation and/or release of the zinc finger transcription factors hairless and/or Gli3 from the complex. Nuclear translocation of the hairless and/or Gli3 proteins results in transactivation of target genes and stimulation of hair production.
  • an assay can be used to identify agents that modulate translocation of the Gli-3, AFX-1 and/or hairless protein into the nucleus.
  • the hairless, AFX-1 and/or Gli3 protein can be tagged with an easily detectable peptide tag such as GFP.
  • Such an assay involves contacting a cell expressing a tagged hairless, AFX-1 or Gli3 protein with a test agent in the presence of FK506 or cyclosporin A.
  • the assay can be performed using a cell expressing a nuclear hormone receptor in the presence of nuclear hormone receptor ligand.
  • the amount of tagged hairless, AFX-1 or Gli3 protein located within the nucleus is measured, e.g., by measuring the amount of tagged protein present in the nucleus. If the amount of tagged protein detected in the nucleus is decreased in the presence of the test agent, as compared to the same assay conducted in the presence of a vehicle control, a modulator of hairless and/or Gli3 nuclear translocation has been identified.
  • cells expressing Gli3, AFX-1 or hairless tagged proteins can be used to assay for agents that modulate the dissociation of hairless, AFX-1 and/or G ⁇ 3 from the FKBP51/52 hsp90 or CyP40/hs ⁇ 90 complexes.
  • Such assays can be done in the presence of FK506 or cyclosporin A to identify agents that inhibit the FK506 - or cyclosporin A - mediated dissociation of hairless, AFX-1 and/or Gli3 from said complexes.
  • a cell expressing a tagged hairless, AFX-1 or Gli3 protein is contacted with a test agent in the presence of FK506.
  • a cell lysate can be prepared followed by immunoprecipitation of the FKBP51/52 or CyP40 protein complex.
  • the immunoprecipitated complex is then analyzed to determine the presence or absence of the tagged Gli3, AFX-1 or hairless protein.
  • Downstream target genes of the Gli3 transcription factor are regulated by FK506 and cyclosporin A treatment.
  • BMP4 is a downstream target gene of the Gli3 pathway and expression of BMP4 is stimulated in the presence of FK506 and cyclosporin A.
  • constructs containing a Gli3 responsive element can be linked to any of a variety of different reporter genes and introduced into cells expressing FKBP51/52.
  • reporter genes can include, but are not limited to, those encoding chloramphenicol acetyltransferase (CAT), luciferase, GUS, growth hormone, or placental alkaline phosphatase.
  • CAT chloramphenicol acetyltransferase
  • luciferase luciferase
  • GUS growth hormone
  • placental alkaline phosphatase placental alkaline phosphatase
  • the cells are contacted with both FK506 and the test agent.
  • Alkaline phosphatase assays are particularly useful in the practice of the invention because the enzyme is secreted from the cell. Therefore, tissue culture supernatant can be assayed for secreted alkaline phosphatase.
  • alkaline phosphatase activity can be measured by calorimetric, bioluminescent or chemilumenscent assays such as those described above.
  • the present invention relates to the identification of agents capable of modulating hair growth without the side effect of immunosuppression.
  • any agents identified as possible modulators of hair growth are also tested for their ability to immunosuppress.
  • Assays designed to measure the immunosuppressive effect of a test agent include, for example, lymphocyte stimulation assays and assays designed to measure cytokine production, i.e., JL-1 production may be performed.
  • One such assay is conducted as follows. Spleens are excised from euthanized (CO 2 asphyxiation) adult male C3H mice ranging in age from seven to sixteen weeks old (live mice commercially available from Harlan Sprague Dawley, Inc., Indianapolis, IN). The spleens are placed immediately in cold Hanks Balanced Salt Solution (HBSS, commercially available from Gibco-BRL, Gaithersburg, MD).
  • HBSS Hanks Balanced Salt Solution
  • the spleens are then ground up between frosted glass slides and filtered through a sterile screen to remove tissue debris.
  • the resulting cell suspension is underlay ed with an equal volume of Ficoll- Paque Plus (commercially available from Pharmacia Biotech, Piscataway, NJ) and centrifuged at 400 x g for approximately forty minutes at 20°C in order to collect the splenocytes.
  • the splenocytes are collected from the interface using a disposable pipet and are washed twice with HBSS, followed by centrifugation at 100 x g for ten minutes at 20°C.
  • Splenocytes are resuspended in five to ten mL of cell culture media consisting of phenol red-free RPMI 1640 (culture media commercially available from Gibco-BRL) containing 10% heat-inactivated fetal bovine serum (Gibco-BRL), penicillin (50 U/mL), streptomycin (100 ⁇ g/mL), L-glutamine (2 mM), 2- mercaptoethanol (10 -5 M), and N-2 hydroxyethylpi ⁇ erazine-N'-2-ethanesulfonic acid (HEPES) (10 mM). The cells are counted and checked for viability using, for example, trypan blue.
  • test compounds are considered non-immunosuppressive if, by using this method, the ratio of (cyclosporin A IC 50 /test compound IC 50 ) x 100 is less than or equal to 0.02, i.e., as defined herein, a non-immunosuppressive test compound has # 2% of the immunosuppressive activity of cyclosporin A.
  • MTT 3-[4,5-dimethyl-thiazoyl-2- yl]2,5-diphenyl-tetrazolium bromide
  • MTT 3-[4,5-dimethyl-thiazoyl-2- yl]2,5-diphenyl-tetrazolium bromide
  • the assay is carried out in serum-free, phenol red-free RPMI 1640 and the dye is solubilized in 100 ⁇ L/well DMSO and read at an OD of 540 nm with a background correction at 650 nm on a SpectraMax Plus microplate reader (Molecular Devices, Menlo Park, CA).
  • animal studies can be performed to determine whether a test agent has an immunosuppressive effect.
  • agents that modulate FKBP51/52 activity can identify agents that modulate FKBP51/52 activity.
  • agents that affect FKBP51/52 activity include, but are not limited to, agents that bind to FKBP51/52 and modulate the activity of FKBP51/52.
  • agents can be identified that do not bind directly to FKBP51/52, but are capable of altering FKBP51/52 activity by altering the activity of a protein involved in FKBP51/52 signal transduction.
  • agents that affect FKBP51/52 gene activity can be identified using the screens of the invention.
  • the agents which may be screened in accordance with the invention can include, but are not limited to, small organic or inorganic agents, peptides, antibodies and fragments thereof, and other organic agents (e.g., peptidomimetics) that bind to FKBP51/52 and either mimic the activity triggered by any of the known or unknown substrates of FKBP51/52 (i.e., agonists) or inhibit the activity triggered by any of the known or unknown substrates of FKBP51/52 (i.e., antagonists).
  • Agents that bind to FKBP51/52 and either enhance FKBP51/52 activities (i.e., agonists) or inhibit FKBP51/52 activities (i.e., antagonists) will be identified.
  • Agents that bind to proteins that alter/modulate the activity of FKBP51/52 will be identified.
  • Agents can include, but are not limited to, peptides such as, for example, soluble peptides, such as members of random peptide libraries (see, e.g., Lam, K.S. et al., 1991, Nature 354:82-84; Houghten, R. et al., 1991, Nature 354:84- 86); and combinatorial chemistry-derived molecular libraries made of D- and/or L- configuration amino acids, phosphopeptides (such as members of random or partially degenerate, directed phosphopeptide libraries); (see, e.g., Songyang, Z.
  • peptides such as, for example, soluble peptides, such as members of random peptide libraries (see, e.g., Lam, K.S. et al., 1991, Nature 354:82-84; Houghten, R. et al., 1991, Nature 354:84- 86); and combinatorial chemistry-derived molecular libraries made of D-
  • antibodies such as polyclonal, monoclonal, humanized, anti- idiotypic, chimeric or single chain antibodies, and FAb, F(ab') 2 FN, and FAb expression library fragments, and epitope binding fragments thereof), and small organic or inorganic molecules.
  • agents that can be screened in accordance with the invention include, but are not limited to, small organic molecules that affect the expression of the FKBP51/52 gene or some other gene involved in the FKBP51/52 signal transduction pathway (e.g., by interacting with the regulatory region or transcription factors involved in gene expression); or such agents that affect the activities of the FKBP51/52 or the activity of some other factor involved in modulating FKBP51/52 activity, such as for example, a protein that modifies FKBP51/52 and thereby inactivates FKBP51/52 enzyme activities.
  • the present invention provides methods of modulating hair growth comprising contacting a cell with an effective amount of a FKBP51/52 or CyP40 modulating agent, such as an FKBP51/52 or CyP40 agonist or antagonist identified using the assays as set forth above.
  • a FKBP51/52 or CyP40 modulating agent such as an FKBP51/52 or CyP40 agonist or antagonist identified using the assays as set forth above.
  • An “effective amount” of the FKBP51/52 or CyP40 inhibitor, i.e., antagonist is an amount that detectably decreases hair growth.
  • An “effective amount” of the FKBP51/52 or CyP40 activator, i.e., agonist is an amount that detectably increases hair growth.
  • the present invention further provides methods of modulating hair growth in a subject in need of such treatment, comprising administering to the subject an effective amount of an agent that modulates FKBP51/52 or CyP40 activity identified as set forth above.
  • the present invention further provides compositions comprising one or more activators or inhibitors of FKBP51/52 and CyP40 activity.
  • the composition may act directly on FKBP51/52 or CyP40, or alternatively may act on proteins involved in the FKBP51/52 and CyP40 signal transduction pathway.
  • the present invention further provides pharmaceutical compositions comprising an effective amount of an agent capable of modulating the activity of FKBP51/52, CyP40-, or FKBP51/52, CyP40-mediated signal transduction and/or the expression of FKBP51/52 or CyP40, thereby regulating hair growth, and a pharmaceutically acceptable carrier.
  • an agent capable of modulating the activity of FKBP51/52, CyP40-, or FKBP51/52, CyP40-mediated signal transduction and/or the expression of FKBP51/52 or CyP40 thereby regulating hair growth
  • a pharmaceutically acceptable carrier comprising an effective amount of an agent capable of modulating the activity of FKBP51/52, CyP40-, or FKBP51/52, CyP40-mediated signal transduction and/or the expression of FKBP51/52 or CyP40, thereby regulating hair growth.
  • “pharmaceutically acceptable” means approved by a regulatory agency of the federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopoeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Examples of suitable pharmaceutical carriers are described in Remington: The Science and Practice of Pharmacy, Gennaro et al. (eds), 20 Edition, Lippincott Williams & Wilkins, Philadelphia, PA (ISBN 0-683-306472).
  • the invention further provides for the treatment of various disorders associated with hair growth by administration of an agent that regulates the expression or activity of FKBP51/52 or CyP40.
  • Such agents include, but are not limited to, FKBP51/52 or CyP40 agonists and antagonists.
  • Such disorders include, but are not limited to, male pattern baldness, female pattern baldness, toxic baldness, alopecia areata and scarring alopecia.
  • the agent can be used to treat subjects with hair loss associated with exposure to radiation or chemotherapy.
  • the agents of the invention are preferably tested in vitro, and then in vivo in an animal system for a desired therapeutic or prophylactic activity, prior to testing and use in humans.
  • in vitro assays that can be used to determine whether administration of a specific therapeutic is indicated include in vitro cell culture assays in which cells expressing FKBP51/52 or CyP40 are exposed to or otherwise administered a therapeutic agent, where the effect of such a therapeutic agent on FKBP51/52 or CyP40 is then observed upon FKBP51/52 or CyP40 activity is then observed.
  • the ability of an agent to regulate the signal transduction pathway mediated by CyP40 or FKBP51/52 is assayed.
  • the invention provides methods of treatment and/or prophylaxis comprising administering to a subject in need thereof an effective amount of a hair growth modulating agent of the invention.
  • the agent is substantially purified.
  • the subject is preferably an animal, more preferably a mammal, and most preferably a human.
  • Various delivery systems are known and can be used to administer an agent capable of regulating hair growth, e.g., encapsulation in liposomes, microparticles, microcapsules.
  • Methods of introduction include, but are not limited to, intradermal, topical, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
  • the agents may be administered by any convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.), and may be administered together with other biologically active agents.
  • Administration can be systemic or local, and is preferably adopted for topical applications.
  • compositions of the invention may be desirable to administer the compositions of the invention locally to a specific area of the body. This may be achieved, for example, and not by way of limitation, by topical application.
  • the active compounds identified according to the methods of the present invention are generally administered in the form of pharmaceutical compositions comprising at least one of such compounds together with a pharmaceutically acceptable vehicle or diluent.
  • Such compositions are generally formulated in a conventional manner utilizing solid or liquid vehicles or diluents as appropriate for topical administration, in the form of solutions, oils, gels, creams, jellies, pastes, lotions, ointments, salves, leave-on and rinse-out hair conditioners, shampoos, aerosols and the like.
  • Examples of vehicles for application of an active compound identified according to a method of the present invention include an aqueous or water-alcohol solution, an emulsion of the oil-in-water or water-in-oil type, an emulsified gel, or a two-phase system.
  • the compositions according to the invention are in the form of lotions, creams, milks, gels, masks, microspheres or nanospheres, or vesicular dispersions.
  • the lipids of which the vesicles are made can be of the ionic or nonionic type, or a mixture thereof.
  • Topical compositions containing the active compound can be admixed with a variety of carrier materials well known in the art, such as, for example, water alcohols, aloe vera gel, allantoin, glycerin, vitamin A and E oils, mineral oil, propylene glycol, PPG-2 myristyle propionate, and the like, as well as any of various types of penetration enhancers, viscosity enhancing agents, pH stabilizers, anti- oxidants, preservatives, perfumes, coloring agents, etc.
  • carrier materials well known in the art, such as, for example, water alcohols, aloe vera gel, allantoin, glycerin, vitamin A and E oils, mineral oil, propylene glycol, PPG-2 myristyle propionate, and the like, as well as any of various types of penetration enhancers, viscosity enhancing agents, pH stabilizers, anti- oxidants, preservatives, perfumes, coloring agents, etc.
  • compositions suitable for use in topical carriers include, for example, emollients, solvents, humectants, thickeners and powers, as known in the art.
  • compositions of the present invention may also optionally comprise other hair growth modulating agents such as potassium channel openers, anti-androgens, thyroid hormones and derivatives and analogs thereof, prostaglandin agonists or antagonists, retinoids, triterpenes, and others known in the art or to be identified.
  • hair growth modulating agents such as potassium channel openers, anti-androgens, thyroid hormones and derivatives and analogs thereof, prostaglandin agonists or antagonists, retinoids, triterpenes, and others known in the art or to be identified.
  • the amount of the agent of the invention which will be effective in the treatment of a particular disorder will depend on the nature of the disorder and can be determined by standard clinical techniques. In vitro assays may optionally be employed to help identify optimal dosage ranges.
  • the precise dose to be employed in the formulation will depend on the route of administration and the nature of the disorder, and should be decided according to the judgment of the medical practitioner and in view of each patient's circumstances. Effective doses can be extrapolated from
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers comprising one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers comprising one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Optionally associated with such container(s) can be a notice in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the kit may further comprise printed instructions or a printed label directing the use of the composition to modulate, i.e., to stimulate or inhibit, hair growth.
  • FKBP51 and FKBP52 are selectively expressed in dermal papillae;
  • FKBP51/52 co-precipitate with hsp90, AFX-1 Gli3 and the hairless protein; and
  • a commercial RT-PCR kit (Promega Access RT-PCR kit) was used for detection of FKBP51, FKBP52, and CyP40 mRNA in different human cells.
  • the sequence of primers used for human FKBP51 is: TGAAGAAAGCCCCACAGC (SEQ ID NO:l) (forward primer) and CTCCAAAACCATATCTTGGTCC (SEQ ID NO:2) (reverse primers).
  • Primer sequence for human FKBP52 is: ACATTGCCATAGCCACCA (SEQ ID NO:3) (forward primer) and AGCCAAGACACGATCTTC (SEQ ID NO:4) (reverse primer).
  • Primer sequence for human CyP40 is: TGAAGGAAGGAGATGACGGG (SEQ ID NO:5) (forward primer) and TCCTCAGGGAAATCTGGATGA (SEQ ID NO:6) (reverse primer).
  • Human skin tissue was extracted using TPER reagent (Pierce, Rockford, JL) at a ratio of 10: 1 (extraction buffe ⁇ tissue; vol:wt) on ice using a Polytron homogenizer in the presence of protease inhibitors (Protease Inhibitor Cocktail, 1:50 dilution; Sigma, St. Louis, MO) to form a lysate.
  • TPER reagent Pieris, Rockford, JL
  • protease inhibitors Protease Inhibitor Cocktail, 1:50 dilution; Sigma, St. Louis, MO
  • FK506 was added to the lysate to a final concentration of 1 ⁇ M.
  • Antibody complexes were immunoprecipitated in TPER buffer at 6°C overnight. Complexes were washed lOx with Tris/saline (4°C) and sequentially eluted with 1M NH 4 CO 3 or 20 mM Tris, pH 7.4, 0.3 M NaCl: (5 x 100 ⁇ l) and 0.1 % TFA, 5% MeOH
  • Proteins were suspended in 1 M GnHCl, 100 mM NH 4 CO 3 , 0.5 mM DTT and subject to digestion with trypsin (Promega) or gluC (Roche) for about 18 hours at 37°C. Digests were desalted using C18 ZipTips (Millipore) eluted with 60% acetonitrile, 0.1 % TFA.
  • the peptide digests were analyzed by matrix-assisted laser disorption ionization (MALDI) time of flight (TOF) spectrometry. Essentially, peptides were mixed with matrix (1:1 sample: ⁇ -cyano-4-hydroxycinnamic acid; 20 mg/ml-HCCA, 30% acetonitrile, 0.1% TFA) in which the dried droplet method was used. Peptides were analyzed using a Voyager DE-Pro spectrometer (PE BioSystems) in reflector mode (2 m flight length) with a positive ion accelerating voltage of 20 kV, a grid voltage of 12.8 kV, guide wire voltage of 1400 V, using 100 ns delayed extraction. Greater than 64 scans were averaged per spectra. 30 - 50 fmols each of bradykinin and ACTH (amino acid residues 18-39) were used as internal mass standards.
  • MALDI matrix-assisted laser disorption ionization
  • TOF time of flight
  • RNA quantification The results as presented in Figure 3 show that cyclosporin A and FK506 both up-regulate the level of BMP4 and HNF3 ⁇ mRNA.
  • downstream target genes of Gli3 were found to be up regulated by cyclosporin A and FK506 treatment in skin cells such as dermal fibroblasts and skin keratinocytes.
  • BMP4 and HNF3 ⁇ mRNA level were induced by cyclosporin A or FK506 treatment.
  • TRE tandem thyroid hormone response elements
  • AGGTCA CAGG AGGTCA underlined sequence is repeated
  • SEQ ID NO:7 Four tandem thyroid hormone response elements (TRE) (AGGTCA CAGG AGGTCA) (underlined sequence is repeated) (SEQ ID NO:7) were synthesized in a single oligonucleotide and ligated 5' of thymidine kinase (TK) promoter using standard procedures.
  • a plasmid (TRE-TK/pUV120puro) was constructed by linking the resulting TRE/TK promoter 5' of the lucif erase reporter gene from H. pyralis, de Wet Jr. et al, 1986, Methods Enzymol 133:3-14, together with a gene encoding a protein conferring resistance to the antibiotic puromycin expressed under the control of the S V40 promoter.
  • the expression of the luciferase gene is under the direct control of the TRE-TK promoter and is inducible by agonists of the thyroid hormone nuclear receptor (TR).
  • TR thyroid hormone nuclear receptor
  • HeLa cells ATCC, Manassas, VA 20108, #CCL-2
  • drug resistant cell lines were selected using puromycin Signa-Aldrich Corp., St. Louis, MI.
  • Drug resistant cell lines were selected for responsiveness to thyroid hormone, and a single, stably transfected, clonal line was used in subsequent experiments.
  • cyclosporine A, FK506 and thyroid hormone T3 were evaluated for their ability to increase thyroid hormone nuclear receptor signaling.
  • HeLa/TRE cells were seeded at a density of 10,000 cells per well in 96 well microtiter plates in DMEM culture media containing 1% charcoal stripped FCS, 2mM glutamine and antibiotics (penicillin and streptomycin). The cells were treated with increasing concentrations (20 nM, 2 nM, 200 pM, and 20 pM) of cyclosporin A or FK506 ) Sigma- Aldrich Corp., St.
  • Dermal Papular (DP) cells are critical for hair growth.
  • CyP40 and FKBP51/52 were detected using RT-PCR ( Figure 2).
  • the levels of FKBP51/52 are much greater than those of FKBP 12/13.
  • the expression patterns in human dermal fibroblasts and keratinocytes have also been studied and were found to be identical.
  • Mass spectrometry analysis of hs ⁇ 90 and FKBP52 immunoprecipitated complexes derived from human scalp skin reveal the presence of three transcription factors.
  • the factors include the zinc finger protein hairless, the sonic hedgehog stimulated factor Gli-3, and AFX-1.
  • downstream target genes of Gli3 such as BMP4 and HNF3 were found to be upregulated by FK506 treatment ( Figure 3).
  • Hsp90 and FKBP52 complexes relevant to immunophillin action were identified from human scalp skin extracts using monoclonal antibodies, protease digestion, mass spectrometric measurement of peptide masses and protein database searching.
  • the following proteins were identified from trypsin and/or GluC digests subject to mass spectrometric analysis:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Dermatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2002/019948 2001-06-26 2002-06-24 Fkbp51/52 and cyp40-mediated mammalian hair growth WO2003002756A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2003508720A JP2005501229A (ja) 2001-06-26 2002-06-24 Fkbp51/52及びcyp40により媒介される哺乳類の発毛
EP02744577A EP1399579A4 (en) 2001-06-26 2002-06-24 MAMMALIAN HAIR GROWTH INDUCED BY FKBP51 / 52 AND CYP40

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US30087601P 2001-06-26 2001-06-26
US60/300,876 2001-06-26

Publications (2)

Publication Number Publication Date
WO2003002756A1 true WO2003002756A1 (en) 2003-01-09
WO2003002756A9 WO2003002756A9 (en) 2004-04-15

Family

ID=23160965

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/019948 WO2003002756A1 (en) 2001-06-26 2002-06-24 Fkbp51/52 and cyp40-mediated mammalian hair growth

Country Status (3)

Country Link
EP (1) EP1399579A4 (ja)
JP (1) JP2005501229A (ja)
WO (1) WO2003002756A1 (ja)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7618956B2 (en) 2005-05-31 2009-11-17 The Gillette Company Reduction of hair growth

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5763590A (en) * 1991-10-11 1998-06-09 Vertex Pharmaceuticals, Inc. Isolation of an Mr 52,000 FK506 binding protein and molecular cloning of a corresponding human cDNA

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH11174041A (ja) * 1997-12-12 1999-07-02 Shiseido Co Ltd 発毛用薬物の探索方法
WO1999038965A1 (en) * 1998-01-29 1999-08-05 The Trustees Of Columbia University In The City Of New York Human hairless gene, protein and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5763590A (en) * 1991-10-11 1998-06-09 Vertex Pharmaceuticals, Inc. Isolation of an Mr 52,000 FK506 binding protein and molecular cloning of a corresponding human cDNA

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP1399579A4 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7618956B2 (en) 2005-05-31 2009-11-17 The Gillette Company Reduction of hair growth

Also Published As

Publication number Publication date
WO2003002756A9 (en) 2004-04-15
JP2005501229A (ja) 2005-01-13
EP1399579A4 (en) 2006-04-19
EP1399579A1 (en) 2004-03-24

Similar Documents

Publication Publication Date Title
Scott et al. Localization of A-kinase through anchoring proteins.
EP1170594A2 (en) Methods for the identification of compounds useful for the treatment of disease states mediated by Prostaglandin D2
Tcherkezian et al. Transmembrane receptor DCC associates with protein synthesis machinery and regulates translation
Crawford et al. M‐LDH serves as a sarcolemmal KATP channel subunit essential for cell protection against ischemia
Pruschy et al. Facilitated nuclear transport of calmodulin in tissue culture cells.
Yellaturu et al. A potential role for nuclear factor of activated T-cells in receptor tyrosine kinase and G-protein-coupled receptor agonist-induced cell proliferation
Hansen et al. Focal transgene expression associated with papilloma development in v‐Ha‐ras–transgenic TG. AC mice
Provence et al. Kv7 channel pharmacological activation by the novel activator ML213: role for heteromeric Kv7. 4/Kv7. 5 channels in guinea pig detrusor smooth muscle function
Ruder et al. EBAG9 adds a new layer of control on large dense-core vesicle exocytosis via interaction with Snapin
Liu et al. Role of secretory carrier membrane protein SCAMP2 in granule exocytosis
KR100648761B1 (ko) 저산소증-유도성 인자 1α HIF-1α 변이체 및HIF-1α 조절제의 동정 방법
Morimoto et al. Overexpression of synaptotagmin modulates short-term synaptic plasticity at developing neuromuscular junctions
US7169564B1 (en) FKBP51/52 and CyP40-mediated mammalian hair growth
EP0887081B1 (en) Human serum glucocorticoid regulated kinase, a target for chronic renal disease and diabetic nephropathy
US20060160145A1 (en) EPF receptor assays, compounds and therapeutic compositions
EP1399579A1 (en) Fkbp51/52 and cyp40-mediated mammalian hair growth
EP1340979A2 (en) Neuropeptide receptor and uses thereof
WO2008076857A2 (en) Method and compositions for inhibiting mage protein interaction with kap-1
Goda et al. Effects of ATP depletion and phosphate analogues on P‐glycoprotein conformation in live cells
KR102441148B1 (ko) 에피토프의 식별 방법
EP1309868A2 (en) Ldl receptor signaling pathways
WO2000045771A9 (en) Suppression of transformation of cells by the transcription factor egr
US20050014170A1 (en) Effect of BDNF genotype on hippocampal function and verbal memory and risk for schizophrenia
Kim The role of the N-end rule pathway in mammalian development and innate immunity
US20030171293A1 (en) Neuropeptide receptor and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2003508720

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2002744577

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2002744577

Country of ref document: EP

COP Corrected version of pamphlet

Free format text: PAGES 1/4-4/4, DRAWINGS, REPLACED BY NEW PAGES 1/4-4/4

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2002744577

Country of ref document: EP