WO2003000896A2 - POLYNUCLEOTIDES AND POLYPEPTIDES OF THE IFNα-5 GENE - Google Patents

POLYNUCLEOTIDES AND POLYPEPTIDES OF THE IFNα-5 GENE Download PDF

Info

Publication number
WO2003000896A2
WO2003000896A2 PCT/EP2002/005458 EP0205458W WO03000896A2 WO 2003000896 A2 WO2003000896 A2 WO 2003000896A2 EP 0205458 W EP0205458 W EP 0205458W WO 03000896 A2 WO03000896 A2 WO 03000896A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
diseases
nucleotide sequence
ifnα
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2002/005458
Other languages
English (en)
French (fr)
Other versions
WO2003000896A3 (en
Inventor
Jean-Louis Escary
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GenOdyssee SA
Original Assignee
GenOdyssee SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by GenOdyssee SA filed Critical GenOdyssee SA
Priority to JP2003507279A priority Critical patent/JP2004535196A/ja
Priority to EP02748710A priority patent/EP1383895A2/en
Priority to AU2002319176A priority patent/AU2002319176A1/en
Publication of WO2003000896A2 publication Critical patent/WO2003000896A2/en
Publication of WO2003000896A3 publication Critical patent/WO2003000896A3/en
Priority to US10/698,402 priority patent/US7358333B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • C07K14/56IFN-alpha
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/24Antidepressants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to new polynucleotides derived from the nucleotide sequence of the IFN ⁇ -5 gene comprising new SNPs, and new polypeptides derived from the natural wild-type IFN ⁇ -5 protein comprising mutations caused by these SNPs, as well as their therapeutic uses.
  • interferon alpha 5 gene hereinafter referred to as IFN ⁇ -5
  • IFN ⁇ -5 The interferon alpha 5 gene, hereinafter referred to as IFN ⁇ -5, is described in the publication of K. Henco et al. "Structural relationship of human interferon alpha genes and pseudogenes"; J. Mol. Biol; 185 (2); 227-260; (1985).
  • the nucleotide sequence of this gene is accessible in the GenBank database under accession number X02956.
  • the IFN ⁇ are known for their cellular antiproliferative effects and their involvements in antiviral and antiparasitic responses.
  • the IFN ⁇ are also known to inhibit the expression of several other cytokines at the level of the hematopoietic stem cells, as well as to inhibit the cellular proliferation of certain tumors.
  • the IFN ⁇ are also known to reduce the expression of the receptors to the EGF in renal carcinomas, to inhibit the expression of certain mitochondrial genes, to inhibit the proliferation of fibroblasts, monocytes and B lymphocytes, especially in vitro, and to block the synthesis of antibodies by B lymphocytes.
  • the IFN ⁇ are also known to induce the expression of tumor specific antigens on the surface of tumor cells and also to induce the genes placed under the control of promoter regions of the ISRE type (Interferon-Stimulated Response Element) by acting on the specific transcription factors of these ISRE.
  • ISRE Interferon-Stimulated Response Element
  • the IFN ⁇ are involved in different disorders and/or human diseases, such as the different cancers like for example, carcinomas, melanomas, lymphomas, leukemias and cancers of the liver, neck, head and kidneys, cardiovascular diseases, metabolic diseases such as those that are not connected with the immune system like, for example, obesity, infectious diseases such as hepatitis B and C and AIDS, pneumonias, ulcerative colitis, diseases of the central nervous system like, for example, Alzheimer's disease, schizophrenia and depression, the rejection of tissue or organ grafts, healing of wounds, anemia in dialyzed patients, allergies, asthma, multiple sclerosis, osteoporosis, psoriasis, rheumatoid arthritis, Crohn's disease, autoimmune diseases and disorders, gastrointestinal disorders or even disorders connected with chemotherapy treatments.
  • the different cancers like for example, carcinomas, melanomas, lymphomas, leukemias and cancers of the liver, neck, head and kidneys, cardiovascular diseases, metabolic diseases such as those that are not
  • the IFN ⁇ are particularly used for the treatment of certain leukemias, metastasizing renal carcinomas as well as tumors that appear following an immunodeficiency, such as Kaposi's sarcoma in the case of AIDS.
  • the IFN ⁇ are also effective against other types of tumors and against certain viral infections.
  • the IFN ⁇ are also recognized by the FDA (Food and Drug Administration) for the treatment of genital warts or venereal diseases.
  • IFN ⁇ and in particular IFN ⁇ -5, have numerous side effects when they are used in pharmaceutical compositions, such as reactions of acute hypersensitivity
  • the patients treated with IFN ⁇ can develop antibodies neutralizing these molecules, thus decreasing their effectiveness.
  • the inventors have found new polypeptide and new polynucleotide analogs to tl e IFN ⁇ -5 gene capable of having a different functionality from the natural wild-type IFN ⁇ -5 protein.
  • the invention has as its first object new polynucleotides that differ from the nucleotide sequence of the reference wild-type IFN ⁇ -5 gene, in that it comprises one or several SNPs (Single Nucleotide Polymorphism).
  • the nucleotide sequence SEQ ID NO. 1 of the human reference wild-type IFN ⁇ -5 gene is composed of 1475 nucleotides and comprises a coding sequence of 570 nucleotides, from nucleotide 434 (start codon) to nucleotide 1003 (stop codon).
  • the applicant has identified 11 SNPs in the nucleotide sequence of the reference wild- type IFN ⁇ -6 gene. These 11 SNPs are the following: c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, a516g, c641g, g798c, and gl009a.
  • the letters a, t, c and g correspond respectively to the nitrogenous bases adenine, thymine, cytosine and guanine.
  • the first letter corresponds to the wild-type nucleotide, whereas the last letter corresponds to the mutated nucleotide.
  • the SNP c42t corresponds to a mutation of the nucleotide cytosine (c) at position 42 of the nucleotide sequence SEQ ID NO. 1 of the reference wild-type IFN ⁇ - 5 gene, into nucleotide thymine (t).
  • the process described in this patent application permits the identification of one (or several) preexisting SNP(s) in at least one individual from a random population of individuals.
  • a fragment of the nucleotide sequence of the IFN ⁇ -5 gene comprising, for example, the coding sequence, was isolated from different individuals in a population of individuals chosen in a random manner.
  • the fragment sequenced in this way was then compared to the nucleotide sequence of the fragment of the reference wild-type IFN ⁇ -5 gene and the SNPs in conformity with the invention identified.
  • the SNPs are natural and each of them is present in certain individuals of the world population.
  • the reference wild-type IFN ⁇ -5 gene codes for an immature protein of 189 amino acids, corresponding to the amino acid sequence SEQ ID NO. 2, that will be converted to a mature protein of 166 amino acids, by cleavage of the signal peptide that includes the first 23 amino acids.
  • Each of the coding SNPs of the invention causes modifications, at the level of the amino acid sequence, of the protein encoded by the nucleotide sequence of the IFN ⁇ -5 gene. These modifications in the amino acid sequence are the following:
  • the SNP a516g causes a mutation of the amino acid glutamine (Q) at position 28 in the immature protein of the IFN ⁇ -5 gene, corresponding to the amino acid sequence SEQ ID NO:
  • the SNP c641g causes a mutation of the amino acid glutamine (Q) at position 70 in the immature protein of the IFN ⁇ -5 gene, corresponding to the amino acid sequence SEQ ID NO:
  • the SNP g798c causes a mutation of the amino acid cysteine (C) at position 122 in the immature protein of the IFN ⁇ -5 gene, corresponding to the amino acid sequence SEQ ID NO: 1
  • the SNPs a516g, c641g, g798c cause modifications of the spatial conformation of the polypeptides in conformity with the invention compared to the polypeptide encoded by the nucleotide sequence of the wild-type reference IFN ⁇ -5 gene. These modifications can be observed by computational molecular modeling, according to methods that are well known to a person skilled in the art, making use of, for example, the modeling tools de novo (for example, SEQFOLD/MSI), homology (for example, MODELER/MSI), minimization of the force field (for example, DISCOVER, DELPHI/MSI) and/or molecular dynamics (for example, CFF/MSI).
  • the modeling tools de novo for example, SEQFOLD/MSI
  • homology for example, MODELER/MSI
  • minimization of the force field for example, DISCOVER, DELPHI/MSI
  • CFF/MSI molecular dynamics
  • the N-terminal domain of IFN ⁇ before helix A is highly conserved. Furthermore, Shafferman et al. (In: Journal of Biological Chemistry (1987) 262:6227-6237) aid Hu et al. (In: Journal of Immunology (2001) 167: 1482-1489) showed that this part of the protein is involved in the activity of IFN ⁇ .
  • the Q5R mutated protein possesses a three-dimensional conformation different from the natural wild-type IFN ⁇ -5 protein involving a moderate change in its structure and a significant change in its activity and function due to the gain of charge from a glutamine (polar) to an arginine (positively charged).
  • the glutamic acid residue of position 47 appears to play an important role in the formation of this loop, because it is retained in all interferons.
  • the Q47E mutated protein possesses a three-dimensional conformation different from the natural wild-type IFN ⁇ -5 protein involving a significant change in its structure and function, in particular at the level of IFN ⁇ -5 binding to its receptor.
  • Computational molecular modeling shows that the mutation C99S on the mature mutated protein results in the disappearance of a disulfide bridge which participates, in the natural wild-type IFN ⁇ -5 protein, in the three-dimensional conformation of the N-terminal part and the "CD" loop, between helixes C and D. This is represented in Figures 2A and 2B. Mutation C99S makes the N-terminal loop (Cysl-Thr6) mobile. This results in unfolding of the end of helix C and disturbance of the "CD" loop.
  • the C99S mutated protein possesses a three-dimensional conformation different from the natural wild-type IFN ⁇ -5 protein involving a significant change in its structure and function, in particular at the level of IFN ⁇ -5 binding to its receptor.
  • SNPs in conformity with the invention namely: c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, and gl009a, do not involve modification of the protein encoded by the nucleotide sequence of the IFN ⁇ -5 gene at the level of the amino acid sequence SEQ ID NO. 2.
  • the SNPs c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, and gl009a are non-coding.
  • Genotyping of the polynucleotides in conformity with the invention can be carried out in such a fashion as to determine the allelic frequency of these polynucleotides in a population. Examples of genotyping are given, hereinafter, in the experimental section.
  • polypeptides of the invention can equally be carried out by a test of their biological activity.
  • the invention also has for an object the use of polynucleotides and of polypeptides in conformity with the invention as well as of therapeutic molecules obtained and/or identified starting from these polynucleotides and polypeptides, notably for the prevention and the treatment of certain human disorders and/or diseases.
  • Figure 1A represents a model of the encoded protein according to the invention comprising the SNP Q47E and the natural wild-type IFN ⁇ -5 protein.
  • Figure IB represents a close up of the model of the superior part of each one of the proteins represented in Figure 1A.
  • the black ribbon represents the structure of the natural wild- type IFN ⁇ -5 protein and the white ribbon represents the structure of the Q47E mutated IFN ⁇ - 5 protein.
  • Figure 2A represents a model of the encoded protein according to the invention comprising the SNP C99S and the natural wild-type IFN ⁇ -5 protein.
  • Figure 2B represents a close up of the model of the superior part of each of the proteins represented in Figure 2A.
  • the black ribbon represents the structure of the natural wild- type IFN ⁇ -5 protein and the white ribbon represents the structure of the C99S mutated IFN ⁇ - 5 protein.
  • FIG. 3 represents the results of the test for measuring the antiproliferative effect of
  • C122S mutated IFN ⁇ -5 on the TF-1 cell line.
  • the abscissas correspond to the concentration of IFN ⁇ (ng/mL) and the ordinates correspond to the inhibition of cell proliferation (%).
  • the antiproliferative effect of the C122S mutated IFN ⁇ -5 black diamonds is compared to that of wild-type IFN ⁇ -2 (white squares).
  • Figure 4 represents the survival rate of mice previously infected by VSV virus and treated with C122S mutated IFN ⁇ -5 protein, in comparison to those treated with wild-type IFN ⁇ -2, or those which have not been treated.
  • the abscissas correspond to the time of survival (days) and the ordinates correspond to the relative survival rate of VSV infected mice.
  • the black diamonds represent the data for VSV infected mice treated with C122S mutated IFN ⁇ -5.
  • the black squares represent the data for VSV infected mice treated with wild-type IFN ⁇ -2, and the open triangles represent the data for VSV infected mice which have not been treated.
  • Figure 5 represents the survival rate of mice previously inoculated with malignant
  • Friend erythroleukemia cells and treated with C122S mutated IFN ⁇ -5 protein, in comparison to those treated with wild-type IFN ⁇ -2, or those which have not been treated.
  • the abscissas correspond to the time of survival (days) and the ordinates correspond to the relative survival rate of FLC inoculated mice.
  • the black diamonds represent the data for FLC inoculated mice treated with C122S mutated IFN ⁇ -5.
  • the black squares represent the data for FLC inoculated mice treated with wild-type IFN ⁇ -2, and the open triangles represent the data for FLC inoculated mice which have not been treated.
  • Nucleotide sequence of the reference wild-type gene is understood as the nucleotide sequence SEQ ID NO. 1 of the human IFN ⁇ -5 gene.
  • Polynucleotide is understood as a polyribonucleotide or a polydeoxyribonucleotide that can be a modified or non-modified DNA or an RNA.
  • polynucleotide includes, for example, a single strand or double strand DNA, a DNA composed of a mixture of one or several single strand region(s) and of one or several double strand region(s), a single strand or double strand RNA and an RNA composed of a mixture of one or several single strand region(s) and of one or several double strand region(s).
  • polynucleotide can also include an RNA and/or a DNA including one or several triple strand regions.
  • modified base is understood, for example, the unusual bases such as inosine.
  • Polypeptide is understood as a peptide, an oligopeptide, an oligomer or a protein comprising at least two amino acids joined to each other by a normal or modified peptide bond, such as in the cases of the isosteric peptides, for example.
  • a polypeptide can be composed of amino acids other than the 20 amino acids defined by the genetic code.
  • a polypeptide can equally be composed of amino acids modified by natural processes, such as post translational maturation processes or by chemical processes, which are well known to a person skilled in the art. Such modifications are fully detailed in the literature. These modifications can appear anywhere in the polypeptide: in the peptide skeleton, in the amino acid chain or even at the carboxy- or amino-terminal ends.
  • a polypeptide can be branched following an ubiquitination or be cyclic with or without branching. This type of modification can be the result of natural or synthetic post- translational processes that are well known to a person skilled in the art.
  • polypeptide modifications is understood to include acetylation, acylation, ADP-ribosylation, amidation, covalent fixation of flavine, covalent fixation of he e, covalent fixation of a nucleotide or of a nucleotide derivative, covalent fixation of a lipid or of a lipidic derivative, the covalent fixation of a phosphatidylinositol, covalent or non-covalent cross-linking, cyclization, disulfide bond formation, demethylation, cysteine formation, pyroglutamate formation, formylation, gamma-carboxylation, glycosylation including PEGylation, GPI anchor formation, hydroxylation, iodization, methylation, myristoylation, oxidation, proteolytic processes, phosphoryla ion, prenylation, racemization, seneloylation, sulfatation, amino acid addition such as arginylation or ubiquit
  • Identity is understood as the measurement of nucleotide or polypeptide sequence identity. Identity is a term well known to a person skilled in the art and well described in the literature. See COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, A.M., Ed., Oxford University Press, New York, 1998; BIOCOMPUTING INFORMATICS AND GENOME PROJECT, Smith, D.W., Ed., Academic Press, New York, 1993; COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin, A.M. and Griffin H.G., Ed, Humana Press, New Jersey, 1994; and SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heinje, G., Academic Press, 1987.
  • a polynucleotide having, for example, an identity of at least 95 % with the nucleotide sequence SEQ ID NO. 1 is a polynucleotide which contains at most 5 points of mutation over 100 nucleotides, compared to said sequence.
  • These points of mutation can be one (or several) substitution(s), addition(s) and/or deletion(s) of one (or several) nucleotide(s).
  • a polypeptide having, for example, an identity of at least 95 % with the amino acid sequence SEQ ID NO. 2 is a polypeptide that contains at most 5 points of mutation over 100 amino acids, compared to said sequence.
  • These points of mutation can be one (or several) substitution(s), addition(s) and/or deletion(s) of one (or several) amino acid(s).
  • polypeptides and the polypeptides according to the invention which are not totally identical with respectively the nucleotide sequence SEQ ID NO. 1 or the amino acid sequence SEQ ID NO. 2, it being understood that these sequences contains at least one of the SNPs of the invention, are considered as variants of these sequences.
  • a polynucleotide according to the invention possesses the same or practically the same biological activity as the nucleotide sequence SEQ ID NO. 1 comprising at least one of the SNPs of the invention.
  • a polypeptide according to the invention possesses the same or practically the same biological activity as the amino acid sequence SEQ ID NO. 2 comprising at least one of the coding SNPs of the invention.
  • a variant, according to the invention, can be obtained, for example, by site-directed mutagenesis or by direct synthesis.
  • SNP is understood any natural variation of a base in a nucleotide sequence.
  • SNP on a nucleotide sequence, can be coding, silent or non-coding.
  • a coding SNP is a polymorphism included in the coding sequence of a nucleotide sequence that involves a modification of an amino acid in the sequence of amino acids encoded by this nucleotide sequence.
  • SNP applies equally, by extension, to a mutation in an amino acid sequence.
  • a silent SNP is a polymorphism included in the coding sequence of a nucleotide sequence that does not involve a modification of an amino acid in the amino acid sequence encoded by this nucleotide sequence.
  • a non-coding SNP is a polymorphism included in the non-coding sequence of a nucleotide sequence. This polymorphism can notably be found in an intron, a splicing zone, a transcription promoter or a site enhancer sequence.
  • a SNP such as previously defined, which is included in a nucleotide sequence or an amino acid sequence, having a functionality.
  • the functionality of a polypeptide or of a polynucleotide according to the invention can consist in a conservation, an augmentation, a reduction or a suppression of the biological activity of the polypeptide encoded by the nucleotide sequence of the wild-type reference gene or of this latter nucleotide sequence.
  • polypeptide or of a polynucleotide according to the invention can equally consist in a change in the nature of the biological activity of the polypeptide encoded by the nucleotide sequence of the reference wild-type gene or of this latter nucleotide sequence.
  • the biological activity can, notably, be linked to the affinity or to the absence of affinity of a polypeptide according to the invention with a receptor.
  • Polynucleotide has for its first object an isolated polynucleotide comprising: a) a nucleotide sequence having at least 80 % identity, preferably at least 90 % identity, more preferably at least 95 % identity and still more preferably at least 99 % identity with the sequence SEQ ID NO. 1 or its coding sequence (from nucleotide 434 to nucleotide 1003), it being understood that this nucleotide sequence comprises at least one of the following coding SNPs a516g, c641g, g798c; or b) a nucleotide sequence complementary to a nucleotide sequence under a).
  • the present invention relates equally to an isolated polynucleotide comprising: a) a nucleotide sequence SEQ ID NO. 1 or its coding sequence, it being understood that each of these sequences comprises at least one of the following coding SNPs: a516g, c641g, g798c; or b) a nucleotide sequence complementary to a nucleotide sequence under a).
  • the polynucleotide of the invention consists of the sequence SEQ ID NO. 1 or its coding sequence, it being understood that each of these sequences comprises at least one of the following coding SNPs: a516g, c641g, g798c.
  • the polynucleotide previously defined comprises a single coding SNP selected from the group consisting of: a516g, c641g, g798c.
  • the polynucleotide previously defined comprises the SNP g798c.
  • a polynucleotide such as previously defined can equally include at least one of the following non-coding SNPs: c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, and gl009a.
  • the present invention equally has for its object an isolated polynucleotide comprising or consisting of: a) a nucleotide sequence SEQ ID NO. 1, it being understood that each of these sequences comprises at least one of the following non coding SNPs: c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, and gl009a; or b) a nucleotide sequence complementary to a nucleotide sequence under a).
  • the present invention also concerns an isolated polynucleotide consisting of a part of: a) a nucleotide sequence SEQ ID NO.
  • each of these sequences comprises at least one of the following SNPs: c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, a516g, c641g, g798c, gl009a; or b) a nucleotide sequence complementary to a nucleotide sequence under a); said isolated polynucleotide being composed of at least 10 nucleotides.
  • the isolated polynucleotide as defined above is composed of 10 to 40 nucleotides.
  • the present invention also has for its object an isolated polynucleotide coding for a polypeptide comprising: a) the amino acid sequence SEQ ID NO. 2; or b) the amino acid sequence comprising the amino acids included between positions 24 and 189 in the sequence of amino acids SEQ ID NO. 2; it being understood that each of the amino acid sequences under a) and b) comprises at least one of the following coding SNPs: Q28R, Q70E, C122S. It is understood, in the sense of the present invention, that the numbering corresponding to the positioning of the SNPs Q28R, Q70E, and C122S, is relative to the numbering of the amino acid sequence SEQ ID NO. 2.
  • the previously defined polypeptide comprises a single coding SNP such as defined above.
  • an isolated polynucleotide according to the invention codes for a polypeptide comprising all or part of the amino acid sequence SEQ ID NO. 2 and having the coding SNP C122S.
  • a polynucleotide according to the invention is composed of a DNA or
  • a polynucleotide according to the invention can be obtained by standard DNA or RNA synthetic methods.
  • a polynucleotide according to the invention can equally be obtained by site-directed mutagenesis starting from the nucleotide sequence of the IFN ⁇ -5 gene by modifying the wild-type nucleotide by the mutated nucleotide for each SNP on the nucleotide sequence SEQ ID NO. 1.
  • a polynucleotide according to the invention comprising a SNP g798c can be obtained by site-directed mutagenesis starting from the nucleotide sequence of the IFN ⁇ -5 gene by modifying the nucleotide guanine (g) by the nucleotide cytosine (c) at position 798 on the nucleotide sequence SEQ ID NO. 1.
  • An isolated polynucleotide can equally include, for example, nucleotide sequences coding for pre-, pro- or pre-pro-protein amino acid sequences or marker amino acid sequences, such as hexa-histidine peptide.
  • a polynucleotide of the invention can equally be associated with nucleotide sequences coding for other proteins or protein fragments in order to obtain fusion proteins or other purification products.
  • a polynucleotide according to the invention can equally include nucleotide sequences such as the 5' and/or 3' non-coding sequences, such as, for example, transcribed or non-transcribed sequences, translated or non-translated sequences, splicing signal sequences, polyadenylated sequences, ribosome binding sequences or even sequences which stabilize mRNA.
  • nucleotide sequences such as the 5' and/or 3' non-coding sequences, such as, for example, transcribed or non- transcribed sequences, translated or non-translated sequences, splicing signal sequences, polyadenylated sequences, ribosome binding sequences or even sequences which stabilize mRNA.
  • a nucleotide sequence complementary to the nucleotide or polynucleotide sequence is defined as one that can hybridize with this nucleotide sequence, under stringent conditions.
  • Stringent hybridization conditions is generally but not necessarily understood as the chemical conditions that permit a hybridization when the nucleotide sequences have an identity of at least 80 %, preferably greater than or equal to 90 %, still more preferably greater than or equal to 95 % and most preferably greater than or equal to 97 %.
  • nucleotide sequence complementary to a nucleotide sequence comprises at least one anti-sense SNP according to the invention.
  • nucleotide sequence comprises the SNP g798c
  • its complementary nucleotide sequence comprises the guanine (g) nucleotide at the equivalent of position 798.
  • the present invention also has for its object the use of all or part of: a) a polynucleotide having 80 to 100 % identity (preferably at least 90 % identity, more preferably 95 % identity and particularly 100 % identity) with the nucleotide sequence SEQ ID NO.
  • a polynucleotide according to the invention comprising at least one SNP; in order to identify, hybridize and/or amplify all or part of a polynucleotide having 80 to 100 % identity (preferably at least 90 % identity, more preferably 95 % identity and particularly 100 % identity) with the nucleotide sequence SEQ ID NO.
  • each one of these sequences comprises at least one of the following SNPs: c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, a516g, c641g, g798c, and gl009a. Genotyping and determination of the frequency of a SNP
  • the present invention equally has for its object the use of all or part of: a) a polynucleotide having 80 to 100 % identity (preferably at least 90 % identity, more preferably 95 % identity and particularly 100 % identity) with the nucleotide sequence
  • SEQ ID NO. 1 SEQ ID NO. 1; and/or b) a polynucleotide according to the invention comprising at least one SNP for the genotyping of all or part of a polynucleotide having 80 to 100 % identity (preferably at least 90 % identity, more preferably 95 % identity and particularly 100 % identity) with the nucleotide sequence SEQ ID NO.
  • each one of these sequences comprises at least one of the following SNPs: c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, a516g, c641g, g798c, gl009a.
  • the genotyping may be carried out on an individual or a population of individuals .
  • genotyping is defined as a process for the determination of the genotype of an individual or of a population of individuals.
  • Genotype consists of the alleles present at one or more specific loci.
  • Population of individuals is understood as a group of individuals selected in random or non-random fashion. These individuals can be humans, animals, microorganisms or plants. Usually, the group of individuals comprises at least 10 individuals, preferably from 100 to 300 individuals.
  • the individuals can be selected according to their ethnicity or according to their phenotype, notably those who are affected by the following disorders and/or diseases: carcinomas, melanomas, lymphomas, leukemias and cancers of the liver, neck, head and kidneys, cardiovascular diseases, metabolic diseases such as those that are not connected with the immune system like, for example, obesity, infectious diseases in particular viral infections like hepatitis B and C and AIDS, pneumonias, ulcerative colitis, diseases of the central nervous system like, for example, Alzheimer's disease, schizophrenia and depression, the rejection of tissue or organ grafts, healing of wounds, anemia in dialyzed patients, allergies, asthma, multiple sclerosis, osteoporosis, psoriasis, rheumatoid arthritis, Crohn's disease, autoimmune diseases and disorders, gastrointestinal disorders or even disorders connected with chemotherapy treatments.
  • a functional SNP according to the invention is preferably genotyped in a population of individuals.
  • Genotyping can notably be carried out by minisequencing with hot ddNTPs (2 different ddNTPs labeled by different fluorophores) and cold ddNTPs (2 different non labeled ddNTPs), in connection with a polarized fluorescence scanner.
  • the minisequencing protocol with reading of polarized fluorescence FP-TDI Technology or Fluorescence Polarization Template-direct Dye-Terminator Incorporation
  • FP-TDI Technology or Fluorescence Polarization Template-direct Dye-Terminator Incorporation is well known to a person skilled in the art.
  • PCR polymerase chain reaction
  • the sense and antisense primers can easily be selected by a person skilled in the art according to the position of the SNPs of the invention.
  • the sense and antisense nucleotide sequences for the PCR amplification primers can be, respectively:
  • SEQ ID NO. 3 Sense primer: GGTCACTCAATCTCAACAGC
  • Antisense primer GGCAGAACTCAAGAAGTGTG
  • the nucleotide sequences permit amplification of a fragment having a length of 681 nucleotides, from nucleotide 390 to nucleotide 1070 in the nucleotide sequence SEQ ID NO. 1.
  • a statistical analysis of the frequency of each allele (allelic frequency) encoded by the gene comprising the SNP in the population of individuals is then achieved, which permits determination of the importance of their impact and their distribution in the different subgroups and notably, if necessary, the diverse ethnic groups that constitute this population of individuals.
  • the genotyping data are analyzed in order to estimate the distribution frequency of the different alleles observed in the studied populations.
  • the calculations of the allelic frequencies can be carried out with the help of software such as SAS-suite® (SAS) or SPLUS® (MathSoft).
  • SAS-suite® SAS
  • SPLUS® SPLUS®
  • the comparison of the allelic distributions of a SNP of the invention across different ethnic groups of the population of individuals can be carried out by means of the software ARLEQUIN® and SAS-suite®.
  • SNPs of the invention as genetic markers.
  • SNPs modifying functional sequences of genes are likely to be directly related to disease susceptibility or resistance
  • all SNPs may provide valuable markers for the identification of one or several genes involved in these disease states and, consequently, may be indirectly related to these disease states (See Cargill et al. (1999). Nature Genetics 22:231-238; Riley et al. (2000). Pharmacogenomics 1 :39-47; Roberts L. (2000). Science 287: 1898-1899).
  • the present invention also concerns a databank comprising at least one of the following SNPs: c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, a516g, c641g, g798c, and gl009a, in a polynucleotide of the IFN ⁇ -5 gene.
  • SNPs are numbered in accordance with their position on nucleotide sequence SEQ ID NO. 1.
  • This databank may be analyzed for determining statistically relevant associations between: (i) at least one of the following SNPs: c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, a516g, c641g, g798c, and gl009a, in a polynucleotide of the IFN ⁇ -5 gene, and (ii) a disease or a resistance to a disease.
  • the present invention also concerns the use of at least one of the following SNPs: c42t, g43a, c82t, al23t, gl52c, tl74c, g292c, a516g, c641g, g798c, and gl009a, in a polynucleotide of the IFN ⁇ -5 gene, for developing diagnostic/prognostic kits for a disease or a resistance to a disease.
  • a SNP of the invention such as defined above may be directly or indirectly associated to a disease or a resistance to a disease.
  • these diseases may be those which are defined as mentioned above.
  • the present invention also has for its object a recombinant vector comprising at least one polynucleotide according to the invention.
  • chromosomes chromosomes
  • episomes derived viruses
  • the recombinant vectors used can be derived from bacterial plasmids, transposons, yeast episomes, insertion elements, yeast chromosome elements, viruses such as baculovirus, papilloma viruses such as SV40, vaccinia viruses, adenoviruses, fox pox viruses, pseudorabies viruses, retroviruses.
  • recombinant vectors can equally be cosmid or phagemid derivatives.
  • the nucleotide sequence can be inserted in the recombinant expression vector by methods well known to a person skilled in the art such as, for example, those that are described in
  • the recombinant vector can include nucleotide sequences that control the regulation of the polynucleotide expression as well as nucleotide sequences permitting the expression and the transcription of a polynucleotide of the invention and the translation of a polypeptide of the invention, these sequences being selected according to the host cells that are used.
  • an appropriate secretion signal can be integrated in the recombinant vector so that the polypeptide, encoded by the polynucleotide of the invention, will be directed towards the lumen of the endoplasmic reticulum, towards the periplasmic space, on the membrane or towards the extracellular environment.
  • the present invention also has for its object a host cell comprising a recombinant vector according to the invention.
  • the introduction of the recombinant vector in a host cell can be carried out according to methods that are well known to a person skilled in the art such as those described in BASIC METHODS IN MOLECULAR BIOLOGY, Davis et al, 2nd ed., McGraw-Hill Professional Publishing, 1995, and MOLECULAR CLONING: A LABORATORY MANUAL, supra, such as transfection by calcium phosphate, transfection by DEAE dextran, transfection, microinjection, transfection by cationic lipids, electroporation, transduction or infection.
  • the host cell can be, for example, bacterial cells such as cells of streptococci, staphylococci, E. coli or Bacillus subtilis, cells of fungi such as yeast cells and cells of
  • Aspergillus Streptomyces, insect cells such as cells of Drosophila S2 and of Spodoptera Sf9, animal cells, such as CHO, COS, HeLa, C127, BHK, HEK 293 cells and human cells of the subject to treat or even plant cells.
  • the host cells can be used, for example, to express a polypeptide of the invention or as active product in pharmaceutical compositions, as will be seen hereinafter.
  • the present invention also has for its object an isolated polypeptide comprising an amino acid sequence having at least 80 % identity, preferably at least 90 % identity, more preferably at least 95 % identity and still more preferably at least 99 % identity with all or part of: a) the amino acid sequence SEQ ID NO. 2; or b) the amino acid sequence comprising the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2; it being understood that each of the amino acid sequences under a) and b) contains at least one of the following coding SNPs: Q28R, Q70E, C122S.
  • the polypeptide of the invention can equally comprise all or part of: a) the amino acid sequence SEQ ID NO. 2; or b) the amino acid sequence containing the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2; it being understood that each of the amino acid sequences under a) and b) contains at least one of the following coding SNPs: Q28R, Q70E, C122S.
  • the polypeptide of the invention can more particularly consist of all or part of: a) the amino acid sequence SEQ ID NO. 2; or b) the amino acid sequence containing the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2; it being understood that each one of the amino acid sequences under a) and b) contains at least one of the following coding SNPs: Q28R, Q70E, C122S.
  • a polypeptide according to the invention contains a single coding SNP selected from the group consisting of: Q28R, Q70E, and C122S. More preferably, the polypeptide according to the invention comprises amino acids 24 through 189 of the amino acid sequence SEQ ID NO. 2, and has the coding SNP C122S.
  • the present invention equally has for its object a process for the preparation of the above-described polypeptide, in which a previously defined host cell is cultivated in a culture medium and said polypeptide is isolated from the culture medium.
  • the polypeptide can be purified starting from the host cells' culture medium, according to methods well known to a person skilled in the art such as precipitation with the help of chaotropic agents such as salts, in particular ammonium sulfate, ethanol, acetone or trichloroacetic acid, acid extraction; ion exchange chromatography; phosphocellulose chromatography; hydrophobic interaction chromatography; affinity chromatography;
  • chaotropic agents such as salts, in particular ammonium sulfate, ethanol, acetone or trichloroacetic acid, acid extraction; ion exchange chromatography; phosphocellulose chromatography; hydrophobic interaction chromatography; affinity chromatography;
  • Culture medium is understood as the medium in which the polypeptide of the invention is isolated or purified. This medium can be composed of the extracellular medium and/or the cellular lysate. Techniques well known to a person skilled in the art equally permit the latter to give back an active conformation to the polypeptide, if the conformation of said polypeptide was altered during the isolation or the purification.
  • the present invention also has for its object a process for obtaining an immunospecific antibody.
  • Antibody is understood as the monoclonal, polyclonal, chimeric, simple chain, humanized antibodies as well as the Fab fragments, including Fab or immunoglobulin expression library products.
  • An immunospecific antibody can be obtained by immunization of an animal with a polypeptide according to the invention.
  • the invention also relates to an immunospecific antibody for a polypeptide according to the invention, such as defined previously.
  • a polypeptide according to the invention one of its fragments, an analog, one of its variants or a cell expressing this polypeptide can also be used to produce immunospecific antibodies.
  • immunospecific means that the antibody possesses a better affinity for the polypeptide of the invention than for other polypeptides known in the prior art.
  • the immunospecific antibodies can be obtained by administration of a polypeptide of the invention, of one of its fragments, of an analog or of an epitopic fragment or of a cell expressing this polynucleotide in a mammal, preferably non human, according to methods well known to a person skilled in the art.
  • the present invention equally has for its object a process for the identification of an agent activating or inhibiting a polypeptide according to the invention, comprising: a) the preparation of a recombinant vector comprising a polynucleotide according to the invention containing at least one coding SNP; b) the preparation of host cells comprising a recombinant vector according to a); c) the contacting of host cells according to b) with an agent to be tested; and d) the determination of the activating or inhibiting effect generated by the agent to test.
  • a polypeptide according to the invention can also be employed for a process for screening compounds that interact with it.
  • These compounds can be activating (agonists) or inhibiting (antagonists) agents of intrinsic activity of a polypeptide according to the invention.
  • These compounds can equally be ligands or substrates of a polypeptide of the invention. See Coligan et al, Current Protocols in Immunology 1 (2), Chapter 5 (1991).
  • Such cells can be, for example, cells of mammals, yeasts, insects such as Drosophila or bacteria such as E. coli.
  • the binding capacity of the compounds to be tested with the polypeptide of the invention can then be observed, as well as the inhibition or the activation of the functional response.
  • Step d) of the above process can be implemented by using an agent to be tested that is directly or indirectly labeled. It can also include a competition test, by using a labeled or non- labeled agent and a labeled competitor agent.
  • an agent to be tested generates an activation or inhibition signal on cells expressing the polypeptide of the invention by using detection means appropriately chosen according to the signal to be detected.
  • activating or inhibiting agents can be polynucleotides, and in certain cases oligonucleotides or polypeptides, such as proteins or antibodies, for example.
  • the present invention also has for its object a process for the identification of an agent activated or inhibited by a polypeptide according to the invention, comprising: a) the preparation of a recombinant vector comprising a polynucleotide according to the invention containing at least one coding SNP; b) the preparation of host cells comprising a recombinant vector according to a); c) placing host cells according to b) in the presence of an agent to be tested; and d) the determination of the activating or inhibiting effect generated by the polypeptide on the agent to be tested.
  • An agent activated or inhibited by the polypeptide of the invention is an agent that responds, respectively, by an activation or an inhibition in the presence of this polypeptide.
  • the agents, activated or inhibited directly or indirectly by the polypeptide of the invention can consist of polypeptides such as, for example, membranal or nuclear receptors, kinases and more preferably tyrosine kinases, transcription factor or polynucleotides. Detection of diseases.
  • the present invention also has for object a process for analyzing the biological characteristics of a polynucleotide according to the invention and/or of a polypeptide according to the invention in a subject, comprising at least one of the following: a) Determining the presence or the absence of a polynucleotide according to the invention in the genome of a subject; b) Determining the level of expression of a polynucleotide according to the invention in a subject; c) Determining the presence or the absence of a polypeptide according to the invention in a subject; d) Determining the concentration of a polypeptide according to the invention in a subject; and/or e) Determining the functionality of a polypeptide according to the invention in a subject.
  • These biological characteristics may be analyzed in a subject or in a sample from a subject.
  • These biological characteristics may permit to carry out a genetic diagnosis and to determine whether a subject is affected or at risk of being affected or, to the contrary, presents a partial resistance to the development of a disease, an indisposition or a disorder linked to the presence of a polynucleotide according to the invention and/or a polypeptide according to the invention.
  • cancers and tumors can be disorders and/or human diseases, such as cancers and tumors, infectious diseases, venereal diseases, immunologicalfy related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • Said cancers and tumors include carcinomas comprising metastasizing renal carcinomas, melanomas, lymphomas comprising follicular lymphomas and cutaneous T cell lymphoma, leukemias comprising hairy-cell leukemia, chronic lymphocytic leukemia and chronic myeloid leukemia, cancers of the liver, neck, head and kidneys, multiple myelomas, carcinoid tumors and tumors that appear following an immune deficiency comprising Kaposi's sarcoma in the case of AIDS.
  • Said infectious diseases include viral infections comprising chronic hepatitis B and C and HIV/ AIDS, infectious pneumonias, and venereal diseases, such as genital warts.
  • Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis.
  • Said metabolic diseases may include such non-immune associated diseases as obesity.
  • Said diseases of the central nervous system may include Alzheimer's disease, Parkinson's disease, schizophrenia and depression.
  • Said diseases and disorders may also include healing of wounds, anemia in dialyzed patient, and osteoporosis.
  • This process also permits genetic diagnosis of a disease or of a resistance to a disease linked to the presence, in a subject, of the mutant allele encoded by a SNP according to the invention.
  • step a) the presence or absence of a polynucleotide, containing at least one coding SNP such as previously defined, is going to be detected.
  • the detection of the polynucleotide may be carried out starting from biological samples from the subject to be studied, such as cells, blood, urine, saliva, or starting from a biopsy or an autopsy of the subject to be studied.
  • the genomic DNA may be used for the detection directly or after a PCR amplification, for example.
  • RNA or cDNA can equally be used in a similar fashion.
  • nucleotide sequence of a polynucleotide according to the invention is then possible to compare the nucleotide sequence of a polynucleotide according to the invention with the nucleotide sequence detected in the genome of the subject.
  • the comparison of the nucleotide sequences can be carried out by sequencing, by DNA hybridization methods, by mobility difference of the DNA fragments on an electrophoresis gel with or without denaturing agents or by melting temperature difference. See Myers et al., Science (1985) 230: 1242. Such modifications in the structure of the nucleotide sequence at a precise point can equally be revealed by nuclease protection tests, such as RNase and the SI nuclease or also by chemical cleaving agents. See Cotton et al., Proc. Nat. Acad. Sci. USA (1985) 85: 4397-4401. Oligonucleotide probes comprising a polynucleotide fragment of the invention can equally be used to conduct the screening.
  • the level of expression of the polynucleotide may be measured by quantifying the level of RNA encoded by this polynucleotide (and coding for a polypeptide) according to methods well known to a person skilled in the art as, for example, by PCR, RT- PCR, RNase protection, Northern blot, and other hybridization methods.
  • step c) and d) the presence or the absence as well as the concentration of a polypeptide according to the invention in a subject or a sample from a subject may be carried out by well known methods such as, for example, by radioimmunoassay, competitive binding tests, Western blot and ELISA tests. Consecutively to step d), the determined concentration of the polypeptide according to the invention can be compared with the natural wild-type protein concentration usually found in a subject.
  • step e) the determination of the functionality of a polypeptide according to the invention may be carried out by methods well known to a person skilled in the art as, for example, by in vitro tests such as above mentioned or by an use of host cells expressing said polypeptide.
  • the present invention also has for its object a therapeutic compound containing, by way of active agent, a polypeptide according to the invention.
  • the invention also relates to the use of a polypeptide according to the invention, for the manufacture of a therapeutic compound intended for the prevention or the treatment of different human disorders and/or diseases.
  • diseases can be disorders and or human diseases, such as cancers and tumors, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • Said cancers and tumors include carcinomas comprising metastasizing renal carcinomas, melanomas, lymphomas comprising follicular lymphomas and cutaneous T cell lymphoma, leukemias comprising hairy-cell leukemia, chronic lymphocytic leukemia and chronic myeloid leukemia, cancers of the liver, neck, head and kidneys, multiple myelomas, carcinoid tumors and tumors that appear following an immune deficiency comprising Kaposi's sarcoma in the case of AIDS.
  • Said infectious diseases include viral infections comprising chronic hepatitis B and C and HIV/ AIDS, infectious pneumonias, and venereal diseases, such as genital warts.
  • Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis.
  • Said metabolic diseases may include such non-immune associated diseases as obesity.
  • Said diseases of the central nervous system may include Alzheimer's disease,
  • Parkinson's disease schizophrenia and depression.
  • Said diseases and disorders may also include healing of wounds, anemia in dialyzed patient, and osteoporosis.
  • a polypeptide according to the invention can also be used for the manufacture of a therapeutic compound intended for the prevention or the treatment of different human disorders and/or diseases, such as certain viral infections such as chronic hepatitis B and C, leukemias such as hairy-cell leukemia and chronic myeloid leukemia, multiple myelomas, follicular lymphomas, carcinoid tumors, malignant melanomas, metastasizing renal carcinomas, Alzheimer's disease, Parkinson's disease, as well as tumors that appear following an immune deficiency, such as Kaposi's sarcoma in the case of AIDS, and genital warts or venereal diseases.
  • certain viral infections such as chronic hepatitis B and C
  • leukemias such as hairy-cell leukemia and chronic myeloid leukemia, multiple myelomas, follicular lymphomas, carcinoid tumors, malignant melanomas, metastasizing renal carcinomas
  • Alzheimer's disease Parkinson's disease
  • Certain of the compounds permitting to obtain the polypeptide according to the invention as well as the compounds obtained or identified by or from this polypeptide can likewise be used for the therapeutic treatment of the human body, i.e. as a therapeutic compound.
  • the present invention also has for an object a medicament containing, by way of active agent, a polynucleotide according to the invention containing at least one previously defined coding SNP, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody.
  • the invention also relates to the use of a polynucleotide according to the invention containing at least one previously defined coding SNP, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody for the manufacture of a medicament intended for the prevention or the treatment of different human disorders and/or diseases.
  • diseases can be disorders and/or human diseases, such as cancers and tumors, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • Said cancers and tumors include carcinomas comprising metastasizing renal carcinomas, melanomas, lymphomas comprising follicular lymphomas and cutaneous T cell lymphoma, leukemias comprising hairy-cell leukemia, chronic lymphocytic leukemia and chronic myeloid leukemia, cancers of the liver, neck, head and kidneys, multiple myelomas, carcinoid tumors and tumors that appear following an immune deficiency comprising Kaposi' s sarcoma in the case of AIDS .
  • Said infectious diseases include viral infections comprising chronic hepatitis B and C and HIV/ AIDS, infectious pneumonias, and venereal diseases, such as genital warts.
  • Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis.
  • Said metabolic diseases may include such non-immune associated diseases as obesity.
  • Said diseases of the central nervous system may include Alzheimer's disease, Parkinson's disease, schizophrenia and depression.
  • Said diseases and disorders may also include healing of wounds, anemia in dialyzed patient, and osteoporosis.
  • the invention concerns the use of a polynucleotide according to the invention containing at least one previously defined SNP, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody, for the manufacture of a medicament intended for the prevention or the treatment of different human disorders and/or diseases, such as certain viral infections such as chronic hepatitis B and C, leukemias such as hairy-cell leukemia and chronic myeloid leukemia, multiple myelomas, follicular lymphomas, carcinoid tumors, malignant melanomas, metastasizing renal carcinomas, Alzheimer's disease, Parkinson's disease, as well as tumors that appear following an immune deficiency, such as Kaposi's sarcoma in the case of AIDS, and genital warts or venereal diseases.
  • diseases such as certain viral infections such as chronic hepatitis B and C, leukemias such as hairy-cell leukemia and chronic myeloid leukemia, multiple my
  • a polypeptide and of the other compounds of the invention useful as active agent, depends on the choice of the compound, the therapeutic indication, the mode of administration, the nature of the formulation, the nature of the subject and the judgment of the doctor.
  • a polypeptide according to the invention is generally administered at doses ranging between 1 and 100 ⁇ g/kg of the subject.
  • the invention also has as an object a pharmaceutical composition that contains, as active agent, at least one above-mentioned compound such as a polypeptide according to the invention, a polynucleotide according to the invention containing at least one previously defined SNP, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody, as well as a pharmaceutically acceptable excipient.
  • a pharmaceutical composition that contains, as active agent, at least one above-mentioned compound such as a polypeptide according to the invention, a polynucleotide according to the invention containing at least one previously defined SNP, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody, as well as a pharmaceutically acceptable excipient.
  • the active agent is advantageously present at physiologically effective doses.
  • compositions can be, for example, solids or liquids and be present in pharmaceutical forms currently used in human medicine such as, for example, simple or coated tablets, gel caps, granules, caramels, suppositories and preferably injectable preparations and powders for injectables.
  • pharmaceutical forms can be prepared according to usual methods.
  • the active agent(s) can be incorporated into excipients usually employed in pharmaceutical compositions such as talc, Arabic gum, lactose, starch, dextrose, glycerol, ethanol, magnesium stearate, cocoa butter, aqueous or non-aqueous vehicles, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives.
  • excipients usually employed in pharmaceutical compositions such as talc, Arabic gum, lactose, starch, dextrose, glycerol, ethanol, magnesium stearate, cocoa butter, aqueous or non-aqueous vehicles, fatty substances of animal or vegetable origin, paraffinic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives.
  • the active agent(s) according to the invention can be employed alone or in combination with other compounds such as therapeutic compounds such as other cytokines such as interleukins or interferons, for example.
  • the different formulations of the pharmaceutical compositions are adapted according to the mode of administration.
  • compositions can be administered by different routes of administration known to a person skilled in the art.
  • the invention equally has for an object a diagnostic composition that contains, as active agent, at least one above-mentioned compound such as a polypeptide according to the invention, all or part of a polynucleotide according to the invention, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody, as well as a suitable pharmaceutically acceptable excipient.
  • a diagnostic composition that contains, as active agent, at least one above-mentioned compound such as a polypeptide according to the invention, all or part of a polynucleotide according to the invention, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody, as well as a suitable pharmaceutically acceptable excipient.
  • This diagnostic composition may contain, for example, an appropriate excipient like those generally used in the diagnostic composition such as buffers and preservatives.
  • the present invention equally has as an object the use: a) of a therapeutically effective quantity of a polypeptide according to the invention; and/or b) of a polynucleotide according to the invention; and/or c) of a host cell from the subject to be treated, previously defined; to prepare a therapeutic compound intended to increase the expression or the activity, in a subject, of a polypeptide according to the invention.
  • this polynucleotide can be inserted in a retroviral expression vector.
  • a retroviral expression vector can be isolated starting from cells having been infected by a retroviral plasmid vector containing RNA encoding for the polypeptide of the invention, in such a fashion that the transduced cells produce infectious viral particles containing the gene of interest. See Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, Chapter 20, in Human Molecular Genetics, Strachan and Read, BIOS Scientifics Publishers Ltd (1996).
  • a polynucleotide containing at least one coding SNP such as previously defined will be preferably used.
  • the present invention equally relates to the use: a) of a therapeutically effective quantity of a previously defined immunospecific antibody; and/or b) of a polynucleotide permitting inhibition of the expression of a polynucleotide according to the invention; in order to prepare a therapeutic compound intended to reduce the expression or the activity, in a subject, of a polypeptide according to the invention.
  • a therapeutically effective quantity of an inhibiting agent and/or of an antibody such as previously defined possibly in combination, with a pharmaceutically acceptable excipient.
  • a pharmaceutically acceptable excipient it is equally possible to reduce the endogenous production of a polypeptide of the invention by administration to the subject of a complementary polynucleotide according to the invention permitting inhibition of the expression of a polynucleotide of the invention.
  • a complementary polynucleotide containing at least one coding SNP such as previously defined can be used.
  • the present invention concerns also the use of a IFN ⁇ -5 protein for the preparation of a medicament for the prevention or the treatment of a patient having a disorder or a disease caused by a IFN ⁇ -5 variant linked to the presence in the genome of said patient of a nucleotide sequence having at least 95% identity (preferably, 97% identity, more preferably
  • said medicament is used for the prevention or the treatment of one of the diseases selected from the group consisting of cancers and tumors, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • Said cancers and tumors include carcinomas comprising metastasizing renal carcinomas, melanomas, lymphomas comprising follicular lymphomas and cutaneous T cell lymphoma, leukemias comprising hairy-cell leukemia, chronic lymphocytic leukemia and chronic myeloid leukemia, cancers of the liver, neck, head and kidneys, multiple myelomas, carcinoid tumors and tumors that appear following an immune deficiency comprising Kaposi's sarcoma in the case of AIDS.
  • Said infectious diseases include viral infections comprising chronic hepatitis B and C and HIV/AIDS, infectious pneumonias, and venereal diseases, such as genital warts.
  • Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis.
  • Said metabolic diseases may include such non-immune associated diseases as obesity.
  • Said diseases of the central nervous system may include Alzheimer's disease, Parkinson's disease, schizophrenia and depression.
  • Said diseases and disorders may also include healing of wounds, anemia in dialyzed patient, and osteoporosis.
  • Mimetic compounds of an IFN ⁇ -5 polypeptide comprismg the SNP C122S of the invention also concerns a new compound having a biological activity substantially similar to that of the polypeptide of: a) amino acid sequence SEQ ID NO. 2; or b) amino acid sequence comprising the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2; provided that said amino acid sequences under a) and b) comprise the SNP C122S.
  • Said biological activity may be evaluated, for example, by measuring signal transduction, dendritic cell maturation, cytokine release by CD4+ or CD8+ T-lymphocytes, cytokine release by monocytes, in vitro or in vivo antiviral activity, anti-tumoral activity in mice previously inoculated with malignant Friend erythroleukemia cells, cellular antiproliferative activity on Daudi Burkitt's cell line, cellular antiproliferative activity on TF- 1 cell line as described in the experimental section.
  • the C122S mutated IFN ⁇ -5 in comparison to wild-type IFN ⁇ -2, the C122S mutated IFN ⁇ -5 possesses: a higher capacity to stimulate IFN-gamma release by CD4+ or CD8+ T-lymphocytes - a higher capacity to stimulate IL-10 and TNF- ⁇ release by monocytes a lower antiviral activity in vitro in cell culture infected with VSV a higher anti-tumoral activity in mice previously inoculated with malignant Friend erythroleukemia cells a similar antiviral activity in vivo in EMCV mouse model
  • C122S mutated IFN ⁇ -5 possesses a high capacity to stimulate dendritic cell maturation, this activity being higher with C122S mutated IFN ⁇ -5 compared to wild-type IFN ⁇ -2 and to wild-type IFN ⁇ -5.
  • the C122S mutated IFN ⁇ -5 in comparison to wild-type IFN ⁇ -5, possesses: - a lower capacity to activate signal transduction in the MCF-7 breast carcinoma cell line a lower antiproliferative activity on Daudi Burkitt's cell line a lower antiviral activity in vitro in cell culture infected with VSV.
  • a new compound of the invention such as previously defined, may possess a biological activity substantially similar to that of the C122S mutated IFN ⁇ -5.
  • Said compound may also have a biological activity such as IFN-gamma release by T- lymphocytes, IL-10 and TNF- ⁇ release by monocytes, anti-tumoral activity in mice previously inoculated with malignant Friend erythroleukemia cells, and/or dendritic cell maturation, which is even higher than that of the C122S mutated IFN ⁇ -5.
  • a biological activity such as IFN-gamma release by T- lymphocytes, IL-10 and TNF- ⁇ release by monocytes, anti-tumoral activity in mice previously inoculated with malignant Friend erythroleukemia cells, and/or dendritic cell maturation, which is even higher than that of the C122S mutated IFN ⁇ -5.
  • Said compound may also have a biological activity such as antiviral activity in vitro in cell culture infected with VSV, and/or antiproliferative activity on Daudi Burkitt's cell line, which is even lower than that of the C122S mutated IFN ⁇ -5.
  • Said compound may be a biochemical compound, such as a polypeptide or a peptide for example, or an organic chemical compound, such as a synthetic peptide-mimetic for example.
  • the present invention also concerns the use of a polypeptide of the invention containing the C122S SNP, for the identification of a compound such as defined above.
  • the present invention also concerns a process for the identification of a compound of the invention, comprising the following steps: a) Determining the biological activity of the compound to be tested, such as signal, transduction, dendritic cell maturation, cytokine release by CD4+ or CD 8+ T- lymphocytes, cytokine release by monocytes, in vitro or in vivo antiviral activity, anti- tumoral activity in mice previously inoculated with malignant Friend erythroleukemia cells, cellular antiproliferative activity on Daudi Burkitt's cell line, for example; b) Comparing: i) the activity determined in step a) of the compound to be tested, with ii) the activity of the polypeptide of amino acid sequence SEQ ID NO.
  • step b) Determining on the basis of the comparison carried out in step b) whether the compound to be tested has a substantially similar, or lower or higher, activity compared to that of the polypeptide of amino acid sequence SEQ ID NO. 2, or of amino acid sequence comprising the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2; provided that said amino acid sequences comprise the C122S SNP.
  • the compound to be tested may be previously identified from synthetic peptide combinatorial libraries, high-throughput screening, or designed by computer-aided drug design so as to have the same three-dimensional structure as that of the polypeptide of amino acid sequence SEQ ID NO. 2, or of amino acid sequence comprising the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2; provided that said amino acid sequences comprise the C122S SNP.
  • the compounds of the invention may be used for the preparation of a medicament intended for the prevention or the treatment of one of the diseases selected from the group consisting of cancers and tumors, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • Said cancers and tumors include carcinomas comprising metastasizing renal carcinomas, melanomas, lymphomas comprising follicular lymphomas and cutaneous T cell lymphoma, leukemias comprising hairy-cell leukemia, chronic lymphocytic leukemia and chronic myeloid leukemia, cancers of the liver, neck, head and kidneys, multiple myelomas, carcinoid tumors and tumors that appear . following an immune deficiency comprising Kaposi's sarcoma in the case of AIDS.
  • Said infectious diseases include viral infections comprising chronic hepatitis B and C and HIV/AIDS, infectious pneumonias, and venereal diseases, such as genital warts.
  • Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis.
  • Said metabolic diseases may include such non-immune associated diseases as obesity.
  • Said diseases of the central nervous system may include Alzheimer's disease, Parkinson's disease, schizophrenia and depression.
  • Said diseases and disorders may also include healing of wounds, anemia in dialyzed patient, and osteoporosis.
  • the compounds of the invention may be used for the preparation of a medicament intended for the prevention or the treatment of one of the diseases selected from the group consisting of certain viral infections such as chronic hepatitis B and C, leukemias such as hairy-cell leukemia and chronic myeloid leukemia, multiple myelomas, follicular lymphomas, carcinoid tumors, malignant melanomas, metastasizing renal carcinomas, Alzheimer's disease, Parkinson's disease, as well as tumors that appear following an immune deficiency, such as Kaposi's sarcoma in the case of AIDS, and genital warts or venereal diseases.
  • certain viral infections such as chronic hepatitis B and C
  • leukemias such as hairy-cell leukemia and chronic myeloid leukemia, multiple myelomas, follicular lymphomas, carcinoid tumors, malignant melanomas, metastasizing renal carcinomas
  • Alzheimer's disease Parkinson's disease
  • Example 1 Modeling of a protein encoded by a polynucleotide of nucleotide sequence containing SNP c641g, or g798c and of the protein encoded by the nucleotide sequence of the wild-type reference gene
  • IFN ⁇ -5 In a first step the three-dimensional structure of IFN ⁇ -5 was constructed starting from that of IFN ⁇ -2 whose structure is available in the PDB database (code 1ITF) and by using the software Modeler (MSI, San Diego, CA). The mature polypeptide fragment was then modified in such a fashion as to reproduce the mutation Q47E, and C99S.
  • Example 2 Genotyping of the SNPs a516g, c641g, or g798c in a population of individuals
  • the genotyping of SNPs is based on the principle of the minisequencing wherein the product is detected by a reading of polarized fluorescence.
  • the technique consists of a fluorescent minisequencing (FP-TDI Technology or Fluorescence Polarization Template- direct Dye-terminator Incorporation).
  • the minisequencing is performed on a product amplified by PCR from genomic DNA of each individual of the population.
  • This PCR product is chosen in such a manner that it covers the genie region containing the SNP to be genotyped. After elimination of the PCR primers that have not been used and the dNTPs that have not been incorporated, the minisequencing is carried out.
  • the minisequencing consists of lengthening an oligonucleotide primer, placed just upstream of the site of the SNP, by using a polymerase enzyme and fluorolabeled dideoxynucleotides.
  • the product resulting from this lengthening process is directly analyzed by a reading of polarized fluorescence.
  • genotyping requires 5 steps: 1) Amplification by PCR 2) Purification of the PCR product by enzymatic digestion
  • the genotyping steps 1 and 2 are carried out in the same conditions for each of the SNPs a516g, c641g, g798c.
  • the steps 3, 4 and 5 are specific to each one of these polymorphisms.
  • the PCR amplification of the nucleotide sequence of the IFN ⁇ -5 gene is carried out starting from genomic DNA coming from 268 individuals of ethnically diverse origins. These genomic DNAs were provided by the Coriell Institute in the United States. The 268 individuals are distributed as follows:
  • the genomic DNA coming from each one of these individuals constitutes a sample.
  • the PCR amplification is carried out starting from the following primers:
  • SEQ ID NO. 3 Sense primer: GGTCACTCAATCTCAACAGC
  • SEQ ID NO. 4 Antisense primer: GGCAGAACTCAAGAAGTGTG
  • nucleotide sequences permit amplification of a fragment of a length of 681 nucleotides, from nucleotide 390 to nucleotide 1070 in the nucleotide sequence SEQ ID NO. 1.
  • the PCR product will serve as a template for the minisequencing
  • the total reaction volume of the PCR reaction is 5 ⁇ l per sample.
  • ABGene (ref: TF-0384-k).
  • the plate is sealed, centrifuged, then placed in a thermocycler for 384-well plates (Tetrad of MJ Research) and undergoes the following incubation: PCR
  • Cycles 1 min at 94° C, followed by 36 cycles composed of 3 steps (15 sec. at 94° C, 30 sec. at 56° C, 1 min at 68° C).
  • SAP Phosphatase
  • Exo I exonuclease I
  • This digestion is done by addition, in each well of the PCR plate, of a reaction mixture of 5 ⁇ l per sample.
  • This reaction mixture is composed of the following reagents:
  • the plate is sealed, centrifuged, then placed in a thermocycler for 384 well plates (Tetrad of MJ Research) and undergoes the following incubation: Digestion SAP- EXO: 45 min at 37° C, 15 min at 80° C.
  • Digestion SAP- EXO 45 min at 37° C, 15 min at 80° C.
  • the elongation or minisequencing step is then carried out on the product of PCR digested by addition of a reaction mixture of 5 ⁇ l per prepared sample.
  • the minisequencing 3) and the reading steps 4) and inte ⁇ retation of reading 5) are specific to each SNP a516g, c641g, and g798c.
  • the minisequencing of the SNPs was first validated over 16 samples, then genotyped over the set of the population of individuals composed of 268 individuals and 10 controls. The elongation or minisequencing step is then carried out as indicated in the following table:
  • the 5X elongation buffer is composed of 250 mM Tris-HCl pH 9, 250 mM KC1, 25 mM NaCl, 10 mM MgCl 2 and 40 % glycerol.
  • ddNTPs For the ddNTPs, a mixture of the 4 bases is carried out according to the polymorphism studied. Only the 2 bases of interest (wild-type nucleotide/mutated nucleotide) composing the functional SNP are labeled, either in Tamra, or in Rl 10.
  • the plate is sealed, centrifuged, then placed in a thermocycler for 384- well plates (Tetrad of MJ Research) and undergoes the following incubation: Elongation cycles: 1 min. at 93° C, followed by 35 cycles composed of 2 steps (10 sec. at 93° C, 30 sec. at 55° C).
  • the plate is directly placed on a polarized fluorescence reader of type Analyst® HT of LJL Biosystems Inc.
  • the plate is read using Criterion Host® software by using two methods. The first permits reading the Tamra labeled base by using emission and excitation filters specific for this fluorophore (excitation 550-10 nm, emission 580-10 nm) and the second permits reading the Rl 10 labeled base by using the excitation and emission filters specific for this fluorophore (excitation 490-10 nm, emission 520-10 nm).
  • a dichroic double mirror (RUO/Tamra) is used and the other reading parameters are: Z-height: 1.5 mm Attenuator: out Integration time: 100,000 ⁇ sec.
  • Raw data units counts/sec Switch polarization: by well Plate settling time: 0 msec PMT setup: Smart Read (+), sensitivity 2 Dynamic polarizer: emission
  • Static polarizer S A file result is thus obtained containing the calculated values of mP (miUiPolarization) for the Tamra filter and that for the Rl lO filter. These mP values are calculated starting from intensity values obtained on the parallel plane (//) and on the pe ⁇ endicular plane (_L) according to the following formula:
  • MP 1000(// - g ⁇ )/(// + g ⁇ ).
  • the value X is weighted by a factor g. It is a machine parameter that must be determined experimentally beforehand.
  • the mP value of the Tamra labeled base On the abscissa is indicated the mP value of the Tamra labeled base, on the ordinate is indicated the mP value of the Rl 10 labeled base.
  • a strong mP value indicates that the base labeled with this fluorophore is inco ⁇ orated and, conversely, a weak mP value reveals the absence of inco ⁇ oration of this base.
  • Allele Caller® software permits, once the identification of the different groups is carried out, to directly extract the genotype defined for each individual in table form.
  • the allele c read in antisense corresponds to the allele g read in sense, and is related to the presence of a cysteine
  • the genotype is in theory either homozygote AA, or heterozygote AG, or homozygote GG in the tested individuals. In reality, and as shown below, the homozygote genotype GG is not detected in the population of individuals.
  • the genotype is in theory either homozygote CC, or heterozygote CG, or homozygote GG in the tested individuals. In reality, and as shown below, the homozygote genotype GG is not detected in the population of individuals.
  • the genotype is in theory either homozygote GG, or heterozygote GC, or homozygote CC in the tested individuals. In reality, and as shown below, the homozygote genotype CC is not detected in the population of individuals.
  • N the number of individuals
  • % represents the percentage of individuals in the specific sub-population
  • allelic frequency represents the percentage of the mutated allele in the specific sub-population
  • 95 % IC represents the minimal and maximal interval of confidence at 95 %.
  • Example 3 Expression of natural wild-type IFN -5 and C122S mutated IFN ⁇ -5 in yeast a) Cloning of the natural wild-type IFN ⁇ -5 and C122S mutated IFN ⁇ -5 in the eukaryote expression vector pPicZ ⁇ -topo The nucleotide sequences coding for the mature part of the natural wild-type
  • IFN ⁇ -5 and C122S mutated IFN ⁇ -5 are amplified by PCR using as template genomic DNA from an individual who is heterozygote for the SNP.
  • the PCR primers permitting such an amplification are: SEQ ID NO. 11: Sense primer: TGTGATCTGCCTCAGACCCAC SEQ ID NO. 12: Antisense primer: TCATTCCTTCCTCCTTAATCTTTCTTG
  • the PCR products are inserted in the eukaryote expression vector pPicZ - TOPO under the control of the hybrid promoter AOX1 inducible by methanol (TOPOTM-c/onz ⁇ g; Invitrogen Co ⁇ .).
  • This vector permits the heterologous expression of eukaryote proteins in the yeast Pichiapastoris.
  • the vector After checking of the nucleotide sequence of the region of the vector coding for the recombinant proteins, the vector is linearized by the Pmel restriction enzyme, and the P. pastoris yeast strain (Invitrogen) is transformed with these recombinant expression vectors.
  • BMGY medium 2% Peptone, 1% yeast extract, 1.34% YNB, 1% Glycerol, 100 mM potassium phosphate, 0.4 mg/Liter biotin pH 6.0
  • a clone coding for natural wild-type IFN ⁇ -5 or that coding for C122S mutated IFN ⁇ -5 were carried out for 24-48 hours at 30°C at an agitation of 200 rotations per minute (rpm).
  • the culture When the culture reaches a saturating cellular density (corresponding to an optical density of 12 measured at a wavelength of 600 nm), it is used to inoculate, at 5 OD/mL, 250 mL of BMMY medium (2% Peptone, 1% yeast extract, 1.34% YNB, 0.5% Methanol, 100 mM potassium phosphate, 0.4 mg/Liter biotin pH 6.0).
  • BMMY medium 2% Peptone, 1% yeast extract, 1.34% YNB, 0.5% Methanol, 100 mM potassium phosphate, 0.4 mg/Liter biotin pH 6.0.
  • the expression of the protein is then induced by methanol at a final concentration of 1%, for 24 hours at 30 °C, with an agitation of the culture flask at 180 rpm.
  • the proteins Due to the presence of the signal peptide sequence of the "alpha factor", upstream of the coding sequence, the proteins are secreted by the yeasts in the culture medium.
  • the alpha factor is naturally cleaved during the processing.
  • the suspension is centrifuged and the protein is purified by HPLC starting from the obtained supernatant.
  • an ultrafiltration (Labscale, cut-off 5000Da, Millipore) followed by a dialysis permits a ten times concentration of the yeast supernatant in a buffer of 50 mM Tris-Cl pH 9.0, 25 mM NaCl.
  • the first chromatographic step permits protein recovery by affinity on a blue sepharose column (Amersham Pharmacia). The presence of the protein in the collected fractions is verified, on the one hand by electrophoresis of SDS PAGE type and on the other hand by immuno-detection by a specific antibody directed against the IFN ⁇ -5 protein. At this step, the purity of the protein of interest is higher than 75%.
  • a gel filtration permits buffer exchange of the collected fractions corresponding to IFN ⁇ -5 proteins against 50 mM Tris pH 9.0, 25 mM NaCl.
  • the last step of the purification consists of a separation of the proteins on an ion exchange chromatography column.
  • the fractions containing the recombinant protein are injected on an anion exchange column (ResourceQ 6.0 mL, Pharmacia) equilibrated beforehand in Tris 50 mM pH 9, NaCl 25 mM buffer.
  • the elution of the proteins is carried out by the migration of a gradient between 0,025 and 1 M NaCl in the Tris 50 mM pH 9 buffer.
  • the purity of the protein of interest is estimated on SDS/PAGE gel and the protein concentrations are measured by densitometry (Quantity one, Biorad) and BCA assay (bicinchoninic acid and copper sulfate, Sigma).
  • Example 4 Evaluation of the capacity of wild-type and C122S mutated IFN ⁇ -5 to activate signal transduction in the breast carcinoma cell line MCF-7
  • the interferons are known to act through signaling pathways involving the JAK (Janus Kinase) and the STAT (Signal Transducers and Activators of Transcription) proteins.
  • JAK Janus Kinase
  • STAT Signal Transducers and Activators of Transcription
  • the binding of interferon to its receptor induces phosphorylation of the JAK proteins which in turn activate by phosphorylation the STAT proteins.
  • Activated STAT proteins translocate to the nucleus where they bind to interferon response elements on gene promoters, which stimulates transcription of the respective genes.
  • the reporter gene technique was used. The procedure is described below.
  • the breast carcinoma cells MCF-7 (ECACC) were seeded at a density of 1.10 4 cells/well in 96-well plates in RPMI supplemented with 10% fetal calf serum for 24 hours. Cells were then transfected for 6 hours with a reporter gene construct (pISRE- Luc) coding for the Firefly Luciferase placed under the control of the Interferon- Stimulated Response Element (Clontech) using Superfect (Qiagen) according to the manufacturer's instructions. Then, culture media were changed and cells were incubated over-night in a CO 2 incubator at 37°C after which they were stimulated with various doses of wild-type or mutated IFN ⁇ -5 proteins for 6 hours at 37°C.
  • pISRE- Luc reporter gene construct
  • pISRE- Luc coding for the Firefly Luciferase placed under the control of the Interferon- Stimulated Response Element (Clontech) using Superfect (Qiagen) according to the manufacturer
  • Results are expressed as the percentage of maximal stimulation of the Luciferase activity.
  • the ability of the wild-type IFN ⁇ -5 or C122S mutated IFN -5 to trigger the signal transduction cascades is based on the measurements of their Efficacy Doses at 50% (EC50's) corresponding to their respective concentrations stimulating 50% of the
  • the average EC50 value measured for the wild-type IFN ⁇ -5 is 5.67 pM.
  • the average EC50 value measured for the C122S mutated IFN -5 is 93.27 pM.
  • the ratio corresponding to the EC50 value for the mutated protein over the EC50 value for the wild-type protein reaches 18.32 (with a standard deviation of 7.63).
  • IFNs type I IFN alpha and IFN beta
  • DC dendritic cells
  • HLA- ABC MHC class I
  • HLA-DR HLA-DR
  • dendritic cells were first generated from adult peripheral blood monocytes cultivated in the presence of GM-CSF and IL-4 cytokines. After purification using a CD 14+ cells purification kit, these dendritic cells were placed in presence of 100 ng/mL of C122S mutated IFN ⁇ -5, wild-type IFN ⁇ -2, or wild-type IFN ⁇ -5, and their phenotype was determined by FACS analysis aiming at looking for the expression of the MHC class I and II molecules and the CD40, CD80, CD86, CD83 and CD la markers. The maturation state of these dendritic cells has also been compared to that obtained without IFN ⁇ treatment, to provide a control with non-stimulated dendritic cells.
  • C122S mutated IFN ⁇ -5 protein possesses a high capacity to stimulate dendritic cell maturation.
  • stimulation of dendritic cell maturation by C122S mutated IFN ⁇ -5 is higher than that of wild-type IFN ⁇ -5 or wild-type IFN ⁇ -2.
  • peripheral blood mononuclear cells were isolated from healthy donors and stimulated for 16 hours in an appropriate medium containing anti-CD3 and anti-CD28 antibodies or SEB. In each culture was added 4 ⁇ g/mL of C122S mutated IFN ⁇ -5 or wild-type IFN ⁇ -2. After stimulation, T lymphocytes were extracellularly labelled with anti-CD3, anti-CD4 and anti-CD69 antibodies or anti-CD3, anti-CD8 and anti-CD69 antibodies, and intracellularly labelled with specific antibodies directed against Thl-type cytokines (IFN-gamma) or Th2-type cytokines (IL-10). Fluorescent cells were analysed using FACScalibur and CellQuest software.
  • IFN-gamma Thl-type cytokines
  • IL-10 Th2-type cytokines
  • C122S mutated IFN ⁇ -5 and wild-type IFN ⁇ -2 do not stimulate IL-10 and IFN-gamma release and, thus, do not activate T lymphocytes in absence of SEB.
  • C122S mutated IFN ⁇ -5 and wild-type IFN ⁇ -2 proteins stimulate cytokines (IL-10 and IFN-gamma) release by SEB-activated T-lymphocytes as shown in the table below.
  • This table represents the cytokine release by T- lymphocytes in presence of SEB, expressed as percentage of the CD4+ CD69+ cells or CD8+ CD69+ cells for the CD4+ T-lymphocytes and CD8+ T-lymphocytes, respectively, and the percentage of CD69+ cells on total cells.
  • IFN ⁇ - 5 than in presence of wild-type IFN ⁇ -2.
  • PBMC peripheral blood mononuclear cells
  • cytokines IL-10, IL-12 and
  • TNF- ⁇ TNF- ⁇
  • C122S mutated IFN ⁇ -5 protein or wild-type IFN ⁇ -2 as shown in the table below.
  • This table represents cytokine release by monocytes in presence of LPS, expressed as percentage of the CD64+ CD4dim cells, and the percentage of CD4dim CD64+ cells on total cells.
  • C122S mutated IFN ⁇ -5 protein is able to stimulate cytokine release by monocytes.
  • stimulation of IL-10 and TNF- ⁇ release by monocytes is higher in presence of C122S mutated IFN ⁇ -5 than in presence of wild-type IFN ⁇ -2.
  • Example 6 Evaluation of in vitro antiproliferative activity of C122S mutated IFN ⁇ -5 a) on the human lymphoblasts of Daudi Burkitt's cell line
  • IFN ⁇ -5 human Daudi Burkitt's lymphoma cell line, hereinafter called "Daudi cells”
  • 1640 medium (supplemented with 10% fetal calf serum and 2 mM of L-Glutamine) are inoculated in 96-well plates at the cellular density of 4.10 4 cells/ well.
  • Daudi cells are placed in contact of increasing concentrations of either natural wild-type or mutated IFN ⁇ -5, ranging from 0.003 pM to 600 nM.
  • the Daudi cells are then incubated for 66 h at 37 °C under 5% CO 2 after which the Uptiblue reagent (Uptima) is added to the cultures.
  • the rate of cell proliferation is quantified by measuring the fluorescence emitted at 590nm (excitation 560nm) after an additional period of incubation of 4 hours.
  • the antiproliferative activity of the C122S mutated IFN ⁇ -5 or wild-type IFN ⁇ -5 is based on the measurements of the IC50 corresponding to the concentration of IFN ⁇ -5 inhibiting 50% of the cell growth.
  • the average IC50 value measured for the C122S mutated IFN ⁇ -5 is 93.27 whereas the average IC50 value measured for the wild-type IFN ⁇ -5 is 5.67.
  • the average ratio corresponding to the value of the IC50 of the mutated protein over the value of the natural wild-type protein reaches 18.32 (standard deviation 7.63).
  • C122S mutated IFN ⁇ -5 was also evaluated on TF-1 erythroleukemia cell line. This test was also performed in presence of wild-type IFN ⁇ -2 used as control and chosen as representative of the Intron A commercial product.
  • TF-1 cells were placed in contact of increasing concentrations of C122S mutated IFN ⁇ -5 or wild-type IFN ⁇ -2 (0.001 to 1000 ng/mL) and the cell proliferation measured. This experiment was repeated three times, and the results of one representative experiment are presented in Figure 3.
  • C122S mutated IFN ⁇ -5 has a weak antiproliferative effect on TF-1 cells.
  • the antiproliferative effect of C122S mutated IFN ⁇ -5 is inferior to that of wild-type IFN ⁇ -2, suggesting that the C122S mutated IFN ⁇ -5's hematologic toxicity is not superior to that of wild-type IFN ⁇ -2.
  • the IFNs play an important role in the antiviral defence.
  • the IFN antiviral activity is partly due to IFNs induced enzymatic systems, such as: - The 2' 5' oligoadenylate synthetase, an enzyme which catalyzes the adenosine oligomere synthesis. These oligomeres activate the RNase L, an endoribonuclease which destroy the viral RNA once activated.
  • the Mx proteins (GTPases) which inhibit the synthesis and/or the maturation of viral transcripts. This activity is mainly exerted on the influenza virus.
  • the PKR protein or p68 kinase which is activated by the double-stranded
  • the activated PKR inhibits protein synthesis.
  • the IFNs antiviral activity is also induced by other mechanisms such as, in the case of retroviruses, the inhibition of viral particles entry into the cells, the replication, the binding, the exit of the particles and the infective power of viral particles.
  • the IFNs exert an indirect antiviral activity by modulating certain functions of the immune system, in particular by favoring the response to cellular mediation (including an increase of the MHC class I and II molecules, increase of IL-12 and IFN-gamma production, increase of the CTL activities, among others).
  • C122S mutated IFN ⁇ - 5 has been evaluated both in vitro in cell culture and in vivo in mouse model. Both tests have been carried out in parallel with wild-type IFN ⁇ -2 used as control and chosen as representative of the Intron A commercial product.
  • This assay permits evaluation of the antiviral activity of C122S mutated IFN ⁇ -5 in cell culture using the vesicular stomatitis virus (VSV), and comparison with that of wild-type IFN ⁇ -2 or of wild-type IFN ⁇ -5.
  • VSV vesicular stomatitis virus
  • WISH human epithelial cells were cultivated for 24 hours in the presence of decreasing concentrations of C122S mutated IFN ⁇ -5, wild-type IFN ⁇ -5 or wild-type IFN ⁇ -2. Then, the cells were infected by the virus of vesicular stomatitis (VSV) during 24 to 48 additional hours and cell lysis was measured.
  • VSV vesicular stomatitis
  • the antiviral effect of the different IFN ⁇ tested is determined by comparing the IC50 value corresponding to the IFN concentration inhibiting 50% of cell lysis induced by the VSV.
  • C122S mutated IFN ⁇ -5 protein possesses an antiviral activity in vitro in cell culture. Moreover, in cell culture infected with VSV, the C122S mutated IFN ⁇ -5 has a lower antiviral activity than the wild-type IFN ⁇ -5 or wild-type IFN ⁇ -2.
  • mice exhibit dose-dependent antiviral activity in the mouse which is in general 100 to 1,000 fold less than that exhibited by the same amount of mouse IFN (Meister et al. (1986). J. Gen. Virol. 67, 1633-1644).
  • Intraperitoneal injection of mice with Encephalomyocarditis virus (EMCV) gives rise to a rapidly progressive fatal disease characterized by central nervous system involvement and encephalitis (Finter NB (1973). Front Biol. 2: 295-360).
  • Mouse and human interferon-alpha have both been shown to be effective in protecting mice against lethal EMCV infection (Tovey and Maury (1999). J. IFN Cytokine Res. 19: 145-155).
  • Groups of 20, six- week old Swiss mice were infected intraperitoneally with 100 x LD50 EMCV and treated one hour later, and then once daily for 3 days thereafter with
  • Example 8 Evaluation of the anti-tumoral activity of C122S mutated IFN ⁇ -5 in mice previously inoculated with malignant Friend erythroleukemia cells
  • IFN ⁇ have been shown to be as effective in protecting mice against the growth of a clone of Friend leukemia cells resistant to the direct anti-proliferative activity of
  • IFN ⁇ as against IFN sensitive parental Friend leukemia cells (Belardelli et al, Int. J. Cancer, 30, 813-820, 1982; Belardelli et al, Int. J. Cancer, 30, 821-825, 1982), reflecting the importance of indirect immune mediated mechanisms in the anti-tumoral activity of IFN ⁇ .
  • mice 12 six- week old DBA/2 mice were inoculated intraperitoneally with 100,000 IFN resistant Friend leukemia cells (3C18) (20,000 LD 50 ) and treated one hour later and then once daily for 21 days thereafter with 2.0 ⁇ g of the wild-type IFN ⁇ -2 or with 2.0 ⁇ g of C122S mutated IFN ⁇ -5 or an equivalent volume of excipient alone.
  • the animals were then followed daily for survival and the primary efficacy measure was defined as survival at 40 days and the primary efficacy analysis was the relative survival at 40 days of each treatment group in comparison to its excipient only group.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Rheumatology (AREA)
  • Diabetes (AREA)
  • Pulmonology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Dermatology (AREA)
  • Pain & Pain Management (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Obesity (AREA)
  • Zoology (AREA)
  • Psychiatry (AREA)
PCT/EP2002/005458 2001-05-03 2002-05-02 POLYNUCLEOTIDES AND POLYPEPTIDES OF THE IFNα-5 GENE Ceased WO2003000896A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2003507279A JP2004535196A (ja) 2001-05-03 2002-05-02 IFNα−5遺伝子のポリヌクレオチド及びポリペプチド
EP02748710A EP1383895A2 (en) 2001-05-03 2002-05-02 Polynucleotides and polypeptides of the ifnalpha-5 gene
AU2002319176A AU2002319176A1 (en) 2001-05-03 2002-05-02 Polynucleotides and polypeptides of the ifnalpha-5 gene
US10/698,402 US7358333B2 (en) 2001-05-03 2003-11-03 Polypeptides of the IFNα-5 gene

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0105919A FR2824333B1 (fr) 2001-05-03 2001-05-03 Nouveaux polynucleotides et polypeptides de l'ifn alpha 5
FR01/05919 2001-05-03

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/698,402 Continuation US7358333B2 (en) 2001-05-03 2003-11-03 Polypeptides of the IFNα-5 gene

Publications (2)

Publication Number Publication Date
WO2003000896A2 true WO2003000896A2 (en) 2003-01-03
WO2003000896A3 WO2003000896A3 (en) 2003-07-17

Family

ID=8862939

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/005458 Ceased WO2003000896A2 (en) 2001-05-03 2002-05-02 POLYNUCLEOTIDES AND POLYPEPTIDES OF THE IFNα-5 GENE

Country Status (6)

Country Link
US (1) US7358333B2 (https=)
EP (1) EP1383895A2 (https=)
JP (1) JP2004535196A (https=)
AU (1) AU2002319176A1 (https=)
FR (1) FR2824333B1 (https=)
WO (1) WO2003000896A2 (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015056125A1 (en) 2013-10-15 2015-04-23 Uab Biotechnologines Farmacijos Centras "Biotechpharma" Fused proteins of interferon alpha 5 with another cytokine and a process for producing thereof
WO2020076970A1 (en) 2018-10-11 2020-04-16 Inhibrx, Inc. B7h3 single domain antibodies and therapeutic compositions thereof
WO2020076977A2 (en) 2018-10-11 2020-04-16 Inhibrx, Inc. Dll3 single domain antibodies and therapeutic compositions thereof
WO2020077257A1 (en) 2018-10-11 2020-04-16 Inhibrx, Inc. Pd-1 single domain antibodies and therapeutic compositions thereof
WO2020076992A1 (en) 2018-10-11 2020-04-16 Inhibrx, Inc. 5t4 single domain antibodies and therapeutic compositions thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7087726B2 (en) 2001-02-22 2006-08-08 Genentech, Inc. Anti-interferon-α antibodies
FR2822845B1 (fr) * 2001-03-30 2003-12-12 Genodyssee Nouveaux polynucleotides comportant des polymorphismes de type snp fonctionnels dans la sequence nucleotidique du gene ifn-alpha-21 ainsi que de nouveaux polypeptides codes par ces polynucleotides et leurs utilisations therapeutiques
WO2011017160A1 (en) * 2009-07-28 2011-02-10 Pestka Biomedical Laboratories, Inc. Mutant human interferon proteins and genes

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES8308534A1 (es) 1980-01-08 1983-09-01 Biogen Nv Un metodo de producir un polipeptido que exhibe actividad inmunologica o biologica del interferon de leucocitos humanos.
US4973479A (en) 1982-01-15 1990-11-27 Cetus Corporation Interferon-α61
WO1983002461A1 (en) * 1982-01-19 1983-07-21 Cetus Corp Multiclass hybrid interferons
US4966843A (en) * 1982-11-01 1990-10-30 Cetus Corporation Expression of interferon genes in Chinese hamster ovary cells
JPS6156199A (ja) * 1984-08-27 1986-03-20 Shionogi & Co Ltd 新規ヒトインタ−フエロンα類
US5705363A (en) * 1989-03-02 1998-01-06 The Women's Research Institute Recombinant production of human interferon τ polypeptides and nucleic acids
WO1998020165A2 (en) * 1996-11-06 1998-05-14 Whitehead Institute For Biomedical Research Biallelic markers
EP1037995A1 (en) * 1997-12-08 2000-09-27 Genentech, Inc. Human interferon-epsilon: a type 1 interferon
ES2138565B1 (es) * 1998-05-13 2000-08-16 Inst Cientifico Tecnol Navarra Uso del interferon alfa 5 en el tratamiento de las hepatopatias viral es.
WO2000006596A2 (en) * 1998-07-28 2000-02-10 Us Health INTERFERON-alpha HYBRIDS
WO2001025438A2 (en) * 1999-10-07 2001-04-12 Maxygen, Inc. Ifn-alpha homologues

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015056125A1 (en) 2013-10-15 2015-04-23 Uab Biotechnologines Farmacijos Centras "Biotechpharma" Fused proteins of interferon alpha 5 with another cytokine and a process for producing thereof
LT6164B (lt) 2013-10-15 2015-06-25 Uab Biotechnologinės Farmacijos Centras "Biotechpharma" Sulieti interferono-alfa 5 baltymai su kitu citokinu ir jų gamybos būdas
WO2020076970A1 (en) 2018-10-11 2020-04-16 Inhibrx, Inc. B7h3 single domain antibodies and therapeutic compositions thereof
WO2020076977A2 (en) 2018-10-11 2020-04-16 Inhibrx, Inc. Dll3 single domain antibodies and therapeutic compositions thereof
WO2020077257A1 (en) 2018-10-11 2020-04-16 Inhibrx, Inc. Pd-1 single domain antibodies and therapeutic compositions thereof
WO2020076992A1 (en) 2018-10-11 2020-04-16 Inhibrx, Inc. 5t4 single domain antibodies and therapeutic compositions thereof
US11208485B2 (en) 2018-10-11 2021-12-28 Inhibrx, Inc. PD-1 single domain antibodies and therapeutic compositions thereof
US11945869B2 (en) 2018-10-11 2024-04-02 Inhibrx, Inc. PD-1 single domain antibodies and therapeutic compositions thereof
US12297271B2 (en) 2018-10-11 2025-05-13 Inhibrx Biosciences, Inc. PD-1 single domain antibodies and therapeutic compositions thereof
US12365728B2 (en) 2018-10-11 2025-07-22 Inhibrx Biosciences, Inc. DLL3 single domain antibodies and therapeutic compositions thereof
US12590169B2 (en) 2018-10-11 2026-03-31 Inhibrx Biosciences, Inc. 5T4 single domain antibodies and therapeutic compositions thereof

Also Published As

Publication number Publication date
FR2824333A1 (fr) 2002-11-08
US7358333B2 (en) 2008-04-15
EP1383895A2 (en) 2004-01-28
WO2003000896A3 (en) 2003-07-17
AU2002319176A1 (en) 2003-01-08
US20040142431A1 (en) 2004-07-22
FR2824333B1 (fr) 2003-08-08
JP2004535196A (ja) 2004-11-25

Similar Documents

Publication Publication Date Title
US20080299081A1 (en) Polynucleotides and Polypeptides of the IFNalpha-21 Gene
US20090004156A1 (en) POLYNUCLEOTIDES AND POLYPEPTIDES OF THE IFNalpha17 GENE
AU2002257777A1 (en) New polynucleotides and polypeptides of the IFN$G(A)-21 gene
AU2002338442A1 (en) New polynucleotides and polypeptides of the IFN alpha-17 gene
US20040203118A1 (en) Polynucleotides and polypeptides of the IFNalpha-14 gene
US7358333B2 (en) Polypeptides of the IFNα-5 gene
US7399464B2 (en) Polypeptides of the IFNα-7 gene
EP1236800A2 (en) Nucleic acids encoding interferon alpha 2, containing single nucleotide polymorphisms and methods of use thereof
WO2002083733A2 (en) Polynucleotides and polypeptides of the ifnalpha-6 gene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 10698402

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2003507279

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2002748710

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2002748710

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642