WO2002086127A1

WO2002086127A1 - Acylase gene

Info

Publication number: WO2002086127A1
Application number: PCT/JP2002/003755
Authority: WO
Inventors: Akiko Okubo; Tetsuya Nagaoka; Shinichi Yokota; Eisaku Konishi; Tetsu Kakutani
Original assignee: Kaneka Corporation
Priority date: 2001-04-17
Filing date: 2002-04-16
Publication date: 2002-10-31
Also published as: JPWO2002086127A1

Abstract

It is intended to provide a xanthomonas g(b)lactam acylase protein, a gene encoding this protein, a recombination vector having this gene and a transformant containing this recombination vector. A β-lactam acylase gene of Xanthomonas citri is cloned and its DNA base sequence and an amino acid sequence deduced therefrom are determined. It is found out that the protein encoded by this gene is a protein consisting of 637 residues and having a molecular weight of 71 kDa and showing a β-lactam acylase activity.

Description

Specification

Acylase gene technology

The present invention relates to a gene having a DNA encoding Xanthomonas genus β-ratatum acylase, a protein predicted from the nucleotide sequence of the gene, an acylase encoded by the gene, a recombinant vector having the gene, And a method for producing the enzyme, which provides a transformant containing the recombinant vector. Background art

The basic substance of β-lactam antibiotics is obtained by fermentation in principle. Fungi such as genus Penicillium and Cephalosporium are used as raw materials for β-ratatam antibiotics such as penicillin G (PenG), penicillin V (PenV), and cephalosporin C. Used for manufacturing. These fermentation products are starting materials for almost all commonly marketed penicillins and cephalosporins. Cleavage of the amide bond from PenG, PenV or cephalosporin C (deacylation), and the most important intermediates in the semi-synthetic penicillin and cephalosporin industrial production, 6-aminodianilic acid (6 -APA) Some resins are converted to peresirin G acylase (benzinorepenicillin amide hydrolase, also known as penicillin G amidase, EC3.5-11) to produce 7-aminocephalosporanic acid (7-ACA). Used in industry. This enzyme is used industrially for the production of 7-aminodeacetoxycephalosporanic acid (7-ADCA) from phenylacetyl-7-aminodeacetoxycephalosporanic acid, which is usually produced chemically from PenG. Used for Semi-synthetic penicillins and cephalosporins produced by the chemical reaction of 6-APA, 7-ACA, and 7-ADCA, which are β-latatum nuclei, with side-chain compounds, It forms an important market for antibiotics.

Conventionally, hydrolases useful for desacylation in the production of β-latatum nuclei are classified as hydrolases based on the form of the chemical reaction. It is usually called "acylase" or "amidase". However, not all acylases recognize β-lactam antibiotics as substrates, and are further identified as “β-latatum acylases”. Acylase activity refers to hydrolysis (deacylation) activity when the acyl group is converted to water, and catalyzes the transfer of the acyl group from the activated side chain substrate to a nucleophile as a reversible reaction. In this case, it refers to metastatic activity. This chemical form is represented by the following general formula: That is, the properties of the chemical forms X and Y in the compound X-CO-NH-Y that is accepted as a substrate by the acylase are determined by the substrate specificity of the corresponding acylase. X represents a side chain, while Y represents an acyl ceptor group. For example, in the case of PenG, X-CO- represents a phenylacetyl side chain, and -HY represents 6-APA. Being able to recognize this, β-ratamyl acylase catalyzes both desacylation and transacylation, and has now shifted the process of transacylation in the production of β-lactam antibiotics from chemical synthesis to enzymatic methods. Its use in conversion is attracting attention.

β-lactam acylase is classified as follows in terms of substrate specificity and molecular characteristics (Process Biochemistry, 27, 131, 1992, World I Microbiology & Biotechnology, 10, 129, 1994). β-Ratatam acylase is roughly classified into penicillin acylase and cephalosporin acylase, and penicillin acylase is further subdivided into penicillin V acylase, penicillin G acylase, and ampicillin acylase, and cephalosporin acylase is And cephalosporin acylase and glutarinole-7-ACA (GL-7-ACA) acylase. Generally, penicillin V acylase forms a subunit tetramer with a molecular weight of 35 KDa. Penicillin G acylase forms a heterodimer consisting of a small subunit (α: 16-26 kDa) and a large subunit ( _: 54-66 kDa). Ampicillin acylase forms a homodimer with a molecular weight of 72 kDa. On the other hand, GL-7-ACA acylase is also known to form a heterodimer.

Among these acylases, the acylase gene sequence of a microorganism encoding penicillin G acylase has been elucidated. That is, E. coli (Nucleic Acids Res., 14 (14), 5713, 1996), Kluyver a citroohila (Gene, 49, 69, 1986), Alcaligenes fuecalis (Alcaligen) es faecalis) (Japanese Unexamined Patent Publication No. 4-228073), Providencia rettgeri (DNA seq., 3, 195, 1992), Arthrobacter viscosus (Appl. Environ. Microbiol., 54, 2603, 1988) ), Arcaeoglobus fulgidus (Nature, 390, 364, 1997), Bacillus megaterium (FEMS Microbiol. Lett. 125, 287, 1995) and the like. GL-7-ACA acylase having a heterodimeric structure was obtained from Pseudomonas sp. (J. Ferment. Bioeng., 77, 591, 1994), and cephalosporin acylase was obtained from Pseudomonas sp. (J. Bacteriol., 163, 1222, 1985, J. Bacteriol., 169, 5821, 1987) and the like are disclosed. However, the Lacta mucilase gene sequence of Xanthomonas citr has not been reported.

Β-lactam acylase possessed by Xanthomonas citri is also referred to as mono-amino acid ester hydrolase because of its high substrate specificity to α-amino acid conjugates (Jpn. J. Antibiot., 30S, S-230, 1977, JP-A-47-25388). It has been reported that this enzyme has a homotetramer structure of 280 kDa with a monomer of 72 kDa as a subunit (Agric. Biol. Chem., 44, 1069, 1980). The gene sequence has not been reported. That is, an enzyme, such as リン esillin G acylase ゃ cephalosporin acylase, in which a single precursor polypeptide chain is translated first and then enzymatically digested to exhibit a heterodimer structure of α, Although genes have been isolated from many microorganisms, no amino acid sequence or DNA sequence has been reported for an enzyme that has a homotetramer structure of Xanthomonas citri. It has also been reported that Pseudomonas melanogenum acylase has a homodimeric structure (Biochim. Biophys. Acta, 1040, 12, 1990). There is no report on DNA sequence. In addition, GL-7-ACA acylase of Bacillus laterosporus has been cloned (J. Bacteriol., 173, 7848, 1991), and forms the same group as Xanthomonas citri β-lactam synthase. However, it is only a guess from the subunit structure and There has been no report that the acylase gene was clogged by the method. On the other hand, many acylases having a heterodimeric structure have been reported. That is, E. coli penicillin G acylase (Nucleic Acids Res., 14 (14), 5713, 1996), Kluyvera citrophila penicillin G acylase (Gen e, 49, 69, 1986) ), Alcaligenes faecalis penicillin G acylase (Japanese Unexamined Patent Publication No. 4-228073), Providencia retgeri penicillin G acylase (DNA seq., 3, 195, 1992), Arislobactus viscosus (Arthrobacter) Penicillin G acylase (Appl. Environ. Microbiol., 54, 2603, 1988), Archaeoglobus fulgidus (Archaeoglo bus fulgidus) penicillin acylase (Nature, 390, 364, 1997), Bacillus megaterium biol FEM Lett. 125, 287, 1995), Pseudomonas C427 GL-7-ACA acylase (J. Ferment. Bioeng., 77, 591, 1994), Pseudomonas GK16 cephalosporin acylase (J. Bacteriol., 163, 1222, 1985), Pseudomonas SE83 cephalosporin acylase (J. Bacterio 1., 169, 5821, 1987). Since these are identified at the DNA level as a gene family, they can be easily cloned from DNA probe design, and can also be easily screened using a method using the enzyme activity of a microbial genomic library as an index. These DNAs can be obtained. Summary of the Invention ''

The problem to be solved by the present invention is to provide a Xanthomonas genus] 3-lactam acylase protein, a gene encoding the acylase protein, a recombinant vector having the gene, and a transformant containing the recombinant vector. Is to provide.

The Xanthomonas citri β-lactamacylase enzyme of the present invention may be any of the reported E. coli penicillin G acylases (Nucleic Acids Res., 14 (14), 5713, 1996), Cruibera Citrophilia (Klu wera citrophila) penicillin G acylase (Gene, 49, 69, 1986), alkali Genes faecalis penicillin G acylase (Japanese Unexamined Patent Publication No. 4-228073), Providencia rettgeri penicillin G acylase (DNA seq., 3, 195, 1992), Alice's mouth patricer Viscosus (Arthrobacter viscosus) Acylase (Appl. Environ. Microbiol., 54, 2603, 198 8), Arcaeoglobus fulgidus Penicillin Asilase (Nature, 390, 364, 1997), Batinoles Megaterium Penicillin G. Ems. , 125, 287, 1995), Pseudomonas C427 GL-7-ACA acylase (J. Ferment. Bioeng., 77, 591, 1994), Pseudomonas GK16 cephalosporin acylase (J. Bacteriol., 163) , 1222, 1985), Pseudomonas s SE83 cephalosporin acylase (J. Bacteriol., 169, 5821, 1987) does not show any characteristic homology with the gene sequence. In addition, there is no report on the DNA sequence or X-amino acid sequence of Xanthomonas citri β-lactam acylase carried out using these homologous probes.

We also attempted to screen for the normal activity of acylase enzymes from the Xanthomonas citri genomic library, but reported that the reported heterodimer acylase ゃ Bacillus laterosporus GL-7-ACA acylase and so on. In contrast, no positive clones showing activity could be obtained. In this enzyme activity measurement screening, a library was prepared using plasmids having different copy numbers in host Escherichia coli, and screening was performed. That is, in a genomic library using pBR322 plasmid, 19,000 colonies containing an average of about 6 Kbp of genomic fragments were screened, and a 110 Mbp genome was screened, and pACYC184 plasmid was theoretically screened. In the library used, 20,000 colonies containing an average of about 6-7 Kbp of genomic fragments were screened, and a 120-140 Mbp genome was screened theoretically. It is generally said that screening a genomic library requires screening 10 times the length of the entire genome, but this time, it covers almost 100 times the length, and the screening length is Although it was considered sufficient, no positive strain could be obtained from any of the libraries. This is Xanthomonas citri It was considered that the expression of (Xanthomonas citri) -lactam acylase in host E. coli was very weak. Thus, purification of the Xanthomonas citri p ~ ratatum acylase protein was attempted to determine the amino acid sequence, but the N-terminal sequence could not be determined. This was thought to be blocked by some terminal amino acid modification. Due to the difficulty in obtaining such an acylase, no report has been made on the β-latatum acylase gene of the genus Xanthomonas.

The present inventors considered that the DNA sequence and amino acid sequence of Xanthomonas citri p-lactam acylase had great industrial significance, and determined the internal amino acid sequence of β-latatam acylase. As a result of intensive studies by screening using the sequence, the Xanthomonas citri-ratatum acylase gene was cloned to determine the DNA base sequence represented by SEQ ID NO: 1. The open reading frame of this gene was found to consist of 1914 bases and encode a protein with a molecular weight of 71 kDa consisting of the 637 amino acid sequence shown in SEQ ID NO: 2. Furthermore, the gene was expressed in a host, and it was confirmed that the gene had an acylation activity. Thus, the present invention was completed.

That is, the present invention relates to a gene consisting of a DNA encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, Alternatively, a gene consisting of a DNA encoding a protein having an amino acid sequence in which several amino acids have been deleted, substituted and / or added, and having an acylase activity, and further, in the nucleotide sequence represented by SEQ ID NO: 1, The nucleotide sequence corresponding to the portion encoding the amino acid sequence represented by SEQ ID NO: 2 relates to a gene consisting of DNA encoding the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2. The present invention also relates to the above gene isolated from the genus Xan thomonas.

Also, the present invention relates to a polynucleotide comprising a nucleotide sequence encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2; Several amino acids A polynucleotide consisting of a deleted, substituted and / or added amino acid sequence and comprising a nucleotide sequence encoding a protein having acylase activity; in the nucleotide sequence represented by SEQ ID NO: 1, an amino acid represented by SEQ ID NO: 2 A polynucleotide having a nucleotide sequence corresponding to the amino acid sequence represented by SEQ ID NO: 2 having a nucleotide sequence corresponding to the sequence-encoding portion; a polynucleotide having a nucleotide sequence represented by SEQ ID NO: 1 The polynucleotide isolated from the genus Xanthomonas; a polynucleotide consisting of a nucleotide sequence encoding an amino acid sequence identical or substantially identical to the amino acid sequence shown in SEQ ID NO: 5.

Furthermore, the present invention relates to a recombinant protein consisting of the amino acid sequence of SEQ ID NO: 2; and the amino acid sequence of SEQ ID NO: 2 in which one or several amino acids have been deleted, substituted and Z or added. And a recombinant protein having acylase activity.

The present invention also relates to the above-mentioned gene which is under the control of a transcription regulatory sequence contained in the gene; a translation regulatory sequence contained in the gene; a regulation comprising a transcriptional and / or translational regulatory sequence; A gene in which one or both of the sequences are replaced by other transcriptional and / or translational regulatory sequences, each obtained from the same or different biological force.

Further, the present invention provides a recombinant vector comprising one or more of the above genes; a transformant containing the above-described recombinant vector; a transformant wherein the transformed host is a Gram-negative microorganism; The present invention relates to the above-mentioned transformant.

Also, the present invention provides a method for producing an acylase, comprising culturing the transformant and recovering an acylase; an acylase comprising an amino acid sequence encoded by the polynucleotide; culturing the transformant; Immobilized acylase obtained by immobilizing the mixed culture of the cells or the disrupted cells; preparing the above-mentioned recombinant vector, transforming the host with the vector, and transforming the resulting transformant And a method for producing or enhancing the production of acylase in a transformant. Detailed Disclosure of the Invention

Hereinafter, the present invention will be described in detail.

The genes described here are a region that encodes amino acids, a region that is transcribed into RNA 5 'upstream and 3' downstream, and regulatory regions that are involved in the execution and efficiency of transcription and translation even in regions outside this region. Indicates an area that includes

Further, the gene of the present invention derived from Xanthomonas citri is abbreviated as Xanthomonas citri β-latataamylase gene (xcacy) and the expression polypeptide of the xcacy gene as XCACY.

According to one aspect of the present invention, there is provided a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, and one or several amino acids in the amino acid sequence represented by SEQ ID NO: 2 A protein comprising an amino acid sequence in which an acid has been deleted, substituted, and / or added, and having an acylase activity is provided.

Furthermore, a gene having a DNA encoding a protein consisting of the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, and one or several amino acids in the amino acid sequence represented by SEQ ID NO: 2 A gene comprising a DNA having a deletion, substitution, Z or addition of an amino acid sequence and encoding a protein having acylase activity (hereinafter, also referred to as “DNA mutant”). You.

The gene is preferably isolated from the genus Xanthomonas. More preferably Xanthomonas citri (Xanthomonas citri), more preferably those isolated from Xanthomonas citri (Xanthomonas citri) IFO ³ δ35 strain.

Here, "an amino acid sequence j substantially identical to the amino acid sequence represented by SEQ ID NO: 2" encodes a protein having the same activity in nature, and is identical to the entire amino acid sequence represented by SEQ ID NO: 2. Means an amino acid sequence having a degree of homology of about 80% or more, preferably about 90% or more as a whole on average.

"One or several amino acids are deleted, substituted and / or added" means that the amino acid can be deleted, substituted and / or added by a known method such as site-directed mutagenesis. It means that a number of amino acids have been deleted, substituted and / or added.

That is, in the present invention, a DNA mutant can be prepared from a DNA consisting of the nucleotide sequence of SEQ ID NO: 1 by a method known in the art. Such operations include, for example, site-directed mutagenesis, point mutation, deletion, duplication, inversion, translocation, degeneracy of the genetic code, etc. Conservative changes.

Acylase activity refers to the hydrolysis (deacylation) activity when an acyl group is converted to water, and catalyzes the transfer of the acyl group from an activated side chain substrate to a nucleophile as a reversible reaction. In some cases, it refers to metastatic activity. In the case of hydrolysis activity, 1 unit is the amount of enzyme that catalyzes the hydrolysis of 1 / z mole of Dp-hydroxyphenyldaricin methyl ester (HPGOMe) per minute. In this case, one unit is the amount of enzyme that synthesizes 1 mole of amoxicillin per minute, and quantification can be performed using HPLC or the like.

Further, in the gene of the present invention, in the nucleotide sequence represented by SEQ ID NO: 1, the nucleotide sequence corresponding to the portion encoding the amino acid sequence represented by SEQ ID NO: 2 is the same as the amino acid sequence represented by SEQ ID NO: 2. It may be a gene consisting of DNA encoding an amino acid sequence. That is, the base sequence represented by SEQ ID NO: 1 contains a DNA encoding the same amino acid as the amino acid sequence represented by SEQ ID NO: 2. Further, the present invention provides the following polynucleotides. A polynucleotide consisting of a nucleotide sequence encoding a protein consisting of the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2; one or more nucleotides in the amino acid sequence represented by SEQ ID NO: 2 A polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence wherein the amino acid sequence of SEQ ID NO: 1 has a deletion, substitution and addition or addition of amino acid, and which encodes a protein having an acylase activity; A polynucleotide comprising a nucleotide sequence corresponding to the amino acid sequence shown in SEQ ID NO: 2 which encodes the same amino acid sequence as the amino acid sequence shown in SEQ ID NO: 2; The polynucleotide isolated from the genus Xanthomonas; SEQ ID NO: 5 An amino acid sequence identical or substantially identical to the amino acid sequence shown A polynucleotide comprising a base sequence to be loaded.

Further, the recombinant protein of the present invention may be a recombinant protein consisting of the amino acid sequence of SEQ ID NO: 2, or may have one or several amino acids deleted in the amino acid sequence of SEQ ID NO: 2. And a recombinant protein comprising an amino acid sequence substituted and / or added and having an acylase activity (hereinafter, also referred to as “mutant protein”).

At this time, the mutant protein includes a protein encoded by the above-described DNA mutant, and a conservative or semi-conservative change in the amino acid sequence without changing the basic β-latatum acylase activity ( For example, proteins in which amino acids having an aliphatic chain such as glycine, palin, leucine, and isoleucine are substituted, and amino acids having an aromatic chain such as phenylalanine, tyrosine, and tryptophan are substituted).

The present invention also provides a transcription regulatory sequence and a translation regulatory sequence contained in the above-described gene of the present invention. The transcription regulatory sequence is a sequence containing ttgaca at positions 164 to 169 of SEQ ID NO: 1, and a sequence containing tacagt at positions 194 to 199 in SEQ ID NO: 1. In addition, the translation control sequence is a sequence containing cggagtcgt at positions 221 to 229 of SEQ ID NO: 1.

Further, the present invention is under the control of a regulon containing transcription and / or translation regulatory sequences, wherein one or both of the regulatory sequences are associated with other transcription and / or translation regulatory sequences, each obtained from the same or different organism. Provide the gene that has been replaced. Here, other transcription regulatory sequences and translation regulatory sequences obtained from the same or different organisms are not particularly limited as long as they can express the gene of the present invention, and are known in the art. Things are used.

According to another aspect of the present invention, there is provided a recombinant vector comprising one or more of the above-described genes of the present invention. Also provided is a transformant containing the recombinant vector. This recombinant vector is prepared by ligating the gene of the present invention into an expression vector cut with an appropriate restriction enzyme.

Moreover, the transformed host used for the production of the transformant is not particularly limited, and examples thereof include gram-negative microorganisms and gram-positive microorganisms. Gram shade Examples of the sexual microorganism include the genus Escherichia and the genus Pseudomonas, and examples of the gram-positive microorganism include the genus Bacillus and the genus Streptomyces.

Further, the present invention provides a vector containing an acylase gene, which has been manipulated with respect to the above-mentioned control sequence (transcriptional and / or translational control sequence), and a transformant containing the vector.

According to another aspect of the present invention, a method for producing an acylase, which comprises culturing the above transformant and collecting an acylase, that is, culturing a transformant encoding an acylase, and recovering an isolated form of acylase To provide a method for producing an acylase.

An acylase comprising an amino acid sequence encoded by the polynucleotide; an immobilized acylase obtained by culturing the transformant and immobilizing a mixed culture of the cells or a crushed product of the cells; . Further, preparing the recombinant vector, transforming the host with the vector, cloning and selecting the obtained transformant, producing acylase in the transformant or enhancing the production thereof. Provide a way to

The transformant can express the trait of the introduced recombinant DNA by culturing it in a usual nutrient medium. If the recombinant DNA has properties derived from gene DNA or vector DNA, the drug (for example, kanamycin, neomycin, kucamramphenicol, tetracycline, etc.) can be captured in the culture medium according to the properties. I don't care.

In order to obtain the thus obtained transformant as an enzyme source, culture may be performed using a normal medium.However, if necessary, addition of IPTG (isopropylthio-j3-D-galactoside) or the like may be performed. However, treatment for enzyme induction can also be performed.

The medium used for culturing the transformed strain is usually a carbon source (eg, carbohydrates such as Dalcose sucrose, organic acids such as acetic acid, alcohols, etc.), a nitrogen source (eg, ammonia gas, ammonia). Examples of the medium include ordinary media containing water, ammonium salt, etc.) and inorganic ions (eg, phosphate ion, magnesium ion, potassium ion, iron ion, etc.). In addition, vitamins, amino acids, etc. The addition of organic micronutrients often results in favorable results.

According to still another embodiment of the present invention, the form in which the acylase enzyme is allowed to act is a culture solution, cells, treated cells, immobilized cells, enzymes extracted from cells, immobilized cells of the transformed strain. Enzymes and the like can be mentioned. These can be used in large-scale acylation or acylation processes.

Examples of the treated cells include crude extracts, freeze-dried cultured cells, dried acetone, cells treated with lysozyme, and cells disrupted by ultrasonication.

Furthermore, these cells, processed cells, cell-free enzyme extract, and purified enzyme can be immobilized by a known method. The immobilization can be performed by a method known to those skilled in the art, such as a crosslinking method, a covalent bonding method, a physical adsorption method, an inclusive method, or the like. For the immobilization method, for example, the method described in WO96 / 20275 is referred to.

As the support used for immobilization, phenol formaldehyde anion exchange resin such as Duolite A568 or DS17186 (Rohm and Haas Co., Ltd.), Amberlite IRA935, IRA945, IRA901 (Rohm and And Haas Co., Ltd. Trademark), Lewatit OC1037 (Bayer: registered trademark), Diaion EX-05 (Mitsubishi Chemical: registered trademark), and other polyanionic resins, and various anions having a functional group of amine-ammonium salt or jetanolamine type. Exchange resins are suitable. Other, DE

A support such as AE-cellulose can also be used.

Further, a cross-linking agent is usually used in order to make the enzyme adsorption more robust and stable, but a preferable example is dataraldehyde. As the enzyme to be used, not only the purified enzyme but also those having various degrees of purification, such as bacterial cells, processed bacterial cells, and cell-free enzyme extracts, can be used. For the preparation of the immobilized bacteria or the immobilized enzyme, a usual adjustment method such as adding a support to the cell fluid or the enzyme solution, stirring and adsorbing the mixture, and then performing a crosslinking treatment can be used. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows a restriction map of PUCXC4 containing the gene region of Xanthomonas citri p-lactam acylase.

FIG. 2 shows the construction of the recombinant vector. BEST MODE FOR CARRYING OUT THE INVENTION

The following examples further illustrate the invention. That is, embodiments of the gene, protein, recombinant vector, transformant and the like of the present invention will be described below, but the present invention is not limited to the following embodiments. Materials and methods

Cloning of the acylase gene

Overall genetic manipulation and cloning procedures were performed as described in Molecular Cloning (Cold Spring Harbor Laboratory Press, 1989). Enzymes, plasmids and E. coli cloning hosts used for DNA manipulation were purchased from commercial suppliers and used as described.

Culture medium

B medium: peptone 5 g / I, I over strike E Tasuto lacto _{5 g / l, K 2 HP0} 4 2 g / l, Shiyukurosu _{20 g / l, MgCl 2 ·} 6H 2 0 1 g / l, sodium glutamate 2 g / l, _{_{FeS0 4 · 7H 2 0 0.1 g}} / l, pH 7.2

LB medium: Bacto-tryptone 10 g / l, yeast extract 5 g / l, NaC 15 g / l, pH 7.0

1 X SSC: 0.15 M NaCl, 0.015 M sodium citrate

30 mM KPB (pH 6.0): adjusted to pH 6.0 with 30 mM KH ₂ P0 _4, KOH

50 mM KPB (pH 5.0): 50 mM KH 2 P0 4, KOH adjustment strains pH 5.0

Xanthomonas citri IF03835 strain was used as a donor strain of Xanthomonas citri β-lactam acylase gene.

E. coli DH5 strain and E. coli HB101 strain were used as hosts for recombinant plasmids.

Acylase activity. Acylase activity is the activity of hydrolysis (deacylation) when the acyl group is converted to water, and the transfer of the acyl group from the activated side chain substrate to a nucleophile as a reversible reaction. In the case of catalyzing, it refers to transfer activity.

In the case of hydrolytic activity, one unit is the amount of enzyme that catalyzes the hydrolysis of 1 μmole of D-p-hydroxyphenylglycine methyl ester (HPGOMe) per minute. For transfer activity, one cut is the amount of enzyme that synthesizes 1 μmole of amoxicillin per minute.

The respective reaction conditions are shown below, and the quantification was performed by HPLC.

HPGOMe hydrolysis reaction

HPGOMe · HC1 was dissolved in 30 mM KPB (pH 8.0) to a concentration of 0.5% to prepare a substrate solution. The cells or the crude enzyme solution were suspended in the substrate solution, and reacted with shaking at 30 ° C for 4 hours. The reaction was stopped by adding IN20 to 1/20 volume of the substrate solution.

Amoxicillin synthesis reaction

6-APA and HPGOMe ■ HC1 were dissolved in 30 mM KPB (pH 6.0) to a concentration of 0.5% to prepare a substrate solution. The cells or the crude enzyme solution were suspended in the substrate solution and reacted while shaking at 30 ° C for 4 hours. The reaction was stopped by adding IN20 to 1/20 volume of the substrate solution. Detection using thin layer chromatography (TLC)

Amoxicillin in the cell reaction and the crude enzyme reaction was detected by thin-layer chromatography. The reaction solution is centrifuged, the supernatant is collected, and a small amount is spotted on a silica gel thin layer plate, developed with a developing solvent of ethyl acetate: acetic acid: water = 60:20:20. After removing the solvent, the ninhydrin reaction is performed. Amoxicillin was detected.

High-performance liquid chromatography (HPLC) detection

The reaction solution was centrifuged to recover the supernatant, diluted 10-fold with the mobile phase, and measured by HPLC. The analysis conditions were as follows: Cosmosil 5C18 AR (Nacalai Tester) was used for the column, the mobile phase was 1% acetonitrile / 50 mM KPB (ρΗ5.θ), the flow rate was 1.0 ml / min, the column temperature was 35 ° C, and the measurement wavelength was 225 Performed in nm. The peak was identified using a standard, and amoxicillin trihydrate (Wako Pure Chemical Industries) was used as a standard for amoxicillin. Retention times were 1.8 min for HPG (Dp-hydroxyphenylglycine), 5.9 min for 6-APA, 7.5 min for moxicillin, and 9.4 min for HPGOMe · HC1. (Example 1) Purification of β-latatum acylase of Xanthomonas citri IFO ³⁸³⁵ strain

Xanthomonas citri (Xanthomonas citri) IF038 ^{³ 3} 5 shares B medium 0. Grown in the same manner. The following operations were performed at 4 ° C. The cells were collected by centrifugation, suspended in 0.1 M Tris-HCl (pH 8.0), EDTA '2Na was added at 4.7 g / l, and lysozyme was added at 0.13 g / 1, followed by stirring for a while. MgS0 ₄ ■ 7¾0 a 3.13 g / l, © shea Hiza臓De Kishiribonukurea ¹ I (bovine pancreatic ^{deoxyribonuclease} I) was added to a ¾r0.06 mg / 1 and reacted overnight, ultrasonically disrupted, The supernatant was collected by centrifugation. Ca (CH ₃ COOH) ₂ '¾0 was added to 22.9 ^^ ^^ (^? ^ G / 1), and the supernatant was collected by centrifugation. After dialysis, cation exchange gel chromatography (CM Sepharose CL) -6B) was purified three times using a Genole filtration chromatograph (Cefatarithle-300) once (Agric. Biol. Chem., 44 (5), 1069, 1980). Confirmed the amoxicillin synthesis activity by TLC and proceeded to the next purification step.The obtained XCACY protein was found to consist of a subunit of about 70 kDa.

The determination of (Example 2) Xanthomonas citri (Xanthomonas citri) IF03S ³ 5 strains of β- rata Tam acylase amino acid sequence

The XCACY protein obtained by the purification method of Example 1 above was limitedly degraded with lysylendopeptidase, and the amino acid sequence of the peptide fragment was determined. Suspend the XCACY protein in a buffer (10 mM Tris-HC1 (pH 9.0), 4 M Urea), add Lysyl endopeptidase to 1/50 volume of the XCACY protein, and add at 37 ° C for 6 hours. Reacted. Peptides were fractionated on a reversed-phase column (YMC-Pack PROTEIN-RP (YMC)) and analyzed using a Model 49X protein sequencer (Applied Biosystems). The obtained amino acid sequence is shown in SEQ ID NO: 3.

(Example 3) β- of Xanthomonas citri IF03835 strain Cloning of lactam acylase gene

Xanthomonas citri (Xanthomonas citri) IF0 ³⁸³ 5 strain 10-20 kbp fractions Genomic DNA was isolated and digested with EcoRI, and a material obtained by Kuroyungu the EcoRI and alkaline phosphatase Fataze (CIAP) treated pUC19 plasmid, I E. coli DH5 o! Strain, and spread on an L-Amp plate (LB medium supplemented with 15 g / l bactoagger and 50 mg / 1 ampicillin). 37 The cells were cultured at ° C. A colony of this plate was replicated on a nylon membrane, and cultured until the colony became a suitable size, and the cells were lysed to prepare a filter. Using the amino acid sequence contained in SEQ ID NO: 3 and encoding the amino acid sequence represented by SEQ ID NO: 5, SEQ ID NO: 4: XI oligonucleotide as a probe, colony hybridization was performed. Gene Images 3'-oligolabelling (Amersham Pharmacia Biotech) fluorescently labels the ³ ends of the XI oligonucleotide, and a 50 ° C hybridization buffer (5 X SSC, 0.1% sodium dodecyl sulfate, 20-fold diluted liquid) Block (Amersham Fanoremasia Nanotech) and 0.5% dextran sulphate were hybridized. Wash the membrane in 5X SSC solution (0.1% sodium dodecyl sulfate) at room temperature and then in 1X SSC solution (0.1% sodium dodecyl sulfate) at 42 ° C, and use the Gene Images CD P-Star detection module (Amersham). (Pharmacia Biotech) to obtain positive clones. The plasmid obtained from this clone was designated as pUCX C4 (FIG. 1).

(Example 4) Sequence determination of β-lactam acylase gene

The rooster sequence of the positive clones obtained above was subjected to sequencing by deoxy sequencing using the BigDye Terminator Cycle Seqensing FS Ready Reaction Kit (Applied Biosystems), and the ABI PRISM 310 Genetic Analyzer ( (Applied Biosystems). The resulting β-ratatum acylase gene sequence is shown in SEQ ID NO: 1, and the predicted amino acid sequence is shown in SEQ ID NO: 2. Example 5 Construction of Recombinant Vector of β-Latatam Acylase Gene A primer for creating an Nde I site at the start codon site of the lacZ gene of pUC19 plasmid was prepared and subjected to polymerase chain reaction (PCR). Then, a pUCNde plasmid was prepared by adding one NdeI site to the pUC19 plasmid. The pTrc99A (Amersham Pharmacia Biotech) plasmid was also subjected to PCR in the same manner to prepare a pTrcNde plasmid in which the NcoI site was changed to an NdeI site. A 2.0 kbp fragment obtained by cutting the pUCNde plasmid with NdeI and SspI and a 0.6 kbp fragment obtained by cutting the pTrcNde plasmid with NdeI and SspI were ligated to prepare pUCNT plasmid.

The kanamycin resistance gene was amplified by PCR using the 1.8 kbp fragment obtained by digesting the pUCNT plasmid with CrflO I and Ssp I and the pKC7 plasmid (Gene, 7, 79, 1979) as a template to have Crfl 0 I and Ssp I sites. A kbp fragment was prepared and ligated to prepare pUCNTkmTn5 (kam plasmid.

Using the pUCXC4 plasmid as a template, PCR was performed using the X45-Nde I primer (GGAATTCCA TATGCGCCGCCTTGCCACCTGC) and the X38-Bam HI primer (CGCGGATCCTC AA CGTACCGGCAGACTGA) to amplify the CDS fragment. This CDS fragment was cloned into the Nde I site and the Bam HI site of the pUCNTkmTn5 (kam ^r ) plasmid vector to obtain pUCNTkmTn5-XC. The construction of this recombinant vector is shown in FIG. (Example 6) Expression of β-latatum acylase gene

A strain obtained by transforming pUCNTkmTn5-XC plasmid into E. coli HB101 (pUCNTkmTn5-XC / HB101) was prepared by adding kanamycin to LB medium at a concentration of 50 mg / 1, and heating at 30 ° C.晚 Cultivated. The cells were collected by centrifugation, suspended in 30 mM PB, sonicated, and the supernatant was collected by centrifugation.SDS-PAGE electrophoresis revealed a band of about 70 kDa. As a result, it was confirmed that β-latatum acylase was expressed.

(Example 7) Confirmation of β-latatamucilase activity

After culturing the pUCNTkmTn5-XC / HB101 strain in the same manner as in Example 6, adjust to 1 mM. To which IPTG was added, followed by further culturing for 3 hours. The cells were treated with 0.44 mg / ml Lysozyme on ice for 15 minutes, and the supernatant obtained by sonication and centrifugation was used as a crude enzyme solution. The total protein mass of the crude enzyme solution was determined by the Bradford method. Substrate (0.5% HPGOMe-HC1, 0.5% 6-APA) Add 25 xg of protein to 200 / zl, react with shaking at 30 ° C for 1 hour, dilute 10-fold and extract 101 by HPLC. Analysis revealed a peak of amoxicillin. This confirmed that the X. citri β-lactam acylase gene cloned into the pUCNTkmTn5 plasmid was expressed in Escherichia coli HB101 and had activity. (Example 8) Immobilization of β-lactam acylase on resin

After culturing the pUCNTkmTn5-XC HB101 strain in the same manner as in Example 7, the cells were crushed to prepare a crude enzyme solution. To this, add Duolite A-568 (Rohm & Haas Co., Ltd.) equilibrated with 0.1 M KPB (pH 7.0) so that 1 g of resin is added to 40 mg of total protein. The mixture was stirred at ° C for 20 hours and adsorbed. The resin is washed with 0.1 M KPB (pH 7.0) and 10 mM dithiothreitol (DTT), and then washed with 0.2% glutaraldehyde and 0.1 M KPB (pH 7.0) at 4 ° C. The protein was cross-linked by reacting for 1 minute to prepare an immobilized resin. Add 1 mg of the immobilized resin to 200 μl of substrate (0.5% HPGOMeHC1, 0.5% 6-ΑΡΑ), react with shaking at 30 ° C for 4 hours, dilute 10-fold, and add Ι was analyzed by HPLC to detect picoximes of amoxicillin. Industrial applicability

The β-lactam acylase gene derived from Xanthomonas citri can be ligated to an expression vector to obtain a recombinant vector, transformed, and expressed, so that β-lactam acylase can be efficiently prepared. . This β-ratatum acylase can be used in a large-scale deacylation group conversion step in an isolated or partially purified state.

Claims

The scope of the claims

1. A gene comprising DNA encoding a protein comprising the same or substantially the same amino acid sequence as the amino acid sequence shown in SEQ ID NO: 2.

2. A gene comprising an amino acid sequence represented by SEQ ID NO: 2 in which one or several amino acids have been deleted, substituted and / or added, and comprising a DNA encoding a protein having an acylase activity.

3. In the nucleotide sequence represented by SEQ ID NO: 1, the nucleotide sequence corresponding to the portion encoding the amino acid sequence represented by SEQ ID NO: 2 encodes the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2 Gene consisting of DNA.

4. The gene according to any one of claims 1 to 3, isolated from the genus Xanthomonas.

5. A polynucleotide consisting of a nucleotide sequence encoding a protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2.

6. A polynucleotide comprising an amino acid sequence represented by SEQ ID NO: 2 in which one or several amino acids have been deleted, substituted and Z- or added, and comprising a base sequence encoding a protein having an enzyme activity. .

7. In the nucleotide sequence represented by SEQ ID NO: 1, the nucleotide sequence corresponding to the portion encoding the amino acid sequence represented by SEQ ID NO: 2 encodes the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2 A polynucleotide consisting of a base sequence.

8. A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1.

9. The polynucleotide according to claims 5 to 8, isolated from the genus Xanthomonas.

10. A polynucleotide comprising a nucleotide sequence encoding the same or substantially the same amino acid sequence as the amino acid sequence shown in SEQ ID NO: 5. Recombination consisting of the amino acid sequence of SEQ ID NO: 2

12. A recombinant comprising an amino acid sequence of SEQ ID NO: 2 in which one or several amino acids have been deleted, substituted and Z or added, and having an acylase activity;

13. A transcription regulatory sequence contained in the gene according to any one of claims 1 to 4. 14. A translation regulatory sequence contained in the gene according to claims 1-4.

15. The gene according to any one of claims 1 to 4, which is under the control of a regulon containing transcriptional and Z or translational regulatory sequences, wherein one or both of said regulatory sequences are the same or both, respectively. A gene that has been replaced by another transcription and Z or translation regulatory sequence from a different organism.

16. A recombinant vector containing one or more genes according to claims 1-4.

17. A transformant comprising the recombinant vector according to claim 16.

18. The transformant according to claim 17, wherein the transformed host is a Gram-negative microorganism.

19. The transformation according to claim 17, wherein the transformed host is a Gram-positive microorganism. body.

20. A method for producing an acylase, comprising culturing the transformant according to any one of claims 17 to 19 and recovering the acylase.

21. An acylase comprising an amino acid sequence encoded by the polynucleotide according to claims 5 to 9.

22. An immobilized acylase obtained by culturing the transformant according to any one of claims 17 to 19, and immobilizing a mixed culture of the cells or a crushed cell thereof.

23. Preparing the recombinant vector according to claim 16, transforming a host with the vector, cloning and selecting the obtained transformant. A method for producing or enhancing the production thereof.