WO2002077637A1 - Selection de sperme en fonction du sexe a partir d'animaux -transgeniques - Google Patents

Selection de sperme en fonction du sexe a partir d'animaux -transgeniques Download PDF

Info

Publication number
WO2002077637A1
WO2002077637A1 PCT/US2002/008933 US0208933W WO02077637A1 WO 2002077637 A1 WO2002077637 A1 WO 2002077637A1 US 0208933 W US0208933 W US 0208933W WO 02077637 A1 WO02077637 A1 WO 02077637A1
Authority
WO
WIPO (PCT)
Prior art keywords
transgene
cells
expression
haploid
mammal
Prior art date
Application number
PCT/US2002/008933
Other languages
English (en)
Inventor
Erik J. Forsberg
Kenneth J. Eilertsen
Michael D. Bishop
Ying Zheng
Gregory H. Leno
Original Assignee
Infigen, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Infigen, Inc. filed Critical Infigen, Inc.
Priority to CA002442019A priority Critical patent/CA2442019A1/fr
Priority to US10/472,542 priority patent/US20050081256A1/en
Publication of WO2002077637A1 publication Critical patent/WO2002077637A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0608—Germ cells
    • C12N5/0612—Germ cells sorting of gametes, e.g. according to sex or motility
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0273—Cloned vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
    • C12N15/877—Techniques for producing new mammalian cloned embryos
    • C12N15/8771—Bovine embryos
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
    • C12N15/877—Techniques for producing new mammalian cloned embryos
    • C12N15/8778—Swine embryos
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/101—Bovine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/102—Caprine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/103—Ovine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/108—Swine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/02—Animal zootechnically ameliorated
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2517/00—Cells related to new breeds of animals
    • C12N2517/04—Cells produced using nuclear transfer

Definitions

  • the present invention relates to methods for pre-selecting the sex of mammalian offspring, hi particular, the materials and methods described herein permit the enrichment of X or Y chromosome-bearing sperm in semen by expressing a transgene present on a sex chromosome in a haploid-specific manner.
  • a recent approach toX problem of sex pre-selection relates to methods that rely on the use of antibodies directed to sex-specific epitopes on sperm, or, alternatively, on fertilized embryos.
  • evidence for a male-specific cell surface antigen was first obtained by Eichwald and Silmser (1955, Transplant Bull 2:148) using the inbred mouse strain C57BL/6, but it remained for Hauscha (Transplant Bull, 1955, 2:154) to later hypothesize the existence an antigen coded for by a Y-linked gene.
  • This surface marker became known as H-Y (histocompatibility locus on the Y chromosome).
  • H-Y-sperm-specific surface expression of the H-Y antigen has been suggested to be a target epitope for sex pre-selection, and antibodies raised to the H-Y antigen were expected to allow the routine sorting of sperm using cell sorting or immunological adsorption of H-Y expressing sperm (Peter et ah, 1993, Theriogenology 40:1177-1185).
  • sex-specific antibodies were disclosed as allowing the selective ablation of sperm or embryos utilizing complement (U.S. Patent
  • H-Y antigen may be the primary sex determinant and may control testicular development in mammals. (Wattle, et al, 1975; Wattle and Ok, 1980); Ok, et al, "Application of Monoclonal Anti-H-Y Antibody for Human H-Y Typing," Human Genetics, 57: 64-67 (1981).
  • H-Y is a "minor" histocompatibility antigen, which is a separate genetic locus from the major histocompatibility complex (MHC).
  • FACS Fluorescence Activated Cell Sorting
  • Spaulding In another example, which combines sorting based on D ⁇ A content, followed by immunological selection, Spaulding, (U.S. Patent No. 5,021,244 and 5,346,990, and 5,660,997) first sorted sperm into enriched X- and Y-chromosome bearing preparations via DNA content and cell sorting techniques. Spaulding then used the sorted sperm to screen for sex-specific sperm proteins and then proceeded to predict the use of the sex-specific protein for raising antibodies to allow purification of the sperm population to either X-chromosome bearing or Y-chromosome bearing populations.
  • WO 01/47353 proposes methods by which expression of a transgene inserted into a sex chromosome might alter the sex ratio of offspring.
  • the present invention discloses a robust technique for producing semen that is enriched for active sperm containing either the X chromosome or the Y chromosome. Because cows of reproductive age normally will give birth to only a single calf per year, which will randomly either be male or female, the ability to pre- select the sex of an offspring is particularly advantageous for the dairy and meat industries. However, in the agricultural industry generally, methods for sex selection could be used to upgrade the nutritional characteristics and quantities of animals produced. Accurate selection of the sex of the offspring could allow the birth of many genetically superior animals of a single sex as offspring of one genetically desirable parent. Thereby, the desirable genetic characteristics of the parent animals can be propagated with much greater velocity than is possible in nature.
  • this invention relates to animals in which one or more transgenes are incorporated into either the X or Y chromosome, and hence into those sperm cells containing a specific sex chromorome, of the transgenic animal.
  • the transgene(s) is (are) under the control of a promoter region and/or an enhancer region which is capable of conferring haploid-specific expression to the coupled transgene.
  • the semen produced by the transgenic animal can be enriched for sperm of a given sex by expression of the transgene.
  • Transgenes useful for this invention include genes that encode a gene product which is toxic for a haploid cell when expressed in cis, e.g., suicide genes such as pertussis toxin or the immunoglobulin heavy chain binding protein (BiP); alternatively, gene products that allow for survival in cis when the sperm cell is exposed to a selective agent may be employed.
  • suicide genes such as pertussis toxin or the immunoglobulin heavy chain binding protein (BiP)
  • gene products that allow for survival in cis when the sperm cell is exposed to a selective agent may be employed.
  • the term "in cis" is defined hereinafter.
  • the gene may encode an antisense construct capable of blocking the expression of a gene essential for the continued viability or function of the sperm.
  • transgene(s) used in the instant invention may be expressed in a haploid-specific manner, and that transgene expression results in enhanced production of offspring having the selected sex.
  • the transgenes of the instant invention need not result in the death of the haploid cells in which it is expressed, however, in order to enrich for sperm of a selected sex.
  • a gene may prevent induction of pregnancy by a haploid cell, for example by preventing fusion of a sperm with an oocyte, or by reducing or preventing motility.
  • Even a minor change in fitness, resulting from the presence of one or more transgenes may result in enhanced production of offspring having the selected sex. See, e.g., Ellison et al, Mol. Reprod. Dev. 55: 249-55 (2000).
  • the transgenes of the instant invention may also encode gene products that allow the haploid cells expressing the gene to be detected by a detection method, e.g., optically.
  • Genes which can be detected optically include the Green Fluorescent Protein (GFP) (Tsien, 1998, Annu. Rev. Biochem. 67:509-44), drFP83 and the E5 mutant (Terskikh, et al, 2000, Science 290:1585-1588).
  • GFP Green Fluorescent Protein
  • the transgenes of the instant invention may encode gene products that make a haploid cell apparent to an in vivo immune response.
  • sex chromosome-specific immune infertility may be produced by immunizing an animal against a transgene product expressed in a sex chromosome-specific and haploid-specific manner.
  • Such immunity may be created in either a male or a female, resulting in enhanced production of offspring of the selected sex. See, e.g., Tsuji et al., J. Reprod. Immunol. 46: 31-8 (2000); Mahmoud et al., Andrologica 28: 191-6 (1996).
  • haploid cell refers to cells that contain a single set of unpaired chromosomes.
  • cells that give rise to gametes i.e., sperm and eggs
  • meiotic division whereby a diploid cell divides into four haploid cells, hi males, a diploid cell contains both an X and a Y chromosome, referred to herein as "sex chromosomes.”
  • sex chromosomes an X and a Y chromosome
  • Each haploid cell contains only one sex chromosome.
  • haploid cell can preferably refer to the following cells produced by a male animal: primary spermatocytes (produced in the first meiotic division); secondary spermatocytes (produced in the second meiotic division); spermatids; differentiating spermatids; and spermatozoa.
  • haploid cell can also refer to cells produced by a female animal, e.g., oocytes and eggs.
  • transgenic refers to a cell or an animal that comprises heterologous deoxyribonucleic acid (DNA).
  • DNA deoxyribonucleic acid
  • Methods for producing transgenic cells and animals are well known to the ordinarily skilled artisan. See, e.g., Mitani et al, 1993, Trends Biotech, 11: 162-166; U.S. Patent 5,633,067, "Method of Producing a Transgenic Bovine or Transgenic Bovine Embryo," DeBoer et al. , issued
  • heterologous DNA refers to DNA having (1) a different nucleic acid sequence than DNA sequences present in cell nuclear DNA; (2) a subset of DNA having a nucleotide sequence present in cell nuclear DNA, where the subset exists in different proportions in the heterologous DNA than in the cell nuclear DNA; (3) a DNA sequence originating from another organism species than the species from which cell nuclear DNA originates; and/or (4) a different nucleic acid sequence than DNA sequences present in cell mitochondrial DNA.
  • An artificial chromosome present in a transgenic cell can comprise heterologous DNA.
  • Heterologous DNA can encode multiple types of recombinant products, as defined hereafter.
  • nucleic acid sequence refers to nucleic acid sequences that are not substantially similar.
  • substantially similar refers to two nucleic acid sequences having preferably 80% or more nucleic acid identity, more preferably 90% or more nucleic acid identity or most preferably 95% or more nucleic acid identity.
  • Nucleic acid identity is a property of nucleic acid sequences that measures their similarity or relationship. Identity is measured by dividing the number of identical bases in the two sequences by the total number of bases and multiplying the product by 100. Thus, two copies of exactly the same sequence have 100% identity, while sequences that are less highly conserved and have deletions, additions, or replacements have a lower degree of identity. Those of ordinary skill in the art will recognize that several computer programs are available for performing sequence comparisons and determining sequence identity.
  • a "transgenic animal” is an animal having cells that contain DNA which has been artificially inserted into a cell, which DNA becomes part of the genome of the animal which develops from that cell.
  • Preferred transgenic animals are mammals, most preferably non-human primates, mice, rats, ungulates (including cows, pigs, horses, goats, and sheep), dogs and cats.
  • a transgenic animal expresses one or more gene products in a haploid-specific manner.
  • preferred sites of integration of a heterologous DNA in a transgenic animal of the instant invention include the Y chromosome and the X chromosome.
  • a nucleic acid construct according to the invention can be injected into the pronucleus of a fertilized egg before fusion of the male and female pronuclei, or injected into the nucleus of an embryonic cell (e.g. , the nucleus of a two- cell embryo) following the initiation of cell division (Brinster et al, Proc. Nat. Acad. Sci. USA 82:4438-4442, 1985).
  • embryos can be infected with viruses, especially retroviruses, modified to carry nucleic acid constructs according to the invention, or other gene delivery vehicles.
  • transgenic animals can be produced by nuclear transfer using a transgenic nuclear donor cell.
  • Nuclear transfer methods are well known to the ordinarily skilled artisan, and are described in detail hereinafter. See, e.g., U.S. Patent No. 6,107,543; U.S. Patent No. 6,011,197; Proc. Nat'l. Acad. Sci. USA 96: 14984-14989 (1999); Nature Genetics 22: 127-128 (1999); Cell & Dev. Diol 10: 253-258 (1999); Nature Biotechnology 17: 456-461 (1999); Science 289: 1188-1190 (2000); Nature Biotechnol. 18: 1055-1059 (2000); Nature 407: 86-90 (2000).
  • transgene refers to the heterologous DNA included in a transgenic cell or animal.
  • the transgene may refer to the coding sequence or it may also refer to the coding sequence plus additional 5' and 3' DNA sequences necessary for the proper expression of the transgene.
  • a cell may contain multiple transgenes, which may or may not be identical to one another.
  • the term "expression” as used herein refers to the production of the protein encoded by a transgene useful in the invention from a nucleic acid vector containing protease genes within a cell.
  • the nucleic acid vector is transfected into cells using well known techniques in the art as described herein.
  • the nucleic acid vector is preferably integrated into the genome of the host.
  • a nucleic acid molecule such as DNA
  • An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene sequence expression.
  • the precise nature of the regulatory regions needed for gene sequence expression may vary from organism to organism, but shall in general include a promoter region which directs the initiation of RNA transcription. Such regions will also normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
  • promoter refers to nucleic acid sequence needed for gene sequence expression. Promoter regions vary from organism to organism, but are well known to persons skilled in the art for different organisms. For example, in prokaryotes, the promoter region contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation. Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like. In preferred embodiments, a promoter is sex-specific, and/or sperm-specific, and/or inducible. A particularly preferred promoter is the protamine promoter.
  • sex chromosome-specific expression refers to expression of a gene product in cells with a specific sex chromosome. Particularly preferred is sex chromosome-specific expression in haploid cells, which, by definition, contain only a single sex chromosome. Sex chromosome-specific expression of a gene can be achieved by inserting the gene to be expressed into the specific sex chromosome.
  • a gene is rendered X chromosome-specific by its operable incorporation into the X chromosome.
  • a gene may be rendered Y chromosome-specific by its operable incorporation into the Y chromosome.
  • haploid-specific expression refers to expression of a gene product only by haploid cells, such as spermatozoa, spermatids, etc.
  • the gene product may be expressed during assembly, during spermatogenesis, or after at any time prior to fertilization.
  • a gene that is expressed in a haploid-specific fashion is also expressed in a sex chromosome-specific fashion.
  • transgenes of the instant invention may also be configured and arranged to confer "tissue-specific" expression on the transgene. That is, the expression of the transgene may take place only in specific body tissue(s) of the transgenic animal. Particularly preferred are transgenes that are expressed only in the testis or only in the ovary of the transgenic animal.
  • specific expression refers to gene expression that is predominantly localized to a desired cell type. Such expression may be “leaky,” i.e., there may be some ectopic expression of the gene in undesired cell types, but the predominant expression may still be in the specific cell type. In preferred embodiments, “specific expression” refers to a gene that is expressed 5-fold higher, 10-fold higher, 20-fold higher, 50- fold higher, and 100-fold higher or more in the desired cell type when compared to expression in undesired cells.
  • haploid-specific expression and/or tissue-specific expression are well known to the skilled artisan. See, e.g., Yamanaka et al., Biol. Reprod. 62: 1694-1701 (2000); Westbrook et al, Biol. Reprod. 63: 469-81 (2000); Tosaka et al, Genes Cells 5: 265-76 (2000); Reddi et al, Biol. Reprod. 61: 1256-66 (1999); Nayernia et al, Biol. Reprod. 61: 1488-95 (1999); Mohapatra et al, Biochem. Biophys. Res. Comm. 244: 540-5 (1998); Herrada et al, J.
  • the gene that is expressed in a haploid-specific manner is under the control of the promoter of the protamine gene. See, e.g., Queralt and Olivia, Gene 133: 197-204 (1993).
  • the transgene is capable of killing haploid cells in which it is expressed ("in cis") and not in cells not expressing the transgene; while in other preferred embodiments, the transgene is capable of functionally disabling haploid cells in cis when expressed.
  • the term "killing haploid cells” refers to the ability of one or more expressed gene products to kill a haploid when expressed.
  • the gene(s) may kill the haploid either directly though the activity of one or more expressed proteins, or indirectly, via metabolizing an exogenously supplied compound to produce a toxic product or by failing to metabolize a toxic chemical supplied exogenously.
  • the gene product(s) are expressed in a haploid-specific manner; in other embodiments, the gene product(s) are expressed in an inducible fashion.
  • Particularly preferred as a gene to kill haploid cells is the immunoglobulin heavy chain binding protein (BiP) gene, mutations of which have been shown to exhibit dominant negative effects in cells. See, e.g., Hendershot et al, Proc. Natl Acad. Sci. USA 93: 5269-74 (1996).
  • the term "disabling haploid cells” refers to the ability of one or more expressed gene products to prevent the proper functioning of a haploid cell when expressed, without killing the cell.
  • Genes which may disable haploid cells include, but are not limited to, (1) proteins that disturb ionic gradients by forming pores in the membranes of a cell, both extracellular and intracellular, (2) proteins that interfere with the motility of sperm, e.g., by binding to microtubules, by affecting protein tyrosine kinases, etc., (3) enzymes capable of degrading DNA such as those involved in apoptosis, (4) proteins that are directly toxic to the cell, (5) enzymes that produce a compound which is toxic to the cell when supplied with an exogenous metabolite, and (6) proteins that affect energy metabolism.
  • bling can also refer to acting upon a haploid cell so as to reduce or destroy its mobility, to disrupt or degrade its DNA so as to block the ability of the DNA to be used in creating a viable offspring, or to prevent it from binding to and combining with another haploid cell (i.e., participating in fertilization). See, e.g., Uma Devi et al, Andrologia 32: 95-106 (2000); Jelks et al, Reprod. Toxicol. 15: 11-20 (2001); Jones & Bavister, J. Androl. 21: 616-24 (2000).
  • the transgene is a marker gene that encodes a product which can be detected and used as a basis for sorting haploid cells.
  • the protein encoded allows for optical detection.
  • a protein can be a fluorescent protein.
  • the term "marker gene” refers to a gene which can be used to physically separate cells expressing this marker from cells not expressing this marker.
  • One such gene is green fluorescent protein.
  • the term “sort” refers to the process of creating two populations of haploid cells with one population enriched for cells containing a specific sex chromosome. This term can refer to FACS sorting, a teclinique which is familiar to one skilled in the art. The term may also encompass others means of creating a population of cells enriched for a specific sex chromosome such as affinity purification by a marker found on the surface of cells, or some other means of selection.
  • the gene(s) described above can be expressed in the final haploid cell types produced by males and females (i.e., spermatozoa and eggs), the skilled artisan will understand that a population of these final cells enriched for cells containing a specific sex chromosome can be obtained by expressing the gene(s) in precursors to those final cells.
  • one or more transgenes can be expressed in primary spermatocytes that kill only those cells containing the transgene(s). As a result, only those cells not expressing the gene can mature into spermatozoa.
  • X sperm refers to a sperm or spermatozoa which includes only an X sex chromosome. Such cells may also be referred to as X-chromosome sperm or an X-chromosome-bearing sperm.
  • Y sperm refers to a sperm or spermatozoa which includes only a Y sex chromosome. Such cells may also be referred to as Y-chromosome sperm or an Y-chromosome-bearing sperm.
  • enriched means both purifying in an numerical sense and purifying in a functional sense. "Enriched” does not imply that there are no undesired cells are present, just that the relative amount of the cells of interest have been significantly increased in either a numeric or functional sense.
  • enriched in referring to haploid cells in a numerical sense is meant that the desired cells constitute a significantly higher fraction (2- to 5-fold) of the total haploid cells present. This would be caused by a person by preferential reduction in the amount of the other haploid cells present.
  • enriched in reference to haploid cells may also mean that the specific cells desired constitute a significantly higher fraction (2- to 5-fold) of the total, functional haploid cells present. This would be caused by a person by preferential reduction in the amount of functional undesired cells. "Enriched” may also mean that one population of haploid cells is at some competitive disadvantage in comparison to another population. For example, a small decrease in fitness of, say, X chromosome- bearing sperm may dramatically reduce their ability to compete with Y chromosome- bearing sperm to fertilize an ovum.
  • the term "significant" is used to indicate that the level of increase is useful to the person making such an increase, and generally means an increase relative to the other of haploid cells of about at least 2-fold, more preferably at least 5- to 10- fold or even more. That is, the term is meant to cover only those situations in which a person has intervened to elevate the proportion of the desired haploid cells.
  • sperm means sperm that are capable of fertilizing ova.
  • a functional sperm is motile, capable of binding to ova, capable of transferring their DNA to the ova, and contain undamaged DNA.
  • non-motile sperm can be directly injected into eggs to initiate fertilization.
  • a transgenic animal is a mammal, most preferably an ungulate.
  • Particularly preferred transgenic animals are selected from the group consisting of a bovid, ovid, suid, equid, caprid, and cervid.
  • mammalian refers to any animal of the class
  • a mammal is a placental, a monotreme and a marsupial.
  • a mammalis a canid, felid, murid, leporid, ursid, mustelid, ungulate, ovid, suid, equid, bovid, caprid, cervid, and a human or non-human primate.
  • a canid is a wolf, a jackal, a fox, and a domestic dog.
  • felid refers to any animal of the family Felidae.
  • a felid is a lion, a tiger, a leopard, a cheetah, a cougar, and a domestic cat.
  • murid refers to any animal of the family Muridae.
  • a murid is a mouse and a rat.
  • leporid refers to any animal of the family Leporidae.
  • a leporid is a rabbit.
  • ursid refers to any animal of the family Ursidae.
  • a ursid is a bear.
  • muscletelid refers to any animal of the family Mustelidae.
  • a mustelid is a weasel, a ferret, an otter, a mink, and a skunk.
  • primaryate refers to any animal of the Primate order.
  • a primate is an ape, a monkey, a chimpanzee, and a lemur.
  • ungulate refers to any animal of the polyphyletic group formerly known as the taxon Ungulata.
  • an ungulate is a camel, a hippopotamus, a horse, a tapir, and an elephant.
  • an ungulate is a sheep, a cow, a goat, and a pig.
  • bovine species are Bos taurus, Bos indicus, and Bos buffaloes cows or bulls.
  • the term "ovid” as used herein refers to any animal of the family Ovidae.
  • an ovid is a sheep.
  • suid refers to any animal of the family Suidae.
  • a suid is a pig or a boar.
  • equid refers to any animal of the family Equidae.
  • an equid is a zebra or an ass.
  • an equid is a horse.
  • bovid refers to any animal of the family Bovidae.
  • an bovid is an antelope, an oxen, a cow, and a bison.
  • caprid refers to any animal of the family Caprinae.
  • a caprid is a goat.
  • Cervid refers to any animal of the family Cervidae. Preferably, a cervid is a deer.
  • this invention relates to animals in which one or more transgenes capable of being expressed in a haploid-specific manner in cells is incorporated into the genome, and hence the haploid cells, of the transgenic animal.
  • This transgene can be under the control of a promoter region and/or an enhancer region which is capable of conferring sex chromosome-specific expression on the coupled transgene; and this transgene can also under the control of a promoter region and/or an enhancer region which only allows expression of its operably linked gene when provided specific inducing agent.
  • inducible refers to a promoter which is only active in the presence of specific inducing agent.
  • the inducing agent is supplied exogenously.
  • the inducing factor may require binding to other cellular components in order to achieve the intended result of increasing transcription. Examples of inducible promoters are well known to those skilled in the art.
  • the exogenous inducing agent may be given to the animal producing the sperm, or it may be incubated with isolated sperm.
  • the inducing agent may also be produced endogenously by the animal from which the enriched sperm is to be isolated.
  • an inducible promoter such as the IL-8 promoter that is responsive to TNF or another cytokine
  • suitable inducible promoter systems include, but are not limited to, the metallothionine inducible promoter system, the bacterial lacZYA expression system, the tetracycline expression system, and the T7 polymerase system.
  • promoters that are selectively activated at different developmental stages e.g., globin genes are differentially transcribed in embryos and adults
  • Still other possibilities include the use of a glucocorticoid response element or a tetracycline response element.
  • Protein expression is dependent on the level of RNA transcription which is regulated by DNA signals.
  • translation of mRNA requires, at the very least, an AUG initiation codon, which is usually located within 10 to 100 nucleotides of the 5' end of the mRNA. Sequences flanking the AUG initiator codon have been shown to influence its recognition by eukaryotic ribosomes, with conformity to a perfect Kozak consensus sequence resulting in optimal translation (see, e.g., Kozak, J. Molec. Biol., 1987, 196:947-950). Also, successful expression of an exogenous nucleic acid in a cell can require post-translational modification of a resultant protein.
  • production of a recombinant protein can be affected by the efficiency with which DNA (or RNA) is transcribed into mRNA, the efficiency with which mRNA is translated into protein, and the ability of the cell to carry out post-translational modification. These are all factors of which one skilled in the art is aware and is capable of manipulating using standard means to achieve the desired end result.
  • the transgenic nucleic acid sequence further comprises a polyadenylation site following the coding region of the transgenic nucleic acid. Also, preferably all the proper transcription signals (and translation signals, where appropriate) will be correctly arranged such that the transgenic nucleic acid sequence will be properly expressed in the cells into which it is introduced. If desired, the transgenic nucleic acid also can incorporate splice sites (i.e., splice acceptor and splice donor sites) to facilitate mRNA production.
  • splice sites i.e., splice acceptor and splice donor sites
  • the transgenic nucleic acid sequence encodes a protein, which is a processed or secreted protein or functions in intracellular organelles, such as a mitochondria or the endoplasmic reticulum
  • the transgenic nucleic acid further comprises the appropriate sequences for processing, secretion, intracellular localization, and the like.
  • sequences and signals are well known to those skilled in the art.
  • non-functional in reference to a spermatozoa refers to cells that are no longer capable of fertilizing an ovum. This may be due to deficiencies in chromosome integrity, motility, or composition of the outer membrane.
  • the invention relates to methods for producing a population of haploid cells which are enriched for cells containing a specific sex chromosome, either the X or the Y, where the haploid cells are harvested from an animal comprising one or more transgenes that are capable of killing or disabling cells in cis when expressed.
  • the transgene(s) are preferably under the control of a promoter which is only active in sperm containing a specific sex chromosome. In preferred embodiments, this promoter is active only in sperm containing a X chromosome; and this promoter is active only in sperm containing a Y chromosome.
  • the promoter of the invention is also only active in haploid cells.
  • the transgene then is allowed to act to kill or disable haploid cells containing the selected chromosome.
  • Viable and/or functional haploid cells may be optionally purified away from the non-functional sperm by techniques known to those skilled in the art.
  • the invention relates to methods for producing a population of haploid cells which are enriched for cells containing a specific sex chromosome, either the X or the Y, where the haploid cells are harvested from an animal comprising one or more transgenes which are capable of killing or disabling cells in cis when expressed, where the promoter of the invention is only active in the presence of an inducing agent.
  • this promoter is active only in haploid cells containing a X chromosome, and this promoter is active only in haploid cells containing a Y chromosome.
  • the cells are exposed to an inducing agent, and the promoter region of the transgene(s) then acts to express the trans gene(s) in cells containing one sex chromsome but not the other.
  • the haploid cells may be exposed in vivo, either in the source animal or in the maternal host, or they may be exposed in vitro.
  • the transgene then acts to kill or disable those haploid cells containing the selected chromosome.
  • one or more transgenes may optionally be used which do not kill or disable the haploid cells expressing the transgene(s), but rather causes the expression of a marker gene.
  • This expressed marker may then be used to sort X-chromosome-bearing cells from Y-chromosome-bearing cells by techniques well known to those skilled in the art.
  • the invention relates to methods for producing an animal using a population of spermatozoa that is enriched for cells containing a specific sex chromosome, either the X or the Y.
  • the offspring produced will thus be primarily of the selected sex.
  • the resultant embryo is transplanted into a maternal host.
  • the invention relates to recombinant nucleic acids arranged and configured for performing the aspects described above, whether in vitro or in a cell or an organism.
  • the transgenes of the instant invention are preferably comprised in the transgenic animals of the invention.
  • the recombinant nucleic acids can alternatively contain a transcriptional initiation region functional in a cell, a sequence complementary to an RNA sequence encoding a protease polypeptide and a transcriptional termination region functional in a cell. Specific vectors and host cell combinations are discussed herein.
  • the present invention also relates to cells and/or organisms that contain the foregoing transgenic nucleic acid molecules incorporated into the genome, and thereby which are capable of expressing a polypeptide or other gene of interest.
  • a cell is said to be "altered to express a desired polypeptide or other gene of interest" when the cell, through genetic manipulation, is made to produce a protein or other gene of interest which it normally does not produce or which the cell normally produces at lower levels.
  • One skilled in the art can readily adapt procedures for introducing and expressing either genomic, cDNA, or synthetic sequences into eukaryotic cells.
  • a nucleic acid molecule such as DNA, is said to be "capable of expressing" a polypeptide or other gene of interest if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are “operably linked” to nucleotide sequences which encode the polypeptide.
  • An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene sequence expression.
  • the precise nature of the regulatory regions needed for gene sequence expression may vary from organism to organism, but shall in general include a promoter region and other 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
  • Two DNA sequences are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region sequence to direct the transcription of a gene sequence encoding the gene of interest, or (3) interfere with the ability of the gene sequence of the gene of interest to be transcribed by the promoter region sequence.
  • a promoter region would be operably linked to a DNA sequence if the promoter were capable of effecting transcription of that DNA sequence.
  • transcriptional and translational signals recognized by an appropriate host are necessary.
  • the present invention encompasses the expression of a gene encoding the gene of interest (or a functional derivative thereof) in eukaryotic cells.
  • control sequences are dependent on the type of host cell used to express the gene, and their selection is well within the skill of the artisan.
  • cell As used herein, "cell”, “cell line”, and “cell culture” may be used interchangeably and all such designations include progeny.
  • the words “transformants” or “transformed cells” include the primary subject cell and cultures derived therefrom, without regard to the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. However, as defined, mutant progeny have the same functionality as that of the originally transformed cell.
  • vector relates to a single or double-stranded circular nucleic acid molecule that can be transfected into cells and replicated within or independently of a cell genome.
  • a circular double-stranded nucleic acid molecule can be cut and thereby linearized upon treatment with restriction enzymes.
  • restriction enzymes An assortment of nucleic acid vectors, restriction enzymes, and the knowledge of the nucleotide sequences cut by restriction enzymes are readily available to those skilled in the art.
  • a nucleic acid molecule encoding a protease can be inserted into a vector by cutting the vector with restriction enzymes and ligating the two pieces together.
  • Preferred vectors are those designed for performing "gene targeting" procedures. See, e.g., U.S. Patents No. 6,090,554, 6,069,010, 5,792,663, and 5,789,215, each of which is hereby incorporated by reference in its entirety, including all tables, figures, and claims.
  • the term "transfecting" defines a number of methods to insert a nucleic acid vector or other nucleic acid molecules into a cellular organism. These methods involve a variety of techniques, such as treating the cells with high concentrations of salt, an electric field, detergent, or DMSO to render the outer membrane or wall of the cells permeable to nucleic acid molecules of interest or use of various viral transduction strategies. [0070] A wide variety of transcriptional and translational regulatory sequences may be employed, depending upon the nature of the host.
  • the transcriptional and translational regulatory signals may be derived from viral sources, such as adenovirus, bovine papilloma virus, cytomegalovirus, simian virus, or the like, where the regulatory signals are associated with a particular gene sequence which has a high level of expression.
  • viral sources such as adenovirus, bovine papilloma virus, cytomegalovirus, simian virus, or the like
  • promoters from mammalian expression products such as actin, collagen, myosin, and the like
  • Transcriptional initiation regulatory signals may be selected which allow for repression or activation, so that expression of the gene sequences can be modulated.
  • regulatory signals which are temperature-sensitive so that by varying the temperature, expression can be repressed or initiated, or are subject to chemical (such as metabolite) regulation.
  • eukaryotic regulatory regions Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis.
  • Preferred eukaryotic promoters include, for example, the promoter of the mouse metallothionein I gene sequence (Hamer et al, J. Mol. Appl. Gen. 1 :213-288, 1982); the TK promoter of Herpes virus (McKnight, Cell 31:355-365, 1982); the SV40 early promoter (Benoist et al, Nature (London) 290:304-31, 1981); and the yeast gal4 gene sequence promoter (Johnston et al, Proc. Natl Acad. Sci. (USA) 79:6971-6975, 1982; Silver et al, Proc. Natl. Acad. Sci. (USA) 81:5951-5955, 1984).
  • a nucleic acid molecule encoding the gene of interest and an operably linked promoter may be introduced into a recipient host cell either as a nonreplicating DNA or RNA molecule, which may either be a linear molecule or, more preferably, a closed covalent circular molecule. Permanent expression will occur through the integration of the introduced DNA sequence into the host chromosome.
  • a vector may be employed which is capable of integrating the desired gene sequences into the host cell chromosome.
  • Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more markers which allow for selection of host cells which contain the expression vector.
  • the marker may provide for prototrophy to an auxotrophic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper, or the like.
  • the selectable marker gene sequence can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. Additional elements may also be needed for optimal synthesis of mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals.
  • cDNA expression vectors incorporating such elements include those described by Okayama (Mol Cell Biol 3:280-289, 1983).
  • the introduced nucleic acid molecule can be incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host. Any of a wide variety of vectors may be employed for this purpose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species.
  • the DNA construct(s) may be introduced into an appropriate host cell by any of a variety of suitable means, i.e., transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate-precipitation, direct microinjection, and the like.
  • suitable means i.e., transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate-precipitation, direct microinjection, and the like.
  • recipient cells are grown in a selective medium, which selects for the growth of vector-containing cells. Expression of the cloned gene(s) results in the production of the gene of interest, or fragments thereof.
  • Figures 1 shows, in schematic form, spermatogenesis, i.e., the production of haploid cells from diploid precursors that occurs in male ammals.
  • Figure 2 shows, in schematic form, an exemplary procedure for producing a transgenic animal of the invention.
  • the present invention describes materials and methods for producing semen that is enriched for active sperm containing either the X chromosome or the Y chromosome, by producing transgenic animals that express one or more genes in a sex chromosome-specific and/or haploid-specific manner.
  • the ability to pre-select the sex of an offspring is particularly advantageous in the agricultural industry.
  • the materials and methods described herein can facilitate this sex pre-selection.
  • Methods for generating transgenic cells typically include the steps of (1) assembling a suitable DNA construct useful for inserting a specific DNA sequence into the nuclear genome of a cell; (2) transfecting the DNA construct into the cells; (3) allowing random insertion and/or homologous recombination to occur.
  • the modification resulting from this process may be the insertion of a suitable DNA construct(s) into the target genome; deletion of DNA from the target genome; and/or mutation of the target genome.
  • DNA constructs can comprise a gene of interest as well as a variety of elements including regulatory promoters, insulators, enhancers, and repressors as well as elements for ribosomal binding to the RNA transcribed from the DNA construct.
  • DNA constructs can also encode ribozymes and anti-sense DNA and/or RNA, identified previously herein. These examples are well known to a person of ordinary skill in the art and are not meant to be limiting.
  • Preferred vectors for use in the present invention are gene targeting vectors, in order to mediate insertion of a gene of interest by homologous recombination with a site in the host genome.
  • Such vectors typically include four major elements.
  • a promoter is linked to, and drives, the expression of a gene.
  • An Y or X chromosome specific DNA sequence is linked to the promoter/gene elements.
  • the Y or X chromosome specific sequence is to be used as homologous arms for targeting the vector to the Y or X chromosome, respectively.
  • a selection marker such as the neomycin-resistance gene, neo (Southern, P.J. & Berg, P.
  • Preferred elements of the vectors which may be obtained and incorporated into the targeting vectors include novel sequence of both the bovine (Lee et al (1987) Biol Chem Hoppe Seyler 368: 131-135; Krawetz et al., (1988) JBiol Chem 263: 321-326) and porcine (Maier et al, (1988) Nucleic Acids Res 16: 11826) protamine promoters.
  • a preferred toxic gene a dominant negative mutant of hamster BiP protein, plus wild-type hamster BiP protein, to disrupt proper protein folding in X- or Y-bearing sperm have been disclosed (Hendershot et al., (1996) Proc Natl Acad Sci USA 93: 5269-5274; Morris et al., (1997) JBiol Chem 111: 4327-4334).
  • Suitable bovine and porcine Y chromosome specific sequences 3' of the SRY gene (Hacker et al., (1995) Development 121: 1603-1614) to be used as homologous arms for gene targeting have also been disclosed.
  • insertion vectors containing the promoter, gene sequence, selectable marker, and a homologous arm have been constructed.
  • a schematic of such a vector is provided below.
  • the vector can be linearized by cutting with a restriction enzyme that bisects the homologous arm prior to transfection to provide a mature insertion vector.
  • Transfection techniques are well known to a person of ordinary skill in the art and materials and methods for carrying out transfection of DNA constructs into cells are commercially available.
  • materials that can be used to transfect cells with DNA constructs are lipophillic compounds such as LipofectinTM, activated polycationic dendrimers such as SuperfectTM, LipoTAXITM, and CLONfectinTM. Particular lipophillic compounds can be induced to form liposomes for mediating transfection of the DNA construct into the cells.
  • cationic based transfection agents that are known in the art can be utilized to transfect cells with nucleic acid molecules (e.g., calcium phosphate precipitation).
  • electroporation techniques known in the art can be utilized to translocated nucleic acid molecules into cells.
  • particle bombardment techniques known in the art can be utilized to introduce exogenous DNA into cells.
  • Target sequences from a DNA construct can be inserted into specific regions of the nuclear genome by rational design of the DNA construct.
  • the protamine promoter can be used to establish haploid-specific and/or tissue-specific gene expression.
  • Protamine is a small, basic protein that binds to DNA during the condensation and compaction of the sperm head. Protamine is expressed exclusively in testis, and it is expressed at the haploid stage in round spermatids following the completion of meiosis.
  • Regulatory sequences for this gene have been found in about 10 species, including bovines. Krawetz et al, 1988, J. Biol. Chem. 263: 321-326; Queralt and Olivia, 1993, Gene 133: 197-204.
  • cytoplasmic bridges that allow sharing of soluble cell contents between adj acent cells.
  • the expression product may kill cells containing both sex chromosomes. Therefore, it may be important to select a gene product that produces its effects only in cis.
  • Such a gene product preferably exhibits the following characteristics: the ability to exert its effects in a dominant fashion (i.e., expression of the transgene alone creates the effect, even against an otherwise wild type expression background); the ability to remain anchored to the matrix of the cell in which it is produced; and participation in an essential function, so that expression causes death or disablement of the cell.
  • BiP immunoglobulin heavy chain binding protein
  • ER disrupted endoplasmic reticulum
  • transgene(s) is (are) inserted into the nuclear genome of the totipotent cell, that cell can be used as a nuclear donor for cloning a transgenic animal.
  • Exemplary embodiments define a NT technique that provide for efficient production of totipotent mammalian embryos.
  • a donor cell may be separated from a growing cell mass, isolated from a primary cell culture, or isolated from a cell line. The entire cell may be placed in the perivitelline space of a recipient oocyte or may be directly injected into the recipient oocyte by aspirating the nuclear donor into a needle, placing the needle into the recipient oocyte, releasing the nuclear donor and removing the needle without significantly disrupting the plasma membrane of the oocyte.
  • a nucleus e.g., karyoplast
  • a recipient cell is typically an oocyte with a portion of its ooplasm removed, where the removed ooplasm comprises the oocyte nucleus.
  • Enucleation techniques are well known to a person of ordinary skill in the art. See e.g., Nagashima et al, 1997, Mol Reprod. Dev. 48: 339-343; Nagashima et al, 1992, J. Reprod.
  • Oocytes can be isolated from either oviducts and/or ovaries of live animals by oviductal recovery procedures or transvaginal oocyte recovery procedures well known in the art and described herein. Furthermore, oocytes can be isolated from deceased animals. For example, ovaries can be obtained from abattoirs and oocytes can be aspirated from these ovaries. The oocytes can also be isolated from the ovaries of a recently sacrificed animal or when the ovary has been frozen and/or thawed. [0103] Oocytes can be matured in a variety of media well known to a person of ordinary skill in the art.
  • Oocytes can be successfully matured in this type of medium within an environment comprising 5% CO 2 at 39°C. Oocytes may be cryopreserved and then thawed before placing the oocytes in maturation medium. Cryopreservation procedures for cells and embryos are well known in the art as discussed herein.
  • Components of an oocyte maturation medium can include molecules that arrest oocyte maturation. Examples of such components are 6- dimethylaminopurine (DMAP) and isobutylmethylxanthine (IBMX). IBMX has been reported to reversibly arrest oocytes, but the efficiencies of arrest maintenance are quite low. See, e.g., Rose-Hellkant and Bavister, 1996, Mol. Reprod. Develop. 44: 241-249. However, oocytes may be arrested at the germinal vesicle stage with a relatively high efficiency by incubating oocytes at 31 °C in an effective concentration of IBMX. Preferably, oocytes are incubated the entire time that oocytes are collected.
  • DMAP 6- dimethylaminopurine
  • IBMX isobutylmethylxanthine
  • Concentrations of IBMX suitable for arresting oocyte maturation are 0.01 mM to 20 mM IBMX, preferably 0.05 mM to 10 mM IBMX, and more preferably about 0.1 mM IBMX to about 0.5 mM IBMX, and most preferably 0.1 mM IBMX to 0.5 mM IBMX.
  • oocytes can be matured in a culture environment having a low oxygen concentration, such as 5% O 2 , 5-10% CO , and 85-90% N 2 .
  • a nuclear donor cell and a recipient oocyte can arise from the same species or different species.
  • a totipotent porcine cell can be inserted into a porcine enucleated oocyte.
  • a totipotent wild boar cell can be inserted into a domesticated porcine oocyte.
  • Any nuclear donor/recipient oocyte combinations are envisioned by the invention.
  • the nuclear donor and recipient oocyte from the same specie.
  • Cross-species NT techniques can be utilized to produce cloned animals that are endangered or extinct.
  • Oocytes can be activated by electrical and/or non-electrical means before, during, and/or after a nuclear donor is introduced to recipient oocyte.
  • an oocyte can be placed in a medium containing one or more components suitable for non-electrical activation prior to fusion with a nuclear donor.
  • a cybrid can be placed in a medium containing one or more components suitable for nonelectrical activation. Activation processes are discussed in greater detail hereafter.
  • a nuclear donor can be translocated into an oocyte using a variety of materials and methods that are well known to a person of ordinary skill in the art.
  • a nuclear donor maybe directly injected into a recipient oocyte. This direct injection can be accomplished by gently pulling a nuclear donor into a needle, piercing a recipient oocyte with that needle, releasing the nuclear donor into the oocyte, and removing the needle from the oocyte without significantly disrupting its membrane.
  • Appropriate needles can be fashioned from glass capillary tubes, as defined in the art and specifically by publications incorporated herein by reference.
  • At least a portion of plasma membrane from a nuclear donor and recipient oocyte can be fused together by utilizing techniques well known to a person of ordinary skill in the art. See, Willadsen, 1986, Nature 320:63-65, hereby incorporated herein by reference in its entirety including all figures, tables, and drawings.
  • lipid membranes can be fused together by electrical and chemical means, as defined previously and in other publications incorporated herein by reference.
  • Examples of non-electrical means of cell fusion involve incubating cybrids in solutions comprising polyethylene glycol (PEG), and/or Sendai virus.
  • PEG polyethylene glycol
  • Sendai virus Sendai virus
  • Both electrical and non-electrical processes can be used for activating cells (e.g., oocytes and cybrids). Although use of a non-electrical means for activation is not always necessary, non-electrical activation can enhance the developmental potential of cybrids, particularly when young oocytes are utilized as recipients.
  • Non-electrical means for activating cells can include any method known in the art that increases the probability of cell division.
  • non-electrical means for activating a nuclear donor and/or recipient can be accomplished by introducing cells to ethanol; inositol trisphosphate (IP 3 ); Ca 2+ ionophore and protein kinase inhibitors such as 6-dimethylaminopurine; temperature change; protein synthesis inhibitors (e.g., cycloheximide); phorbol esters such as phorbol 12-myristate 13-acetate (PMA); mechanical techniques, thapsigargin, and sperm factors.
  • Sperm factors can include any component of a sperm that enhance the probability for cell division.
  • Other non-electrical methods for activation include subjecting the cell or cells to cold shock and/or mechanical stress.
  • Examples of preferred protein kinase inhibitors are protein kinase A, G, and C inhibitors such as 6-dimethylaminopurine (DMAP), staurosporin, 2-aminopurine, sphingosine. Tyrosine kinase inhibitors may also be utilized to activate cells.
  • DMAP 6-dimethylaminopurine
  • staurosporin 2-aminopurine
  • 2-aminopurine 2-aminopurine
  • sphingosine sphingosine
  • Tyrosine kinase inhibitors may also be utilized to activate cells.
  • An embryo resulting from a NT process can be manipulated in a variety of manners.
  • the invention relates to cloned embryos that arise from at least one NT.
  • Exemplary embodiments of the invention demonstrate that two or more NT procedures may enhance the efficiency for the production of totipotent embryos.
  • Exemplary embodiments indicate that incorporating two or more NT procedures into methods for producing cloned totipotent embryos may enhance placental development, hi addition, increasing the number of NT cycles involved in a process for producing totipotent embryos may represent a necessary factor for converting non-totipotent cells into totipotent cells.
  • An effect of incorporating two or more NT cycles upon totipotency of resulting embryos is a surprising result, which was not previously identified or explored in the art.
  • Incorporating two or more NT cycles into methods for cloned totipotent embryos can provide further advantages. Incorporating multiple NT procedures into methods for establishing cloned totipotent embryos provides a method for multiplying the number of cloned totipotent embryos.
  • oocytes that have been matured for any period of time can be utilized as recipients in the first, second or subsequent NT procedures.
  • one or more of the NT cycles may be preceded, followed, and/or carried out simultaneously with an activation step.
  • an activation step may be accomplished by electrical and/or non-electrical means as defined herein. Exemplified embodiments described hereafter describe NT techniques that incorporate an activation step after one NT cycle.
  • an activation step may also be carried out at the same time as a NT cycle (e.g., simultaneously with the NT cycle) and/or an activation step may be carried out prior to a NT cycle.
  • Cloned totipotent embryos resulting from a NT cycle can be (1) disaggregated or (2) allowed to develop further.
  • disaggregated embryonic derived cells can be utilized to establish cultured cells. Any type of embryonic cell can be utilized to establish cultured cells. These cultured cells are sometimes referred to as embryonic stem cells or embryonic stem-like cells in the scientific literature.
  • the embryonic stem cells can be derived from early embryos, morulae, and blastocyst stage embryos. Multiple methods are known to a person of ordinary skill in the art for producing cultured embryonic cells. These methods are enumerated in specific references previously incorporated by reference herein.
  • EG cells embryonic germ cells
  • Streptomyces griseus protease can be used to remove unwanted cells from theembryonic germ cell culture.
  • NT totipotent embryos resulting from NT can also be manipulated by cryopreserving and/or thawing the embryos. See, e.g., Nagashima et al, 1989, Japanese J. Anim. Reprod. 35: 130-134 and Feng et al, 1991, Theriogenology 35: 199, each of which is incorporated herein by reference in its entirety including all tables, figures, and drawings.
  • Other embryo manipulation methods include in vitro culture processes; performing embryo transfer into a maternal recipient; disaggregating blastomeres for NT processes; disaggregating blastomeres or inner cell mass cells for establishing cell lines for use in NT procedures; embryo splitting procedures; embryo aggregating procedures; embryo sexing procedures; and embryo biopsying procedures.
  • the exemplary manipulation procedures are not meant to be limiting and the invention relates to any embryo manipulation procedure known to a person of ordinary skill in the art.
  • Cloning procedures discussed herein provide an advantage of culturing cells and embryos in vitro prior to implantation into a recipient female. Methods for culturing embryos in vitro are well known to those skilled in the art. See, e.g., Nagashima etal, 1991, Mol. Reprod. Dev. 48: 339-343; Petters & Wells, 1993, J. Reprod. Fert. (Suppl) 48: 61-73; Reed et al, 1992, Theriogenology 37: 95-109; and Dobrinsky et al, 1996, Biol Reprod. 55: 1069-1074, each of which is incorporated herein by reference in its entirety, including all figures, tables, and drawings.
  • Feeder cell layers may or may not be utilized for culturing cloned embryos in vitro. Feeder cells are described previously and in exemplary embodiments hereafter.
  • Cloned embryos can be cultured in an artificial or natural uterine environment after NT procedures and embryo in vitro culture processes.
  • artificial development environments are being developed and some are known to those skilled in the art.
  • Components of the artificial environment can be modified, for example, by altering the amount of a component or components and by monitoring the growth rate of an embryo.
  • Methods for implanting embryos into the uterus of an animal are also well known in the art, as discussed previously.
  • the developmental stage of the embryo(s) is correlated with the estrus cycle of the animal.
  • Embryos from one species can be placed into the uterine environment of an animal from another species.
  • bovine embryos can develop in the oviducts of sheep. Stice & Keefer, 1993, "Multiple generational bovine embryo cloning," Biology of Reproduction 48: 715-719.
  • the invention relates to any combination of a porcine embryo in any other ungulate uterine environment.
  • a cross-species in utero development regime can allow for efficient production of cloned animals of an endangered species.
  • a wild boar embryo can develop in the uterus of a domestic porcine sow.
  • an embryo Once an embryo is placed into the uterus of a recipient female, the embryo can develop to term. Alternatively, an embryo can be allowed to develop in the uterus and then can be removed at a chosen time. Surgical methods are well known in the art for removing fetuses from uteri before they are born.
  • Preferred targeting vectors include four major elements.
  • a promoter preferably the protamine gene promoter, is linked to, and drives, the expression of a gene, preferably the hamster BiP protein, to disrupt sperm development. Both wild- type and mutant hamster BiP genes may be used to prepare vectors.
  • the third element of the vectors is a Y or X chromosome specific DNA sequence which is linked to the promoter/gene elements. The Y or X chromosome specific sequence is to be used as homologous arms for targeting the vector to the Y or X chromosome, respectively.
  • the fourth element of the vectors is a selection marker, such as the neomycin-resistance gene, neo (Southern, P.J. & Berg, P. (1982) JMol Appl Genet 1 : 327-341).
  • Preferred elements of the vectors which may be obtained and incorporated into the targeting vectors include novel sequence of both the bovine (Lee et al (1987) Biol Chem Hoppe Seyler 368: 131-135; Krawetz et al., (1988) JBiol Chem 263: 321-326) and porcine (Maier et al., (1988) Nucleic Acids Res 16: 11826) protamine promoters.
  • a preferred toxic gene a dominant negative mutant of hamster BiP protein, plus wild-type hamster BiP protein, to disrupt proper protein folding in X- or Y-bearing sperm have been disclosed (Hendershot et al., (1996) Proc Natl Acad Sci USA 93: 5269-5274; Morris et al, (1997) JBiol Chem 111: 4327-4334).
  • Suitable bovine and porcine Y chromosome specific sequences 3' of the SRY gene (Hacker et al., (1995) Development 111: 1603-1614) to be used as homologous arms for gene targeting have also been disclosed.
  • protamine 1 begins from nucleotide 208 of the published sequence, and contains only 390 bp of the 5' flanking region, hi addition, a ⁇ 1 kb sequence which is located further upstream of the protamine 1 gene was obtained.
  • Table 1 Published bovine protamine 1 gene sequence (5' to 3') (SEQ ID NO: 1).
  • the EcoRI site at nt 202-207 is italicized and underlined.
  • the star indicates the transcription start site and the atg start codon is underlined.
  • the italicized and bold sequence is the intron 1 region of protamine 1.
  • a preferred promoter sequence used in the present invention is shown below in Table 3. This promoter sequence is shown in the same orientation as that of
  • sequences contain nt 202 -nt 690 (before the atg start codon) of the published bovine protamine 1 sequence (shown in italics) and 852 bp of sequence obtained in the present invention (shown in bold, also shown in Fig. 2 in italics, including the underlined region).
  • a Clontech Genomic Walking kit was used to isolate a promoter sequence from the porcine protamine gene.
  • the two walking primers used based on known sequences were:
  • PP1W1 5' GACTTCCTAAAGGATGAGTCAGAGTTGGAGG 3' (SEQ ID NO: 4)
  • PP1 W2 5 ' GGAACAGCAGGTGCTAAGTTCTGAGGCAG 3 ' (SEQ ID NO: 5)
  • a -1.0 kb fragment was amplified and sequenced, and the sequence obtained is shown in Table 4.
  • the underlined sequence matches nt 1 to nt 47 of the published sequence.
  • a preferred sequence for use in a porcine targeting construct contains nt 1 - nt 694 of the published porcine protamine sequence and 954 bp of sequence obtained in the present invention (bold italics), as shown in Table 5.
  • Preferred promoter sequences are those in which no more than about 2% of the nucleotides differ by deletion, substitution, and/or addition from the sequences disclosed herein; more preferably no more than about 1% of the nucleotides differ by deletion, substitution, and/or addition from the sequences disclosed herein; even more preferably no more than about 0.5 % of the nucleotides differ by deletion, substitution, and/or addition from the sequences disclosed herein; and most preferably no more than about 0.1% of the nucleotides differ by deletion, substitution, and/or addition from the sequences disclosed herein.
  • the term "about" in this context refers to
  • +/- 10% of a given percentage e.g., about 1% refers to from 0.9% to 1.1%.
  • a preferred gene for use in disrupting sperm function is the dominant negative mutant of hamster BiP protein disclosed in Hendershot et al., (1996) Proc Natl Acad Sci USA 93: 5269-521 A. This dominant negative mutant has been shown to cause improper protein folding and abnormal expansion of ER in monkey cells (COS cells). Expansion of ER may affect the compaction of sperm head during spermatogenesis and improper folding of sperm surface proteins would disrupt the function and motility of sperm. Since BiP is a native ER protein, it is less likely to diffuse through the cytoplasmic bridges connecting the developing spermatids.
  • the mutant BiP is expressed in X- or Y-bearing sperm by targeting the BiP cDNA to X or Y chromosome, it may disrupt the function of the sperm population that expresses it.
  • the sequence of wild type hamster BiP is shown below in Table 6.
  • the dominant negative mutant of BiP is identical to the wild type with the exception of a change in the codon at nt 259 from ACC (coding for threonine at amino acid 37) to GGC (coding for glycine).
  • the preferred segment of the gene that was used in the present invention is bounded by the nucleotides indicated in bold underline; the start and stop codons of the coding segment of the gene are indicated in italic underline.
  • Table 6 Hamster BiP cDNA sequence (5' to 3') (SEQ ID NO: 8)
  • Targeting a specific chromosome site is usually accomplished by insertion of a construct (containing a gene of interest and preferably containing a selectable marker, often neomycin resistance) into a host genome, causing disruption of splicing, promoter function, or reading frame, with or without deletion of the targeted gene. Incorporation of the construct into the genome depends upon insertion into, or replacement of, the endogenous gene by homologous recombination through one or more arms of the construct into one allele of genomic DNA. As starting material, a genomic clone of reasonable length must be obtained from a host genome.
  • homologous arm typically at least about 1 kB of uninterrupted sequence is used as a homologous arm, preferably at least about 2 kB, more preferably at least about 4 kB, even more preferably at least about 6 kB, and even more preferably about 7 kB.
  • the arms need not be equal in length (e.g., one arm may contain about 4 kB of sequence, the other about 2 kB).
  • the term "about” as used in this context refers to +/- 1-% of a given dimension.
  • SRY sequence was used as a probe to screen a bovine BAC library to identify sufficient sequence to act as a homologous arm.
  • the primers used for library screening were:
  • SRYF3 5' GCA CCT GTG AGA CCC AAG GTT TCA TCT C 3' (SEQ ID NO: 9)
  • SRYR1 5' CAC CTC ATC AGA TTA ATC AGA CAG G 3' (SEQ ID NO: 10)
  • BAC clone containing the bovine SRY gene was isolated, and the genome sequenced towards the 3' end of the gene. About 11 kB of sequence downstream of SRY on Y chromosome was identified, as shown in
  • Table 7 A 6.6 kB segment of the sequence was used as the homologous arm in the insertion vector, as shown in Table 8.
  • Table 7 An 11 kb sequence 3' of the bovine SRY gene (5' to 3') (SEQ ID NO:
  • porcine SRY gene sequence was used to screen a porcine BAC library to isolate a clone containing the porcine SRY.
  • the primers used for library screening in the present invention were:
  • PSRYF1 5'cacctgtgact tagtttcag 3 ' (SEQ ID NO: 13)
  • PSRYR1 5'ggctaatcacgggaacaac 3' (SEQ ID NO: 14)
  • nucleotides may be deleted, substituted, and/or added to such a sequence while still providing a functional homologous arm.
  • Preferred homologous arms are those in which no more than about 2% of the nucleotides differ by deletion, substitution, and/or addition from the sequences disclosed herein; more preferably no more than about 1% of the nucleotides differ by deletion, substitution, and/or addition from the sequences disclosed below; even more preferably no more than about 0.5 % of the nucleotides differ by deletion, substitution, and/or addition from the sequences disclosed herein; and most preferably no more than about 0.1% of the nucleotides differ by deletion, substitution, and/or addition from the sequences disclosed herein.
  • the term "about” in this context refers to +/- 10%) of a given percentage (e.g., about 1% refers to from 0.9%o to 1.1%).
  • the cells were subjected to electroporation using 250V and 960 ⁇ F (BioRad GenePulser with Capacitance Extender, BioRad Laboratories) and the contents of each cuvette were aliquoted equally into five, 100 mm culture dishes and cultured in Amniomax medium. An aliquot of body cells (1.2x10 ) was similarly transfected and cultured.
  • Non-transfected control cells were passaged into selection medium at the same time. Following 14 days of selection, the control cells were dead, while the transfected cells had given rise to drug-resistant colonies. For the genital ridge colonies, the cells were trypsinized, counted and aliquoted into 96-well plates seeding an average of 2 cells per well; drug selection was lowered to 100 ⁇ g ml. The 96-well plates were monitored daily until confluent wells were observed. Typically, cells in these wells were passaged into duplicate wells so that cells could be analyzed and if found to be positive, frozen for future nuclear transfer. In populations of bovine body and genital ridge cells transfected with the mutant BiP-containing vector, PCR analysis indicated that the vector had been incorporated into the genome of the cells.
  • Sow and gilt ovaries were collected at separate, local abattoirs and maintained at 30° C during transport to the laboratory. Follicles ranging from 2-8 mm were aspirated into 50 ml conical centrifuge tubes (BD Biosciences, Franklin Lakes,
  • Oocytes surrounded by a compact cumulus mass were selected and placed into North Carolina State University (NCSU) 37 oocyte maturation medium (Petters et al, J Reprod Fertil Suppl 48, 61-73 (1993)) supplemented with 0.1 mg/ml cysteine (Grupen et al, Biol Reprod 53, 173-178 (1995)), 10 ng/ml EGF (epidermal growth factor) (Grupen et al, Reprod Fertil Dev 9, 571-575 (1997)), 10% PFF (porcine follicular fluid) (Naito et al, Gamete Res 21, 289- 295 (1988)), 0.5 mg/ml cAMP (Funahashi et al, Biol Reprod 57, 49-53 (1997)), 10
  • NCSU North Carolina State University
  • a single donor cell obtained from a confluent culture by trypsin-EDTA dissociation was placed in the perivitelline space of the oocyte so as to contact the oocyte membrane.
  • a single electrical pulse of 95 volts for 45 ⁇ sec from an ElectroCell Manipulator 200 (Genetronics, San Diego, CA) was used to fuse the membranes of the donor cell and oocyte, forming a cybrid.
  • the fusion chamber consisted of wire electrodes 500 um apart and the fusion medium was SOR2 (0.25 M sorbitol, 0.1 mM calcium acetate, 0.5 mM magnesium acetate, 0.1% BSA, pH 7.2, and osmolarity 250). Following the fusion pulse, cybrids were incubated in CR2 embryo culture medium for approximately 4 hours prior to activation.
  • Oocytes/cybrids were activated by incubation in 15 ⁇ M calcium ionomycin (Calbiochem, San Diego, CA) for 20 minutes followed by incubation with 1.9 mM 6-dimethylaminopurine (DMAP) in CR2 for 3-4 hours. After DMAP incubation, cybrids were washed through two 35 mm plates containing TL-HEPES, cultured in CR2 medium containing BSA (3 mg/ml) for 48 hours, then placed in NCSU
  • NCSU 23 medium containing 0.4% BSA for 24 hours followed by a final culture in NCSU 23 containing 10% FBS. Total time in culture was for 0-4 days following activation.
  • Embryos cultured 48 hours or more were placed in the tip of the uterine horn using a similar catheter.
  • 100- 300 NT embryos were placed in the oviduct or uterine tip, depending on embryonic stage and 100 IVF embryos were placed in the oviduct. All recipients and protocols conformed to University of Wisconsin animal health-care guidelines.
  • Ultrasound detection of pregnancy was accomplished using an Aloka 500 ultrasound scanner (Aloka Co. Ltd, Wallingford, CT) with an attached 3.5 MHz trans-abdominal probe.
  • Monitoring for pregnancy initiation began at 23 days post fusion/fertilization and repeated as necessary through day 40. Pregnant recipients were reexamined by ultrasound weekly.
  • Oocytes aspirated from ovaries were matured overnight (about 16-18 hours) in maturation medium.
  • Medium 199 Biowhittaker, Cat #12-119F
  • luteinizing hormone 10IU/ml LH; Sigma, Cat # 13113
  • 1 mg/ml estradiol Sigma, Cat # E8875
  • 10% FCS or estrus cow serum was used.
  • Oocytes were stripped of their cumulus cell layers and nuclear material stained with Hoechst 33342 5mg/ml (Sigma, Cat # 2261) in TL HEPES solution supplemented with cytochalasin B (7 ⁇ g/ml, Sigma, Cat # C6762) for 15 min. Oocytes were then enucleated in TL HEPES solution under mineral oil. A single nuclear donor cell of optimal size (12 to 15 ⁇ m) was then inserted from a cell suspension and injected into the perivitelline space of the enucleated oocyte. The cell and oocyte membranes were then induced to fuse by electrofusion in a 500 ⁇ m chamber by application of an electrical pulse of 90V for 15 ⁇ s, forming a cybrid.
  • cybrid activation was induced by a 4 min exposure to 5 ⁇ M calcium ionophore A23187 (Sigma Cat. # C-7522) or ionomycin Ca-salt in HECM (hamster embryo culture medium) containing 1 mg/ml BSA followed by a 1 :1000 dilution in HECM containing 30 mg/ml BSA for 5 min.
  • HECM medium see, e.g., Seshagiri & Barister, 1989, "Phosphate is required for inhibition of glucose of development of hamster eight-cell embryos in vitro," Biol.
  • Embryos from the first generation NT at the morula stage were disaggregated either by pronase E (1-3 mg/ml in TL HEPES) or mechanically after treatment with cytochalasin B. Single blastomeres were placed into the perivitelline space of enucleated aged oocytes (28-48 hours of incubation). Aged oocytes were produced by incubating matured "young" oocytes for an additional time in CR2 media with 3 mg/ml BSA in humidified air with 5% CO 2 at 39°C.
  • a blastomere from a nuclear transfer embryo was fused into the enucleated oocyte via electrofusion in a 500 ⁇ m chamber with an electrical pulse of 105 V for 15 ⁇ s in an isotonic sorbitol solution (0.25 M) at 30°C.
  • Aged oocytes were simultaneously activated with a fusion pulse, not by chemical activation as with young oocytes.
  • the cybrids from the first or second generation NT were cultured in CR2 media supplemented with BSA (3 mg/ml) under humidified air with 5% CO 2 at 39°C.
  • BSA 3 mg/ml
  • developing embryos were evaluated and cultured further until day seven in CR2 media containing 10% FCS. Morphologically good to fair quality embryos were non-surgically transferred into recipient females.
  • Matured oocytes were inseminated by the procedures described by Long et al. (Theriogenology 51, 1375-1390 (1999)) with a modification described by Grupen and Nottle (Theriogenology 53, 422 (2000)). Briefly, 50 matured oocytes stripped of their cumulus and in a volume of 3 ⁇ l, were placed into 92 ⁇ l drops of fertilization medium (TLP-PVA). Each drop containing oocytes was inseminated with 5 ⁇ l of fertilization medium containing 2000 sperm. Fresh boar semen was purchased from Genes Diffusion (Stoughton, WI). Several different boars were used during the course of these experiments.
  • oocytes After 10 minutes of co-incubation with sperm, the oocytes were moved to a fresh drop of fertilization medium and incubated for an additional 5 hours. Oocytes were washed through unused fertilization drops to remove sperm and cultured in NCSU 23 with 0.4% BSA until embryos were transferred into recipients 0-4 days post-fertilization. Embryos that were maintained in culture to evaluate development rates were placed in NCSU 23 with 10% FBS from day 5 to day 7.
  • X being bromine and chlorine are fully described.
  • the nucleotide sequences described herein are provided without corresponding homologous sequences according to the Watson/Crick base pairing rules. Those of skill in the art will recognize that the corresponding homologous sequences are also described herein.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Environmental Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des techniques et des matériaux destinées à présélectionner le sexe de la progéniture de mammifères. Ces techniques et ces matériaux permettent en particulier d'enrichir le sperme porteur du chromosome X ou Y dans la semence par introduction d'un transgène dans un chromosome sexuel sous la commande de régions régulatrices qui fournissent l'expression de ce transgène d'une manière spécifiquement haploïde.
PCT/US2002/008933 2001-03-22 2002-03-22 Selection de sperme en fonction du sexe a partir d'animaux -transgeniques WO2002077637A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CA002442019A CA2442019A1 (fr) 2001-03-22 2002-03-22 Selection de sperme en fonction du sexe a partir d'animaux -transgeniques
US10/472,542 US20050081256A1 (en) 2001-03-22 2002-03-22 Sex- specific selection of sperm from transgenic animals

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US27815501P 2001-03-22 2001-03-22
US60/278,155 2001-03-22

Publications (1)

Publication Number Publication Date
WO2002077637A1 true WO2002077637A1 (fr) 2002-10-03

Family

ID=23063884

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/008933 WO2002077637A1 (fr) 2001-03-22 2002-03-22 Selection de sperme en fonction du sexe a partir d'animaux -transgeniques

Country Status (3)

Country Link
US (1) US20050081256A1 (fr)
CA (1) CA2442019A1 (fr)
WO (1) WO2002077637A1 (fr)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2031071A1 (fr) * 2007-08-31 2009-03-04 Minitüb Abfüll- und Labortechnik GmbH & Co. KG Procédé pour la catégorisation d'échantillons contenant des spermatozoïdes par profilage moléculaire
US7713687B2 (en) 2000-11-29 2010-05-11 Xy, Inc. System to separate frozen-thawed spermatozoa into x-chromosome bearing and y-chromosome bearing populations
US7723116B2 (en) 2003-05-15 2010-05-25 Xy, Inc. Apparatus, methods and processes for sorting particles and for providing sex-sorted animal sperm
US7758811B2 (en) 2003-03-28 2010-07-20 Inguran, Llc System for analyzing particles using multiple flow cytometry units
US7820425B2 (en) 1999-11-24 2010-10-26 Xy, Llc Method of cryopreserving selected sperm cells
US7833147B2 (en) 2004-07-22 2010-11-16 Inguran, LLC. Process for enriching a population of sperm cells
US7838210B2 (en) 2004-03-29 2010-11-23 Inguran, LLC. Sperm suspensions for sorting into X or Y chromosome-bearing enriched populations
US7855078B2 (en) 2002-08-15 2010-12-21 Xy, Llc High resolution flow cytometer
US7929137B2 (en) 1997-01-31 2011-04-19 Xy, Llc Optical apparatus
US8137967B2 (en) 2000-11-29 2012-03-20 Xy, Llc In-vitro fertilization systems with spermatozoa separated into X-chromosome and Y-chromosome bearing populations
US8486618B2 (en) 2002-08-01 2013-07-16 Xy, Llc Heterogeneous inseminate system
US8497063B2 (en) 2002-08-01 2013-07-30 Xy, Llc Sex selected equine embryo production system
US9365822B2 (en) 1997-12-31 2016-06-14 Xy, Llc System and method for sorting cells
US11230695B2 (en) 2002-09-13 2022-01-25 Xy, Llc Sperm cell processing and preservation systems

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100476347B1 (ko) * 2002-09-30 2005-03-16 한국과학기술원 샤페론 단백질의 발현량을 조절함으로써 목적 단백질을 대량으로 생산하는 방법
US20140359795A1 (en) * 2013-05-31 2014-12-04 Recombinetics, Inc. Genetic techniques for making animals with sortable sperm
US20140359796A1 (en) * 2013-05-31 2014-12-04 Recombinetics, Inc. Genetically sterile animals

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001032008A1 (fr) * 1999-11-04 2001-05-10 Pig Improvement Co (Uk) Ltd. Procedes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001032008A1 (fr) * 1999-11-04 2001-05-10 Pig Improvement Co (Uk) Ltd. Procedes

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7929137B2 (en) 1997-01-31 2011-04-19 Xy, Llc Optical apparatus
US9422523B2 (en) 1997-12-31 2016-08-23 Xy, Llc System and method for sorting cells
US9365822B2 (en) 1997-12-31 2016-06-14 Xy, Llc System and method for sorting cells
US7820425B2 (en) 1999-11-24 2010-10-26 Xy, Llc Method of cryopreserving selected sperm cells
US8652769B2 (en) 2000-11-29 2014-02-18 Xy, Llc Methods for separating frozen-thawed spermatozoa into X-chromosome bearing and Y-chromosome bearing populations
US7771921B2 (en) 2000-11-29 2010-08-10 Xy, Llc Separation systems of frozen-thawed spermatozoa into X-chromosome bearing and Y-chromosome bearing populations
US9879221B2 (en) 2000-11-29 2018-01-30 Xy, Llc Method of in-vitro fertilization with spermatozoa separated into X-chromosome and Y-chromosome bearing populations
US7713687B2 (en) 2000-11-29 2010-05-11 Xy, Inc. System to separate frozen-thawed spermatozoa into x-chromosome bearing and y-chromosome bearing populations
US8137967B2 (en) 2000-11-29 2012-03-20 Xy, Llc In-vitro fertilization systems with spermatozoa separated into X-chromosome and Y-chromosome bearing populations
US8497063B2 (en) 2002-08-01 2013-07-30 Xy, Llc Sex selected equine embryo production system
US8486618B2 (en) 2002-08-01 2013-07-16 Xy, Llc Heterogeneous inseminate system
US7855078B2 (en) 2002-08-15 2010-12-21 Xy, Llc High resolution flow cytometer
US11230695B2 (en) 2002-09-13 2022-01-25 Xy, Llc Sperm cell processing and preservation systems
US11261424B2 (en) 2002-09-13 2022-03-01 Xy, Llc Sperm cell processing systems
US9377390B2 (en) 2003-03-28 2016-06-28 Inguran, Llc Apparatus, methods and processes for sorting particles and for providing sex-sorted animal sperm
US10100278B2 (en) 2003-03-28 2018-10-16 Inguran, Llc Multi-channel system and methods for sorting particles
US11718826B2 (en) 2003-03-28 2023-08-08 Inguran, Llc System and method for sorting particles
US11104880B2 (en) 2003-03-28 2021-08-31 Inguran, Llc Photo-damage system for sorting particles
US8664006B2 (en) 2003-03-28 2014-03-04 Inguran, Llc Flow cytometer apparatus and method
US8709825B2 (en) 2003-03-28 2014-04-29 Inguran, Llc Flow cytometer method and apparatus
US8709817B2 (en) 2003-03-28 2014-04-29 Inguran, Llc Systems and methods for sorting particles
US8748183B2 (en) 2003-03-28 2014-06-10 Inguran, Llc Method and apparatus for calibrating a flow cytometer
US9040304B2 (en) 2003-03-28 2015-05-26 Inguran, Llc Multi-channel system and methods for sorting particles
US7943384B2 (en) 2003-03-28 2011-05-17 Inguran Llc Apparatus and methods for sorting particles
US7758811B2 (en) 2003-03-28 2010-07-20 Inguran, Llc System for analyzing particles using multiple flow cytometry units
US7799569B2 (en) 2003-03-28 2010-09-21 Inguran, Llc Process for evaluating staining conditions of cells for sorting
US7723116B2 (en) 2003-05-15 2010-05-25 Xy, Inc. Apparatus, methods and processes for sorting particles and for providing sex-sorted animal sperm
US7838210B2 (en) 2004-03-29 2010-11-23 Inguran, LLC. Sperm suspensions for sorting into X or Y chromosome-bearing enriched populations
US7892725B2 (en) 2004-03-29 2011-02-22 Inguran, Llc Process for storing a sperm dispersion
US7833147B2 (en) 2004-07-22 2010-11-16 Inguran, LLC. Process for enriching a population of sperm cells
EP2031071A1 (fr) * 2007-08-31 2009-03-04 Minitüb Abfüll- und Labortechnik GmbH & Co. KG Procédé pour la catégorisation d'échantillons contenant des spermatozoïdes par profilage moléculaire
WO2009027096A1 (fr) * 2007-08-31 2009-03-05 Minitüb Abfüll- und Labortechnik GmbH & Co. KG Procédé de catégorisation d'échantillons contenant des spermatozoïdes par établissement de leur profil moléculaire

Also Published As

Publication number Publication date
CA2442019A1 (fr) 2002-10-03
US20050081256A1 (en) 2005-04-14

Similar Documents

Publication Publication Date Title
Krimpenfort et al. Generation of transgenic dairy cattle using ‘in vitro’embryo production
US5994619A (en) Production of chimeric bovine or porcine animals using cultured inner cell mass cells
US20050081256A1 (en) Sex- specific selection of sperm from transgenic animals
JP3739652B2 (ja) 成体の体細胞核を再構成した被核除去卵母細胞からの動物の満期の成長
Whitworth et al. Method of oocyte activation affects cloning efficiency in pigs
US6700037B2 (en) Method of cloning porcine animals
JP4095898B2 (ja) 人工染色体を含むトランスジェニック動物のクローニング
Gong et al. Production of transgenic blastocyst by nuclear transfer from different types of somatic cells in cattle
AU2002252076A1 (en) Cloning of transgenic animals comprising artificial chromosomes
Niemann et al. Manipulating early pig embryos
US8119785B2 (en) Nucleic acid sequences and homologous recombination vectors for distruption of a Fel D I gene
US10626417B2 (en) Method of genetically altering and producing allergy free cats
Popova et al. Production of transgenic models in hypertension
WO2005011371A1 (fr) Procede d'edification d'un oeuf par transplantation du noyau, embryon parthenogenetique et mammifere parthenogenetique
JP4845073B2 (ja) 再構築受精卵の作製方法及びそれを用いたトランスジェニック胚の作製方法
Kono et al. Thymocyte transfer to enucleated oocytes in the mouse
Gong et al. Production of transgenic calves by somatic cell nuclear transfer
WO2005028655A1 (fr) Procede d'augmentation de l'efficacite d'un animal transgenique
US20040077077A1 (en) Novel methods for the production of cloned mammals, mammals cloned according to the methods, and methods of use of same
Heyman Cloning and transgenesis in cattle: potential applications
Duszewska et al. Obtaining calves after transfer of embryos microin-jected with the human interferon alpha (IFNα) gene, pbLGIFN-GFPBsd
EP1611785A1 (fr) Clonage d'ongulés transgeniques comprenant des chromosomes artificiels
Seamark Efficient Creation of Transgenic Sheep: The Challenge for the Cell Biologist
Dai et al. Clone of Chinese Jinan redcross yellow cattle and evaluation of reproductive characteristics of cloned calf
Pinkert¹ et al. EMBRYO BIOTECHNOLOGIES

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2442019

Country of ref document: CA

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
WWE Wipo information: entry into national phase

Ref document number: 10472542

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP