WO2002059264A2 - Specific human antibodies for selective cancer therapy - Google Patents

Specific human antibodies for selective cancer therapy Download PDF

Info

Publication number
WO2002059264A2
WO2002059264A2 PCT/US2001/049440 US0149440W WO02059264A2 WO 2002059264 A2 WO2002059264 A2 WO 2002059264A2 US 0149440 W US0149440 W US 0149440W WO 02059264 A2 WO02059264 A2 WO 02059264A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
peptide
cell
seq
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2001/049440
Other languages
English (en)
French (fr)
Other versions
WO2002059264A3 (en
Inventor
Yocheved Hagai
Janette Lazarovits
Rachel Guy
Orly Lipschitz
Esther Szanton
Avigdor Levanon
Daniel Plaksin
Tuvia Peretz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Savient Pharmaceuticals Inc
Original Assignee
Savient Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Savient Pharmaceuticals Inc filed Critical Savient Pharmaceuticals Inc
Priority to IL15669001A priority Critical patent/IL156690A0/xx
Priority to JP2002559551A priority patent/JP2004524023A/ja
Priority to BR0116763-4A priority patent/BR0116763A/pt
Priority to CA002433227A priority patent/CA2433227A1/en
Priority to MXPA03005944A priority patent/MXPA03005944A/es
Priority to EP01994329A priority patent/EP1353937A4/en
Priority to NZ527173A priority patent/NZ527173A/xx
Priority to KR10-2003-7008885A priority patent/KR20030091952A/ko
Priority to AU2002246737A priority patent/AU2002246737B2/en
Priority to HU0400775A priority patent/HUP0400775A2/hu
Publication of WO2002059264A2 publication Critical patent/WO2002059264A2/en
Publication of WO2002059264A3 publication Critical patent/WO2002059264A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/472Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to the field of tissue targeting and identification, with the aid of phage display technology, of peptides and polypeptides that specifically bind to target cells.
  • peptides and polypeptides are Fv molecules, constructs thereof, fragments of either or constructs of a fragment.
  • the peptides and polypeptides may have anti-cancer activity, and/or are associated with, or conjugated to, anti-cancer agents, especially against blood-related cancers.
  • Tissue-selective targeting of therapeutic agents is an emerging discipline in the pharmaceutical industry. New cancer treatments based on targeting have been designed to increase the specificity and potency of the treatment, while reducing toxicity, thereby enhancing overall efficacy.
  • Mouse monoclonal antibodies (MAb's) to tumor-associated antigens have been employed in an attempt to target toxin, radionucleotide, and chemotherapeutic conjugates to tumors.
  • differentiation antigens such as CD 19, CD20, CD22 and CD25, have been exploited as cancer specific targets in treating hematopoietic malignancies.
  • this approach has several limitations. One limitation is the difficulty of isolating appropriate monoclonal antibodies that display selective binding.
  • a second limitation is the need for high antibody immunogenicity as a prerequisite for successful antibody isolation.
  • a third limitation is the elicitation in the patient of an immune response against murine antibodies (human anti -mouse antibody-HAMA response) that often results in a shorter serum half-life, and prevents repetitive treatments, thus diminishing the therapeutic value of the antibody.
  • This latter limitation has stimulated interest both in engineering chimeric or humanized monoclonal antibodies of murine origin, and in discovering human antibodies.
  • Mabs monoclonal antibodies
  • MAbs rapidly bind to leukemia and lymphoma cells in the bloodstream and easily penetrate to malignant cells in lymphatic tissue, thus making lymphoid tumors excellent candidates for MAb-based therapy.
  • An ideal system would entail identifying a MAb that recognizes a marker on the cell surface of stem cells that produce malignant progeny cells.
  • phage libraries have been used to select random single chain Fvs (scFvs) that bind to isolated, pre-determined target proteins such as antibodies, hormones and receptors.
  • scFvs random single chain Fvs
  • target proteins such as antibodies, hormones and receptors.
  • phage scFv libraries facilitates an alternative means of discovering unique molecules for targeting specific, yet unrecognized and undetermined, cell surface moieties.
  • ALL Acute lymphoblastic leukemia
  • B-ALL B-cell ALL
  • AML is a heterogeneous group of neoplasms with a progenitor cell that, under normal conditions, gives rise to terminally differentiated cells of the myeloid series (erythrocytes, granulocytes, monocytes, and platelets).
  • AML is associated with acquired genetic alterations that result in replacement of normally differentiated myeloid cells with relatively undifferentiated blasts, exhibiting one or more type of early myeloid differentiation.
  • AML generally evolves in the bone marrow and, to a lesser degree, in the secondary hematopoietic organs.
  • AML primarily affects adults, peaking in incidence between the ages of 15- 40 years, but it is also known to affect both children and older adults. Nearly all patients with AML require treatment immediately after diagnosis to achieve clinical remission, in which there is no evidence of abnormal levels of circulating undifferentiated blast cells.
  • a chimeric antibody against the leukocyte antigen CD-45 (cHuLym3) is in preclinical phase for treatment of human leukemia and lymphoma (Sun et al, Cancer Immunol. Immunother., 48, 595-602 (2000)) as a conditioning for bone marrow transplantation.
  • specific cell lysis was observed in ADCC (antibody dependent cell-mediated cytotoxicity) assays (Henkart, Immunity, 1, 343- 346 (1994); Squier and Cohen, Current Opin. Immunol, 6, 447-452 (1994)).
  • the final product comprises non-human sequences, resulting in a problematic immune response to non-human material, such as HAMA.
  • This HAMA response prevents repetitive treatments and results in a shorter serum half-life for the product.
  • the above methods allow for the isolation of a single antibody species only, and only allow for the isolation of antibodies against known and purified antigens. Further, these methods are not selective insofar as they allow for the isolation of antibodies against cell surface markers that are present on normal cells as well as on malignant cells.
  • scFvs comprising fully human sequences.
  • fully human antibody against the human TGFb2 receptor based on a scFv clone derived from phage display technology was recently developed.
  • This scFv converted into a fully human IgG4 that is capable of competing with the binding of TGFb2 (Thompson et al, J. Immunol Methods, 221, 17-29 (1999)), has strong anti-pro liferative activity.
  • the inventors of the present invention have identified cell markers present on or cells in diseased or malignant state. Therefore, it is an objective of the present invention to identify peptides and polypeptides that recognize cell markers that are substantially exposed or over- expressed, particularly on or in cells in a diseased or malignant state.
  • composition comprising an effective amount of such peptides, polypeptides or motifs associated with, or coupled to, an anti-cancer agent or to a diagnostic label or marker.
  • Single chain Fv (scFv) fragments are comprised of the variable domains of the heavy (V H ) and light (V L ) chains of an antibody tethered together by a polypeptide linker.
  • the linker is long enough to allow the (V H ) and the (V L ) domains to fold into a functional Fv domain enabling the scFv to recognize and bind its target with the similar or increased affinity of the parent antibody.
  • a commonly used linker comprises glycine and serine residues to provide flexibility and protease resistance.
  • scFv monomers are designed with the C-terminal end of the
  • V H domain tethered by a polypeptide linker to the N-terminal residue of the V L .
  • an inverse orientation is employed: the C-terminal end of the V L domain is tethered to the N-terminal residue of V H through a polypeptide linker.
  • Power B., et al., J. Immun. Meth. 242, 193-204 (2000).
  • the polypeptide linker is typically around twelve amino acids in length. When the linker is reduced to about three to twelve amino acids, the scFvs can not fold into a functional Fv domain and instead associate with a second scFv to form a diabody.
  • mulitvalent antibody fragments such as scFv dimers, trimers, and tetramers often provide higher apparent affinity over the binding of the parent antibody to the target. This higher affinity offers many advantages including ideal pharmaco-kinetics for tumor targeting applications.
  • a scFv may be employed as a blocking agent to bind a target receptor and thus block the binding of the "natural" ligand.
  • this high affinity is especially critical when the target receptors are involved in adhesion and rolling or when the target receptors are on cells present in areas of high sheer flow, such as platelets.
  • an object of the invention is multivalent forms of Yl and
  • Y17 scFv Y17 scFv.
  • These multivalent forms include, but are not limited to dimers, trimers and tetramers, sometimes referred to herein as diabodies, triabodies, and tetrabodies, respectively.
  • the present invention provides for the identification of peptides and polypeptides that bind selectively and/or specifically to target cells especially against blood related cancer cells, their construction, their use on their own, or in association with, or combined, conjugated or fused to one or more pharmaceutical agents.
  • One embodiment of the present invention provides for a peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment of either, or a construct of a fragment having enhanced binding characteristics so as to bind selectively and/or specifically to a target cell in favor of other cells, wherein the binding selectivity or specificity is primarily determined by a first hypervariable region, and wherein the Fv is a single chain Fv ("scFv") or a disulfide Fv (“dsFv”), and optionally having one or more tags.
  • scFv single chain Fv
  • dsFv disulfide Fv
  • a peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment of either, or a construct of a fragment having enhanced binding characteristics so as to bind selectively and/or specifically to a substantially exposed and/or overexpressed binding site on, or in, a target comprising a cell in favor of other cells on, or in which, the binding site is not substantially available and/or expressed, wherein the binding selectivity or specificity is primarily determined by a first hypervariable region, and wherein the Fv is a scFv or a dsFv, and optionally having one or more tags.
  • a peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment of either, or a construct of a fragment having enhanced binding characteristics so as to bind selectively and/or specifically to a target cell in favor of other cells
  • the Fv molecule comprises a first chain having a first, a second and a third hypervariable region and a second chain having a first, a second and a third hypervariable region, wherein one of the hypervariable regions of the first chain has a sequence selected from the group comprising SEQ ID NOs:8-24, and wherein one of the hypervariable regions of the second chain has a sequence selected from the group comprising SEQ ID NOs:l-6 and 125-202, and wherein the first, second, and third hypervariable regions are a CDR3, CDR2 and CDR1 region, respectively, and wherein the Fv is a scFv or a dsFv, and optionally
  • the first and second chain each comprises a first hypervariable region selected from the group comprising SEQ LD NOs:8-24,
  • the first hypervariable regions of the first and second chains are identical and are selected from the group comprising SEQ LD NOs:8-24,
  • the first hypervariable region of the first chain is selected from the group comprising SEQ LD NOs:8-24, and the first hypervariable region of the second chain is selected from the group comprising SEQ ID NOs:l-6 and 125-202, or
  • the first hypervariable region of the first chain is selected from the group comprising SEQ ID NOs:l-6 and 125-202, and the first hypervariable region of the second chain is selected from the group comprising SEQ LD NOs:8-24.
  • a peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment of either or a construct of a fragment that binds to an unknown ligand on a first cell having a first and a second state, wherein the binding is effective in the second state but not substantially in the first state and, by virtue of immuno-cross-reactivity, binds specifically or selectively to a ligand on a second cell, and wherein the Fv is a scFv or a dsFv, and optionally having one or more tags.
  • step (b) subsequent biopanning and/or selection steps commencing with the resultant stock of recognition molecules of step (a) that are performed on a second cell that displays a binding site comprising an unknown ligand having immuno-cross- reactivity to the the unknown ligand of the first cell so as to produce a second population of recognition molecules;
  • step (c) amplification and purification of the second population of recognition molecules of step (b);
  • step (d) construction from the recognition sites of the purified recognition molecules of step (c) peptides or polypeptides that comprise targeting molecules that are selective and/or specific for unknown ligands on the second cell.
  • a binding motif comprising the amino acid sequence of Ri-X Phe Pro-R 2 wherein R_ and R 2 each comprises 0-15 amino acid residues, and wherein X is either Arg, Gly or Lys.
  • the targeting agent can be a peptide, polypeptide, antibody or antibody fragment or a multimer thereof.
  • X is a hypervariable CDR3 region of 3 to 30 amino acids;
  • a and B can each be amino acid chains from 1 to 1000 amino acids in length, wherein A is the amino end and B is the carboxy end.
  • Figure 1 presents phage clone binding to fixed platelets, as determined by the EIA assay. Data are presented as a function of absorbance at 405 nm.
  • Figures 2a, 2b and 2c present the binding of mononuclear cell samples obtained from three individual AML patients to scFvs, as determined by FACS analysis. Fluorescence intensity of cells bound by the two FITC-labeled tested samples (control scFv and scFv clone Yl) is presented.
  • Figure 3 presents the binding of Y-I to platelets (3a) and monocytes
  • Figure 4 presents the binding of FITC-labeled scFv clone Yl to cord- blood CD34+ stem cells.
  • CD34+ gated cells, in the FL3-H channel were analyzed in the FLI-H channel for their binding to FITC-labeled negative control scFv (figure 4a) or FITC-labeled scFv clone Yl (figure 4b).
  • Figure 4c presents a FSC and SSC dot plot analysis of the same FITC-labeled scFv clone Yl sample as in 4b.
  • the circled areas in figures 4b and 4c delineate the sub-population of CD34+ cells that bind scFv clone Yl.
  • Figure 5 FACS analyses of samples obtained from two patients with pre-B-ALL cells are presented: one from a child (5a, 5c, 5e) and the other from an adult (5b, 5d, 5f).
  • a double staining procedure using either a commercially available PE-labeled CD19 (a marker for normal peripheral B-cells; Figure 5a, 5c) or a PE- labeled CD34 (a marker for stem cells; Figure 5d) was employed, together with a FITC-labeled negative control scFv (5a, 5b) or FITC-labeled Y-I scFv (5c, 5d).
  • Figure 5b is a double negative control. Fluorescence intensity (x-axis) of cells bound by the FITC-labeled sample (scFv clone Yl), relative to the negative control staining pattem, is presented (5e and 5f).
  • Figure 6 This figure provides results of a binding comparison study performed using Jurkat cells. FACS analysis of binding to Jurkat cells of FITC- labeled Y-I scFv monomers, diabodies and triabodies, together with a negative control, is presented.
  • Figure 7 This figure proivdes results of a study comparing the binding of IgG- Y-I and scFv-Yl. A double staining procedure was employed to compare the binding of full sized IgG-Yl to that of the scFv-YI form. Five nanograms of IgG-YI were used for FACS analysis on RAJI cell (Yl negative cells; Figure 7a) and on Jurkat cells (Yl positive cells; Figure 7b). For detection, PE labeled goat anti-human IgG was used. For the binding of the scFv-YI -I ⁇ l ⁇ g (200- fold) was used, followed by staining with PE-labeled rabbit anti-scFv antibodies and FACS analysis (Figure 7c).
  • Figure 8 This figure shows a binding comparison between a Yl dimer, the Yl scFv (CONY1), and Yl IgG.
  • Figure 9 This figure shows a binding comparison between a Yl sulfide bridge dimer with the Yl scFv (CONY1).
  • Figure 10 This figure is a graph of the Superdex 75 profile of Yl- cys-kak.
  • Figure 11 This figure reveals the size of the dimers compared to the monomer in reducing and non-reducing conditions.
  • Figure 12 This figure provides results of an ELISA assay.
  • Figure 13 This figure is a chart of the epitopes of anti-GPIb antibodies.
  • Figure 14 This figure is the amino acid SEQ ID NO:.
  • Specificity is herein defined as the recognition, by one or more domains in the peptide or polypeptide of the invention, of a target ligand and subsequent binding thereto.
  • Selectivity is herein defined as the ability of a targeting molecule to choose and bind one cell type or cell state from a mixture of cell types or cell states, all cell types or cell states of which may be specific for the targeting molecule.
  • Conservative amino acid substitution is defined as a change in the amino acid composition by way of changing one or two amino acids of a peptide, polypeptide or protein, or fragment thereof.
  • the substitution is of amino acids with generally similar properties (e.g., acidic, basic, aromatic, size, positively or negatively charged, polar, non-polar) such that the substitutions do not substantially in a major way alter peptide, polypeptide or protein characteristics (e.g., charge, IEF, affinity, avidity, conformation, solubility) or activity.
  • Typical substitutions that may be performed for such conservative amino acid substitution may be among the groups of amino acids as follows:
  • Conservative amino acid substitutions can be made in, as well as, flanking the hypervariable regions primarily responsible for the selective and/or specific binding characteristics of the molecule, as well as other parts of the molecule, e.g., variable heavy chain cassette. Additionally or alternatively, modification can be accomplished by reconstructing the molecules to form full-size antibodies, diabodies (dimers), triabodies (timers) and/or tetrabodies (tetramers) or to form minibodies or microbodies.
  • an Fv is defined as a molecule that is made up of a variable region of a heavy chain of a human antibody and a variable region of a light chain of a human antibody, which may be the same or different, and in which the variable region of the heavy chain is connected, linked, fused or covalently attached to, or associated with, the variable region of the light chain.
  • a fragment of an Fv molecule is defined as any molecule smaller than the original Fv that still retains the selective and/or specific binding characteristics of the original Fv.
  • fragments include but are limited to (1) a minibody, which comprises a fragment of the heavy chain only of the Fv, (2) a microbody, which comprises a small fractional unit of antibody heavy chain variable region (PCT Application No. PCT/IL99/00581), (3) similar bodies comprising a fragment of the light chain, and (4) similar bodies comprising a functional unit of a light chain variable region.
  • An anti-cancer agent is an agent with anti-cancer activity, i.e., any activity that inhibits the growth or differentiation of cancerous or immature pre- cancerous cells, or any activity that inhibits metastasis of cancerous cells.
  • an anti-cancer agent is also an agent with anti-angiogenic activity that prevents, inhibits, retards or halts angiogenesis of tumor tissue or is also an agent with anti-adhesion acitivities that inhibits, retards or halts adhesion and metastatic invastion of cancerous and pre-cancerous cells.
  • Inhibition of growth of a cancer cell is herein defined as the (i) prevention of cancerous or metastatic growth, (ii) slowing down of the cancerous or metastatic growth, (iii) the total prevention of the growth process of the cancer cell or the metastatic process, while leaving the cell intact and alive, or (iv) killing the cancer cell. More specifically, inhibition of cancerous growth can be applied especially against blood-related cancers, e.g., AML, multiple myeloma, or chronic lymphatic leukemia.
  • blood-related cancers e.g., AML, multiple myeloma, or chronic lymphatic leukemia.
  • a phagemid is defined as a phage particle that carries plasmid DNA.
  • the phagemid particle does not have sufficient space to contain the full complement of the phage genome.
  • the component that is missing from the phage genome is information essential for packaging the phage particle. In order to propagate the phage, therefore, it is necessary to culture the desired phage particles together with a helper phage strain that complements the missing packaging information.
  • a cassette refers to a given sequence of consecutive amino acids that serves as a framework and is considered a single unit and is manipulated as such. Amino acids can be replaced, inserted into, removed, or attached at one or both ends. Likewise, stretches of amino acids can be replaced, inserted into, removed or attached at one or both ends.
  • an immunoglobulin (Ig) molecule is defined as any one of five classes, i.e., IgG, IgA, IgD, IgE, or IgM.
  • the IgG class encompasses several sub-classes including, but not restricted to, IgGl, IgG2, IgG3, and IgG4.
  • a pharmaceutical composition refers to a formulation which comprises a peptide or polypeptide of the invention and a pharmaceutically acceptable carrier, excipient or diluent thereof.
  • a pharmaceutical agent refers to an agent that is useful in the prophylactic treatment or diagnosis of a mammal including, but not restricted to, a human, bovine, equine, porcine, murine, canine, feline, or any other warm-blooded animal.
  • the pharmaceutical agent is selected from the group comprising radioisotope, toxin, oligonucleotide, recombinant protein, antibody fragment, and anti-cancer agent.
  • anti-viral agents including acyclovir, ganciclovir and zidovudine
  • anti-thrombosis/restenosis agents including cilostazol, dalteparin sodium, reviparin sodium, and aspirin
  • anti-inflammatory agents including zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid
  • anti- autoimmune agents including leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide
  • anti-adhesion/anti-aggregation agents including limaprost, clorcromene
  • An anti-leukemia agent is an agent with anti-leukemia activity.
  • anti-leukemia agents include agents that inhibit or halt the growth of leukemic or immature pre-leukemic cells, agents that kill leukemic or pre-leukemic, agents that increase the susceptibility of leukemic or pre-leukemic cells to other anti-leukemia agents, and agents that inhibit metastasis of leukemic cells.
  • an anti-leukemia agent may also be agent with anti-angiogenic activity that prevents, inhibits, retards or halts vascularization of tumors.
  • association constant between a receptor (e.g., one binding site on an antibody) and a ligand (e.g., antigenic determinant).
  • the strength of the sum total of noncovalent interactions between a single antigen-binding site on an antibody and a single epitope is the affinity of the antibody for that epitope.
  • Low affinity antibodies bind antigen weakly and tend to dissociate readily, whereas high-affinity antibodies bind antigen more tightly and remain bound longer.
  • the term "avidity" differs from affinity because the former reflects the valence of the antigen-antibody interaction.
  • antigen- antibody reaction is specific, in some cases antibody elicited by one antigen can cross- react with another unrelated antigen. Such cross-reactions occur if two different antigens share an homologous or similar epitope or an anchor region thereof or if antibodies specific for one epitope bind to an unrelated epitope possessing similar chemical properties.
  • Blast cells are cells in an immature stage of cellular development distiguished by a higher cytoplasm-to-nucleus ratio than a resting cell.
  • a platelet is a disc like cytoplasmic fragment of a megakaryocyte that is shed in the marrow sinus and subsequently are circulating in the peripheral blood stream. Platelets have several physiological functions including a major role in clotting. A platelet contains granules in the central part and peripherally, clear protoplasm, but no definite nucleus.
  • epitope is used herein to mean the antigenic determinant or antigen site that interacts with an antibody, antibody fragment, antibody complex or a complex comprising a binding fragment thereof or T-cell receptor.
  • epitope is used interchangeably herein with the tersm ligand, domain, and binding region.
  • a given cell may express on its surface a protein having a binding site
  • Stage I may be, for example, a normal, healthy, non-diseased status.
  • the epitope may be exposed by, e.g., undergoing modifications itself, or being unblocked because nearby or associated molecules are modified or because a region undergoes a conformational change.
  • modifications include changes in folding, changes in post-translational modifications, changes in phospholipidation, changes in sulfation, changes in glycosylation, and the like.
  • Such modifications may occur when the cell enters a different state, which may be called a second stage (stage II).
  • second states, or stages include activation, proliferation, transformation, or in a malignant status.
  • the epitope may then be exposed, and the antibody may bind.
  • the term "Fab fragment" is a monovalent antigen- binding fragment of an immunoglobulin. A Fab fragment is composed of the light chain and part of the heavy chain.
  • Polyclonal antibodies are the product of an immune response and are formed by a number of different B-lymphocytes. Monoclonal antibodies are derived from a single cell.
  • Agglutination as used herein means the process by which suspended bacteria, cells, discs, or other particles of similar size are caused to adhere and form into clumps. The process is similar to precipitation but the particles are larger and are in suspension rather than being in solution.
  • aggregation means the clumping of platelets induced in vitro, and thrombin and collagen, as part of a sequential mechanims leading to the formation of a thrombus or hemostatic plug.
  • the expression pattern of a gene can be studied by analyzing the amount of gene product produced under various conditions, at specific times, in various tissues, etc.
  • a gene is considered to be "over expressed" when the amount of gene product is higher than that found in a normal control, e.g., non-diseased control.
  • a promoter is a region on DNA at which RNA polymerase binds and initiates transcription.
  • Antibodies are protein molecules that bind to antigen. They are composed of units of four polypeptide chains (2 heavy and 2 light) linked together by disulfide bonds. Each of the chains has a constant and variable region. They can be divided into five classes, IgG, IgM. IgA, IgD, and IgE, based on their heavy chain component. They are produced by B lymphocytes and recognize a particular foreign antigenic determinant and facilitate clearing of that antigen.
  • Antibodies may be produced and used in many forms, including antibody complexes.
  • antibody complex or “antibody complexes” is used to mean a complex of one or more antibodies with another antibody or with an antibody fragment or fragments, or a complex of two or more antibody fragments.
  • F(ab')2 fragment is a bivalent antigen binding fragment of an immunoglobulin obtained by pepsin digestion. It contains both light chains and part of both heavy chains.
  • Fc fragment is a non-antigen-binding portion of an immunoglobulin. It contains the carboxy-terminal portion of heavy chains and the binding sites for the Fc receptor.
  • Fd fragment is the variable region and first constant region of the heavy chain of an immunoglobulin.
  • Contaminating proteins are those proteins that are not specifically being selected for and which may be present in a sample.
  • Peptido-mimetics are small molecules, peptides, polypeptides, lipids, polysaccharides or conjugates thereof that have the same functional effect or activity of another entity such as an antibody.
  • Phagemids are plasmid vectors designed to contain an origin of replication from a filamentous phage, such as ml 3 of fd.
  • the subject invention provides for peptides or polypeptides that comprise an Fv molecule, a construct thereof, a fragment thereof, a construct of a fragment thereof, or a fragment of a construct, all of which have enhanced binding characteristics. These binding characteristics allow the peptide or polypeptide molecule to bind selectively and/or specifically to a target cell in favor of other cells, the binding specificity and/or selectivity being primarily determined by a first hypervariable region.
  • the Fv can be a scFv or a dsFv.
  • the Fv molecule described above can be used to target the diseased cell.
  • the diseased cell can be, for example, a cancer cell.
  • types of cancer that are amenable to diagnosis and/or treatment by specific targeting include, but are not limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma.
  • Leukemia, lymphoma, and myeloma are cancers that originate in the bone marrow and lymphatic tissues and are involved in uncontrolled growth of cells.
  • Phage display is a technique in which peptides, polypeptides, antibodies or proteins are generated and selected by their expression and display on the surface of a filamentous bacteriophage by fusion to a phage coat protein, with the DNA encoding the displayed protein residing within the phage virion.
  • the scFv that is produced by the phage display technique is comprised of the variable domains of each of the antibody heavy and light chains, linked by a flexible amino-acid polypeptide spacer (Nissim et al, EMBO J, 13, 692-698 (1994)).
  • a phage display library (also termed phage peptide/antibody library, phage library, or peptide/antibody library) comprises a large population of phage (generally 10 - 10 ), each phage particle displaying a different peptide or polypeptide sequence. These peptide or polypeptide fragments may constructed to be of variable length.
  • the displayed peptide or polypeptide can be derived from, but need not be limited to, human antibody heavy or light chains.
  • an scFv antibody library produced by the phage display technique was utilized to obtain and produce targeting molecules.
  • Flow cytometry particularly fluorescence-activated cell sorting ("FACS"), was used for identifying and isolating specific phage clones, the peptide or polypeptide of which recognizes target cells.
  • FACS fluorescence-activated cell sorting
  • Phage-expressed scFv antibody fragments are amenable to in vitro screening, enrichment and selection of high affinity clones (U.S. patent 5,821,337; U.S. patent 5,720,954).
  • a library of this type offers a powerful means for generating new tools for research and clinical applications, and has numerous advantages over the conventional approach (Caron et al, Cancer Supplement, 73, 1049-1056 (1994)).
  • the library contains the potential for a high diversity of antibody molecules (Nissim et al, EMBO J., 692-69 8 (1994)).
  • stable human cDNA can be used as a continuous source of material for antibody production (U.S. patent 5,843,439). Molecule recognition and selection are not influenced by the in vivo immunogenicity of candidate target proteins.
  • affinity selection of phage displayed antibodies provides a useful method for enriching antigen-reactive scFvs from large libraries, it requires multiple steps to isolate a single clone and to characterize soluble scFv.
  • the scFvs themselves can be modified to improve their affinities and/or avidity by performing conservative amino acid substitutions, or by producing fragments of the scFv, or constructs of said fragments.
  • the scFvs of the subject invention can be associated with, combined, fused or linked to various pharmaceutical agents and/or radioactive isotopes in a pharmaceutically effective amount with, optionally, a pharmaceutically effective carrier, to form drug-peptide compositions, fusions or conjugates having anti-disease and/or anti-cancer activity, and/or for diagnostic purposes thereof.
  • Phage clones are selected by and identified through a multi-step procedure known as biopanning. Biopanning is carried out by incubating phage displaying protein ligand variants (a phage display library) with a target, removing unbound phage by a washing technique, and specifically eluting the bound phage. The eluted phage are optionally amplified before being taken through additional cycles of binding and optional amplification that enriches the pool of specific sequences in favor of those phage clones bearing antibody fragments that display the best binding to the target.
  • biopanning is carried out by incubating phage displaying protein ligand variants (a phage display library) with a target, removing unbound phage by a washing technique, and specifically eluting the bound phage. The eluted phage are optionally amplified before being taken through additional cycles of binding and optional amplification that enriches the pool of specific sequences in favor of those phage clones bearing
  • the scFv obtained in this manner is also referred to a lead compound.
  • a lead compound is defined as a compound, the final format of which comprises a core peptide or polypeptide.
  • the lead compound can be modified and/or expanded, but it must retain the core peptide or polypeptide or some conservatively modified form thereof. Modifications by way of amino acid substitution can be made at the N- terminus, at the carboxy terminus, or in any of the CDR regions of an Fv or in the regions upstream or downstream thereof, for example. Modifications also include but are not limited to, fused proteins, coupling to drugs or toxins, construction of multimers, and expansion to full antibody molecules.
  • One preferred category of lead compound, as provided for in the present patent is an scFv obtained as the final product of the biopanning procedure.
  • An embodiment of the invention provides for at least one non-natural modification of the peptide or polypeptide of the invention.
  • the non-natural modification can render the peptide or polypeptide more immunogenic or more stable.
  • Non-natural modifications include, but are not limited to peptoid modification, sernipeptoid modification, cyclic peptide modification, N-terminus modification, C- terminus modification, peptide bond modification, backbone modification, and residue modification.
  • An embodiment of the invention provides for a peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment of either or a construct of a fragment that binds to an unknown ligand on a first cell having a first and a second state, wherein the binding is effective in the second state but not substantially in the first state and, by virtue of immuno-cross-reactivity, binds specifically or selectively to a ligand on a second cell, and wherein the Fv is a scFv or a dsFv, and optionally having one or more tags.
  • a further embodiment provides for the peptide or polypeptide of the invention, wherein the selective and/or specific binding of the peptide or polypeptide to the ligand of the second cell is determined primarily by a first hypervariable region.
  • a yet further embodiment provides for the peptide or polypeptide of the invention, wherein the first hypervariable region is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ LD NOs:8-24.
  • a yet further embodiment provides for the peptide or polypeptide of the invention, wherein the first hypervariable region is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ LD NOs:8-24, and wherein the binding selectivity or specificity is secondarily influenced by a second hypervariable region and/or by a third hypervariable region and/or by one or more of the upstream and/or by one or more of the downstream regions flanking the first, the second and the third hypervariable regions, respectively.
  • a further embodiment provides for the ligand of the second cell bound by the peptide or polypeptide of the invention.
  • One such two-cell selection protocol was based on the following: Megakaryocytes are large multinucleated cells derived from hematopoietic stem cells in the bone marrow. Platelets break off the megakaryocyte cytoplasm and enter the peripheral blood. In vitro, a wide range of cytokines directly affects stem cells. For example, thrombopoietin increases platelet count by directly increasing the differentiation of stem cells into megakaryocytes. Thus, these cells express several cell surface markers that are also found in premature cells.
  • Malignant blood cells (leukemia and lymphoma) are characterized as immature cells that express cell surface proteins normally found in partially differentiated hematopoietic progenitors.
  • platelets are an attractive source for the identification of premature cell surface markers expressed on diseased or malignant blood cells.
  • specific cells such as, but not limited to platelets, carrying unknown ligands, were used for initial biopanning steps.
  • Subsequent clone selection was performed with a desired target cell, of which the targeted cell surface markers are unknown, such as but not limited to AML cells.
  • phage clones obtained by biopanning on platelets can provide tools for recognizing and binding to ligands on diseased or malignant blood cells of interest.
  • the target as described above includes cells derived from an isolated tissue.
  • the isolated tissue can be a diseased tissue and, more specifically, a cancer tissue.
  • Cancer tissue can be derived from any form of malignancy including, but not limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma.
  • the present invention provides for a peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment of either, or a construct of a fragment.
  • a construct may be a multimer (e.g., diabody, triabody, tetrabody) or a full-size Ig molecule; a fragment might be a minibody or a microbody. All derived constructs and fragments retain enhanced binding characteristics so as to bind selectively and/or specifically to a target cell in favor of other cells.
  • the binding selectivity and/or specificity is primarily determined by a first hypervariable region, and wherein the Fv is a scFv or a dsFv, and optionally having one or more tags.
  • a tag is inserted or attached to the
  • the tag can later be removed from the molecule.
  • the tag may be, but is not limited to, the following tags: AU1, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, LRS, KT3, Protein C, S»Tag ® , T7, V5, VSV-G (Jarvik and Telmer, Ann. Rev. Gen., 32, 601-618 (1998)), and KAK (lysine-alanine-lysine).
  • the tag is preferably c-myc or KAK.
  • the two variable chains of the Fv molecule of the present invention may be connected or linked together by a spacer of 0-20 amino acid residues in length.
  • the spacer may be branched or unbranched.
  • the linker is 0-15 amino acid residues, and most preferably the linker is (Gly Ser) 3 to yield a single chain Fv ("scFv").
  • the scFv is obtainable from a phage display library.
  • the Fv molecule itself is comprised of a first chain and a second chain, each chain comprising a first, second and third hypervariable region.
  • the hypervariable loops within the variable domains of the light and heavy chains are termed Complementary Determining Regions (CDR).
  • CDR Complementary Determining Regions
  • the most variable of these regions in nature being the CDR3 region of the heavy chain.
  • the CDR3 region is understood to be the most exposed region of the Ig molecule and as shown and provided herein is the site primarily responsible for the selective and/or specific binding characteristics observed.
  • An embodiment of the invention provides for a peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment of either, or a construct of a fragment having enhanced binding characteristics so as to bind selectively and/or specifically to a substantially exposed and/or over-expressed binding site on or in a target comprising a cell in favor of other cells on or in which the binding site is not substantially available and/or expressed, wherein the binding selectivity or specificity is primarily determined by a first hypervariable region, and wherein the Fv is a scFv or a dsFv, and optionally having one or more tags.
  • a further embodiment of the invention provides for a peptide or polypeptide wherein the first hypervariable region is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ LD NOs:8-24.
  • a yet further embodiment provides for the peptide or polypeptide of the invention, wherein the first hypervariable region is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ LD NOs:8-24, and wherein the binding selectivity or specificity is secondarily influenced by a second hypervariable region and/or by a third hypervariable region and/or by one or more of the upstream regions and/or by one or more of the downstream regions flanking the first, the second and the third hypervariable regions, respectively, wherein the second and third hypervariable regions are a CDR2 and a CDR1 region, respectively.
  • An embodiment of the invention provides for peptide or polypeptide that binds to a target cell that is an activated, excited, modified, changed, disturbed or diseased cell.
  • a further embodiment of the invention provides for the target cell being a cancer cell.
  • the target cell can be selected from the group comprised of, but is not limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma.
  • the cancer cell is a leukemia cell.
  • the leukemia cell is an AML cell.
  • the peptide or polypeptide of the present invention is also any construct or modified construct of the Fv that retains one or more of the hypervariable regions of the heavy and/or light chains and has selective and/or specific binding characteristics.
  • Construct or modified construct includes, but is not limited to, scFv, dsFv, multimers of scFv such as dimers, trimers, tetramers and the like (also referred to as diabody, triabody, tetrabody), and full antibody, and any other multimer that can be constructed thereof, and that incorporates one or more of the hypervariable domains of the antibody.
  • the peptide or polypeptide of the present invention is also a fragment of any construct or modified construct having some or all of the binding characteristics of the original construct.
  • the peptide or polypeptide of the present invention is also a construct of a fragment having some or all of the selective and/or specific binding characteristics of the original construct. Fvs herein described selectively and/or specifically bind to target cells and can be associated with, or conjugated to, anticancer agents or anti-disease agents.
  • Peptides, polypeptides, fragments thereof, constructs thereof and fragments of constructs thereof of Fv molecules of the invention can be prepared in either prokaryotic or eukaryotic expression systems.
  • the eukaryotic expression system is a mammalian system, and the peptide or polypeptide produced in the mammalian expression system, after purification, is substantially free of mammalian contaminants.
  • a eukaryotic cell system refers to an expression system for producing peptides or polypeptides by genetic engineering methods, wherein the host cell is a eukaryote.
  • a prokaryotic system for production of the peptide or polypeptide of the invention uses E. coli as the host for the expression vector.
  • the peptide or polypeptide produced in the E. coli system, after purification, is substantially free of E coli contaminating proteins.
  • Use of a prokaryotic expression system may result in the addition of a methionine residue to the N- terminus of some or all of the sequences provided for in the present invention.
  • Removal of the N-terminal methionine residue after peptide or polypeptide production to allow for full expression of the peptide or polypeptide can be performed by methods commonly known in the art, such as, but not limited to, the use of Aeromonas aminopeptidase under suitable conditions (U.S. Patent No.; 5,763,215).
  • the subject invention provides for production of a scFv based on the
  • Promoters incorporated into the vectors used for the cloning and amplification of the scFv in prokaryotic cells can be chosen from a wide selection.
  • a promoter is a DNA sequence that is situated upstream of structural genes and is capable of controlling the expression of genes. Promoters are found in the natural state in the chromosome(s) of the organism and can also be engineered into prokaryotic or eukaryotic expression vectors. Promoters engineered into specific loci on the desired DNA fragment provide for finely tuned and precisely controlled expression of the gene of interest. In the present invention, several promoters were used in constructs that include the gene coding for the Fv of choice.
  • Promoters include, but are not limited to the following: deo, P1-P2, osmB, ⁇ P L , ⁇ -lac-U5, SR 5, and CMV early promoter.
  • Deo is a double stranded DNA plasmid which, upon introduction into a. suitable E. coli host, renders the host capable of effecting expression of DNA encoding a desired naturally-occurring polypeptide or polypeptide analog thereof under the control of the constitutive E. co/t-derived deoxyribonucleotide promoter, deo P1-P2.
  • a fuller description is provided in U.S. Patent No. 5,795,776 (Fischer, August 18, 1998) and U.S. Patent No. 5,945,304 (Fischer, August 31, 1999).
  • E. coli osmB promoter is regulated by osmotic pressure.
  • Vectors carrying this promoter can be used to produce high levels of a wide variety of recombinant eukaryotic and prokaryotic polypeptides under control of the osmB promoter in an E. coli host.
  • a fuller description is provided in U.S. Patent No. 5,795,776 (Fischer, August 18, 1998) and U.S. Patent No. 5,945,304 (Fischer, August 31, 1999).
  • ⁇ P L is a thermoinducible ⁇ bacteriophage promoter regulated by the thermolabile repressor cl 857 .
  • thermolabile repressor cl 857 For A fuller discussion, see Hendrix et al. Lambda II, Cold Spring Harbor Laboratory (1983).
  • ⁇ -lac-U5 is a lacZ promoter (Gilbert and Muller-Hill, PNAS (US), 58,
  • SR ⁇ 5 is a mammalian cDNA expression system composed of the simian virus 40 (SV40) early promoter and the R-U5 segment of the human T-cell leukemia virus type 1 long terminal repeat. This expression system is 1 or 2 orders of magnitude more active than the SV40 early promoter in a wide variety of cell types (Takebe et al, Molecular and Cellular Biology, 8, 466-472 (1988).
  • the human cytomegalovirus promoter known as the CMV intermediate/early enhancer/promoter is most preferably used in the present invention to promote constitutive expression of clone DNA inserts in mammalian cells.
  • the CMV promoter is described in Schmidt, EN. et al., (1990) Mol. Cell. Biol, 10, 4406, and is U.S. Patent ⁇ os. 5,168,062 and 5,385,839.
  • the promoter for induction of the phagemid system in prokaryotes is selected from a group comprising deo, osmB, ⁇ P L , ⁇ -lac-U5, and CMV promoters.
  • the ⁇ -lac-U5 promoter was used for induction of the phagemid system in E. coli.
  • the CMV promoter is used.
  • a peptide or polypeptide of the subject invention comprises: (a) a leader sequence that is present only in the encoded sequence but is lacking in the mature protein; (b) a variable regions of a heavy chain of the order of 135-145 amino acids, including a first hypervariable region of 4-12 amino acids that is subject to modifications; (c) a spacer region of ⁇ 20 amino acids that may be shortened or eliminated; (d) variable region of a light chain that is also subject to specific modifications described herein followed by; (e) a tag sequence for follow-up, that is optionally not present in the final injectable product.
  • the spacer being generally about 15 amino acid residues long in the scFv, allows the two variable chains (heavy and light) to fold into functional Fv domain.
  • the functional Fv domain retains selective and/or specific enhanced binding activity.
  • (d) above is followed by a tag sequence or label that can be used for conjugation, diagnostic and/or identification purposes.
  • the tag is designed to connect between the peptide or polypeptide of the invention and an agent for treatment or diagnosis of the target cell.
  • the spacer region of the scFv may be linear or branched, and is generally comprised of glycine and serine residues, in multiples of the formula (Gly 4 Ser) n , and is generally between a total of 0-20 amino acids in length, preferably 0-15 amino acids long and linear.
  • the spacer length is 0-5 amino acids in length.
  • the spacer is ⁇ 3 amino acids long (as detailed below).
  • the leader sequence is underlined with a dashed line.
  • the V H region is encoded by the bolded amino acid sequence. This specific clone is derived from the germline V H 3-DP32; however, the germline of each clone is dependent on its particular origin (see below).
  • the amino acid sequence enclosed in a box encodes for the V H -CDR3 sequence, the hypervariable region among all clones derived from this library.
  • the spacer region joining the VH and the V L regions is a flexible polypeptide, encoded by amino acids shown by italics. Finally the V L region is presented.
  • the fused V L fragment in all the clones is derived from a single unmutated V gene of germline IGLV3SI, and is here followed by the c-myc tag, underlined with a wavy line.
  • the full amino acid sequence is identical to SEQ LD NO:25.
  • V H fragments from 49 germlines
  • Repertoires of V H fragments were first generated by PCR from rea ⁇ anged V-genes of peripheral blood lymphocytes of non-immunized human (refe ⁇ ed to as a "naive repertoire") by the supplier of the library.
  • the origin (germline) of the V H -sequence can be identified by a homology test (Blast search), using one of the following web sites:
  • the binding characteristics of an antibody can be optimized in one of several ways.
  • One way of optimizing an antibody to obtain a higher binding affinity relative to the original lead-compound is based on replacing the amino acid residues in the lead-compound, to introduce higher variability, or to extend the sequence. For example, the entire original V L region can be replaced with a V L region from a different antibody subtype.
  • a phagemid display mutagenesis library An additional way to optimize binding affinity is to construct a phagemid display mutagenesis library.
  • a phagemid display mutagenesis library oligonucleotides are synthesized so that each amino acid of the core sequence within the V H and the V CDR3 is independently substituted by any other amino acid, preferably in a conservative manner known in the art.
  • the subject invention provides for a set of specific antibody scFv displayed on phage, wherein the displayed antibody fragments and the soluble antibody fragments that can be extracted from the phage virions have the same biological activity.
  • the phage display library used herein was constructed from peripheral blood lymphocytes of non-immunized human, and the Fv peptide was selected against previously uncharacterized and unpurified antigens on the surface of a target cell.
  • previously uncharacterized and unpurified antigens refer to ligands presented on the surface of cells that have not been identified, characterized, isolated or purified by biochemical or molecular means previous to the current work, and that are observed or predicted in the present work by virtue of the selective and/or specific binding to isolated antibody fragments observed.
  • the scFv of the present invention displays enhanced binding to a target cell.
  • the enhanced binding is directed to specific surface markers.
  • Specific surface markers are molecules that are sequestered in the cellular membrane and are accessible to circulating recognition molecules. The presence of surface markers allowed for the development of the phage display technology via the biopanning technology described herein.
  • specific surface markers are employed to characterize and differentiate among various cell types, as well as to serve as the binding site for Fvs in their various forms.
  • a variety of hematopoietic cell types can be differentiated according to their characteristic surface markers and, similarly, diseased or cancerous cells display surface markers that are unique to their type and stage.
  • step-wise selection by using a first e.g., normal cell in a second, e.g., activated, excited, modified, changed, or disturbed state, whereby a binding site of the first cell in the second state comprises an unknown ligand that is substantially exposed or displayed.
  • a binding site of the first cell in the second state comprises an unknown ligand that is substantially exposed or displayed.
  • the resulting clone may bind, after subsequent biopanning or selection steps, selectively and/or specifically to a novel and unknown ligand on a second cell.
  • targeting molecules may be constructed from the recognition sites of the purified recognition molecules selective and/or specific for an unknown ligand on a second cell.
  • the first cell may be a normal cell, the first state a non- activated state and the second state an activated, excited, modified, changed or disturbed state.
  • the second cell in the step-wise selection may be a human cell.
  • the second cell in the step- wise selection is a diseased cell.
  • the second cell in the step-wise selection is a cancer cell such as, but not limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma.
  • the second cell is a leukemia cell.
  • the second cell is an AML cell.
  • a more preferred embodiment of the invention provides for a peptide or polypeptide wherein the selective and/or specific binding of the peptide or polypeptide to the ligand of the second cell is determined primarily by a first hypervariable region.
  • the first hypervariable region is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ LD NOs:8-24.
  • the enhanced binding to a cancer cell is most likely due to overexpression of the ligand and/or exposure of binding site in the cancer cell relative to expression in the normal cell.
  • the term overexpression of the ligand is defined as the expression of a gene or its product normally silent in the particular cell type and/or in a particular stage of the cell cycle, or of increased expression of a gene that is expressed at basal levels under normal, non-malignant conditions for that particular cell type.
  • the target cell of the biopanning procedure is contained in a cell suspension. Hematopoietic cells are obtained in suspension, and biopanning may be carried out by mixing a phage library with a blood cell suspension, followed by washing with several buffers. Phage are extracted from the human cells, amplified, and the displayed antibody fragment sequence is determined.
  • the blood cell suspension comprises leukemic cells. In a most preferred embodiment, the blood cell suspension comprises AML cells.
  • the target cell is derived from an isolated organ or part thereof.
  • the target cell or the second cell is derived from a cell line.
  • Cell lines can be cultured and manipulated such that they can aid in determination of the binding characteristics of the Fv clones.
  • cell lines can be useful in the development of diagnostic kits.
  • the cell line is a hematopoietic cell line, such as but not limited to the following lines: Jurkat, Molt-4, HS-602, U937, TF-I, THP-1, KG-1, ML-2, and HUT-78 cell lines.
  • the CDR3 region is built, inserted, coupled or fused into or onto any one of 84 cassettes (SEQ ED NOs:30-113).
  • the CDR3 region is built, inserted, coupled or fused into or onto any one of 49 cassettes (SEQ ID NOs:30-32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-92, 94, 97, 99, 103, 106, 112, and 113).
  • the CDR3 region is built, inserted, coupled or fused to the C-terminus of cassette of SEQ LD NO:61, or any of the above sequences having at least 90% sequence similarity therewith.
  • the amino acid sequence of the cassette is ostensibly fixed, whereas the replaced, inserted or attached sequence can be highly variable.
  • the cassette can be comprised of several domains, each of which encompasses a function crucial to the final construct.
  • the cassette of a particular embodiment of the present invention comprises, from the N-termmius, framework region 1 (FRI), CDRI, framework region 2 (FR2), CDR2, and framework region 3 (FR3).
  • the CDR2 and CDRl hypervariable regions of the cassette may be replaced or modified by non-conservative or, preferably, conservative amino acid substitutions. More specifically, the CDR2 and CDRl regions of a cassette of consecutive amino acids selected from the group comprising of SEQ ID NOs:30-l 13 or a fragment thereof can be replaced by SEQ LD NOs:l 15 and 114, respectively.
  • the CDR2 and CDRl regions of a cassette of consecutive amino acids selected from the group comprising of SEQ ED NOs:30-32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-92, 94, 97, 99, 103, 106, 112, and 113 or fragment thereof can be replaced by SEQ DD NOs:115 and 114, respectively.
  • the peptide or polypeptide comprises a heavy and a light chain, and each chain comprises a first, second and third hypervariable region which are the CDR3, CDR2 and CDRl regions, respectively.
  • the binding selectivity and specificity are determined particularly by the CDR3 region of a chain, possibly by the CDR3 region of the light chain and, preferably, by the CDR3 region of the heavy chain, and secondarily by the CDR2 and CDRl regions of the light chain and, preferably, of the heavy chain.
  • the binding selectivity and specificity may also be secondarily influenced by the upstream or downstream regions flanking the first, second, and/or third hypervariable regions.
  • the CDR3 region of the peptide or polypeptide has an amino acid sequence selected from the group comprising SEQ ID NOs:8-24.
  • the CDR3 region of the heavy chain has an amino acid sequence selected from the group comprising SEQ ED NOs:8-24, the CDR2 has an amino acid sequence identical to SEQ ED NO: 115, and the CDRl region has an amino acid sequence identical to SEQ LD NO: 114.
  • the CDR3 region has an amino acid sequence identical to SEQ LD NO:8.
  • the Fv comprises a flexible spacer of 0-20 amino acid residues.
  • the spacer can be a branched chain or a straight chain. Two possible sequences of the spacer are identical to SEQ ID NOs:123 and 124.
  • a prefe ⁇ ed embodiment of the invention is a scFv with a CDR3 sequence identical to SEQ ED NO: 8 and a full scFv sequence identical to SEQ ED NO: 25.
  • Another prefe ⁇ ed embodiment of the invention is a scFv with a CDR3 sequence identical to SEQ D NO: 20and a full scFv sequence identical to SEQ ED NO: 203.
  • CDRl regions have the amino acid SEQ ID NOs:8, 115 and 114, respectively.
  • the Fv peptide comprises a CDRl and CDR2 region of the variable heavy chain, which itself comprises a cassette with an amino acid sequence selected from the group comprising SEQ LD NOs:30-l 13; a CDR3 region, preferably of the variable heavy chain, which has an amino acid sequence selected from the group comprising SEQ ID NO: 8-24; an upstream region flanking the CDR3 region which has the amino acid sequence of SEQ ID NO: 117; a downstream region flanking the CDR3 region which has the amino acid sequence of SEQ ED NO:l 16; a spacer of 0-20 amino acid residues of SEQ ED NO:123 or 124; a variable light chain region the sequence of which is SEQ ED NO:7.
  • CDR2 region has the amino acid sequence of SEQ ED NO:l 19
  • the downstream region flanking the CDR2 region has the amino acid sequence of SEQ ID NO: 118
  • the upstream region flanking the CDRl region has the amino acid sequence of SEQ ED NO: 121
  • the downstream region flanking the CDRl region has the amino acid sequence of SEQ LD NO: 120.
  • a prefe ⁇ ed embodiment of the invention provides for a peptide or polypeptide wherein the second and third hypervariable regions are a CDR2 and a CDRl hypervariable region, respectively and wherein the CDR3 amino acid sequence is SEQ LD NO:8, wherein the CDR2 amino acid sequence is SEQ LD NO:l 15, wherein the CDRl amino acid sequence is SEQ ED NO:l 14, wherein the upstream region flanking the CDR3 region has the amino acid sequence of SEQ ED NO:l 17, wherein the downstream region flanking the CDR3 region has the amino acid sequence of SEQ ED NO:l 16, wherein the upstream region flanking the CDR2 region has the amino acid sequence of SEQ ED NO: 119, wherein the downstream region flanking the CDR2 region has the amino acid sequence of SEQ LD NO: 118, wherein the upstream region flanking the CDRl region has the amino acid sequence of SEQ ID NO: 121 and wherein the downstream region flanking the CDRl region
  • Another prefe ⁇ ed embodiment of the invention provides for an Fv molecule that comprises a first chain having a first, a second and a third hypervariable region and a second chain having a first, a second and a third hypervariable region, wherein one of the hypervariable regions of the first chain has a sequence selected from the group consisting of SEQ ID NOs:8-24, and wherein one of the hypervariable regions of the second chain has a sequence selected from the group consisting of SEQ ID NOs:l -6 and 125-202, and wherein the first, second and third hypervariable regions are a CDR3, CDR2 and CDRl region, respectively and wherein the Fv is a scFv or a dsFv, and optionally having one or more tags.
  • Another embodiment of the invention provides for a peptide or polypeptide (i) wherein the first chain and the second chain each comprises a first hypervariable region selected from the group consisting of SEQ LD NOs:8-24; or (ii) wherein the first hypervariable region of the first and second chains are identical and selected from the group consisting of SEQ ID NOs:8-24; or (iii) wherein the first hypervariable region of the first chain is selected from the group consisting of SEQ LD NOs:8-24, and the first hypervariable region of the second chain is selected from the group consisting of SEQ ED NOs:l-6 and 125-202; or (iv) wherein the first hypervariable region of the first chain is selected from the group consisting of SEQ LD NOs:l-6 and 125-202, and the first hypervariable region of the second chain is .
  • a further embodiment provides for the peptide or polypeptide of the invention wherein the second and third hypervariable regions of the first chain are SEQ ED NOs: 114 and 115, respectively.
  • amino acid sequences of ⁇ _25 amino acid residues described and detailed herein include within their scope one or two amino acid substitution(s) and that preferably the substitutions are conservative amino acid substitutions.
  • amino acid sequences of > 25 amino acid residues described and detailed herein it is to be understood and considered as an embodiment of the invention that these amino acid sequences include within their scope an amino acid sequence with > 90% sequence similarity to the original sequence (Altschul et al, Nucleic Acids Res., 25, 3389-3402 (1997)).
  • Similar or homologous amino acids are defined as non-identical amino acids which display similar properties, e.g., acidic, basic, aromatic, size, positively or negatively charged, polar, non-polar.
  • Percentage amino acid similarity or homology or sequence similarity is determined by comparing the amino acid sequences of two different peptides or polypeptides. The two sequences are aligned, usually by use of one of a variety of computer programs designed for the purpose, and amino acid residues at each position are compared. Amino acid identity or homology is then determined. An algorithm is then applied to determine the percentage amino acid similarity. It is generally preferable to compare amino acid sequences, due to the greatly increased sensitivity to detection of subtle relationships between the peptide, polypeptide or protein molecules.
  • Protein comparison can take into account the presence of conservative amino acid substitutions, whereby a mismatch may yet yield a positive score if the non-identical amino acid has similar physical and/or chemical properties (Altschul et al, Nucleic Acids Res., 25, 3389-3402 (1997).
  • the three hypervariable regions of each of the light and heavy chains can be interchanged between the two chains and among the three-hypervariable sites within and/or between chains.
  • a suitable negative control may be a peptide or polypeptide, the amino acid sequence of which is almost identical to the peptide or polypeptide of the invention, with the only difference being in the hypervariable CDR3 region.
  • Another suitable negative control may be a peptide or polypeptide that is the same size and/or general three-dimensional structure as the peptide or polypeptide of the invention but has a totally unrelated amino acid sequence.
  • Another suitable negative control may be a peptide or polypeptide with completely different physical and chemical characteristics, when compared to the peptide or polypeptide of the invention.
  • the negative controls used in the development of the present invention are designated N14, having a CDR3 sequence identical to SEQ ED NO:28, and C181, having a CDR3 sequence identical to SEQ ED NO:29. Other negative controls, however, may likewise be suitable.
  • nucleic acid molecule preferably a nucleic acid molecule
  • DNA molecule encoding the Fv peptide or polypeptide of the invention.
  • the CDR3 sequences that confers primary binding selectivity and/or specificity to the Fv may be moved to any other heavy chain germline. More particularly they may be moved to one of 84 possible heavy chain germlines.
  • These 84 germlines (SEQ LD NOs:30-l 13) comprise (a) the germline in which the claimed phage clone was originally isolated, (b) 48 additional germlines available in the phage display library and (c) 35 alternative germlines claimed herein (Tomlinson et al, J. Mol. Biol, 221 (3):116-198 (1992)).
  • the local linear, or 3- dimensional environment of the CDR3 region may potentially play a role in guiding or encouraging the proper CDR3 binding.
  • peptides having any of the CDR3 sequences recited herein as SEQ ED NOs:8-24, 125 and derived from any of the 49 germline sequences (SEQ LD NOs:30- 32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-92, 94, 97, 99, 103, 106, 112, and 113) are also encompassed by the subject invention.
  • Germline DP-32 is the cassette for several clones of the present invention.
  • the C-terminus of this germline has been replaced with a consensus sequence to aid in phage display library preparation.
  • the seven carboxy-terminal amino acids of SEQ ED NO: 61 have been replaced by the seven amino acid sequence of SEQ ED NO: 122.
  • CDR3 regions of Fvs of the present invention may contain the core sequence Ar8 /G i y LyS Phe Pro which binds specifically to AML cells. Eight examples of such CDR3 regions are presented in Table 2. Although the motif coincides with the three N-terminal amino acid residues of the CDR3 region in each case, it may also be located elsewhere in the CDR3 region. Alternatively, the motif is a binding motif that is used to build or construct an anchor or a binding region of part of a larger binding or targeting or recognition molecule or is used alone as a target vehicle.
  • a binding motif comprising the amino acid sequence of Rj-X Phe Pro-R 2 wherein Ri and R 2 each comprises 0- 15, preferably 1-9, amino acid residues and wherein X is either Arg, Gly or Lys.
  • the CDR3 comprises the amino acid sequence of Ri-X Phe Pro-R 2 , wherein Ri and R each comprises 0-15 amino acid residues, and wherein X is either Arg, Gly, or Lys.
  • 1-1000 amino acids may be added either to the C-terminus or to the N-terminus of the peptide, while the peptide maintains its biological activity.
  • 150-500 amino acids may be added either to the C-terminus or to the N-terminus of the peptide or polypeptide, while the peptide maintains its biological activity.
  • 800-1000 amino acids may be added either to the C-terminus or the N-terminus of the peptide or polypeptide, while the peptide or polypeptide maintains its biological activity.
  • An example for extending the core amino-acid sequence is by building a full-sized immunoglobulin Ig, using a lead compound as the core of the Ig.
  • the full-sized Ig may, for example, belong to the immunoglobulin class that can induce the endogenous cytolytic activity via complement or activation of cellular cytolytic activity (e.g., LgGl, LgG2, or IgG3).
  • the full-sized Ig may belong to the immunoglobulin class of strongly binding antibodies (e.g., IgG4).
  • the full-sized Ig may act in one or more of many ways, e.g., by acting as a flag for the body's defense mechanism to initiate an immune response, by tranducing intracellular cell signaling, or by causing damage to a target cell.
  • One prefe ⁇ ed embodiment of the present invention provides for an Ig molecule expressed as a recombinant polypeptide and produced in a eukaryotic cell system.
  • the Eg polypeptide is an IgG polypeptide and it is produced in a mammalian cell system.
  • the mammalian cell system comprises the CMV promoter.
  • the IgG molecule comprises a CDR3, CDR2 and CDRl hypervariable region, both in the light and in the heavy chains.
  • the Fv molecule comprises a CDR3, CDR2 and a CDRl region having SEQ ED NOs:8, 115 and 114, respectively.
  • the CDR3, CDR2 and CDRl regions can be of the heavy chain or of the light chain.
  • a further prefe ⁇ ed embodiment of the invention provides for an IgG molecule having a light chain with a sequence identical to SEQ ID NO: 27 and a heavy chain with a sequence identical to SEQ ED NO: 26, or a heavy chain and a light chain having at least 90% sequence similarity therewith.
  • the two heavy chains of the IgG are identical and the two light chains of the IgG are identical.
  • the peptide of the subject invention is constructed to fold into multivalent Fv forms.
  • the present invention provides for a Yl or Y17 peptide or polypeptide comprising an scFv molecule.
  • a scFv is defined as a molecule which is made up of a variable region of a heavy chain of a human antibody and a variable region of a light chain of a human antibody, which may be the same or different, and in which the variable region of the heavy chain is connected, linked, fused or covalently attached to, or associated with, the variable region of the light chain.
  • a Yl and Y17 scFV construct may be a multimer (e.g., dimer, trimer, tetramer, and the like) of scFv molecules that incorporate one or more of the hypervariable domains of the Yl or Y17 antibody. All scFv derived constructs and fragments retain enhanced binding characteristics so as to bind selectively and/or specifically to a target cell in favor of other cells. The binding selectivity and/or specificity is primarily determined by hypervariable regions.
  • CDR Complementary Determining Regions
  • the Yl and Y17 peptide of the subject invention can be constructed to fold into multivalent Fv forms.
  • Yl and Y17 multimeric forms were constructed to improve binding affinity and specificity and increased half-life in blood.
  • a free cysteine is introduced in the protein of interest.
  • a peptide-based cross linker with variable numbers (2 to 4) of maleimide groups was used to cross link the protein of interest to the free cysteines.
  • the phage library (as described herein above) was designed to display scFvs, which can fold into the monovalent form of the Fv region of an antibody. Further, and also discussed herein above, the construct is suitable for bacterial expression.
  • the genetically engineered scFvs comprise heavy chain and light chain variable regions joined by a contiguously encoded 15 amino acid flexible peptide spacer.
  • the prefe ⁇ ed spacer is (Gly Ser) 3 .
  • the length of this spacer, along with its amino acid constituents provides for a nonbulky spacer, which allows the VH and the VL regions to fold into a functional Fv domain that provides effective binding to its target.
  • the present invention is directed to Yl and Y17 multimers prepared by any known method in the art.
  • a prefe ⁇ ed method of forming multimers, and especially dimers employs the use of cysteine residues to form disulfide bonds between two monomers.
  • dimers are formed by adding a cysteine on the carboxyl terminus of the scFvs (referred to as Yl-cys scFv or Yl dimer) in order to facilitate dimer formation.
  • Yl dimers were expressed in a production vector and refolded in vitro. The protein was analyzed by SDS-PAGE, HPLC, and FACS.
  • dimer refolding Conditions for dimer refolding were determined, and material comprising >90% dimers (mg quantities) was produced after subsequent dialysis, chromatographic, and gel filtration steps.
  • the purified dimer was characterized by gel filtration and by SDS-PAGE analysis under oxidizing conditions.
  • the dimer' s binding capacity was confirmed by radioreceptor assay, ELISA, and FACS analyses.
  • CONY1 scF antibody fragment is derived from Yl scFV.
  • the DNA sequence encoding the myc tag of Yl scFv were removed and replaced by synthetic oligonucleotide DNA sequence encoding the amino acids lysine, alanine lysine (KAK).
  • YASWYQQKPG QAPVLVEYGK 180 181 NNRPSGEPDR FSGSSSGNTA SLTITGAQAE DEADYYCNSR DSSGNHVVFG GGTKLTVLGG 240 241 GGCKAK
  • the Yl-cys-kak was produced in a ⁇ -pL vector in bacteria. Expression in the ⁇ -pL vector was induced by increasing the temperature to 42 °C. Inclusion bodies were obtained from induced cultures and semi-purified by aqueous solutions, to remove unwanted soluble proteins. The inclusion bodies were solubilized in guanidine, reduced by DTT, and refolded in vitro in a solution based on arginine/ox-glutathione. After refolding, the protein was dialyzed and concentrated by tangential flow filtration to a buffer containing Urea/phosphate buffer. The protein was repurified and concentrated by ionic-chromatography in an SP-column.
  • the dimer was characterized by SDS-page electrophoresis, gel filtration chromatography, ELISA, radioreceptor binding, and FACS.
  • the apparent affinity of the dimer was higher than the monomer due to the avidity effect. This effect was confirmed by ELISA to glycocalicin, FACS to KG-1 cells, and competition in a radioreceptor assay.
  • FIG. 11 a gel is shown with a mixed population of dimers and monomers. En the reduced form, the monomers are seen due to the reduction between the two monomers and in the non-reduced form, two population are seen (as in the gel filtration experiment) a monomer fraction of about 30kDa and a dimer of about 60kDa.
  • Varying the length of the spacers is yet another preferred method of forming dimers, trimers, and tetramers (often refe ⁇ ed to in the art as diabodies, triabodies and tetrabodies, respectively). Dimers are formed under conditions where the spacer joining the two variable chains of a scFv is shortened to generally. This shortened spacer prevents the two variable chains from the same molecule from folding into a functional Fv domain. Instead, the domains are forced to pair with complimentary domains of another molecule to create two binding domains. In a prefe ⁇ ed method, a spacer of only 5 amino acids (Gly Ser) was used for diabody construction. This dimer can be formed from two identical scFvs, or from two different populations of scFvs and retain the selective and/or specific enhanced binding activity of the parent scFv(s), and/ or show increased binding strength or affinity.
  • triabodies are formed under conditions where the spacer joining the two variable chains of a scFv is shortened to generally less than 5 amino acid residues, preventing the two variable chains from the same molecule from folding into a functional Fv domain. Instead, three separate scFv molecules associate to form a trimer. n a prefe ⁇ ed method, triabodies were obtained by removing this flexible spacer completely.
  • the triabody can be formed from three identical scFvs, or from two or three different populations of scFvs and retain the selective and/or specific enhanced binding activity of the parent scFv(s), and/or show increased binding strength or affinity.
  • Tetrabodies are similarly formed under conditions where the spacer joining the two variable chains of a scFv is shortened to generally less than 5 amino acid residues, preventing the two variable chains from the same molecule from folding into a functional Fv domain. Instead, four separate scFv molecules associate to form a tetramer.
  • the tetrabody can be formed from four identical scFvs, or from 1-4 individual units from different populations of scFvs and should retain the selective and/or specific enhanced binding activity of the parent scFv(s), and/or show increased binding strength or affinity.
  • tetramers are formed via a biotin/streptavidin association.
  • a novel fermentation construct that is capable of being enzymatically labeled with biotin (refe ⁇ ed to herein as Yl-biotag or Yl-B) was created.
  • a sequence that is a substrate for the BirA enzyme was added at the Yl C-terminus.
  • the BirA enzyme adds a biotin to the lysine residue within the sequence.
  • Yl-biotag was cloned and expressed in E. coli. The inclusion body material was isolated and refolded.
  • the purity of the folded protein was >95%, and >100 mg were obtained from a 1-L culture (small-scale, non-optimized conditions).
  • the molecular weight of this form was found to be similar to that of the scFv according to HPLC, SDS-PAG ⁇ , and mass spectroscopy.
  • Yl-biotag was found to be the most consistent reagent for FACS analysis. However, when Yl-biotag binding to KG-1 cells was examined in the presence of serum, high concentrations (10-fold more) are required for comparable binding in the absence of serum. Nevertheless, this construct offered the advantage of specific biotinylation in which the binding site of the molecule remains intact. Further, each molecule is labeled by only one biotin — each molecule receives one biotin on the carboxyl end.
  • the tetramers were incubated with the cell samples.
  • a low dose of the Yl tetramers (5 ng) binds well to the cell line (KG-1) providing a 10 to 20-fold higher response than previously observed with other Yl antibody forms.
  • a minor reaction was observed when a negative cell line was examined with varying doses of the tetramers.
  • An embodiment of the invention provides for a method for identifying a targeting molecule which binds to unknown immuno-cross-reactive binding sites on first and second cells comprising (a) one or more biopanning steps that are performed on a first target cell that, in a second state but not in a first state, substantially exposes or displays a binding site comprising an unknown ligand so as to produce a first population of recognition molecules; (b) subsequent biopanning and/or selection steps, commencing with the resultant stock of recognition molecules of step (a), that are performed on a second cell that displays a binding site comprising an unknown ligand having immuno-cross-reactivity to the unknown ligand of the first cell so as to produce a second population of recognition molecules; (c) amplification and purification of the second population of recognition molecules of step (b); and (d) construction from the recognition sites of the purified recognition molecules of step (c) peptides or polypeptides that comprise targeting molecules that are selective and/or specific for unknown ligands on the second
  • a prefe ⁇ ed embodiment provides for the first cell to be a normal cell, the first state to be a non-activated state and the second state to be an activated, excited, modified, changed or disturbed state.
  • the second cell is a diseased cell.
  • the diseased cell is a cancer cell.
  • the cancer cell may be, but is not limited to carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma.
  • the cancer cell is a leukemia cell.
  • the leukemia cell is an AML cell.
  • An embodiment of the present invention provides for use of the peptide or polypeptide optionally in association with or attached, coupled, combined, linked or fused to a pharmaceutical agent, in the manufacture of a medicament.
  • the medicament has activity against a diseased cell.
  • the activity is against a cancer cell.
  • the cancer cell be but is not limited to carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma.
  • the cancer cell is a leukemia cell.
  • the leukemia cell is an AML cell.
  • An embodiment of the invention provides for a pharmaceutical composition comprising mixtures of different monomeric scFvs, and/or mixtures of diabodies or triabodies or tetrabodies constructed from different scFvs.
  • a further embodiment provides for use of the peptide or polypeptide of the invention, in association with, or attached, coupled, combined, linked or fused to a pharmaceutical agent, in the manufacture of a medicament.
  • the medicament can have activity against diseased cells, and more specifically against cancer cells.
  • the cancer cells may be, but are not limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma.
  • the medicament is active against leukemia cells.
  • the medicament is active against AML cells. Activity of the medicament against the said cells may cause retardation of cancerous growth, complete prevention of any growth, or killing of the cancerous cells.
  • the activity of the medicament or of the pharmaceutical composition is by inhibiting cell growth.
  • the peptide or polypeptide of the invention can be used for preparing a composition, preferably a pharmaceutical composition, for use in inhibiting the growth of a cancer cell, preferably a leukemia cell, and most preferably an AML cell.
  • the peptide or polypeptide can be used for preparing a composition for use in inhibition of growth of a cancer cell, said composition comprising at least one compound having a pharmaceutical ligand selective and/or specific for the cancer cell.
  • a peptide or polypeptide of the subject invention may be administered alone to a patient, or as comprising a medicament or a pharmaceutical composition, in association with, conjugated, linked, or fused to a pharmaceutically effective amount of a pharmaceutical agent, a pharmaceutically effective carrier and, optionally, an adjuvant.
  • a pharmaceutical agent e.g., a pharmaceutically effective carrier
  • an adjuvant e.g., an adjuvant for a pharmaceutical agent
  • Such pharmaceutical compositions may include proteins, diluents, preservatives and anti-oxidants (see Osol et al. (eds.), Remington 's Pharmaceutical Sciences (16 th ed), Mack Publishing Company, (1980)).
  • the pharmaceutical agent is an antibody or fragment thereof that is linked to a peptide or polypeptide of the invention by a peptide bond.
  • the toxin is, for example, gelonin,
  • PE Pseudomonas exotoxin
  • PE40 Pseudomonas exotoxin
  • PE38 diptheria toxin
  • ricin or modifications or derivatives thereof.
  • the radioisotopes used include gamma- emitters, positron-emitters, and x-ray emitters that may be used for localization and/or therapy, and beta-emitters and alpha-emitters that may be used for therapy.
  • the therapeutic radioisotope is selected from a group comprising ⁇ n indium, U3 indium, 99m rhenium, 105 rhenium, 101 rhenium, 99m technetium, tellurium, 122m tellurium, 125m telluriunm 165 thulium, 167 thulium 168 thulium 123 iodine, 126 iodine, 131 iodine, 133 iodine, 81m krypton, 33 xenon, 90 yttrium, 213 bismuth, 77 bromine, 18 fluorine, 95 ruthenium, 97 ruthenium, 103 ruthenium, 105 ruthenium, 107 mercury, 203 mercury, 7 gallium and 68 gallium and the like.
  • the anticancer agent is selected from the group comprising doxorubicin, adriamycin, cis- platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives thereof.
  • An embodiment of the invention provides for a method of inhibiting the growth of a cancer cell that comprises contacting the cancer cell with an amount of the peptide or polypeptide of the invention.
  • the cancer cells may be but are not limited to carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma.
  • the cancer cell is a leukemia cell.
  • the leukemia cell is an AML cell.
  • An embodiment of the invention allows for in vivo and ex vivo treatment of the patient.
  • a more specific embodiment of the invention allows for ex vivo purging of autologous bone ma ⁇ ow to remove abnormal stem cells.
  • the blood of a leukemia patient can be circulated ex vivo through a system comprising a peptide or polypeptide of the invention conjugated to an anti-cancer agent. After removal of bound cells and unbound anti-cancer agent, the blood cells can be reintroduced into the body of a patient.
  • the blood of a leukemia patient can be circulated ex vivo through a system comprising a peptide or polypeptide of the invention attached to a solid phase. The cells that pass through the system and that do not bind to the peptide or polypeptide of the invention attached to a solid phase can be reintroduced into the body of a patient.
  • the peptide or polypeptide is utilized for ex vivo autologous bone ma ⁇ ow in suspension in order to remove abnormal stem cells prior to implantation.
  • Purging of abnormal stem cells can be performed by running the suspension over a solid support (such as, but not limited to, magnetic beads and affinity columns) to which the peptide or polypeptide of the invention (i.e., the targeting molecule), constructs, fragments, fragments of constructs, or constructs of fragments thereof are bound.
  • Bone marrow thus purged ex vivo can then be used for autologous bone ma ⁇ ow transplantation.
  • This preferred embodiment is based on the identification in the present invention of a phagemid clone (Yl) that binds to stem cells released from bone ma ⁇ ow of leukemia patients, but does not bind to stem cells released from the bone ma ⁇ ow of healthy donors.
  • Yl phagemid clone
  • the Yl phagemid clone binds to blast cells that are determined by FACS analysis to be abnormal, as well as to leukemic cells.
  • Blast cells are herein defined as primary cells that are precursors for all the circulating cells in the mammalian organism. Due to their progenitor characteristics, blast cells are not found circulating in significant quantities in the adult organism. The presence of circulating blast cells without exogenous stimulation can be an indication of malignancy, e.g., of the hematopoietic system, and their subsequent disappearance may indicate remission of the malignant disease.
  • the pharmaceutical composition is used for prophylaxis.
  • a mixture is defined as two or more molecules or particles of different species that are contained in a single preparation.
  • the different species of molecules form neither covalent nor non-covalent chemical bonds.
  • the peptide or polypeptide of the subject invention is linked, fused or conjugated to a pharmaceutical agent.
  • the link between the peptide and the pharmaceutical agent is a direct link.
  • a direct link between two or more neighboring molecules is obtained via a chemical bond between elements or groups of elements in the molecules.
  • the chemical bond can be for example, an ionic bond, a covalent bond, a hydrophobic bond, a hydrophilic bond, an electrostatic bond or a hydrogen bond.
  • the bonds can be selected from, but not limited to, a group comprising amine, carboxy, amide, hydroxyl, peptide and disulfide.
  • the direct link could preferably be a protease resistant bond.
  • the link between the peptide and the pharmaceutical agent is affected by a linker compound.
  • a linker compound is defined as a compound that joins two or more moieties together.
  • the linker can be straight-chained or branched.
  • the branched linker compound can be composed of a double-branch, triple branch, or quadruple or more branched compound.
  • the linker compound may be, but is not limited to, a dicarboxylic acid, a malemido hydrazide, PDPH, a carboxylic acid hydrazide, and a small peptide.
  • linker compounds include: Dicarboxylic acids such as succinic acid, glutaric acid, and adipic acid; Maleimido hydrazides such as N-[ ⁇ -maleimidocaproic acid] hydrazide, 4-[N- maleimidomethyl]cyclohexan- 1 -carboxylhydrazide, and N-[ ⁇ -maleimidoundcanoic acid] hydrazide]; PDPH linker such as (3-[2-pyridyldithio]propionyl hydrazide) conjugated to sulfurhydryl reactive protein; Carboxylic acid hydrazides selected from 2-5 carbon atoms; and direct coupling using small peptide linkers between the free sugar of, for example, the anti-cancer drug doxorubicin and a scFv.
  • Dicarboxylic acids such as succinic acid, glutaric acid, and adipic acid
  • Maleimido hydrazides such as N-[
  • Small peptides include, but are not limited to AU1, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, ERS, KT3, Protein C, S*Tag ® , T7, V5, VSV-G, and KAK Tag.
  • Any known method of administration of a peptide or polypeptide of the subject invention may be sued such as: intravenous, intramuscular, subcutaneous, topical, intratracheal, intrathecal, intraperitoneal, intralymphatic, nasal, sublingual, oral, rectal, vaginal, respiratory, buccal, intradermal, transdermal or intrapleural.
  • the formulation preferably will be prepared so that the amount administered to the patient will be an effective amount from about 0.1 mg to about lOOOmg of the desired composition. More preferably, the amount administered will be in the range of about lmg to about 500mg of the desired composition.
  • the compositions of the invention are effective over a wide dosage range, and depend on factors such as the particulars of the disease to be treated, the half-life of the peptide or polypeptide-based pharmaceutical composition in the body of the patient, physical and chemical characteristics of the pharmaceutical agent and of the pharmaceutical composition, mode of administration of the pharmaceutical composition, particulars of the patient to be treated or diagnosed, as well as other parameters deemed important by the treating physician.
  • the pharmaceutical composition for oral administration can be in the form of tablet, liquid, emulsion, suspension, syrup, pill, caplet, or capsule.
  • the pharmaceutical composition may also be administered in a device.
  • the pharmaceutical composition for topical administration can be in the form of cream, ointment, lotion, patch, solution, suspension, or gel. [228.] In addition, the pharmaceutical composition can be prepared for solid, liquid, or sustained release formulation.
  • compositions comprising the antibody fragments produced in accordance with the invention may comprise conventional pharmaceutically acceptable diluents or ca ⁇ iers.
  • Tablets, pills, caplets and capsules may include conventional excipients such as lactose, starch and magnesium stearate.
  • Suppositories may include excipients such as waxes and glycerol.
  • injectable solutions comprise sterile pyrogen-free media such as saline, and may include buffering agents, stabilizing agents or preservatives. Conventional enteric coatings may also be used.
  • the subject invention also encompasses a method of producing the antibody fragment by synthetic means known in the art.
  • An embodiment of the invention comprises a pharmaceutical composition comprising at least one peptide or polypeptide of the invention, attached, coupled, combined, linked or fused to an imaging agent for use in the diagnostic localization and/or imaging of a tumor.
  • a further embodiment of the invention provides for a diagnostic kit for in vitro analysis of treatment efficacy before, during, or after treatment, comprising an imaging agent comprising a peptide of the invention linked to an indicative marker molecule.
  • the invention further provides for a method of using the imaging agent for diagnostic localization and/or imaging of a cancer, more specifically a tumor, comprising the following steps:
  • the imaging agent of the kit is a fluorescent dye and the kit provides for analysis of treatment efficacy of cancers, more specifically blood-related cancers, e.g., leukemia, lymphoma and myeloma.
  • FACS analysis is used to determine the percentage of cells stained by the imaging agent and the intensity of staining at each stage of the disease, e.g., upon diagnosis, during treatment, during remission and during relapse.
  • the invention further provides a composition comprising an effective amount of an imaging agent, the peptide of the invention and a physiologically acceptable carrier.
  • the indicative marker molecule is any known marker known in the art, which includes, but is not limited to, a radioactive isotope, an element that is opaque to X-rays, a paramagnetic ion, or a fluorescent molecule, and the like.
  • the indicative radioactive isotope may be, but is not limited to, U 1 indium, 113 indium, 99m rhenium, 105 rhenium, ,01 rhenium, 99m technetium, m ""tellurium, 122m tellurium, 125m telluriunm 165 thulium, 167 thulium 168 thulium 123 iodine, 126 iodine, 131 iodine, 133 iodine, 81m krypton, 33 xenon, 90 yttrium, 213 bismuth, 77 bromine, 18 fluorine, 95 ruthenium, 97 ruthenium, 103 ruthenium, 105 ruthenium, 107 mercury, 203 mercury, 67 gallium and 68 gallium.
  • the indicative marker molecule is a fluorescent marker molecule.
  • the fluorescent marker molecule is fluorescein, phycoerythrin, or rhodamine, or modifications or conjugates thereof.
  • the subject invention also envisages a composition comprising an effective amount of an imaging agent of the invention, a pharmaceutical agent linked thereto and a physiolgically acceptable carrier.
  • the invention also provides a method for imaging an organ or cells that involves contacting the organ or cells to be imaged with an imaging agent of the invention under conditions such that the imaging agent binds to the organ and cells, imaging the bound imaging agent and, thereby, imaging the organ or cells.
  • the subject invention further provides a method of treating an organ in vivo that involves contacting the organ to be treated with a composition of the invention under conditions such that the composition binds to the organ, thereby treating the organ.
  • the peptide or polypeptide may be utilized to target malignant cells, more particularly, leukemia cells in whole blood, by monitoring and imaging the cells, e.g., by FACS analysis. Specimens receiving higher scores (e.g., four-fold higher) for tumor cells relative to normal cells are subject for treatment.
  • the invention provides for treating a patient suffering from a cancer, comprising administering to the patient an amount of the peptide or polypeptide of the invention effective to treat the cancer.
  • the cancer is selected from the group comprising carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma.
  • the cancer is a leukemia and in a most specific embodiment the leukemia is AML.
  • the peptide or polypeptide of the invention specifically or selectively binds to AML cells.
  • the invention provides for a ligand presented on AML cells bound the peptide or polypeptide of the invention, and further provides for a peptide or polypeptide that binds said ligand.
  • novel antibody fragments of the subject invention or their co ⁇ esponding peptidomimetics are used in the manufacture of compositions or medicaments to treat various diseases and conditions.
  • the subject invention provides a method for production of a targeting agent comprising the following steps:
  • a targeting agent from the one or more targeting molecules or recognition sites thereof wherein the targeting agent can be a peptide, polypeptide, antibody or antibody fragment or a multimer thereof.
  • the targeting agent can additionally be constructed so as to be coupled, attached, combined, linked or fused to or in association with a pharmaceutical agent.
  • the targeting agent is an anti-disease or anti-cancer agent.
  • the pharmaceutical agent is selected from the group comprising radioisotope, toxin, oligonucleotide, recombinant protein, antibody fragment, and anti-cancer agent.
  • the radioisotope may be selected from a group comprising l Hndium, 113 indium, 99m rhenium, 105 rhenium, 10, rhenium, 99m technetium, m tellurium, 122m tellurium, ,25m telluriunm ,65 thulium, 167 thulium 168 thulium 123 iodine, 126 iodine, 13, iodine, 133 iodine, 81m krypton, 33 xenon,
  • the toxin may be selected from the group comprising gelonin, Pseudomonas exotoxin (PE), PE40, PE38, diptheria toxin, ricin, or modifications or derivatives thereof.
  • the anti-cancer agent is selected from the group comprising doxorubicin, morpholino-doxorubicin (MDOX), adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives thereof.
  • MDOX morpholino-doxorubicin
  • adriamycin adriamycin
  • cis-platinum taxol
  • calicheamicin vincristine
  • cytarabine cytarabine
  • cyclophosphamide prednisone
  • daunorubicin idarubicin
  • the subject invention provides a method for the identification of antibody fragments by: (a) biopanning that involves incubating a phage display library with cells derived from blood; (b) washing to remove unbound phage; (c) eluting the bound phage from the blood cells; (d) amplifying the resulting bound phage; and (e) determining the displayed peptide sequence of the bound phage so as to identify the peptide.
  • the subject invention provides for a peptide or polypeptide having, the formula or structure:
  • X is a hypervariable CDR3 region of 3 to 30 amino acids; and A and B can each be amino acid chains from 1 to 1000 amino acids in length, wherein A is the amino end and B is the carboxy end.
  • A is 150-250 amino acid residues and B is 350-500 amino acid residues.
  • the CDR3 region of the peptide is 5-
  • X in the formula above is an amino acid sequence selected from the group consisting of SEQ ID NOs:8-24.
  • the peptide or polypeptide is part of a larger or full antibody or a multimer.
  • a dimeric molecule comprises two peptides or polypeptides, one of which is the peptide or polypeptide of the invention.
  • the dimeric molecule may comprise two identical peptides or polypeptides of the invention.
  • X is an amino acid sequence selected from the group consisting of SEQ ED NOs:8-24 in said dimeric molecule.
  • Another embodiment provides for a nucleic acid molecule encoding the peptide or polypeptide or dimeric molecule of the invention.
  • the invention provides for the use of the peptide or polypeptide, optionally in association with or attached, coupled, combined, linked or fused to a pharmaceutical agent, in the manufacture of a medicament.
  • the invention further provides for use of the peptide or polypeptide in the manufacture of a medicament that has activity against a diseased cell, more specifically a cancer cell.
  • the cancer cell may be selected from a group comprising carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, seminoma, and melanoma. More specifically, the cancer cell may be a leukemia cell and most specifically, the leukemia cell may be an AML cell.
  • An exchangeable system as defined in the present invention and as discussed below in the examples, is a nucleic acid construct that has been designed to allow for exchange or replacement of a redefined variable region within said construct, without need for further manipulation or rebuilding of the molecule. Such a system allows for rapid and convenient preparation of the desired nucleic acid molecule.
  • Bacterial strains - TG-1 and HB2151 Fresh bacterial cultures were prepared for infection by growing the cells to A 600 of 0.5-0.9 (exponentially growing cells). E. coli TG-1 cells were used for phage propagation and E. coli HB2151 cells were used for scFv protein production.
  • scFv display phage library source The scFv library (Nissim et al, EMBO J, 13, 692-698 (1994)) was provided by Dr. A. Nissim with the agreement of the MRC.
  • the library was originally constructed as a phagemid library displaying scFv fragments in which the V H and the V L domains were linked by a flexible polypeptide.
  • the scFvs displayed in the phagemid library were fused to the N-terminus of the minor coat protein pill of the phage, which was then subcloned into the pHENl vector (Nissim et al, EMBOJ, 13, 692-698 (1994)).
  • Repertoires of antibody fragments were first generated by PCR from rea ⁇ anged V-genes of peripheral blood lymphocytes of unimmunized human (refe ⁇ ed to as "naive repertoires"). To diversify the repertoire, random nucleotide sequences encoding heavy chain CDR3 lengths of 4-12 residues were introduced into a bank of 49 cloned human V H gene segments. The fused V L fragment in all the clones it derived from a single unmutated V gene of germline IGLV3S1, creating a single pot library of approximately 10 clones.
  • Phagemid selection and amplification Phagemids that expressed epitopes of specific interest were selected from the library by a four-step biopanning procedure:
  • Binding of the phagemid particles to a target more particularly binding of the phagemid particles to washed target cells or cell membranes
  • primer #191181 (5%-CGATCCGCCACCGCCAGAG) and its complementary primer # 191344 (5'-CTCTGGCGGTGGCGGATCG), which are located at the flexible polypeptide junction region between the heavy and light chains, were used for sequencing.
  • Protocol AM AML cell membrane panning/bacterial elution, followed by whole AML cell panning/trypsin elution
  • Protocol YPR fixed human platelet panning/acid elution
  • Protocol YPNR fixed human platelet panning/acid elution
  • the platelets were incubated for 10 minutes at RT with 200 ⁇ l 0.1 M glycine (pH 2.2). After neutralization with 0.5 M Tris-HCl, pH 8.0 and centrifugation, the remaining platelet-bound phage were eluted by addition of 200 ⁇ l trypsin-EDTA (0.25%/0.05) and neutralization by the addition of 50 ⁇ l FCS. The cells were removed by centrifugation, and the supernatant fluids containing eluted phage, from both acid and trypsin elution protocols, were collected and designated YPR(a)-l and YPR(t)-l stocks, respectively.
  • N14 CDR3 sequence For all binding experiments, a single clone was picked from the naive library (before selection). A phage stock and a soluble scFv, designated N14, were prepared from this clone. Sequence analysis indicates that it belongs to the V H 4-DP65 gene family. The sequence of the 11-mer V H -CDR3 encoded by this clone, designated N14 CDR3, is as follows (S ⁇ Q LD NO:28): Phe Leu Thr Tyr Asn Ser Tyr Glu Val Pro Thr
  • C181 CDR3 sequence An additional negative clone, C181, was used in the binding analysis experiments.
  • Clone C181 (reactive to recombinant hepatitis B virus [HBV] particles) belongs to the V H 3-DP35 family, and the sequence of the 9-mer V H -CDR3 encoded by this clone, designated C181 CDR3, is as follows (SEQ LD NO:29):
  • He Ser Glu Glu Asp Leu; SEQ ED NO: 123.) is contained in the vector upstream to the amber mutation.
  • the C-terminus of the expressed scFv should cany the c-myc tag, which can be detected using mouse anti-myc tag antibodies (derived from the European Collection of Cell Culture (EC ACC) 9E10-hybridoma).
  • the scFvs of selected clones and of the control clone C181 all belong to the V H 3 family, allowing purification on a Protein -A affinity column. Periplasmic fractions
  • N14-scFv on a Sephacryl S-200 column The scFv of the negative clone N14 belongs to the V H 4 gene family and cannot, therefore, be purified on a Protein-A affinity column.
  • scFv-N14 purification total protein in the periplasmic fraction of a 200ml induced culture was precipitated by 60% ammonium sulfate. The pellet was resuspended in 2ml O.lxPBS, 5mM EDTA, 5mM PMSF and loaded on a Sephaeryl S-200 column (1.5 x 90cm) pre-equilibrated with the running buffer (0.1 xPBS, 5mM EDTA).
  • Proteins were fractionated, and fractions containing the N14-scFv (as detected by SDS-PAGE and Western analysis) were pooled, lyophilized, and suspended in 1/10 volume H20. The N14-scFv (unlabeled and FITC-labeled) was then used as a negative control in FACS analysis experiments.
  • a phagemid stock was prepared individually from each of the selected clones.
  • Phagemid binding to selected cells Approximately 5X10 5 of the selected cells were fixed with acetone:methanol (1 :1) on the surface of 24 well plates. The binding test required 10 9 phagemids. Binding was carried out at 37°C for lhr, followed by an extensive wash with PBS/Tween (0.05%). After extensive washing with PBS, the plates were incubated with rabbit anti-M13, anti-rabbit IgG- HRP and substrate. The intensity of the color produced was read by an ELISA plate reader, at A 405 , and was proportional to the level of bound phagemids.
  • Phagemid binding to fixed platelets Polystyrene microtiter plates were coated with 10 8 fixed platelets and were incubated overnight, at 4°C. Approximately 10 10 phagemids were used for evaluating binding. Washing and incubation of plates and determination of binding level were carried out as described in 5.1.3.1 above.
  • Binding assays to specific proteins were performed. Binding was assayed in the following manner. Polystyrene microtiter plate wells were coated with one of the proteins to be tested, at 2 ⁇ g/well. Coating was allowed to proceed during overnight incubation, at 4°C. Approximately 10 10 phagemids were added to test binding. After extensive washing with PBS, the plates were incubated with rabbit anti-M13, anti-rabbit BRP, and substrate. The level of binding was measured by the intensity of color produced.
  • hGH human growth hormone
  • fibrinogen fibrinogen
  • fibronectin fibronectin
  • BSA fibronectin
  • SM fibronectin
  • glycocalicin proteolytic fragment of GPEb
  • EIA of soluble scFv Approximately 5xl0 5 AML cells were incubated with 5-10 ⁇ g total protein. Binding was carried out at 4°C for Bit, followed by EIA, using mouse anti-myc antibodies, anti-mouse HRP, and a substrate. Excess unbound antibodies were removed after each step by washing cells three times with PBS. The intensity of the color produced is read by an ELISA plate reader (O.D. 405 ). As above, the color intensity is proportional to the level of binding.
  • FACS analysis requires 5-8xl0 5 cells, which have been Ficoll-purified and resuspended in PBS+1% BSA. Binding was carried out for Cup at 4°C. After each step, cells were washed and resuspended in PBS+1% BSA. After the final staining step, cells were fixed by resuspending in PBS, 1% BSA, 2% formaldehyde, then read by FACS (Becton-Dickinson).
  • CDR3 regions with high affinity for binding to AML cells may be constructed based on the core sequence Ar8 / G i y PhePro. They may be constructed by varying any of the above 5-12-mers by additions, deletions or mutations, while maintaining the Ar /ci y PhePro core sequence.
  • CDR3 regions of the invention have the amino acid sequence Rl-
  • RI comprises 0-15 amino acids, preferably 0-9, most preferably 0-1 amino acid and R2 comprises an amino acid sequence from 1-15 amino acids, most preferably 1-9 amino acids.
  • RI and R2 are amino acid equences that do not adversely affect the specific binding of the Ar / G i y PhePro sequence to AML cells.
  • Table 3 demonstrates that trypsin elution yields a 4-fold greater output as compared to acid elution in the first round.
  • Table 5 Selected Y-series clones following the YPR biopanning protocol with the R3 output.
  • Phagemid binding - EIA using fixed platelets After three rounds of panning using two different protocols, phage clones were tested by EEA for binding to fixed platelets. Phagemid stock was prepared from each of the selected clones, and these clones were tested in two sets of EIA. Each sample was assayed in duplicate, and the average, was calculated. The results are summarized in Figure I and indicate that six of the nine Y-series clones show a positive EIA reaction. The highest degree of binding was associated with clones Yl, Y16, Y17, and Y-27.
  • Phage stocks Ml 3 (wild-type bacteriophage) and E6 (selected on CLL leukemia cells) were used as negative controls.
  • the dominant clone, phage Yl showed the highest binding to fixed platelets and, together with Y17, showed significantly higher binding than M 13 or E6 phage clones.
  • Y-I was assessed by HPLC analysis with a Superdex 75 column and by mass spectroscopy. Results of the former method indicate the presence of monomers, dimers, and tetramers in the preparation. Mass spectroscopy was sufficiently sensitive to identify the expected molecular weight of 26.5 kD and, in cases in which the c-myc tag was cleaved, a molecular weight of 24 kD was obtained.
  • Results of SDS-PAGE indicate that the intact, non-cleaved molecule has an apparent molecular weight of 30 kD, despite the expected molecular weight is 26.5 kD, according to the nucleic acid sequence and to the mass spectroscopy results above.
  • Western analysis using c-myc-specific antibodies confirmed the SDS-PAGE 30 kD results and supported the implication that the c-myc tag is present on the end of the intact molecule. The discrepancy between the results of the two procedures is due to the level of precision of the methods as well as the running conditions of SDS-PAGE that can alter the apparent molecular weight of the tested protein.
  • platelet cell surface markers may be expressed on premature hematopoietic cells.
  • the binding of platelet-selected clones was tested by FACS analysis. FACS analysis was performed after staining whole blood, followed by RBC lysis, or on Iso-prep- (Ficoll cushion) purified mononuclear cells. ScFvs were prepared from each clone, purified on protein-A, and FITC labeled (as described in Sections 4.1-4.4). In order to enable production of intact scFv in the non-suppressor E.
  • the amber codon (TAG) found in the V H -CDR3 of the Y-27 clone was mutated by DNA site-directed mutagenesis to code for glutarnic* acid (GAG).
  • GAG glutarnic* acid
  • Clones Yl and Y17 showed preferential binding to the leukemia cells tested whereas all the other Y-series clones gave binding at background levels only.
  • Table 6 presents the binding of FITC-labeled Y- 1 and Y- 17 to a variety of leukemic cells.
  • Yl binding to Ficoll purified normal blood cells was analyzed according to the different blood cell types. Although no binding to normal lymphocytes was detected, Yl bound to Ficoll purified monocytes from 9/28 subjects, platelets from 5/8 subjects, and red blood cells (RBC) from 1/4 subjects. However, CD14-specific antibodies bound to cells in all of the monocyte preparations and in many of the neutrophil preparations. A summary of this analysis is presented in Table 7.
  • Figure 4 demonstrates the binding of Yl to Ficoll-purified platelets (4a) and to monocyte-gated cells (4b).
  • the shift on the monocyte cell population is greater than that observed on platelets, with a calculated mean fluorescence 30-fold and 5- fold greater, respectively, than the negative control. This observation is most probably due to the characteristic of platelets to adhere in multiples to Ficoll-purified monocytes.
  • Subsequent experiments showed that, when assayed in whole blood samples, no Yl binding was observed in any of the normal monocytes, granulocytes, platelets or RBC tested. Similarly, no Yl binding to platelets was observed when derived from platelet-rich plasma (PRP).
  • PRP platelet-rich plasma
  • FIG. 5 presents the binding results of FITC-labeled scFv clones to cord-blood CD34+ stem cells;
  • Figure 5a presents the results of binding of CD34+ gated cells to the FITC-labeled negative control scFv, and
  • Figure 5b presents the same analysis for binding of CD34+ gated cells to FITC-labeled scFv clone Yl.
  • Figure 5c presents a FSC and SSC dot plot analysis of the same FITC-labeled scFv clone Y- 1 sample as in 5b. Results of this analysis indicated the presence of two CD34+ stem cell sub-populations derived from cord blood, with differences in forward scatter (FSC) an indication of cell size. Yl binds to the smaller sized cells of the two populations. The circled areas in Figures 5b and 5c delineate the sub-population of CD34+ cells that bind the clone Yl scFv. Further analysis indicated that the smaller sized cells are dead cells that are present in the cell population, and Yl binding may possibly indicate the presence of an intracellular ligand recognized by Yl.
  • FSC forward scatter
  • results are expressed as the percentage of cells in Ficoll-purified samples of a given patient, which was identified by FACS analysis as positively reacting with each individual antibody.
  • FIG. 6 presents a FACS analysis of Yl scFv binding to pre-B-ALL cells obtained from two patients.
  • a double staining procedure using either a commercially available PE-labeled CD 19 (a marker for normal peripheral B-cells; Figure 6a, 6c) or a PE-labeled CD34 (a marker for stem cells; Figure 6d) was employed, together with a FITC-labeled negative control scFv or FITC-labeled Yl scFv.
  • Figure 6b is a double negative control. Fluorescence intensity (x-axis) of cells bound by the FITC-labeled sample (scFv clone Yl), relative to the negative control-staining pattern, is presented (6e and 6f). The results of Figure 6 demonstrate that most of the leukemic, pre-B-ALL cells within each of the two samples tested are positive for Yl cell staining due to Y- 1 binding.
  • Yl is a specific clone to leukemia cells:
  • the Yl cassette belongs to the V H -DP32 germline.
  • the primary sequences (i.e., germline cassette) of all these clones differ in their CDR3 regions only. However, only Yl shows selectivity to leukemic cells.
  • the CD3 sequences of these clones are summarized in Table 10, and the binding profiles of the clones are summarized in Table 11.
  • Tables 10 and 11 indicate that, although the primary sequences are identical among the four clones with the exception of the V H -CDR3 region, the binding profiles differ significantly from one clone to another. This observation reinforces the concept that the sequence of the V H -CDR3 region plays an important role in the specificity of the binding site to the antigen. Note that neither the length of the CDR3 sequence nor the specific germfirie cassette in which it is placed appears to be a primary determinant of binding specificity. Y17 and Y-27 each comprises a 6- mer CDR3, as does Yl, and heavy chains of all three clones are derived from the identical germline. In the case of Y17 and Y-27, selective binding to hematopoietic cells has not been demonstruted.
  • AACTCGAGTGAGCTGACACAGGACCCT and the anti-sense oligonucleotide 5'-TTTGTCGACTCATTTCTTTTTTGCGGCCGCACC were used for the V L PCR reaction.
  • the cDNA product of the expected size of ⁇ 350 bp was purified, sequenced, and digested with Xhol and Notl restriction enzymes.
  • V H PCR product was digested with Ncol and Xhol restriction enzymes.
  • the final vector was designated pTria- Y 1.
  • the pTria-Yl vector from above was linearized with Xhol restriction enzyme, and synthetic complimentary double stranded oligonucleotides (5'-TCGAGAGGTGGAGGCGGT and 5' TCGAACCGCCTCCACCTC) were pre-annealed and ligated into the Xhol site, between the Yl -heavy and Yl -light chains.
  • This new vector was designated pDia-Yl. As described for the triabodies, the DNA sequence and protein expression was confirmed.
  • FACS analysis was performed on Jurkat cells using a "three step staining procedure.” First, crude extracts or purified unlabeled scFv are stained, then mouse anti-myc antibodies, and finally, FITC- or PE-conjugated anti-mouse antibodies. FACS analysis requires 5-8xl0 5 cells, which have been Ficoll-purified and resuspended in PBS+1 % BSA. Binding was carried out for 1 hour at 4°C. After each step, cells were washed and resuspended in PBS+1% BSA. After the final staining step, cells were fixed by re-suspending in PBS, 1 % BSA, 2 % formaldehyde, and then read by FACS (Becton-Dickinson).
  • the inclusion bodies were solublized in 6M Guanidine-HCl, 0.1M Tris pH 7.4, 2 mM EDTA (1.5 grams of inclusion bodies in 10 mis solubilization buffer provided -10 mg/ml soluble protein). This was incubated for at least 4 hrs. The protein concentration was measured and brought to a concentration of 10 mg/ml. DTE was added to a final concentration of 65 mM and incubated overnight at room temperature. Re-folding was initiated by dilution of 10 mis of protein (drop by drop) to a solution containing 0.5 M Arginine, 0.1 M Tris pH 8, 2 mM EDTA, 0.9 mM GSSG. The re-folding solution was incubated at -10° C for 48 hrs.
  • the re-folding solution containing the protein was dialyzed in a buffer containing 25 mM Phosphate buffer pH 6, 100 mM Urea, and concentrated to 500 mis.
  • the concentrated/dialyzed solution was bound to an SP-sepharose column, and the protein was eluted by a gradient of NaCl (up to 1M).
  • the assay system involved the use of radioactive ligands that were prepared by iodination with 125 I using chloramine T on the Yl-IgG construct or the Bolton-Hunter reagent on the CONY1 (the Yl scFv) construct.
  • the assay tubes contained 5x10° KG-1 cells per 0.2 ml and a labeled tracer with varying amounts of unlabeled competitor, in PBS + 0.1 % BSA, pH 7.4. After 1-hour incubation with agitation at 4°C, the cells were thoroughly washed with cold buffer and taken for radioactivity counting.
  • the plate was washed and anti-rabbit HRP was added for an additional hour.
  • the plate was washed 5 times and 100 ⁇ l TMB substrate was added for approximately 15 minutes then 100 ⁇ l of 0.5 H SO 4 was added to stop the reaction.
  • the optical density of the plate was measured at 450nm in an ELISA reader. [382 ] 9.8 Yl reactivity with recombinant glycocalicin (GC) expressed in Prokaryotic (E. coli) system
  • Post-translational modification such as glycosilation and sulfation is essential for scFv and commercially available antibodies binding to GC.
  • the prokaryotic (E.coli) system lacks post-translation modification mechanisms, such as glycosilation and sulfation.
  • LNDEFEAQKIEWHE was added at the C-terminus of the Yl by PCR and cloning into a LPTG inducible expression system.
  • the clone was named Yl-biotag.
  • This sequence is a substrate for the enzyme BirA, that in the presence of free biotin, the enzyme is capable of covalently connecting biotin to the lysine (K) residue (Phenotypic analysis of antigen-specific T lymphocytes. Science. 1996 Oct 4;274(5284):94-6, Altman JD et al).
  • This construct was produced as inclusion bodies in BL21 bacterial cells. Refolding was performed as described previously. Inclusion bodies were solubilized in guanidine-DTE. Refolding was done by dilution in a buffer containing arginine-tris-EDTA. Dialysis and concentration was performed followed by HiTrapQ ionic exchange purification.
  • biotinylated Yl-biotag was analyzed by HABA test (that estimates the amount of biotin per molecule) and demonstrated that there was around >0.8 biotin residues/molecule.
  • Streptavidin can bind up to 4 biotinilated Y-1-biotag molecules. The sensitivity of the binding was increased at least 100 fold due to the increase in avidity.
  • EXAMPLE 10 Construction of full sized Yl-IgGl
  • a leader sequence compatible for a mammalian expression system An exchangeable system was designed to allow convenient insertion of elerAents required for a full IgG molecule. The following complimentary double stranded oligonucleotides encoding a putative leader sequence were synthesized, annealed, and ligated into the Xhol site of mammalian expression vector (under the SR ⁇ 5 promoter). 5'-
  • V L encoding sequence derived from the Yl scFv cDNA sequence was inserted between the leader and the constant light region-encoding sequence.
  • V H encoding sequence derived from the Yl scFv cDNA sequence was inserted between the leader and the constant heavy region-encoding sequence. This was accomplished by PCR amplification of the vector pHEN-Yl, encoding for the original Yl, to obtain the V and the V H regions, individually.
  • RT-PCR was performed on mRNA extracted from a pool of normal peripheral B-cells (CD 19+ cells) in combination with the sense 5'-CCGTCCTAGGTCAGCCCAAGGCTGC and the anti-sense 5'-TTTGCGGCCGCTCATGAACATTCTGTAGGGGCCACTGT oligonucleotides.
  • the PCR product of the expected size (-400 bp) was purified, sequenced, and digested with Avrll and Notl restriction enzymes.
  • CMV - clone #40 human B cell clone
  • This clone was shown to secrete IgGl against human CMV and was also shown to induce ADCC response in in-vitro assays.
  • CH1-CH3 cDNA oligonucleotides 5'-
  • CCGCTCGAGTGC(T/C)TCCACCAAGGGCCCATC(G/C)GTCTTC (sense) and 5'- TTTGCGGCCGCTCATTTACCC(A/G)GAGACAGGGAGAGGCT (anti-sense) were synthesized and used for PCR amplification.
  • the PCR product of expected size (-1500 bp) was purified, sequenced, and digested with Avrll and Notl restriction enzymes.
  • V H and V L regions are each encoded by amino acid sequences that are bolded, followed by either the IgGl (for the heavy chain) or the ⁇ 3 (for the light chain) constant region sequences.
  • Vectors Yl-HC and Yl-LC were used individually for the transfection and selection of stable cells expressing the heavy or light chains. Following selection on G418 and cell growth, the secreted protein in the supernatant was analyzed for IgGl expression by the capture ELA assay and by Western blot analysis, as described below.
  • F-12 medium with 10% fetal calf serum and 40 ⁇ g/mi gentaMicin at 37°C in 5% C0 2 atmosphere.
  • One day before transfection 0.8 xlO cells were seeded on 90mm dishes. The cultures were co-transfected with 10 ⁇ g of light and heavy chains DNA by the FuGene (Roche) transfection reagent technique. After 2 days of growth in nonselective medium, the cells were cultured for 10-12 days in F-12 medium containing 550 ⁇ g/ml neomycin and 3 ⁇ g/ml puromycin. The cells were trypsinized and cloned by limiting dilution of 0.5 cell/well in Costar 96-well plates. Individual colonies were picked, grown in six -well dishes and transferred to flasks.
  • Results indicate that both Yl-IgG and scFv-YI bind to the Jurkat cells, with approximately 10 3 -fold more scFv-YI molecules needed to obtain a level of detection similar to that of the Yl-IgG.
  • Table 1 Panning results derived from protocol AM. The estimated number of phagemids used for panning (input), and the estimated number of bound phagemids eluted (output) are summarized for the four consecutive steps of the AM biopanning protocol. The cell source and elution medium for each output result is listed, as well as the term used to distinguish each separate stock.
  • Table 2 Selected clones following the AM biopanning protocol.
  • V H -CDR3 size The number of amino acid residues in the CDR3 region (V H -CDR3 size) and the CDR3 amino acid sequences for the different clone types isolated are summarized. n addition, the frequency of each of the clone types in the two AM biopanning outputs, the T16M3 and T16M3.1 outputs, are presented.
  • Table 3 Panning results derived from the YPR protocol. The estimated number of phagemids used for panning (input), and the estimated number of bound phagemids eluted (output) are summarized. The elution medium for each output result is listed, as well as the term used to distinguish each separate stock.
  • Table 4 Panning results derived from the YPNR protocol. The estimated number of phagemids used for panning (input), and the estimated number of bound phagemids eluted (output) are summarized for the three consecutive steps of the YPNR biopanning protocol. The elution medium for each output result is listed, as well as the term used to distinguish each separate stock.
  • Table 5 Selected Y-series clones following the YPR biopanning protocol with the R3 output. Several different clones were identified in the R3 output stock. The number of amino acid residues comprising, and the amino acid sequences of, the V H -CDR3 regions of the identified clones, as well as germline designations, are detailed. [417.] Table 6: Yl binding specificity for leukemia cells. The results of binding experiments of three different scFv clones, each reacted with mixtures of cells containing primarily each of seven different leukemic cell types, as determined by FACS analysis, are presented. The results represent the fraction of patients, the cells of whom were identified by FACS analysis as positively reacting with each tested antibody. The numerator represents the number of positive patients, with the denominator denoting the total number of patients tested for a given scFv/leukemic cell type combination
  • Table 7 FACS analysis of scFv binding to Ficoll-purified normal blood cells. Three scFv clones are each analyzed for binding to five different Ficoll- purified normal blood cell types. These binding results represent the fraction of normal blood samples that were identified by FACS analysis as positively reacting with each tested antibody.
  • Table 8 Comparison of Yl scFv binding with binding of antibodies to various cell markers. Results of FACS analysis of staining by Yl and by a panel of other antibodies are presented. Ficoll-purified peripheral and bone manow cells from ANE patients were prepared and the binding specificity of Yl scFv compared to various cell markers on AML cells was studied. The results are expressed as the percentage of cells in the Ficoll-purified samples of a given patient, which was identified by FACS analysis as positively reacting with each Fv.
  • CD13 - a marker for granulocytes and monocytes
  • CD 14 - a marker for monocytes and neutrophils
  • CD33 - a marker for normal myeloid cells and leukemic myeloid cells
  • CD34 - a marker for stem cells.
  • Table 9 Binding of Yl to hematopoietic cell lines. FACS analysis was performed to determine the binding of Yl scFv to three different categories of human leukemia cell lines, and to one murine cell line. Cell lines to which Yl was positively bound (reactive) or not (non-reactive) are listed.
  • Clones Yl, Y17, Y-27 and Y-44 were identified during the biopanning selection on platelets (YPR and YPNR protocols). The sequence of the V H -CDR3 region of each of these clones is presented.
  • Table 11 Binding profile of V H 3-DP32 isolated clones. The binding specificity of DP32-derived clones to several hematopoietic cells was tested by FACS analysis.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2001/049440 2000-12-29 2001-12-31 Specific human antibodies for selective cancer therapy Ceased WO2002059264A2 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
IL15669001A IL156690A0 (en) 2000-12-29 2001-12-31 Specific human antibodies for selective cancer therapy
JP2002559551A JP2004524023A (ja) 2000-12-29 2001-12-31 選択的癌療法のための特異的ヒト抗体
BR0116763-4A BR0116763A (pt) 2000-12-29 2001-12-31 Anticorpos humanos especìficos para terapia seletiva do c ncer
CA002433227A CA2433227A1 (en) 2000-12-29 2001-12-31 Specific human antibodies for selective cancer therapy
MXPA03005944A MXPA03005944A (es) 2000-12-29 2001-12-31 Anticuerpos humanos especificos para terapia selectiva de cancer.
EP01994329A EP1353937A4 (en) 2000-12-29 2001-12-31 SPECIFIC HUMAN ANTIBODIES FOR SELECTIVE CANCER THERAPY
NZ527173A NZ527173A (en) 2000-12-29 2001-12-31 Specific human antibodies for selective cancer therapy
KR10-2003-7008885A KR20030091952A (ko) 2000-12-29 2001-12-31 선택적인 암 치료용의 특이적 인간 항체
AU2002246737A AU2002246737B2 (en) 2000-12-29 2001-12-31 Specific human antibodies for selective cancer therapy
HU0400775A HUP0400775A2 (en) 2000-12-29 2001-12-31 Specific human antibodies for selective cancer therapy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US75118100A 2000-12-29 2000-12-29
US09/751,181 2000-12-29

Publications (2)

Publication Number Publication Date
WO2002059264A2 true WO2002059264A2 (en) 2002-08-01
WO2002059264A3 WO2002059264A3 (en) 2003-03-06

Family

ID=25020844

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/049440 Ceased WO2002059264A2 (en) 2000-12-29 2001-12-31 Specific human antibodies for selective cancer therapy

Country Status (15)

Country Link
EP (1) EP1353937A4 (cg-RX-API-DMAC7.html)
JP (1) JP2004524023A (cg-RX-API-DMAC7.html)
KR (1) KR20030091952A (cg-RX-API-DMAC7.html)
CN (1) CN100374456C (cg-RX-API-DMAC7.html)
AU (1) AU2002246737B2 (cg-RX-API-DMAC7.html)
BR (1) BR0116763A (cg-RX-API-DMAC7.html)
CA (1) CA2433227A1 (cg-RX-API-DMAC7.html)
CZ (1) CZ20031983A3 (cg-RX-API-DMAC7.html)
HU (1) HUP0400775A2 (cg-RX-API-DMAC7.html)
IL (1) IL156690A0 (cg-RX-API-DMAC7.html)
MX (1) MXPA03005944A (cg-RX-API-DMAC7.html)
NZ (1) NZ527173A (cg-RX-API-DMAC7.html)
PL (1) PL365758A1 (cg-RX-API-DMAC7.html)
RU (1) RU2316564C2 (cg-RX-API-DMAC7.html)
WO (1) WO2002059264A2 (cg-RX-API-DMAC7.html)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1551452A4 (en) * 2002-07-01 2006-08-30 Savient Pharmaceuticals Inc COMPOSITIONS AND METHODS FOR THERAPEUTIC TREATMENT
EP1646401A4 (en) * 2003-06-30 2007-07-18 Bio Technology General Israel SPECIFIC HUMAN ANTIBODIES
US7452537B2 (en) 2005-04-26 2008-11-18 Agouron Pharmaceuticals, Inc. P-cadherin antibodies
WO2010078916A1 (en) * 2008-12-19 2010-07-15 Philogen S.P.A. Immunocytokines for tumour therapy with chemotherapeutic agents
WO2016100533A3 (en) * 2014-12-17 2016-08-18 Intrexon Corporation Intercalated single-chain variable fragments
WO2016169992A1 (en) * 2015-04-22 2016-10-27 Ucb Biopharma Sprl Method for protein purification
WO2022103961A1 (en) * 2020-11-13 2022-05-19 Prometheus Biosciences, Inc. Methods, systems, and kits for treatment of inflammatory diseases targeting tl1a
US12215147B2 (en) 2019-05-14 2025-02-04 Prometheus Biosciences, Inc. Methods of selecting, based on polymorphisms, an inflammatory bowel disease subject for treatment with an anti-TL1A antibody
US12331132B2 (en) 2018-04-11 2025-06-17 Inhibrx Biosciences, Inc. Multispecific polypeptide constructs having constrained CD3 binding and related methods and uses
US12590169B2 (en) 2018-10-11 2026-03-31 Inhibrx Biosciences, Inc. 5T4 single domain antibodies and therapeutic compositions thereof

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103003296A (zh) * 2010-07-09 2013-03-27 阿菲博迪公司 多肽
CN101948534B (zh) * 2010-08-19 2014-05-28 中国科学院生物物理研究所 一种筛选抗体的方法
GB201310544D0 (en) * 2013-06-13 2013-07-31 Ucb Pharma Sa Obtaining an improved therapeutic ligand
US20160115247A1 (en) * 2014-10-23 2016-04-28 Singh Biotechnology, Llc Single domain antibodies directed against intracellular antigens
US12509530B2 (en) 2015-08-27 2025-12-30 Singh Moelcular Medicine, LLC Single domain antibodies directed against intracellular antigens
CA2998270A1 (en) * 2015-10-01 2017-04-06 Ospedale San Raffaele S.R.L. Tcr and uses thereof
FI3377103T4 (fi) * 2015-11-19 2025-04-16 Revitope Limited Funktionaalinen vasta-ainefragmenttikomplementointi kaksikomponenttiselle järjestelmälle epätoivottujen solujen uudelleenohjattua tappamista varten
PE20241349A1 (es) * 2016-09-14 2024-07-03 Teneobio Inc Anticuerpos de union a cd3
IL317134A (en) 2016-12-21 2025-01-01 Teneobio Inc An antibody containing only heavy chains that binds a human B-cell maturation antigen, a pharmaceutical composition containing the same, its use in the treatment of B-cell disorders and a method for its preparation
SG11201909160WA (en) * 2017-04-11 2019-10-30 Inhibrx Inc Multispecific polypeptide constructs having constrained cd3 binding and methods of using the same
CN116333100A (zh) * 2022-10-31 2023-06-27 南京欧凯生物科技有限公司 一种重组人的lgM抗体快速纯化方法

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997002479A2 (en) * 1995-06-30 1997-01-23 Yale University Human monoclonal anti-tumor antibodies
WO1998031394A2 (en) * 1997-01-22 1998-07-23 Board Of Regents, The University Of Texas System Tissue factor methods and compositions for coagulation and tumor treatment

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1551452A4 (en) * 2002-07-01 2006-08-30 Savient Pharmaceuticals Inc COMPOSITIONS AND METHODS FOR THERAPEUTIC TREATMENT
EP1646401A4 (en) * 2003-06-30 2007-07-18 Bio Technology General Israel SPECIFIC HUMAN ANTIBODIES
JP2007527393A (ja) * 2003-06-30 2007-09-27 バイオ−テクノロジー・ジェネラル(イスラエル)リミテッド 特異的ヒト抗体
US7452537B2 (en) 2005-04-26 2008-11-18 Agouron Pharmaceuticals, Inc. P-cadherin antibodies
US7928214B2 (en) 2005-04-26 2011-04-19 Agouron Pharmaceuticals, Inc. P-cadherin antibodies
US8974781B2 (en) 2005-04-26 2015-03-10 Pfizer Inc. P-cadherin antibodies
WO2010078916A1 (en) * 2008-12-19 2010-07-15 Philogen S.P.A. Immunocytokines for tumour therapy with chemotherapeutic agents
US8580267B2 (en) 2008-12-19 2013-11-12 Philogen S.P.A. Immunocytokines for tumour therapy with chemotherapeutic agents
WO2016100533A3 (en) * 2014-12-17 2016-08-18 Intrexon Corporation Intercalated single-chain variable fragments
KR20170139131A (ko) * 2015-04-22 2017-12-18 유씨비 바이오파마 에스피알엘 단백질 정제 방법
WO2016169992A1 (en) * 2015-04-22 2016-10-27 Ucb Biopharma Sprl Method for protein purification
US10927164B2 (en) 2015-04-22 2021-02-23 UCB Biopharma SRL Method for protein purification
AU2016251223B2 (en) * 2015-04-22 2021-12-09 UCB Biopharma SRL Method for protein purification
KR102675400B1 (ko) * 2015-04-22 2024-06-13 유씨비 바이오파마 에스알엘 단백질 정제 방법
US12516106B2 (en) 2015-04-22 2026-01-06 UCB Biopharma SRL Method for protein purification
US12331132B2 (en) 2018-04-11 2025-06-17 Inhibrx Biosciences, Inc. Multispecific polypeptide constructs having constrained CD3 binding and related methods and uses
US12590169B2 (en) 2018-10-11 2026-03-31 Inhibrx Biosciences, Inc. 5T4 single domain antibodies and therapeutic compositions thereof
US12215147B2 (en) 2019-05-14 2025-02-04 Prometheus Biosciences, Inc. Methods of selecting, based on polymorphisms, an inflammatory bowel disease subject for treatment with an anti-TL1A antibody
US12391752B2 (en) 2019-05-14 2025-08-19 Prometheus Biosciences, Inc. Methods of enriching or amplifying nucleic acids in a sample from a patient with inflammatory bowel disease
WO2022103961A1 (en) * 2020-11-13 2022-05-19 Prometheus Biosciences, Inc. Methods, systems, and kits for treatment of inflammatory diseases targeting tl1a

Also Published As

Publication number Publication date
EP1353937A2 (en) 2003-10-22
KR20030091952A (ko) 2003-12-03
IL156690A0 (en) 2004-01-04
WO2002059264A3 (en) 2003-03-06
EP1353937A4 (en) 2005-04-13
CN1551886A (zh) 2004-12-01
HUP0400775A2 (en) 2007-05-02
PL365758A1 (en) 2005-01-10
MXPA03005944A (es) 2005-04-29
AU2002246737B2 (en) 2007-03-01
CN100374456C (zh) 2008-03-12
BR0116763A (pt) 2004-03-09
NZ527173A (en) 2006-03-31
CA2433227A1 (en) 2002-08-01
RU2003123100A (ru) 2005-03-10
CZ20031983A3 (cs) 2005-07-13
JP2004524023A (ja) 2004-08-12
RU2316564C2 (ru) 2008-02-10

Similar Documents

Publication Publication Date Title
AU2002246737B2 (en) Specific human antibodies for selective cancer therapy
AU2002246737A1 (en) Specific human antibodies for selective cancer therapy
AU2001249760B2 (en) Mucin-1 specific binding members and methods of use thereof
US20040002450A1 (en) Y17 - isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US20040001822A1 (en) Y1-isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US20040001839A1 (en) Multimers - isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US7132510B2 (en) Specific human antibodies for selective cancer therapy
AU2001249760A1 (en) Mucin-1 specific binding members and methods of use thereof
KR102698752B1 (ko) 암 치료법에서 괴사를 표적화하기 위한 인간화 항-핵 항체
MXPA03005945A (es) Moleculas aisladas que comprenden epitopes que contienen grupos sulfato, anticuerpos para tales epitopes y usos de ellos.
JP2005503756A5 (cg-RX-API-DMAC7.html)
US20040202665A1 (en) Compositions and methods for therapeutic treatment
CA2491363A1 (en) Antibodies and uses thereof
KR20050059001A (ko) 치료적 처리를 위한 조성물 및 방법
US20110117602A1 (en) Human antibody capable of inducing apoptosis
US20040208877A1 (en) Antibodies and uses thereof
AU2002246738A1 (en) Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 01822885.2

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 648/KOLNP/2003

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: PA/a/2003/005944

Country of ref document: MX

Ref document number: 2433227

Country of ref document: CA

Ref document number: 2002559551

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 156690

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 1020037008885

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 200305337

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: PV2003-1983

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 527173

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2001994329

Country of ref document: EP

Ref document number: 01172/DELNP/2003

Country of ref document: IN

Ref document number: 2002246737

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2001994329

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1020037008885

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: PV2003-1983

Country of ref document: CZ

WWP Wipo information: published in national office

Ref document number: 527173

Country of ref document: NZ

WWG Wipo information: grant in national office

Ref document number: 2002246737

Country of ref document: AU