WO2002053171A2 - Verwendung von 'intermediate-conductance kaliumkanälen und modulatoren zur diagnose und behandlung von krankheiten mit gestörter keratinozytenaktivität - Google Patents
Verwendung von 'intermediate-conductance kaliumkanälen und modulatoren zur diagnose und behandlung von krankheiten mit gestörter keratinozytenaktivität Download PDFInfo
- Publication number
- WO2002053171A2 WO2002053171A2 PCT/EP2001/015317 EP0115317W WO02053171A2 WO 2002053171 A2 WO2002053171 A2 WO 2002053171A2 EP 0115317 W EP0115317 W EP 0115317W WO 02053171 A2 WO02053171 A2 WO 02053171A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- group
- alkyl
- phenyl
- formula
- halogen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 C*=C(*)c1c(*)c(*)c(*=C)cc1 Chemical compound C*=C(*)c1c(*)c(*)c(*=C)cc1 0.000 description 1
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/4164—1,3-Diazoles
- A61K31/4184—1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/42—Oxazoles
- A61K31/423—Oxazoles condensed with carbocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/425—Thiazoles
- A61K31/428—Thiazoles condensed with carbocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4422—1,4-Dihydropyridines, e.g. nifedipine, nicardipine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/04—Antipruritics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/10—Anti-acne agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/16—Emollients or protectives, e.g. against radiation
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6881—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from skin
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/20—Dermatological disorders
- G01N2800/205—Scaling palpular diseases, e.g. psoriasis, pytiriasis
Definitions
- the invention relates to the use of “intermediate conductance” calcium-activated potassium channels and / or its coding nucleic acids from humans or mice for the diagnosis, prevention and / or treatment of diseases which are associated with impaired keratinocyte activity, and to their use for identifying pharmacologically
- the invention further relates to the use of modulators of intermediate-conductance calcium-activated potassium channels for the diagnosis, prevention and / or treatment of diseases which are associated with impaired keratinocyte activity.
- the wound healing process is an extremely complex process, which is characterized by the phases of blood clotting in the area of the wound, the recruitment of inflammatory cells, re-epithalization and tissue reorganization is.
- Blood clotting leads to the formation of a fibrin matrix, which is used to fill the cavity created by the wound and to provide a matrix through which cells can migrate.
- neutrophils and monocytes that initiate an inflammatory reaction are recruited by chemo-attractants embedded in the matrix.
- keratinocytes that make up the majority of the Make up epidermal cells and only occur in the skin.
- the keratinocyte composition of the integrin on the cell surface changes, allowing them to detach from their starting point and migrate over the wound. There they attach again, eventually proliferate and differentiate.
- Keratinocytes secrete matrix metalloproteinases and collagenases, which break down proteins in the surrounding tissue and thus enable migration in the wound tissue.
- keratinocytes secrete growth factors such as VEGF, KAF, TGF-beta and TGF-alpha.
- the overview of the wound healing process shows that complex wound and keratinocyte activity, such as migration, proliferation and differentiation, are required for normal wound healing.
- Disorders of keratinocyte activity can therefore lead to wound healing disorders and other skin diseases.
- Diseases associated with dysfunctional keratinocytes include psoriasis, contact dermafitis, atopic eczema, ulcers, vitiligo, hyperkeratosis, actinic keratosis and acne.
- aging skin is characterized by a thinning of the epidermis and thus the protective barrier.
- the number of enzymatically active melanocytes decreases by 10-20% every 10 years in people aged 25-30 years, which increases the radiation exposure.
- the skin pigmentation of old skin is often heterogeneous; Local loss of pigmentation and hyperpigmentation are observed.
- Common pigment lesions are e.g. Lentigo and Ephelids.
- Potassium channels have in some cases been linked to genetically inheritable diseases (Curran, 1998, Curr. Opin. In Biotech., 9: 565-572). This fact, as well as the advantages of the potassium channels, that they can be used to develop robust assay systems for in vitro characterization and for "high throughput screening", justify the attractiveness of the potassium channels as a goal of drug development (Curran, supra).
- the family of potassium channels is a very heterogeneous group that can be divided into five subfamilies: the voltage-activated potassium channels (Kv), the "long QT related" potassium channels, the "inward rectifying” potassium channels and the calcium-activated potassium channels.
- the voltage-dependent potassium channels are mentioned in a large number of publications as suitable targets for the treatment of skin diseases (WO 99/07411; WO 97/18332; WO 99/25703), but so far there are no medications for the treatment of diseases which are associated with disturbed keratinocyte activity have been developed.
- the calcium-activated potassium channels are divided into three well-characterized subgroups: the "small-conductance” (SK); “intermediate conduetance” (IK) and “big-conduetance” (BK) potassium channels. These subgroups differ in their voltage and calcium sensitivity, their expression profile, biological function and their pharmacological properties.
- the Gardos channel which is characterized purely electrophysiologically and pharmacologically in erythrocytes, is identical to hlKl (Ishii et al. 1997 Proc. Natl. Acad. Sci. USA 94: 11651-11656).
- the Gardos channel plays an important role in the strength of the expression of the sickle cell anemia phenotype by influencing the dehydration and the volume of diseased erythrocytes (Curran, supra).
- the cDNA encoding the IK channel was isolated from erythroleukemia cells (Vandorpe et al., Supra). In this study it could be shown that the expression of mIKl is increased during the differentiation of ES cells to erythroid cells. In addition, proliferation and differentiation could be inhibited by inhibitors of the ion channel.
- the object of the invention was to provide polypeptides and / or nucleic acids coding for them, which are involved in diseases which are associated with impaired keratinocyte activity, and their use in the diagnosis, prevention or treatment and in the identification and development of pharmaceuticals which decisively improved in diseases which are associated with impaired keratinocyte activity.
- polypeptides and their coding nucleic acids are not among the previously known targets for diagnosis, for example indication and / or treatment - such as for example modulation - and / or prevention of diseases associated with impaired keratinocyte activity in connection or for the identification of pharmacologically active substances, so that completely new therapeutic approaches result from this invention
- modulators of the polypeptides according to the invention - such as inhibitors or activators - were not used for diagnosis, prevention on and / or treatment of diseases associated with impaired keratinocyte activity, so that completely new therapeutic approaches arise.
- the task is therefore accomplished through the use of the intermediate-conductance calcium-activated potassium channel IK1 polypeptide from humans (hlKl or hSK4; SEQ ID No. 3; Ishii et al. 1997 Proc. Natl. Acad. Sci. USA 94: 11651-11656 ; Joiner et al., 1997, Proc. Natl. Acad. Sci. USA, 94: 11013-11018; WO 99/03882; WO 98/11139) or mouse (mIKl; SEQ ID No. 4; Vandorpe et al. 1998 , J. Biol. Chem.
- the object is further achieved by using modulators of the IK1 activity for the diagnosis, prevention and / or treatment of diseases which are associated with impaired keratinocyte activity.
- modulators of the IK1 activity for the diagnosis, prevention and / or treatment of diseases which are associated with impaired keratinocyte activity.
- a connection with diseases which are connected with impaired keratinocyte activity for example with an impaired wound healing, has so far been described or suggested. It was therefore unexpected that these compounds can be used in the present invention.
- the "accession" numbers or accession numbers of the polypeptides used according to the invention and their cDNAs are listed in Table 1.
- the modulators of the activity of the polypeptides which can be used according to the invention can be used to diagnose, prevent and / or treat diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, so that completely new ones therapeutic approaches start from this invention.
- polypeptides used according to the invention can furthermore be characterized in that they are produced synthetically.
- all or part of the polypeptide can be synthesized using classic synthesis (Memfield technique).
- Parts of the polypeptides described above are particularly suitable for obtaining antisera by means of which suitable gene expression banks can be searched in order to arrive at further functional variants of a polypeptide which can be used according to the invention.
- “Keratinocyte activity” means the state of a keratinocyte, which is determined by the parameters proliferation rate and the degree of differentiation of the keratinocytes to be examined. Methods for determining the parameters are known to the person skilled in the art (de Fries and Mitsuhashi, 1995, J. Clin. Lab. Anal.
- Disrupted keratinocyte activity means a keratinocyte activity of a keratinocyte in the skin which differs from the keratinocyte activity of keratinocytes in normal, intact skin.
- the activity of the "disturbed" keratinocytes can be caused by an increased or slowed rate of proliferation, or by an premature increase differentiated from slow keratinocytes, slowed, delayed or non-existent differentiation.
- Diseases which are connected with disturbed keratinocyte activity are for example contact dermatitis, atopic eczema, vitiligo, hyperkeratoses, actinic keratoses, hypertrophic scars, keloids, lentigo, ephelids, aging skin in particular wounds, for example normally healing wounds and poorly healing wounds, in particular ulcers preferred diseases in the sense of the present invention which are characterized by disturbed keratinocyte activity
- the disease is psoriasis.
- regulation is understood to mean, for example, the increase or decrease in the amount and / or activity of the polypeptides or the nucleic acid encoding them, this change being caused, for example transcriptional, translational as well as post-transcriptional or post-translational level can take place.
- polypeptides which, for example, like the polypeptides which can be used according to the invention, are related to impaired keratinocyte activity and / or have structural features of the polypeptides which can be used according to the invention.
- Functional variants also include fusion proteins of the IK channels, with a proportion of approximately 1-300, preferably approximately 1-200, particularly preferably approximately 1-150, in particular approximately 1-100, especially approximately 1-50 Foreign amino acids, which can be linked N-terminal, C-terminal and as an insert with the polypeptide chain of the IK channels.
- an IK channel that can be used according to the invention can be linked to a “green fluorescent protein” or variants thereof.
- Functional variants of the polypeptide can also include parts of the polypeptide used according to the invention with a length of at least 6 amino acids, preferably with a length of at least 8 amino acids, in particular with a length of at least 12 amino acids, very particularly with a length of at least 20 amino acids, especially with a length of at least 40 amino acids be at least 80 amino acids in length.
- Deletions of the polypeptide in the range from about 1-60, preferably from about 1-30, in particular from about 1-15, especially from about 1-5 amino acids are also included.
- the first amino acid methionine may be absent without significantly changing the function of the polypeptide.
- “Functional variants” in the sense of the present invention are polypeptides which have a sequence homology, in particular a sequence identity, of approximately 50%, preferably approximately 60%, in particular approximately 70%, particularly preferably approximately 90%, most preferably 95% to one of the IK channels with the amino acid sequence according to one of SEQ ID No. 3 or SEQ ID No. 4.
- Examples of such functional variants are accordingly also the corresponding polypeptides, which are derived from organisms other than humans or the mouse, preferably from non-human mammals such as, for. B. monkeys, pigs and rats.
- Other examples are polypeptides that are encoded by different alleles of the gene, in different individuals or in different organs of an organism.
- Functional variants also include, for example, polypeptides which are encoded by nucleic acids which are derived from non-skin-specific tissue, e.g. B. embryonic tissue, are isolated, but after expression in a keratinocyte have the designated functions.
- the activity of the polypeptide to be tested can be compared with the activity of a polypeptide according to SEQ ID No. 3 or SEQ ID No. 4 using functional tests become.
- the polypeptide to be tested fulfills the requirements of a functional variant at the sequence identity level, the polypeptide to be tested is a functional variant if its activity in the functional test is similar or similar to that of the polypeptide which can be used according to the invention turns out identical.
- These functional tests include, for example, the application of an expression vector which contains a nucleic acid encoding the polypeptide to be tested, or the application of the polypeptide to be tested itself or an antibody directed against the polypeptide to be tested or an antisense oligonucleotide in wounds. After incubation, for example of an expression vector, the progress of wound healing upon administration of the different expression vectors containing either a nucleic acid encoding the polypeptide to be tested or a nucleic acid encoding a polypeptide which can be used according to the invention or an expression vector without insert is compared.
- An expression vector which contains a nucleic acid encoding the polypeptide to be tested, or the polypeptide itself or an antibody directed against the polypeptide to be tested or an antisense oligonucleotide, for example, is applied to an affected human skin area which has been transplanted onto SCID mice. applied and the course of the skin disease, for example the healing, determined and compared with the course of the skin disease in the control experiment. In the case of psoriasis, this can also include, for example, anti-proliferation studies in so-called "mouse tail tests".
- tail skin has so-called "hinge”"Regions where hair comes out from under the scales; there the skin is orthokeratotic and has a granular layer like normal skin.
- histological sections of the tail skin are formed on the formation of a granulation layer, the induction Orthokeratotic tissue in parakeratotic regions and the thickness of the epidermis were measured (Jarret et al., 1970, Br J Dermatol 82: 187-199).
- This method can also be quantified by measuring sagital sections after hematoxylin / eosin staining (Bosman et al., 1992, Skin Pharmacol 5: 41-48; Bosman et al., 1994, Skin Pharmakol 7: 324-334).
- the anti-inflammatory effect of the polypeptide to be tested can be used by topical application on mice in which edema was induced with oxazolone or on pigs in whom allergic skin reactions were induced with DNFB (Meingassner et al., 1997, Br J Dermatol 137: 568-576 ).
- Functional tests also include measuring the influence of the polypeptide to be tested on the extent of skin flaking.
- TEWL transepidermal water loss
- coding nucleic acid refers to a DNA sequence which codes for an isolatable bioactive polypeptide which can be used according to the invention or a precursor.
- the polypeptide can be encoded by a full-length sequence or any part of the coding sequence, as long as the specific, for example ion channel activity is retained.
- nucleic acids which can be used according to the invention, for example due to the degeneracy of the genetic code, or that untranslated sequences can be attached to the 5 'and / or 3' end of the nucleic acid without whose activity is changed significantly.
- This invention therefore also includes so-called "variants" of the nucleic acids described above.
- “Stringent hybridization conditions” are understood to mean those conditions in which hybridization at 60 ° C. in 2.5 ⁇ SSC buffer is followed of several washing steps at 37 ° C in a lower buffer concentration, such as 0.5 x SSC buffer and is stable.
- variants denotes all DNA sequences that are complementary to a DNA sequence that hybridize to the reference sequence under stringent conditions and code for a polypeptide that has an activity similar to that of the polypeptide encoded by the reference sequence.
- Variants of the nucleic acids can also be parts of the nucleic acids used according to the invention with at least 8 nucleotides in length, preferably with at least 18 nucleotides in length, in particular with at least 24 nucleotides in length.
- the nucleic acids used according to the invention are preferably DNA or RNA, preferably a DNA, in particular a double-stranded DNA. Furthermore, the sequence of the nucleic acids can be characterized in that it has at least one intron and / or a polyA sequence. The nucleic acids used according to the invention can also be used in the form of their antisense sequence.
- nucleic acid which has been prepared synthetically can be used to carry out the invention.
- the nucleic acid which can be used according to the invention can be used chemically using the cDNA sequences according to SEQ ID No. 1 or SEQ ID No. 2 and / or using the protein sequences according to SEQ ID No. 3 or SEQ ID No. 4 (see also Table 1)
- the genetic code z. B. can be synthesized by the phosphotriester method (see, for example, Uhlmann, E. & Peyman, A. (1990) Chemical Reviews, 90, 543-584, No. 4).
- nucleic acid sequences used according to the invention is the construction of anti-sense oligonucleotides (Zheng and Kemeny, 1995, Clin. Exp. Immunol. 100: 380-2; Nellen and Lichtenstein, 1993, Trends Biochem. Sei. 18: 419 -23; Stein, 1992, Leukemia 6: 967-74) and / or ribozymes (Amarzguioui, et al. 1998, Cell. Mol. Life Sei. 54: 1175-202; Vaish, et al., 1998, Nucleic Acids Res . 26: 5237-42; Persidis, 1997, Nat.Biotechnol.
- siRNAs small interfering RNA molecules
- the expression of the corresponding genes in skin cells can be reduced both in vivo and in vitro by using antisense molecules and / or siRNA molecules and / or ribozymes.
- These oligonucleotides can therefore be used as therapeutic agents.
- This strategy is suitable for skin cells, preferably for keratinocytes, especially if the "antisense" oligonucleotides are complexed with liposomes (Smyth et al., 1997, J. Invest. Dermatol. 108: 523-6; White et al., 1999 , J. Invest. Dermatol. 112: 699-705; White et al., 1999, J. Invest. Dermatol. 112: 887-92).
- a single-stranded DNA or RNA is preferred for use as a probe or as an "antisense" oligonucleotide.
- the probe according to the invention can be used for the diagnosis of diseases which are related to impaired keratinocyte activity, if appropriate combined or together with suitable additives and / or auxiliaries.
- oligonucleotides are rapidly degraded by endo- or exonucleases, in particular by DNases and RNases occurring in the cell. It is therefore advantageous to modify the nucleic acid in order to stabilize it against degradation so that a high concentration of the nucleic acid is maintained in the cell over a long period of time (Beigelman et al., 1995, Nucleic Acids Res. 23: 3989- 94; Dudycz, 1995, WO 95/11910; Macadam et al., 1998, WO 98/37240; Reese et al., 1997, WO 97/29116).
- stabilization can be obtained by introducing one or more internucleotide phosphor groups or by introducing one or more non-phosphor internucleotides.
- Suitable modified internucleotides are summarized in Uhlmann and Peymann (1990 Chem. Rev. 90, 544) (see also Beigelman et al., 1995 Nucleic Acids Res. 23: 3989-94; Dudycz, 1995, WO 95/11910; Macadam et al ., 1998, WO 98/37240; Reese et al., 1997, WO 97/29116).
- Modified internucleotide phosphate residues and / or non-phosphorus bridges in a nucleic acid which can be used in one of the uses according to the invention contain, for example, methylphosphonate, phosphorothioate, phosphoramidate, phosphorodithioate, phosphate esters, while non-phosphorus internucleotide analogs, for example siloxane bridges, carbonate bridges , Carboxymethyl ester, acetamidate bridges and / or thioether bridges. It is also intended that this modification improve the shelf life of a pharmaceutical composition that can be used in one of the uses of the invention.
- the nucleic acids which can be used according to the invention are used to produce a vector, preferably in the form of a "shuttle” vector, phagemid, cosmid, expression vector or vector which is active in gene therapy.
- "knock-out" gene constructs or expression cassettes can be produced using the nucleic acids described above.
- the nucleic acid which can be used according to the invention can be contained in a vector, preferably in an expression vector or a gene therapy vector.
- the gene therapeutically active vector preferably contains skin or keratinocyte-specific regulatory sequences which are functionally linked to the nucleic acid described above.
- a double-stranded DNA is generally preferred for the expression of the gene in question, the DNA region coding for the polypeptide being particularly preferred.
- This area begins, for example, with the first start codon (ATG) lying in a Kozak sequence (Kozak, 1987, Nucleic. Acids Res. 15: 8125-48) until the next stop codon (TAG, TGA or TAA), the is in the same reading frame as the ATG.
- ATG first start codon
- TGA next stop codon
- this region begins with a conserved sequence of 6 nucleotides a few nucleotides above the start codon, the so-called Shine-Dalgarno sequence (Shine & Dalgarno, 1975, Eur J Biochem. 57: 221-30).
- the expression vectors can be prokaryotic or eukaryotic expression vectors.
- prokaryotic expression vectors are e.g. for expression in E. coli the vectors pGEM or pUC derivatives and for eukaryotic expression vectors for expression in Saccharomyces cerevisiae z.
- the expression vectors also contain suitable promoters for the respective host cell, e.g. B. the trp promoter for expression in E. coli (see e.g. EP-B1-0 154 133), the Met 25, GAL 1 or ADH2 promoter for expression in yeasts (Radorel et al. (1983 ), J. Biol. Chem. 258, 2674-2682; Mumberg, supra) or the baculovirus polyhedrin promoter, for expression in insect cells (see e.g. 13. EP-B1-0 127 839).
- regulatory elements are suitable for the expression in mammalian cells, which allow a constitutive, regulatable, tissue-specific, cell cycle-specific or metabolically specific expression in eukaryotic cells. Regulatory elements according to the present invention contain promoter, activator, enhancer, silencer and / or repressor sequences.
- Suitable regulatory elements which enable constitutive expression in eukaryotes are promoters which are recognized by the RNA polymerase III or viral promoters, CMV enhancers, CMV promoters, SV40 promoters or LTR promoters, e.g. B. from MMTV (mouse mammary tumor virus; Lee et al. (1981) Nature 214, 228-232) and other viral promoter and activator sequences derived from, for example, HBV, HCV, HSV, HPV, EBV, HTLV or HIV.
- regulatory elements that enable inducible expression in eukaryotes are the tetracycline operator in combination with a corresponding repressor (Gossen M. et al. (1994) Curr. Opin. Biotechnol. 5, 516-20).
- tissue-specific promoters such as, for example, the human K10 promoter (Bailleul et al., 1990. Cell 62: 697-708), the human K14 promoter (Vassar et al., 1989, Proc. Natl. Acad. Sci. USA 86: 1563-67) or the bovine cytokeratin IV promoter (Fuchs et al., 1988; The biology of wool and hair (ed .: GE Rogers, et al.), S 287-309 Chapman and Hall, London / New York) are particularly preferred.
- tissue-specific promoters such as, for example, the human K10 promoter (Bailleul et al., 1990. Cell 62: 697-708), the human K14 promoter (Vassar et al., 1989, Proc. Natl. Acad. Sci. USA 86: 1563-67) or the bovine cytokeratin IV promoter (Fuchs et al., 1988; The biology
- regulatory elements which enable cell cycle-specific expression in eukaryotes are promoters of the following genes: cdc25, cyclin A, cyclin E, cdc2, E2F, B-myb or DHFR (Zwicker J. and Müller R. (1997) Trends Genet. 13, 3 -6).
- regulatory elements which enable metabolically specific expression in eukaryotes are promoters which are regulated by hypoxia, by glucose deficiency, by phospha concentration or by heat shock.
- regulatory elements which simultaneously allow spatially and temporally limited expression are nucleic acids which code for a fusion protein, the nucleic acid being contained between the sequence for the site-specific recombinase Cre and a modified estrogen receptor which is under the control of a tissue-specific promoter ,
- the resulting tissue-specific cytoplasmic fusion protein can translocate into the cell nucleus by administration of the estrogen analog tamoxifen and generate recominations that lead to altered gene expression (Feil et al., 1996, Proc Natl Acad Sei 93: 10887-90)
- the nucleic acid can be present as a plasmid, as part of a viral or non-viral vector.
- viral vectors baculoviruses, vaccinia viruses, adenoviruses, adeno-associated viruses and herpes viruses.
- non-viral vectors virosomes, liposomes, cationic lipids, or poly-lysine-conjugated DNA.
- vectors which are active in gene therapy are virus vectors, for example adenovirus vectors or retroviral vectors (Lindemann et al., 1997, Mol. Med. 3: 466-76; Springer et al., 1998, Mol. Cell. 2: 549-58).
- Isolated eukaryotic expression vectors are suitable for gene therapy use, since naked DNA can penetrate skin cells when applied topically (Hengge et al., 1996, J. Clin. Invest. 97: 2911-6; Yu et al., 1999, J Invest Dermatol 112: 370-5).
- Gene therapy-effective vectors can also be obtained by complexing the nucleic acid used according to the invention with liposomes, since this enables a very high transfection efficiency, in particular of skin cells, to be achieved (Alexander and Akhurst, 1995, Hum. Mol. Genet. 4: 2279- 85).
- lipofection small unilamellar vesicles are made from cationic lipids by ultrasound treatment of the liposome suspension.
- the DNA is ionically bound to the surface of the liposomes in such a ratio that a positive net charge remains and the plasmid DNA is completely complexed by the liposomes.
- lipid mixtures DOTMA (1,2-dioleyloxypropyl-3-trimefhylammonium bromide) and DPOE (dioleoyl-phosphatidylethanolamine) have meanwhile been synthesized and numerous new lipid formulations have been synthesized and tested for their efficiency in transfecting various cell lines (Behr, JP et al. (1989), Proc. Natl. Acad. Sci. USA 86, 6982-6986; Feigner, JH et al. (1994) J. Biol. Chem. 269, 2550-2561; Gao, X. & Huang, L. ( 1991), Biochim. Biophys. Acta 1189, 195-203).
- Excipients that increase the transfer of nucleic acids into the cell can, for example, proteins or peptides that are bound to DNA or synthetic peptide-DNA molecules that allow the transport of the nucleic acid into the nucleus of the cell (Schwartz et al. (1999) Gene Therapy 6, 282; Branden et al. (1999) Nature Biotech. 17, 784). Auxiliaries also include molecules that allow the release of nucleic acids into the cell cytoplasm (Planck et al. (1994) J. Biol. Chem. 269, 12918; Kichler et al. (1997) Bioconj. Chem. 8, 213) or, for example, liposomes (Uhlmann and Peymann (1990) supra).
- gene therapy vectors can be obtained by applying the nucleic acids used according to the invention to gold particles and using the so-called "gene gun” to shoot them into tissue, preferably into the skin, or cells (Wang et al., 1999 , J. Invest. Dermatol., 112: 775-81, Tuting et al., 1998, J. Invest. Dermatol. 111: 183-8).
- epidermal cells and keratinocytes which form the main constituent of the epidermis, are preferably transfected (Udvardi et al., 1999, J. Mol. Med. 77: 744-750; Lu and Goldsmith, 1996, Proc. Assoc. Am Physicians, 108: 165-172).
- a gene therapy vector can be produced by introducing "bare" expression vectors into a biocompatible matrix, for example a collagen matrix.
- This matrix can be introduced into skin with impaired keratinocyte activity, for example a wound, in order to transfect the immigrating cells with the expression vector and to express the polypeptides used according to the invention in the cells (Goldstein and Banadio, US Pat. No. 5,962,427).
- the part of the nucleic acid which codes for the polypeptide contains one or more non-coding sequences including intron sequences, preferably between the promoter and the start codon of the polypeptide, and / or one polyA sequence, in particular the naturally occurring polyA sequence or an SV40 virus polyA sequence, especially at the 3 'end of the gene, since this achieves stabilization of the mRNA (Jackson, RJ (1993) Cell 74, 9-14 and Palmiter, RD et al. (1991) Proc. Natl. Acad. Sci. USA 88, 478-482).
- the present invention furthermore relates to a host cell, preferably a skin cell, in particular a keratinocyte, which contains at least one vector and / or at least one “knock-out” gene construct, which is a nucleic acid or variants thereof, which are suitable for a polypeptide or functional variants thereof according to SEQ ID No. ID No. 3 or SEQ ID No. Coded ID No. 4, includes.
- a host cell preferably a skin cell, in particular a keratinocyte, which contains at least one vector and / or at least one “knock-out” gene construct, which is a nucleic acid or variants thereof, which are suitable for a polypeptide or functional variants thereof according to SEQ ID No. ID No. 3 or SEQ ID No. Coded ID No. 4, includes.
- “Knock-ouf gene constructs are known to the person skilled in the art, for example, from US Pat. No. 5,625,122; US 5,698,765; US 5,583,278 and US 5,750
- Host cells can be both prokaryotic and eukaryotic cells, examples of prokaryotic host cells are E. coli and for eukaryotic cells S. cerevisiae or insect cells.
- the host cells according to the invention can be used for the diagnosis, prevention and / or treatment of diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis or for the identification of pharmacologically active substances.
- a further preferred transformed host cell is a transgenic embryonic non-human stem cell which has at least one nucleic acid or variant thereof which is for a polypeptide or functional variant thereof according to SEQ ID No. ID No. 3 or SEQ ID No. Coded ID No. 4, contains.
- the preceding nucleic acid is contained in a “knock-ouf” gene construct or an expression cassette or a stem cell described above. Transformation process. Transfection or infection host cells and / or stem cells are well known to those skilled in the art and include, for example, electroporation or microinjection.
- transgenic non-human mammal that contains at least one previously described “knock-ouf gene construct or an above-described expression cassette, preferably integrated into the genome.
- Transgenic animals generally show a tissue-specific increased expression of the nucleic acids and / or polypeptides and can be used for the analysis and / or diagnosis of diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis.
- an Activin A transgenic mouse has improved wound healing (Münz et al., 1999, EMBO J. 18: 5205-15) while a transgenic mouse with a dominant negative KGF receptor has delayed wound healing (Werner et al., 1994 , Science 266: 819-22).
- nucleic acids which can be used according to the invention can be integrated into so-called “targeting" vectors (Pinkert, 1994, supra), after transfection of embryonic stem cells and homologous recombination, for example "knock-out" mice can be generated, which, as heterozygous mice, generally reduce expression of the nucleic acid show, while homozygous mice no longer have expression of the nucleic acid.
- a tissue-specific reduction in the expression of genes used according to the invention for example in skin-specific cells, in particular in keratinocytes, using the Cre-loxP system (stat3 knock-out, Sano et al., EMBO J 1999 18: 4657-68) is particularly preferred .
- the transgenic and "knock-out" cells or animals produced in this way can be used, for example, for the analysis of diseases which are associated with impaired keratinocyte activity, for example a wound. However, they can also be used, for example, for the screening and identification of pharmacologically active substances or gene therapy-active vectors.
- the invention further relates to a method for producing a polypeptide for the diagnosis and / or prevention and / or treatment of diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, or for the identification of pharmacologically active substances in a suitable one Host cell, which is characterized in that a nucleic acid described above is used.
- the polypeptide is produced, for example, by expression of the nucleic acid described above in a suitable expression system, as already described above, using methods which are generally known to the person skilled in the art.
- Suitable host cells are, for example, the E. coli strains DHS, HB101 or BL21, the yeast strain S. cerevisiae, the insect cell line Lepidopteran, e.g. B. from Spodoptera frugiperda, or the animal cells COS, Vero, 293, HaCaT, and HeLa, all of which are commonly available.
- Another object of the invention is a method for producing a fusion protein for the diagnosis and / or prevention and / or treatment of diseases which are associated with impaired keratinocyte activity, or for the identification of pharmacologically active substances in a suitable host cell, in which one described above Nucleic acid is used.
- a functional variant of the polypypetides which can be used according to the invention is a fusion protein, i.e. Fusion proteins containing at least one polypeptide according to SEQ ID No. 3 or SEQ ID No. 4 or a functional variant thereof.
- Fusion proteins can be used for the diagnosis, prevention and / or treatment of diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, or for the identification of pharmacologically active substances.
- Fusion proteins are produced here which contain the polypeptides described above, the fusion proteins themselves already having the function of a polypeptide described above or the specific function only being functionally active after the fusion portion has been split off. Above all, this includes fusion proteins with a proportion of approximately 1-300, preferably approximately 1-200, particularly preferably approximately 1-150, in particular approximately 1-100, especially approximately 1-50 foreign amino acids.
- Examples of such peptide sequences are prokaryotic Peptide sequences, e.g. B. can be derived from the galactosidase of E. coli.
- viral peptide sequences such as, for example, from bacteriophage Ml 3, can also be used in order to generate fusion proteins for the "phage display" method known to the person skilled in the art.
- peptide sequences for fusion proteins are peptides which facilitate the detection of the fusion protein, these include, for example, “green fluorescent protein” or variants thereof.
- a further polypeptide can be added to purify the proteins described above.
- Suitable protein tags allow, for example, high affinity absorption to a matrix, stringent washing with suitable buffers without eluting the complex to any appreciable extent, and then targeted elution of the absorbed complex.
- Examples of the protein tags known to the person skilled in the art are (His) 6 tag, Myc tag, FLAG tag, hemagluteinin tag, glutathione transferase (GST) tag, intein with an affinity chintin binding tag or maltose binding protein (MBP) tag.
- GST glutathione transferase
- MBP maltose binding protein
- Another object of the invention relates to a method for producing an antibody, preferably a polyclonal or monoclonal antibody for the diagnosis, prevention and / or treatment of diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, or for identification of pharmacologically active substances in which a polypeptide or functional equivalents thereof or parts thereof with at least 6 amino acids, preferably with at least 8 amino acids, in particular with at least 12 amino acids according to the present invention is used.
- the method is carried out according to methods generally known to the person skilled in the art by immunizing a mammal, for example a rabbit, with the above-described polypeptide or the parts thereof, optionally in the presence of, for. B.
- Another object of the present invention is an antibody for analysis, diagnosis, for the prevention and / or treatment of diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, or for the identification of pharmacologically active substances against an
- the above-described polypeptide or functional variants thereof are directed and react specifically with the above-described polypeptides, wherein the above-mentioned parts of the polypeptide are either themselves immunogenic or by coupling to suitable carriers, such as. B. bovine serum albumin, immunogenic or can be increased in their immunogenicity.
- This antibody is either polyclonal or monoclonal, a monoclonal antibody is preferred.
- the term antibody is also understood to mean genetically engineered and optionally modified antibodies or antigen-binding parts thereof, such as, for example, chimeric antibodies, humanized antibodies, multifunctional antibodies, bi- or oligo-specific antibodies, single-stranded antibodies, F (ab) - or F (ab) - fragments (see, for example, EP-B1-0 368 684, US 4,816,567, US 4,816,397, WO 88/01649, WO 93/06213, WO 98/24884).
- Another object of the invention is the use of an antibody against a polypeptide or functional variants thereof according to SEQ ID No. ID No. 3 or SEQ ID No. ID No. 4 is directed to the diagnosis and / or prevention and / or treatment of diseases which are associated with impaired keratinocyte activity, in particular of wound healing disorders and / or psoriasis, particularly preferably of psoriasis.
- Another object of the invention is the use of modulators of the activity of a polypeptide or functional variants thereof according to SEQ ID No. 3 or SEQ ID No. 4, preferably a polypeptide according to SEQ ID No. 3 or SEQ ID No. 4 for diagnosis and / or prevention and / or treatment of diseases associated with impaired keratinocyte activity.
- modulator also includes compounds, compositions and mixtures which modulate the expression of the polypeptides according to SEQ ID No. 3 or SEQ ID No. 4 or functional variants thereof.
- the modulation can take place, for example, at the transcriptional or translational level.
- Substances, the amount of usable according to the invention Increasing polypeptides are activators, while substances which reduce the amount of polypeptides which can be used according to the invention are inhibitors.
- IK channels were expressed, for example, by means of in vitro transcription and injection in oocytes, and the ion channel activity was measured by means of the "patch clamp” method (WO 98/11139; Gerlach et al., 2000, J. Biol. Chem., 275: 585- 598; Khanna et al., 1999, J. Biol. Chem., 274: 14838-14849).
- IK channels can be expressed in human cell lines and analyzed using the "patch clamp” method (WO 00/37422; WO 99/25347).
- IK channels expressed endogenously or by means of transfection in skin cells for example keratinocytes
- Other methods that are suitable for identifying channel modulators are, for example, radioactive Ru + flux test systems and fluorescence test systems with voltage-dependent dyes (Vestergaard-Bogind et al., 1988, J. Membr. Biol. 88: 67-75; Daniel et al ., 1991, J. Pharmacol. Meth. 25: 185-193; Holevinsky et al. 1994, J. Membr.
- a FLIPR test system (“Fluorescence Image Plate Reader”) can be used (WO 99/25347).
- Test systems for testing the inhibitory or activating effect of a substance on the potassium flux through an IK channel can be added to a by adding the substances Solution which is in contact with cells expressing the IK channel can be carried out (e.g. Blatz et al., 1986, Nature, 323: 718-720; Park, 1994, J. Physiol., 481: 555-570).
- the activity of a channel can be determined by measuring the electrical current or the ion flow or the secondary effects of the electrical current or the ion flow.
- Ion channel activity modulators change electrical current or flow.
- substances to be tested can be tested for their modulatory properties.
- Changes in the cation flux through the channel can be detected, for example, directly by determining the concentration changes of the ions or indirectly by measuring the membrane potential by radioactive labeling of the ions. If the influence of the modulators on intact cells or organisms is detected, a wide variety of secondary physiological effects can be measured. Possible effects are transcriptional changes, changes in cell volume, changes in cell metabolism, release of hormones etc. (WO 98/11139). Methods for screening a chemical substance for a modulatory effect on an IK channel are disclosed in WO 99/25347.
- the modulator is an inhibitor.
- At least one antibody which is against a polypeptide or functional variants thereof according to SEQ ID no. ID No. 3 or SEQ ID No. ID No. 4 is used.
- the antibodies can have an inhibiting or activating effect on the activity of the polypeptide which can be used according to the invention.
- Inhibitors of the IK channel activity are known for example from WO 99/25347.
- R represents an alkyl group or cycloalkyl group which is optionally substituted by halogen, preferably by F or Cl; or R represents a mono- or polycyclic aryl group, the aryl group being selected by a substituent selected from halogen, in particular F or Cl, trifluoromethyl (-CF 3 ), nitro (-NO 2 ), cyano (-CN), azido (-N 3 ), a group of the formula -S (O) n -alkyl, -S (O) n -NH-alkyl, or -S (O) possibly- N- (alkyl) 2 , where n is preferably 0, 1 or 2 may be an alkyl group, a cycloalkyl group, an alkoxy group, a trifluoromethyloxy group (-OCF 3 ), a carboxy group (-COOH), a group of the formula -COO-alkyl, a carbamoyl group (-CONH 2 ), and
- R 1 , R 2 , R 3 and R 4 independently of one another, hydrogen, an alkyl group, a cycloalkyl group, an alkenyl group, an alkynyl group, an alkoxy group, a phenyl group, a phenylalkyl group, a furanyl group, represents a furanyl alkyl group, a pyridyl group or a pyridyl alkyl group which is optionally substituted by halogen, preferably by F or CL.
- a preferred embodiment is the use of an inhibitor of the general formula (I), in which R is a C 3 . 7 cycloalkyl group, especially a cyclohexyl group; or represents a phenyl group, preferably a monosubstituted phenyl group, the phenyl group having one or more substituents selected from the group consisting of halogen, trifluoromethyl (- CF 3 ), nitro (-NO 2 ), cyano (-CN); or R is a pyridyl or a dihydropyridyl group, which group may be monosubstituted with a group of the formula -COO-alkyl or a group of the formula -COO-phenyl.
- an inhibitor according to the general formula (I) can be used, where R is a 2-nitrophenyl group, a 3-nitrophenyl group, a 4-nitrophenyl group, a 2-trifluoromethylphenyl group, a 3-trifluoromethylphenyl group, a 4- Tri-fluoroethylphenyl group, a 2-cyanophenyl group, a 3-cyanophenyl group, a 4-cyanophenyl group; or R is a 2-pyridyl, 4-pyridyl, 3-pyridyl, a 1,2- or 1,4- or 1,6-dihydro-2-pyridyl-, a 1,2- or 1,4- or 1, 6-Dihydro-3-pyridyl, a 1,2- or 1,4- or 1,6-dihydro-4-pyridyl group, the pyridyl or dihydropyridyl groups with C] ;. 6 alkyl, a group of
- a modulator of the general formula (I) is used, where R 1 , R 2 , R 3 and R 4 independently of one another are C 1 -C 6 -alkyl, preferably methyl, ethyl, propyl, isopropyl, butyl or isobutyl ,
- R 1 , R 2 , R 3 and R 4 independently of one another are C 1 -C 6 -alkyl, preferably methyl, ethyl, propyl, isopropyl, butyl or isobutyl
- a preferred embodiment is the use of an inhibitor of the general formula (I), the inhibitor being an asymmetric derivative of 1,4-dihydropyridine-3,5-dicarboxylic acid according to the general formula (I).
- Asymmetric derivatives are preferably asymmetric Ci- 6- alkyl derivatives of 1,4-dihydropyridine-3,5-dicarboxylic acid (I).
- Another preferred embodiment is the use of a symmetrical derivative of 1,4-dihydropyridine-3,5-dicarboxylic acid represented by the general formula (I).
- Preferred compounds contain symmetrical Ci- 6- alkyl derivatives of 1,4-dihydropyridine-3,5-dicarboxylic acid.
- the following substances can be used according to the invention: 1,4-dihydro-2,6-dimethyl-4- (2-nitrophenyl) pyridine-3,5-dicarboxylic acid dimethyl ester (nifedipine); 1,4-Dihydro-2,6-dimethyl-4- (2-nitrophenyl) pyridine-3,5-dicarboxylic acid diethyl ester.
- inhibitors can be used according to the invention, the derivatives or metabolites of clotrimazole according to the general formula (II) (see also WO 99/25347) or are a pharmaceutically acceptable salt, oxide or hydrate thereof; in which
- X represents halogen, in particular F or Cl, a trifluoromethyl group, a nitro group or a cyano group;
- R 5 is hydrogen, halogen, in particular F or Cl, hydroxy, an alkyl group, a cycloalkyl group, an alkoxy group or an alkyloxy group, optionally substituted with halogen, preferably F or Cl;
- R 6 represents hydrogen, or a phenyl group, where the phenyl group can be mono- or polysubstituted with substituents selected from halogen, preferably F or Cl, and hydroxy;
- R 7 is hydrogen, halogen, preferably F or Cl, hydroxy, alkyl or alkoxy, optionally substituted with halogen, preferably F or Cl;
- Z is O, or N; and R 10 represents hydrogen, halogen, preferably F or Cl, or hydroxyl group.
- WO 99/25347 discloses further substances which act as inhibitors of hlKl and can be used according to the invention.
- examples are the imidazole derivatives miconazole, econazole, butoconazole, oxiconazole, sulconazole, thioconazole, the triazole derivatives fluconazole, terconazole, itraconazole, the nitroimidazole derivatives, metronidazole, tinidazole, nimorazole and benzidazole.
- Y represents oxygen, sulfur or an ammo group, preferably an ammo group of the formula NHR 13 ;
- R is hydrogen; an alkyl group; a cycloalkyl group; is a phenyl or a benzyl group, the group, in particular the phenyl or benzyl group, having one or more substituents selected from halogen, in particular F or Cl, -CF 3 , -NO 2 , -CN, alkyl, cycloalkyl, Hydroxy and alkoxy group may be substituted;
- R 13 is hydrogen; an alkyl group; a cycloalkyl group; represents a phenyl or a benzyl group, the group, in particular the phenyl or benzyl group, having one or more substituents selected from halogen, in particular F or Cl, -CF 3 , -NO 2 , -CN, alkyl, cycloalkyl, hydroxy and alkoxy group can be substituted; and
- R 14 and R 15 are independently hydrogen; Halogen, in particular F or Cl; -CF 3 ; -NO 2 ; CN; an alkyl group, an alkoxy group; a phenyl or a benzyl group, the group, in particular the phenyl or benzyl group, being substituted one or more times with substituents selected from halogen, in particular F or Cl, -CF 3 , -NO, -CN, alkyl, cycloalkyl, hydroxy and alkoxy can be; or a group of the formula -S ⁇ 2 NR "R '", where R "and R'" independently of one another are hydrogen or an alkyl group; or R 14 and R 15 together form an additional 4- to 7-membered condensed ring, where the condensed ring can be aromatic or partially saturated, and one or more times with substituents selected from halogen, in particular F or Cl, -CF 3 , -NO 2 , -CN and a group of the formula
- R 11 is hydrogen or an alkyl group.
- R is hydrogen, an alkyl group or a benzyl or phenyl group, where the phenyl or benzyl group is selected one or more times with substituents selected from halogen, -CF 3 , -NO 2 , - CN, alkyl, cycloalkyl, Hydroxy and alkoxy can be substituted.
- Y represents oxygen or an amino group of the formula NHR 13 , where R 13 here denotes hydrogen, alkyl, benzyl or acetyl.
- R 14 and R 15 are independently hydrogen, halogen, alkyl or alkoxy.
- R 14 and R 15 together form an additional 6-membered condensed ring, wherein the condensed ring can be aromatic or partially saturated, wherein the condensed ring can be mono- or polysubstituted with substituents selected from halogen, in particular F or Cl, -CF 3 , -NO 2 , -CN and a group of the formula - SO 2 NR "R"', where R "and R'" independently of one another are hydrogen or an alkyl group.
- oxime derivatives can be used as modulators according to the invention:
- A represents oxygen, sulfur, or nitrogen
- R 17 is hydrogen; an alkyl group; a cycloalkyl group; represents a phenyl or a benzyl group, the group, in particular the phenyl or benzyl group, having one or more substituents selected from halogen, in particular F or Cl, -CF 3 , -NO 2 , -CN, alkyl, cycloalkyl, hydroxy and Alkoxy may be substituted;
- R, R and R independently of one another are hydrogen; Halogen, in particular F or Cl; -CF 3 ; -NO 2 ; -CN; an alkyl group; an alkoxy group; a phenyl or a benzyl group, the group, in particular the phenyl or benzyl group, having one or more substituents selected from halogen, in particular F or Cl, -CF 3 , -NO 2 , -CN, alkyl, cycloalkyl, hydroxy and alkoxy can be substituted; or a group of the formula -SO 2 NR "R '", where R "and R'" independently of one another are hydrogen or an alkyl group, optionally substituted, preferably with F or Cl; or R 20 is as defined above and R 18 and R 19 together form an additional 4- to 7-membered fused ring, the fused ring may be heterocyclic, the heteroatoms preferably being N, S or O, aromatic, saturated or partial can be saturated, and optionally with
- R 16 represents hydrogen or an alkyl group.
- R 17 represents hydrogen or an alkyl group.
- Embodiment R, R and R independently represent hydrogen or an alkyl group.
- a modulator according to formula (IV) in which R 18 and R 19 together form a 5- or 6-membered fused ring, which ring can be heterocyclic; furthermore the ring can be aromatic, saturated or partially saturated and the ring with substituents selected from the group consisting of halogen, in particular F or Cl, -CF 3 , -NO 2 , -CN and a group of the formula - SO 2 NR "R '"can be optionally mono- or polysubstituted, where R" and R "" independently of one another are hydrogen or an alkyl group, optionally substituted, in particular with F or Cl.
- 1,3-diethyl-5,6,7,8-tetrahydronaphto- [1,2-d] -imidazolinone, l-ethyl-5,6,7,8-tetrahydronaphto- [1,2 is particularly preferred d] - imidazolinone; 3-ethyl-naphtho [1,2-d] oxazolinone; 3-ethyl-naphtho [1,2-d] imidazolinone; 3-ethyl-quinolino- [5,6-d] -imidazolinone, 3-benzyl- (2, 1, 3-thia-diazolo) - [4, 5-g] -benzimidazolone.
- R 21 and R 22 independently of one another alkyl, alkenyl, alkynyl, cycloalkyl, amino, trihalomethyl, in particular trifluoromethyl or triochloromethyl, nitro, cyano, phenyl or a group of the formula OR ', -SR', -R'OR “, -R ' SR ", - C (O) R ', -C (S) R', -C (O) OR ', -C (S) OR', -C (O) SR ', -C (S) SR' , -C (O) NR '(OR "), - C (S) NR'(OR"), -C (O) NR '(SR "), -C (S) NR'(SR", -CH [C (O) R '] 2
- R 'and R "independently of one another represent hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy or phenyl, optionally substituted, in particular with F or Cl, or a group of the formula NR'" R "", where R '"and R" "independently of one another are hydrogen or alkyl;
- R 23 and R 24 independently of one another, alkyl, alkenyl, alkynyl, cycloalkyl, amino, trihalomethyl, in particular trifluoromethyl or trichloromethyl, nitro, cyano, phenyl or a group of the formula OR ', -SR', -R'OR “, - R'SR ", - C (O) R ', -C (S) R', -C (O) OR ', -C (S) OR', -C (O) SR ', -C (S) SR ', -C (O) NR' (OR "), - C (S) NR '(OR"), -C (O) NR' (SR "), -C (S) NR '(SR") , -CH (CN) 2 , -C (S) NR'R ", - C (O) NR'R", -CH [C (O) R ']
- R 'and R "independently of one another are hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, phenyl or a group of the formula NR'" R "", where R '"and R""independently of one another are hydrogen or alkyl, optionally substituted, especially with F or Cl, mean; or R 23 and R 24 together form an unsaturated, partially saturated or fully saturated mono- or polycyclic group, or a mono- or poly-heterocyclic group, the heteroatom preferably being N, S or O, the mono- or polycyclic groups can be mono- or polysubstituted by a group consisting of halogen, in particular F or Cl, trihalomethyl, in particular trifluoromethyl or trichloromethyl, alkyl, alkenyl, alkynyl, amino, nitro, cyano or amido, or a group of the formula -R ', - OR ', SR',
- R 'and R "independently of one another are hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, phenyl or a group of the formula NR'" R "", where R '"and R" "independently of one another are hydrogen or alkyl, optionally substituted, in particular with F or Cl.
- A, B, R 21 and R 22 are as defined above and R 25 and R 26 , independently of one another, are hydrogen, alkyl, cycloalkyl, optionally substituted, in particular with F or Cl, or a group of the formula NR '"R"", where R "'and R""independently of one another represent hydrogen or alkyl, optionally substituted, in particular with F or Cl.
- a malonic ester derivative can be used as described above, where R and R together form a heterocyclic 6-9 membered ring and give a diester derivative.
- malonic acid derivatives as modulators of the IK activity is particularly preferred:
- the modulators used according to the invention act as an activator of the IK activity.
- Isatin derivatives according to the following general formula (VI) see also WO 00/33834
- R 27 is hydrogen; an alkyl group; a cycloalkyl group; an acyl group; a phenyl or benzyl group, the group, in particular the phenyl or benzyl group with a group selected from halogen, in particular F or Cl, -NO 2 , -CN, -CF 3 , alkyl, cycloalkyl, hydroxy and alkoxy one or more times can be substituted; a group of the formula -CH 2 CN; a group of the formula -CH 2 CO 2 R ', where R' is hydrogen or an alkyl group, optionally substituted, in particular with F or Cl; a group of the formula - CH 2 CONR IV R v , where R IV and R v independently of one another are hydrogen, alkyl, optionally substituted, in particular with F or Cl, phenyl or benzyl group, the phenyl or benzyl group one or more times with halogen and / or alkyl may be
- R 28 is hydrogen; an alkyl group; a cycloalkyl group; a group of the formula -CH 2 CO 2 R ', where R' is hydrogen or an alkyl group; or represents a phenyl or benzyl group, the phenyl or benzyl group, optionally with substituents selected from halogen, in particular with F or Cl, -NO 2 , -CN, CF 3 , alkyl, cycloalkyl, hydroxy and alkoxy, being mono- or polysubstituted can; and
- R 29 , R 30 , R 31 and R 32 are independently hydrogen; Halogen, especially with F or Cl; -NO 2 ; -CN; CF 3 ; alkyl; an alkoxy group; a phenyl or benzyl group, where the phenyl or benzyl groups can be substituted one or more times with substituents selected from halogen, in particular with F or Cl, -NO 2 , -CN, CF 3 , alkyl, cycloalkyl, hydroxy and alkoxy; or a group of the formula -S ⁇ 2 NR "R '", where R "and R'" independently of one another represent hydrogen or an alkyl group, optionally substituted, in particular with F or Cl; or R and R are as defined above, and R and R together form an additional 4- to 7-membered fused ring, where the fused ring can be aromatic, partially saturated or saturated, and the fused ring with substituents selected from halogen, in particular with F or Cl, -
- R of the formula (VI) is hydrogen; a C 1 . 6 alkyl group; a phenyl group; a benzyl group; R ', wherein R' is hydrogen or an alkyl group CI_ 6, optionally substituted, in particular with F or Cl, represents a group of the formula -CH2CO 2; a group of the formula -CH 2 NH-Z, where Z is a phenyl or benzyl group, these phenyl or benzyl groups can be substituted one or more times with halogen, in particular with F or Cl; or a group of the formula CH 2 CO-Y ", where Y" is a heterocyclic 6-membered monocyclic group containing at least one nitrogen atom as hetero atom, and the one or more can be substituted with a C 6 alkyl group or a phenyl group.
- R of the formula (VI) is hydrogen, C]; 6 alkyl group, phenyl, benzyl or a group of the formula - CH 2 COOH.
- R, R, R, and R are independently hydrogen, F, Br, Cl, NO2, CN, CF 3 or Alkyl, optionally substituted, especially with F or Cl.
- modulators which can be used according to the invention are: 5,7-dinitro-1-methyl-1H-indole-2,3-dione-3- (O-methyloxime); 5-bromo-7-nitro-1H-indole-2,3-dione-3-oxime; 5-bromoisatin-3-oxime; 5,6-dichloro-1-methylisatin-3-oxime; 4.5-dichloroisatin 3-oxime; 4,5-dichloro-1-methylisatin-3-oxime; O-methyl-4,5-dichloro-l-methylisatin 3-oxime; Benzoisatin-3-oxime; 6,7-dichloroisatin 3-oxime; O-methyl 6,7-dichloroisatin-3-oxime; O-methyl 6,7-dichloro-1-methylisatin-3-oxime; 6,7-dichloro-1-methylisatin-3-oxime; O-t-butyl-6,7-dichloroisatin-3
- zoxazolamine which acts as activators of hlKl (Syme et al., 2000, Am. J. Physiol. 278: C570-C581).
- Halogen in the sense of the invention means a fluorine, chlorine, bromine or iodine atom. Particularly preferred halogens are F or Cl.
- alkyl group in the sense of the invention means a monovalent, saturated, unbranched or branched hydrocarbon chain.
- the hydrocarbon chain preferably contains 1 to 12 carbon atoms (.n-alkyl), in particular 1 to 6 carbon atoms (Ci- ⁇ alkyl; lower alkyl), containing pentyl, isopentyl, neopentyl, tertiary pentyl, hexyl and isohexyl.
- alkyl represents a C M alkyl group containing butyl, isobutyl, secondary butyl and tertiary butyl.
- alkyl means a C 1-4 alkyl group, which can in particular be methyl, ethyl, propyl or isopropyl.
- a cycloalkyl group in the present invention means a cyclic alkyl group which preferably three to seven carbon atoms (C3. 7 cycloalkyl), including cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl.
- alkoxy group in the sense of the invention means an “alkyl-O-” group, alkyl being as defined above.
- An amino group in the sense of the present invention can be a primary (- NH2), secondary (-NH-R) or tertiary amino group (-N-R'R "), where R 'and R" independently of one another are alkyl, as defined above, means.
- an acyl group in the sense of the present invention means a carboxy group or an alkylcarbonyl group, alkyl being as defined above. Examples of preferred acyl groups are carboxy, acetyl and propionyl.
- an alkenyl group means a carbon chain containing one or more double bonds, including di-enes, tri-enes and poly-enes. In a preferred embodiment the alkenyl group of the present invention between two and six carbon atoms (C 2 - 6 alkenyl). Particularly preferred alkenyl groups are ethenyl, 1,2 or 2,3-propenyl; or 1,2-, 2,3-, or 3,4-butenyl.
- an alkynyl group designates a carbon chain containing one or more triple bonds, including di-ines, tri-ines and poly-ines.
- the alkynyl group of the present invention between two and six carbon atoms (- 6 alkynyl C 2).
- Particularly preferred alkynyl groups are ethynyl, 1,2 or 2,3-propynyl; or 1,2-, 2,3-, or 3,4-butynyl.
- amido group in the sense of the present invention means a substituent of the formula R'-CO-NH- or R'-CO-N (alkyl) -, where R 'is hydrogen or an alkyl group as defined above.
- Examples of preferred amido groups are formamido, acetamido and propionamido.
- a mono- or polycyclic aryl group in the sense of this invention means a monocyclic or polycyclic aromatic hydrocarbon group.
- Examples of preferred aryl groups are phenyl, naphthyl and anthracenyl.
- an unsaturated mono- or polycyclic group means a mono- or polycyclic aryl group, ie a monocyclic or polycyclic aromatic hydrocarbon chain.
- An example of a preferred partially saturated monocyclic group is cyclopenta-2,4-dien-1-ylidene.
- An aralkyl group in the sense of the invention means an aryl group, as defined above, the aryl group being connected to an alkyl group, as defined above.
- An example of a preferred aralkyl group is benzyl.
- a monocyclic or heterocyclic group in the sense of the invention means a monocyclic or polycyclic compound which contains one or more heteroatoms in the ring structure.
- Preferred heteroatoms contain nitrogen (N), oxygen (O) and sulfur (S).
- One or more ring structures can be aromatic (i.e. heteroaryl), saturated, or partially saturated.
- Preferred monocyclic groups contain 5- and 6-membered heterocyclic groups. Examples of preferred monocyclic heterocyclic groups include furan-2-yl; Furan-3-yl; 2-, 4- or 5-imidazolyl, 3-, 4-, or 5-isoxazolyl, 1-, 2-, 3-pyridinyl and 1- or 2-thienyl.
- Examples of preferred saturated or partially saturated monocyclic heterocyclic groups include 1,3,5,6,2-dioxadiazinyl, piperazinyl, piperidinyl, 1,2-, 1,3- or 1,4-pyranyl and pyrrolidinyl.
- Examples of preferred aromatic heterocyclic groups include acridinyl, carbazolyl, indazolyl, quinolinyl, benzofuranyl.
- a heteroalkyl group in the sense of the invention designates a mono- or poly-heterocyclic group as defined above, the heterocyclic group being connected to an alkyl group as defined above.
- Benzoxazolones chlorzoxazone and zoxazolamine which act as activators of hlKl (Syme et al., 2000, Am. J. Physiol. 278: C570-C581).
- isatin derivatives from WO 00/33834 are known as activators of hlKl. Examples are 5-bromoisatin 3-oxime and 5,6-dichloro-l-methylisatin 3-oxime.
- Particularly preferred inhibitors of hIK4 are charybdotoxin and clotrimazole (Khanna et al., 1999, J. Biol. Chem. 274: 14838-14849).
- WO 99/25347 discloses further substances which act as inhibitors of hlKl.
- examples are the imidazole derivatives miconazole, econazole, butoconazole, oxiconazole, sulconazole, thioconazole, the triazole derivatives fluconazole, terconazole, itraconazole, the nitroimidazole derivatives, metronidazole, tinidazole, nimorazole, ornidazole, ornidazole.
- the document also discloses derivatives of 1,4-dihydropyridine-3,5-dicarboxylic acid, for example 1,4-dihydro-2,6-dimethyl-4- (2-nitrophenyl) pyridine-3,5-dicarboxylic acid ethyl methyl ester, and also clotrimazole Derivatives, for example 2-chlorophenyl-4-hydroxyphenyl-phenyl-methane.
- the modulators used according to the invention can be used for the diagnosis and / or prevention and / or treatment of diseases which are associated with impaired keratinocyte activity, in particular of wound healing disorders, particularly preferably psoriasis.
- diseases associated with impaired keratinocyte activity are contact dermatitis, atopic eczema, vitiligo, hyperkeratoses, actinic keratoses, hypertrophic scars, keloids, lentigo, ephelids and aging skin.
- Particularly preferred diseases are wounds, for example normally healing wounds and poorly healing wounds, in particular ulcers, and psoriasis.
- the present invention also relates to a method for producing a medicament for the treatment of diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders, particularly preferably psoriasis, in which at least one nucleic acid which can be used according to the invention, at least one polypeptide which can be used according to the invention and at least one according to the invention usable antibodies and / or at least one modulator usable according to the invention is combined together with suitable additives and auxiliaries.
- psoriasis use of an ion channel activity modulator, for example an ion channel activity activator or an ion channel activity inhibitor according to the present invention, is preferable or preferred.
- modulators are DCEBIO, zoxazolamine, chlorzoxazone, 1-EBIO and a specific antibody.
- a nucleic acid is preferred which leads to a downregulation of the amount of IK channel, for example an antisense oligonucleotide, an siRNA or a ribozyme according to the present invention.
- IK channel In the case of wound healing, in particular ulcers, it is preferable to increase the amount of IK channel, for example by gene therapy treatment with a nucleic acid coding for a polypeptide which can be used according to the invention.
- the present invention further relates to a medicament produced by this method for the treatment of diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, particularly preferably psoriasis, the at least one polypeptide, according to SEQ ID No. 3 or SEQ ID No. 4, or a nucleic acid encoding it or or at least one antibody which can be used according to the invention or at least one modulator which can be used according to the invention, optionally together with suitable additives and auxiliaries.
- the invention further relates to the use of this medicament for the treatment of diseases which are associated with impaired keratinocyte activity.
- the treatment of diseases which are associated with impaired keratinocyte activity can be carried out in a conventional manner, for example by dressings, plasters, compresses or gels, which contain the medicaments according to the invention. So it is possible to use the appropriate additives or auxiliaries, such as. B. physiological saline, demineralized water, stabilizers, proteinase inhibitors, gel formulations, such as white petroleum jelly, low-viscosity paraffin and / or yellow wax, etc., medicaments containing topically and locally to immediately and immediately affect the disease.
- auxiliaries such as. B. physiological saline, demineralized water, stabilizers, proteinase inhibitors, gel formulations, such as white petroleum jelly, low-viscosity paraffin and / or yellow wax, etc.
- the medicaments according to the invention can also be administered topically and locally in the area of the diseased skin area, optionally in the form of liposome complexes or gold particle complexes.
- the treatment can be carried out by means of a transdermal therapeutic system (TTS), which enables the medication according to the invention to be delivered in a time-controlled manner.
- TTS are known for example from EP 0 944 398 AI, EP 0 916 336 AI, EP 0 889 723 AI or EP 0 852 493 AI.
- Treatment by means of the medicaments according to the invention can, however, also take place via oral dosage forms, such as tablets or capsules, via the mucous membranes, for example the nose or the oral cavity, or in the form of disposers implanted under the skin.
- a preferred embodiment of a medicament serves for the prevention and / or treatment of psoriasis, wherein the keratinocyte activity is to be reduced.
- a particularly preferred embodiment is the inhibition of the (electrophysiological) activity of the hlKl channel according to the invention by suitable modulators and / or antibodies.
- a particularly preferred embodiment consists in the administration of a medicament containing a modulator which can be used according to the invention can take the form of the active form of the modulator.
- a composition containing the active form of the modulator optionally in the form of a pharmaceutically acceptable salt, together with one or more Suitable additives and auxiliaries, such as adjuvants, carrier materials and buffer solutions and diluents, such as.
- Suitable additives and auxiliaries such as adjuvants, carrier materials and buffer solutions and diluents, such as.
- a preferred embodiment consists in the use of an antibody directed against the hlKl channel polypeptide or a functional variant thereof or an antibody fragment as a medicament according to the present invention.
- Another particularly preferred embodiment consists in reducing the expression of the nucleic acids encoding hlKl polypeptide according to the invention.
- a preferred embodiment of a nucleic acid as a medicament according to the present invention are anti-sense nucleotides (see above) and ribozymes (WO 99/15703) as well as so-called “small interfering RNAs” (siRNAs). These are double-stranded RNA molecules that are gene-specific in terms of sequence and post-transcription downregulate (Elbashir et al., 2001, Nature 411: 494-498).
- a drug is particularly suitable which contains the nucleic acid described in the naked form or in the form of one of the gene therapy vectors described above or in a form complexed with liposomes or gold particles.
- the pharmaceutical carrier is, for example, a physiological buffer solution, preferably with a pH of approximately 6.0-8.0, preferably approximately 6.8-7.8. In particular of approximately 7.4 and / or an osmolarity of approximately 200-400 milliosmol / liter, preferably of approximately 290-310 milliosmol / liter.
- the pharmaceutical carrier can contain suitable stabilizers, such as, for example, nuclease inhibitors, preferably complexing agents such as EDTA and / or other auxiliaries known to the person skilled in the art.
- nucleic acid described optionally in the form of the virus vectors described in more detail above, or as liposome complexes or gold particle complex, is usually carried out topically and locally in the area of the wound.
- a preferred embodiment of a medicament according to the present invention is to polypeptide itself with suitable additives or adjuvants, such as. B. physiological saline, demineralized water, stabilizers, proteinase inhibitors, gel formulations such as e.g. white petroleum jelly, low-viscosity paraffin and / or yellow wax, etc., to influence the healing of the wound immediately and immediately.
- suitable additives or adjuvants such as. B. physiological saline, demineralized water, stabilizers, proteinase inhibitors, gel formulations such as e.g. white petroleum jelly, low-viscosity paraffin and / or yellow wax, etc.
- a further preferred embodiment of a medicament according to the present invention consists in the transplantation of autologous or allogeneic cells which express the polypeptide according to the invention with the aid of a suitable carrier material, for example so-called microcarriers, which consist of biocompatible materials, such as a dextran matrix (see US598888).
- the present invention further relates to a method for producing a diagnostic agent for diagnosing diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, which is characterized in that at least one nucleic acid according to SEQ ID No. 1 and 2 , at least one polypeptide, according to SEQ Id Nos. 3 and 4, or at least one modulator according to the present invention, optionally together with suitable additives and auxiliaries.
- the present invention further relates to a diagnostic agent for diagnosing diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, the at least one nucleic acid, according to SEQ ID No. 1 and 2, at least one polypeptide, according to SEQ ID Nos. 3 and 4, or at least one modulator according to the invention, optionally together with suitable additives and auxiliaries.
- a diagnostic agent based on the polymerase chain reaction (examples 3, 4, 5; PCR diagnostics, for example according to EP 0 200 362) or an "RNase protection assay" , as shown in Example 2, are prepared. These tests are based on the specific hybridization of the nucleic acids described above with the complementary counter strand, usually the corresponding mRNA.
- the nucleic acid described above can also be modified, such as. B. described in EP 0 063 879.
- a previously described DNA fragment is preferably prepared using suitable reagents, e.g. B.
- RNA which are preferably previously attached to suitable membranes from e.g. B. was bound cellulose or nylon, incubated.
- the Amount of mRNA that was specifically labeled by the probe can be determined and compared with the amount of mRNA from healthy tissue.
- the determination of mRNA can also be carried out in tissue sections with the aid of in situ hybridization (see, for example, Werner et al., 1992, Proc. Natl. Acad. Sci. USA 89: 6896-900).
- a tissue sample can thus also be measured in vitro specifically for the expression level of the corresponding gene in order to be able to reliably diagnose a possible disease which is related to impaired keratinocyte activity (Examples 2, 3, 4, 5).
- Such a method is particularly suitable for the early prognosis of faults.
- This enables preventive therapy and the analysis of predispositions.
- the expression of the mIKl gene is already increased in the non-wounded state in the intact skin of old mice, which showed wound healing disorders after wounding, in comparison to intact skin of control mice and in particular to intact skin of young mice.
- the expression level of the mIK1 gene therefore enables a prediction of the wound healing disorder in the intact tissue (Example 3, Table 2).
- Another diagnostic agent according to the invention contains the polypeptide which can be used according to the invention or the immunogenic parts thereof described in more detail above.
- the polypeptide or parts thereof which are preferably attached to a solid phase, e.g. B. from nitrocellulose or nylon, for example, with the body fluid to be examined, for. B. wound secretion, in vitro in contact, so as to be able to react with autoimmune antibodies, for example.
- the antibody-peptide complex can then be detected, for example, using labeled anti-human IgG or anti-human IgM antibodies.
- the label is, for example, an enzyme, such as peroxidase, that catalyzes a color reaction. The presence and the amount of autoimmune antibodies present can thus be easily and quickly detected via the color reaction.
- Another diagnostic agent contains the antibodies according to the invention themselves. With the aid of these antibodies, for example, a tissue sample can be easily and quickly examined to determine whether the polypeptide in question is present in an increased amount, thereby indicating a possible disease that is associated with impaired keratinocyte activity stands to get.
- the antibodies of the invention are labeled, for example, with an enzyme, as already described above. The specific antibody-peptide complex can thus be detected easily and just as quickly via an enzymatic color reaction.
- Another diagnostic agent according to the invention contains a probe, preferably a DNA probe, and / or primer.
- a probe preferably a DNA probe, and / or primer.
- DNA or RNA fragments with a length of approx. 100-1000 nucleotides, preferably with a length of approx. 200-500 nucleotides, in particular with a length of approx. 100-400 nucleotides the sequence of which from the polypeptide sequences are suitable or functional variants thereof according to SEQ ID No. 3 or SEQ ID No. 4 of the sequence listing and / or from the cDNA sequences or variants thereof according to SEQ ID No. 1 or SEQ ID No. 2 database entries can be derived (see also Example 2 ).
- the derived nucleic acid sequences can be used to synthesize oligonucleotides which are suitable as primers for a polymerase chain reaction.
- Suitable primers are, for example, DNA fragments with a length of approximately 10-100 nucleotides, preferably with a length of approximately 10 to 50 nucleotides, in particular with a length of 10-30 nucleotides, the sequence of which from the polypeptides according to SEQ ID No. 3 to SEQ ID No. 4 and / or can be derived from the cDNA sequences according to SEQ ID No. 1 or SEQ ID No. 2 (Examples 3, 4, 5).
- the invention further relates to a method for producing a test for the detection of pharmacologically active substances which are associated with disorders with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, characterized in that at least one nucleic acid according to SEQ ID No. 1 and 2, at least one polypeptide, according to SEQ ID Nos. 3 and 4, at least one antibody or at least one modulator according to the present invention, optionally together with suitable additives and auxiliaries, is used to prepare the test.
- pharmacologically active substances in the context of the present invention is to be understood as meaning all those molecules, compounds and / or compositions and mixtures of substances which are suitable with the nucleic acids, polypeptides or antibodies described above, if appropriate together with suitable additives and auxiliaries Conditions can interact.
- Possible pharmacologically active substances are simple chemical organic or inorganic molecules or compounds, but can also contain peptides, proteins or complexes thereof.
- the pharmacologically active substances can due to their Interaction affect the function (s) of the nucleic acids, polypeptides or antibodies in vivo or in vitro or only bind to the previously described nucleic acids, polypeptides or antibodies or enter into other interactions with them covalently or non-covalently.
- pharmacologically active substances are substances that can modulate channel activity as described above.
- the invention further contains a test for the identification of pharmacologically active substances in connection with diseases which are associated with disturbed keratinocyte activity, the at least one nucleic acid, at least one polypeptide or at least one modulator according to the present invention, optionally together with suitable additives and auxiliaries, includes.
- a suitable system can be produced, for example, by the stable transformation of epidermal or dermal cells, in particular of keratinocytes with expression vectors which contain selectable marker genes and the nucleic acids described above.
- the expression of the nucleic acids described above in the cells is changed so that it corresponds to the pathologically disturbed expression in vivo.
- Anti-sense oligonucleotides which contain the nucleic acid sequences which can be used according to the invention can also be used for this purpose. It is therefore of particular advantage for these systems to know the expression behavior of the genes in the case of disturbed physiological processes, as described in this application. Often the pathological behavior of the cells can be mimicked in vitro and substances can be sought that restore the normal behavior of the cells and that have a therapeutic potential.
- Suitable for these test systems are, for example, HaCaT cells, which are generally available, and the expression vector pCMV4 (Anderson et al., 1989, J. Biol. Chem. 264: 8222-9).
- the nucleic acid which can be used according to the invention can be integrated into the expression vectors both in sense and in anti-sense orientation, so that the functional concentration of mRNA of the corresponding genes in the cells is either increased or is reduced by hybridization with the antisense RNA.
- the cells in culture After the transformation and selection of stable transformants, the cells in culture generally show a changed proliferation, migration and / or differentiation behavior compared to control cells.
- the proliferation behavior of cells can be very quickly, for example, by incorporating labeled nucleotides into the DNA of the cells (see, for example, de Fries and Mitsuhashi, 1995, J. Clin. Lab. Anal. 9: 89-95; Perros and Weightman, 1991 , Cell Prolif. 24: 517-23; Savino and Dardenne, 1985, J. Immunol. Methods 85: 221-6), by staining the cells with specific dyes (Schulz et al., 1994, J. Immunol. Methods 167: 1-13) or using immunological methods (Frahm et al., 1998, J. Immunol. Methods 211: 43-50).
- Suitable differentiation markers are, for example, keratin 6, 10 and 14 as well as loricrin and involucrin (Rosenthal et al., 1992, J, Invest, Dermatol, 98: 343-50), the expression of which can be easily detected, for example, using generally available antibodies.
- test system Another suitable test system is based on the identification of interactions with the so-called “two-hybrid system” (Fields and Sternglanz, 1994, Trends in Genetics, 10, 286-292; Colas and Brent, 1998 TIBTECH, 16, 355-363).
- cells are transformed with expression vectors which express fusion proteins from the polypeptide which can be used according to the invention and a DNA binding domain of a transcription factor such as, for example, Gal4 or LexA.
- the transformed cells also contain a reporter gene, the promoter of which contains binding sites for the corresponding DNA binding domain.
- the expression of the reporter gene can be greatly increased if the second fusion protein interacts with the polypeptide which can be used according to the invention .
- This increase in expression can be used to identify new pharmacologically active substances, for example by producing a cDNA library from regenerating tissue for the construction of the second fusion protein.
- this test system can be used for the screening of substances which inhibit an interaction between the polypeptide which can be used according to the invention and an already known pharmacologically active substance.
- Such substances reduce the expression of the reporter gene in cells which express fusion proteins of the polypeptide which can be used according to the invention and the pharmacologically active substances (Vidal and Endoh, 1999, Trends in Biotechnology, 17: 374-81). In this way, new active ingredients can be quickly identified that can be used to treat diseases that are related to impaired keratinocyte activity.
- Pharmacologically active substances of the polypeptides which can be used according to the invention can also be nucleic acids which are obtained via selection methods, such as SELEX (see Jayasena, 1999, Clin. Chem. 45: 1628-50; Klug and Famulok, 1994, M. Mol. Biol. Rep. 20 : 97-107; Toole et al., 1996, US 5582981).
- SELEX see Jayasena, 1999, Clin. Chem. 45: 1628-50; Klug and Famulok, 1994, M. Mol. Biol. Rep. 20 : 97-107; Toole et al., 1996, US 5582981).
- SELEX selection methods
- Aptamers can also be found in their mirror-image form, for example as L-ribonucleotide, can be synthesized and selected (Nolte et al., 1996, Nat. Biotechnol. 14: 1116-9; Klussmann et al., 1996, Nat. Biotechnol. 14: 1112-5). Forms isolated in this way have the advantage that they are not broken down by naturally occurring ribonucleases and therefore have greater stability.
- the invention further relates to a method for producing an array fixed on a carrier material for analysis in connection with diseases which are associated with disturbed keratinocyte activity, in which at least one nucleic acid, at least one polypeptide or at least one antibody according to the invention is used for the production becomes.
- Another object of the invention is an array fixed on a carrier material for analysis in connection with diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, which is characterized in that it has at least one nucleic acid and / or at least one Contains polypeptide and / or or at least one Antikö ⁇ er according to the present invention.
- Arrays according to the invention can be used for analysis in connection with diseases which are related to impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis.
- the invention further relates to a method for producing a DNA chip and / or protein chip for analysis in connection with diseases which are associated with impaired keratinocyte activity.
- a method for producing a DNA chip and / or protein chip for analysis in connection with diseases which are associated with impaired keratinocyte activity in particular of wound healing disorders and / or psoriasis, which is characterized in that at least one nucleic acid, according to SEQ ID No. 1 and 2, at least one polypeptide, according to SEQ ID No. 3 and 4, or at least one antibody, as described above, for Manufacturing is used.
- Another object of the invention includes a DNA chip and / or protein chip for analysis in connection with diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, the at least one nucleic acid, according to SEQ ID No. lund 2, and / or at least one polypeptide, according to SEQ ID No. 3 and 4, and / or at least one antibody according to the present invention.
- DNA chips are known, for example, from US Pat. No. 5,837,832.
- the present invention also relates to a medicament for indication and therapy which contains a nucleic acid which can be used according to the invention, a polypeptide which can be used according to the invention or a modulator which can be used according to the invention and, if appropriate, suitable additives or auxiliaries, and a method for producing such a medicament for the treatment of diseases, which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, in which a nucleic acid which can be used according to the invention, according to SEQ ID Nos. 1 and 2, a polypeptide which can be used according to the invention, according to SEQ ID Nos. 3 and 4, or one which can be used according to the invention Modulator is formulated with a pharmaceutically acceptable carrier.
- Table 1 shows the list of the hlKl polypeptides and nucleic acids that can be used according to the invention, and their
- Table 2 shows the differential regulation of the expression of mIKl in various wound healing states of the mouse, determined by means of “TaqMan” analysis, as an example of diseases which are associated with impaired keratinocyte activity.
- Table 3 shows the kinetics of the differential regulation of mIKl expression in wound healing determined by means of “TaqMan” analysis as an example of a disease which is associated with impaired keratinocyte activity.
- Table 4 shows the differential regulation of the expression of mIKl in two different wound healing states of humans (normal wound healing and ulcer), determined by means of “TaqMan” analysis, as an example of diseases which are associated with impaired keratinocyte activity.
- Table 5 shows the expression profile of hlKl in various human organs, determined by means of “TaqMan” analysis.
- FIG. 1 shows the change in membrane potential (Vm) in mV determined by means of “patch clamp” analysis as the electrophysiological response of HaCaT keratinocytes to (A) different concentrations of ATP, (B) 10 ⁇ M bradykinin or 100 ⁇ M histamine (C) "Caged IP 3 " before and after UV-induced flash photolysis.
- FIG. 2 shows the influence of various modulators of hlKl on the ATP-induced electrophysiological response, determined by means of a "patch clamp” analysis, as a change in the membrane potential (Vm) in mV.
- A Addition of charybdotoxin in various concentrations before the addition of ATP
- B addition of clotrimazole (1 ⁇ M) before the addition of ATP
- C addition of charybdotoxin (100 nM) after the addition of ATP
- D addition of 1-EBIO (1 mM) before the addition of ATP.
- Figure 3 shows the immunostaining of just confluent (confluent), 2 days post-confluent (2d post-confluent), 4 days post-confluent (4d post-confluent) and 6 days post-confluent (6 days post-confluent) HaCaT cells with an anti-KlO antibody.
- FIG. 4 shows, by means of the “RNAse Protection Assay”, a certain amount of HLCl in proliferating (lane “1”), just confluent (lane “2”) and 4 days post-confluent (lane “3”) HaCaT keratinocytes as autoradiography. 1000 cpm of the hybridization probe are plotted in the "probe” lane. The "tRNA” lane contains the negative control.
- FIG. 6 shows amounts of protein markers detected by immunoblot for the keratinocyte differentiation involucrin, keratin 1 (Kl) and keratin 10 (K10) under the influence of 1000 ⁇ M 1-EBIO (lanes 1 and 2), 100 ⁇ M 1-EBIO (lanes 3 and 4), 1 ⁇ M 1-EBIO (lanes 5 and 6), 1000 ⁇ M zoxazolamine (lanes 7 and 8), 100 ⁇ M zoxazolamine (lanes 9 and 10), 1 ⁇ M zoxazolamine (lanes 11 and 12) and in the control (lane "C”; 1% DMSO / DMEM) in HaCaT keratinocytes.
- FIG. 7 shows the influence of different concentrations of the activator of hlKl, 1-EBIO, on the proliferation of HaCaT keratinocytes without the addition of serum.
- the incorporation of BrDU was determined as a measure of the proliferation by measuring the absorption at 450 nm (A [450 nm]). A stronger proliferation is reflected in a higher absorption. Cells that grew under the influence of serum were used as proliferation control (trace "KGM-10% FCS”).
- Another hlKl activator, zoxazolamine (trace "1000 ⁇ M Zox") was used as a comparison for the effect of 1-EBIO ,
- the negative controls without activator or only with the solvent DMSO are marked with "KGM” or "KGM-DMSO”.
- FIG. 8 shows the influence of different concentrations of the hlKl activator, 1-EBIO, on the serum-induced proliferation of HaCaT keratinocytes (trace "DMEM-10% FCS”).
- DMEM-10% FCS serum-induced proliferation of HaCaT keratinocytes
- polypeptide sequences of mIKl and hlKl, as well as their coding nucleic acids are listed according to SEQ ID No. 1 to SEQ ID No. 4.
- oligonucleotides and polynucleotides used for the examples are listed in accordance with SEQ ID No. 5 to SEQ ID No. 13.
- Example 1 The “intermediate-conductance” calcium-dependent potassium channel hlKl mediates a long-lasting hypothetical polarization of keratinocytes by 1-EBIO after stimulation with ATP, bradykinin or histamine
- HaCaT cells were examined electrophysiologically.
- the HaCaT keratinocytes were grown in DEM with 10% FRS (Gibco BRL) to which antibiotics (penicillin / streptomycin 100 U / ml) had been added.
- the final Ca 2+ concentration was 1.8 mM.
- the cells were incubated until a confluent cell culture developed; the culture medium was then removed by "Standard Bath Solution”(SBS; 130mM NaCl, 3mM KC1; 2 mM CaCl 2 ; 2 mM MgCl 2 ; 25 mM HEPES / NaHEPES; 10 mM D-glucose; pH 7.4) and the dishes were examined on an inverted microscope (Axiovert, Zeiss).
- the "patch” pipettes were produced from borosilicate tubes on a horizontal pull-out device (DMZ, Zeitz) using the two-step pull-out method.
- the resistance of these" patch "pipettes was 5-8 G ⁇ in the bath. After a seal in the G ⁇ range was established (typically 1.5-2 G ⁇ ) the amplifier was switched to current-clamping mode. The membrane potentials reached stable values within 3-5 minutes.
- the electrophysiological signals were recorded using an Axopatch 200 amplifier in conjunction with a TL-1 Labmaster interface and AXOTAPE software (Axon Instruments) recorded, amplified and digitized
- the statistical evaluation (one-way ANOVA with Bonferri post-test comparison) was carried out with Graphpad prism 2.0.
- the outflow was effected by applying a negative pressure by means of a vacuum pump.
- the substances were added under visual observation directly to the keratinocytes to be examined by means of a remote-controlled, magnetically controlled Y-tube system (diameter of the outflow tube: 100 ⁇ m).
- ChTx Charybdotoxin
- Verapamil (10-100 ⁇ M), which inhibits K + currents in terminally differentiating keratinocytes (Mauro et al., 1997, J. Invest. Denn., 108: 864-870), did not affect the hype-polarizing effect of ATP (hype-polarization on - 73 ⁇ 1 mV, n 3).
- K + channels, which are inhibited by clotrimazole and charybdotoxin are voltage-independent calcium-activated potassium channels.
- 1-EBIO a specific activator of the intermediate conductance calcium-activated potassium channel hlKl (Syme et al., 2000, Am. J.
- hlKl was detected in keratinocytes and its role in keratinocyte activity was demonstrated. This shows that the polypeptide hlKl and the nucleic acids encoding it and channel modulators are suitable for use in diseases which are associated with impaired keratinocyte activity, in particular in wound healing disorders and / or psoriasis.
- Proliferating subconfluent cells cells that had just reached confluence and resting cells (4 days after confluence) were examined.
- the activity of these keratinocytes was determined on the basis of the differentiation-specific keratin 10 expression.
- the cells were washed in ice-cold PBS and fixed with acetone / methanol (1: 1) at -20 ° C. for 20 min. endogenous Peroxidases were blocked with 1% H 2 O 2 at room temperature. After the non-specific binding sites had been saturated with 3% BSA in PBS, the cells were incubated overnight in a 1: 500 dilution of the mouse anti-KlO antibody (DAKO) in 3% BSA in PBS at 4 ° C.
- DAKO mouse anti-KlO antibody
- a gene fragment amplified by means of PCR was cloned into the transcription vector pBluescript KSII (+) (Stratagene) and the plasmid was linearized.
- An "antisense" transcript was then prepared in vitro using T3 or T7 polymerase and 32 P-UTP (800 Ci / mol). 20 ⁇ g RNA each were hybridized at 42 ° C. overnight with 100,000 cpm labeled “antisense” transcript. 20 ⁇ g tRNA were used as negative control.
- the hybrids were then digested for 1 h at 30 ° C. with RNAse and RNAse Tl. The protected fragments were separated on 5% acrylamide / 8 M urea gels and analyzed by autoradiography.
- hlKl a riboprobe (SEQ ID No. 5) was used which is complementary to nucleotides 740-1004 of the human hlKl gene.
- the result of the experiment is shown in Figure 4. It was observed that hlKl is strongly expressed in proliferating (lane “1”) and just confluent cells (lane “2”), while the amount was significantly reduced in post-confluent, partially differentiated cells (lane “3”). In the negative control (Trace "tRNA”), no signal was observed. In the "Probe” lane, 1000 cpm of the hybridization probe was plotted as a radioactive label control and as a size standard.
- the skin is a highly complex system, the cell composition of which is subject to changes in space and time, for example during an illness. Furthermore, the activities of the cells change, for example, through interaction with other cells. Therefore, processes in the skin can only be mimicked inadequately by simple cell systems.
- the expression of murine mIK 1 (SEQ ID No. 2) was used using the example of wound healing and various wound healing states. haunted by punch wounds in biopsies. The investigation was carried out by means of "TaqMan analysis" in the GeneAmp5700 from Applied Biosystems.
- Wound tissue and intact skin of mice with diabetes were obtained by isolating untreated day 1 wounds and intact skin from 10 week old C57B / Ks-db / db / Ola mice by scissors cutting. C57B / Ks wild-type mice were used as control animals. Intact skin and untreated day 1 wounds were also obtained from the latter animals.
- RNA (ad 50 ⁇ l with DEPC-treated water) with 5.7 ⁇ l transcription buffer (Röche), 1 ⁇ l RNase inhibitor (Röche; 40 U / ⁇ l) and 1 ⁇ l DNase I (Röche; 10 U) / ⁇ l) incubated at 37 ° C for 20 min. Then 1 ⁇ l of DNase I was again added and incubated at 37 ° C. for a further 20 min. The RNA was then phenolized, ethanol precipitated and washed. All of the steps listed above were carried out with DEPC (diethyl pyrocarbonate) -treated solutions or liquids, provided they did not contain any reactive amino groups.
- DEPC diethyl pyrocarbonate
- the cDNA was then produced from the extracted RNA. This was done in the presence of 1 x "TaqMan" RT buffer (PE Applied Biosystems), 5.5 mM MgCl 2 (PE Applied Biosystems), 500 ⁇ M dNTPs (PE Applied Biosystems), 2.5 ⁇ M random hexamers (PE Applied Biosystems), 1.25 U / ⁇ l MultiScribe Reverse Transcriptase (50 U / ⁇ l, PE Applied Biosystems), 0.4 U / ⁇ l RNase inhibitor (20 U / ⁇ l, PE Applied Biosystems), 20 ⁇ l RNA (50 ng / ⁇ l) and DEPC-treated water (ad 100 ⁇ l volume) After adding the RNA and mixing well, the solution was distributed to 2 0.2 ml tubes (50 ⁇ l each) and the reverse transcription in a temperature cycler (10 min at 25 ° C; 30 min at 48 ° C and 5 min at 95 ° C).
- the subsequent quantification of the cDNA was carried out by means of quantitative PCR using the “SYBR-Green PCR Master Mix” (PE Applied Biosystems), a triple determination (in each case using mIKl primers and GAPDH primers) being carried out to determine the amount of mIKl-cDNA
- the stock solution for each triplet contained 37.5 ⁇ l 2 ⁇ “SYBR Master Mix”, 0.75 ⁇ l AmpErase UNG (1 U / ⁇ l) and 18.75 ⁇ l DEPC-treated water for a total volume of 57 ⁇ l.
- 1.5 ⁇ l of forward and backward primers mIKl Primer 1 (SEQ ID No. 6) and mIKl Primer 2 (SEQ ID No.
- cDNAs were - Solutions prepared as a dilution series to create a standard curve for the GAPDH-PCR (4 ng / ⁇ l; 2 ng / ⁇ l; 1 ng / ⁇ l; 0.5 ng / ⁇ l and 0.25 ng / ⁇ l). 15 ⁇ l each cDNA solutions were mixed with 60 ⁇ l stock solution / primer mixture for the determination of GAPDH and divided into 3 "wells". A standard curve was also prepared for the mIKl-PCR using the same dilutions as for the GAPDH standard curve A PCR mixture without cDNA was used as a control.
- a modulation preferably an increase in the expression and / or activity of IK1, can therefore advantageously be used for the treatment or prevention of diseases which are related to impaired keratinocyte activity.
- mIKl in murine biopsies In order to determine suitable times for a diagnosis, the prevention and / or treatment of a disease associated with impaired keratinocyte activity, the expression of mIKl in murine biopsies from different times of wound healing determined. At the time of 1 h, 7 h, 15 h, 24 h, 3 days, 5 days, 7 days and 14 days after wounding, wound biopsies and a biopsy of intact skin from 10-week-old control mice were obtained by scissors cutting as described above. The RNA was isolated from the tissue and the relative amount of mIKl in the biopsies was determined. It was found that a clear upregulation of the mIKl expression can be observed as early as 7 hours after wounding (Table 3).
- mice have proven to be a suitable model system for studying wound healing in humans. Nevertheless, it should be checked whether a differential expression of the nucleic acids that can be used according to the invention and observed in the mouse using the example of wound healing can also be detected in humans.
- skin samples were taken from healthy subjects from untreated intact skin, from day 1 wounds or from day 5 wounds using 4 mm or 6 mm punches.
- the biopsies of 14 subjects were pooled from each group (intact skin, day 1 wound, day 5 wound).
- punch biopsies were taken from patients with chronic venous ulcers (Ulcera cruris venosum) simultaneously from intact skin as well as from the wound bed and wound edge.
- hGAPDH primer 1 CATGGGTGTGAACCATGAGAAG (SEQ ID No. 10); hGAPDH primer 2: CTAAGCAGTTGGTGGTGCAGG (SEQ ID No. 11), hlKl Primer 1: SECA IDQG.
- hlKl Primer 2 GTGTTCATGTAAAGCTTGGCCA (SEQ ID No. 9)) on the basis of the known sequences of human GAPDH (GenBank: M17851) and human hlKl (SEQ ID No. 1).
- cDNA was amplified from 10 ng of reverse transcribed total RNA in a total volume of 25 ⁇ l per batch. The PCR was carried out according to the manufacturer's instructions (PE Applied Biosystems, SYBR Green PCR and RT-PCR Reagents Protocol, 1998). The Gr values were analyzed and the frequency of hlKl-mRNA relative to GAPDH-mRNA was calculated. The results of the experiment are shown in Table 4.
- a modulation preferably an increase in the expression and / or activity of IK1
- IK1 can therefore advantageously be used for the treatment or prevention of diseases which are associated with impaired keratinocyte activity.
- the expression of IK1 in wounds, in particular ulcers of the skin, is preferably to be increased.
- hlKl has already been detected in various tissues in humans (Ishii et al. 1997; Proc. Natl. Acad. Sei. USA 94: 11651-11656; Joiner et al. 1997; Proc. Natl. Acad. Sei. USA 94 : 11013-11018; WO 99/03882). It is striking that the expression is restricted to organs that cannot be electrically regenerated, such as the placenta and prostate, but no expression in the brain or heart was detected. This is reflected in the doctrine that the expression of hiKl in humans is limited to cells of the blood and the blood vessel system (WO00 / 34248).
- modulators of this channel are considered suitable medicaments for a variety of diseases in various administration forms, since the risk of cardiovascular complications is assumed to be low.
- expression in skin has so far not been demonstrated in humans or in any other mammal.
- organ-specific total RNA pools from adult human donors were used (BioChain Institute, Inc.): total kidney RNA was isolated from 5 donors Total lung RNA from 5 donors, Total RNA from 4 donors, Total RNA from 5 donors, Total RNA from 5 donors, Brain total RNA from 5 donors, Heart RNA from 5 donors, Spleen from 2 donors Total RNA, isolated from 5 donors of total skeletal muscle RNA and from 5 donors of small intestine total RNA, digested with DNAse I, and the total RNAs pooled separately according to organs.
- Example 3 A “TaqMan analysis” was then carried out as described in Example 3 with the total RNAs of these organs and total RNA from skin, which was obtained as in Example 4, and the frequency of hlKl-mRNA relative to GAPDH-mRNA was determined relative amounts of hlKl mRNA in the organs are in Table 5 specified. Surprisingly, it could be demonstrated for the first time that hlKl is expressed in the skin. In addition, it was observed that hlKl is expressed in skin to a comparable extent as, for example, in the lungs and spleen. In the latter two organs, a comparatively strong expression of hlKl had been detected (WO 99/03882).
- hlKl in the brain, heart and skeletal muscle was surprisingly demonstrated.
- the result which is contradictory to the prior art, is probably due to the higher sensitivity of the TaqMan analysis compared to the Northern Blof analysis used in the prior art.
- This experiment therefore shows two aspects of the present invention.
- the expression of hlKl is a prerequisite for this that the gene hlKl, the protein and modulators of its activity can be used for the diagnosis, prevention and / or treatment of diseases associated with impaired keratinocyte activity.
- hlKl cardiovascular disease
- the surprising detection of the expression of hlKl in negligible organs shows that contrary Cardiovascular complications, for example in the case of oral administration, are probable, however the prevention and / or treatment of diseases which are associated with impaired keratinocyte activity, in particular wound healing disorders and / or psoriasis, should preferably be treated topically, since this form of application ensures direct and specific contact with the keratinocytes.
- the use of hlKl, its coding nucleic acids and / or modulators of its activity is therefore particularly advantageous in the prevention and / or treatment of these diseases.
- modulators of the IK channel can regulate keratinocyte activity.
- the influence of modulators on the differentiation was examined using the example of the activator of hlKl, 1-EBIO (Syme et al., 2000, Am. J. Physiol., 278: C570-C581).
- HaCaT cells were grown in medium for 2 days.
- 1 mM 1-EBIO (Tocris) was then added to the medium to the proliferating, subconfluent cells and incubated for 3 days.
- the differentiation of the keratinocytes was then investigated by immunostaining with a KlO antibody as shown in Example 2.
- the influence of IK1 activators on proliferation was investigated using 1-EBIO and zoxazolamine (supra).
- the influence of different concentrations of 1-EBIO on the growth rate of HaCaT cells in the presence and absence of serum was first measured.
- 1 ⁇ 10 4 HaCaT cells per “well” in a 96 “well” plate were cultured in keratinocyte growth medium (KGM) for 5 days in order to synchronize the cell cycle, followed by a two-day incubation of different concentrations of 1-EBIO in KGM (see FIGS. 7 and 8) in the absence ( Figure 7) and in the presence ( Figure 8) of serum.
- KGM keratinocyte growth medium
- KGM / 10% FCS was used as a positive control with regard to proliferation, while the IK1 activator zoxazolamine in a concentration of 1 mM was used as a comparison for the 1-EBIO effect.
- 1% DMSO in KGM served as solvent control.
- the cell proliferation was measured with the help of the incorporation of bromo-dideoxyuridine (BrDU) during cell division according to the manufacturer's instructions (“The Cell Proliferation ELISA, BrDU, Röche). The incorporation of BrDU was quantified by determining the absorption at 450 nm.
- the Abso ⁇ tion (A [450nn ⁇ J) is plotted as a measure of the proliferation rate on the Y axis.
- clotrimazole and charybdotoxin either 10 ⁇ M clotrimazole, 200 nM charybdotoxin (ChTx) or 1 mM 1-EBIO were added to subconfluently grown cells and the number of cells per well was determined every day.
- the addition of clotrimazole and 1-EBIO in the specified concentration led to complete inhibition; on the other hand, growth was only slowed down when 200 nM charybdotoxin was added.
- modulation of various hlKl activities for the treatment and / or prevention of diseases that are related to impaired keratinocyte activity can result in special and completely new therapeutic options.
- modulating the activity of hlKl is particularly advantageous for the treatment of psoriasis, where the cause of the disease is based on a combination of cell hypoliferation and reduced apoptosis of differentiated cells.
- Derivatives of the modulators which can be used in a lower concentration are particularly preferred, for example DCEBIO (5,6-dichloro-ethyl-l, 3-dihydro-2H-benzimidazol-2-one) as the dichloro derivative of 1-EBIO ,
- DCEBIO 5,6-dichloro-ethyl-l, 3-dihydro-2H-benzimidazol-2-one
- an increase in the amount of the IK channel is preferred. This can be done, for example, using gene therapy using a gene therapeutic vector containing a nucleic acid coding for an IK channel that can be used according to the invention.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- General Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Dermatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Pulmonology (AREA)
- Marine Sciences & Fisheries (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE50105735T DE50105735D1 (de) | 2000-12-28 | 2001-12-27 | Chlorzoxazon zur behandlung von psoriasis |
| JP2002554120A JP2004530642A (ja) | 2000-12-28 | 2001-12-27 | 障害のあるケラチノサイト活性に関係する疾患を診断および処置するための中コンダクタンス型カリウムチャネルおよびモジュレーターの使用 |
| US10/451,805 US20040248099A1 (en) | 2000-12-28 | 2001-12-27 | Use of intermediate -conductance potassium channels and modulators for diagnosing and treating diseases having disturbed keratinocyte activity |
| CA002433041A CA2433041A1 (en) | 2000-12-28 | 2001-12-27 | Use of intermediate-conductance potassium channels and modulators for diagnosing and treating diseases involving disturbed keratinocyte activiyty |
| AT01272669T ATE291435T1 (de) | 2000-12-28 | 2001-12-27 | Chlorzoxazon zur behandlung von psoriasis |
| EP01272669A EP1345618B1 (de) | 2000-12-28 | 2001-12-27 | Chlorzoxazon zur behandlung von psoriasis |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE10065475A DE10065475A1 (de) | 2000-12-28 | 2000-12-28 | Verwendung von "intermediate-conductance" Kaliumkanälen und Modulatoren zur Diagnose und Behandlung von Krankheiten mit gestörter Keratinozytenfunktion |
| DE10065475.4 | 2000-12-28 | ||
| US27745301P | 2001-03-20 | 2001-03-20 | |
| US60/277,453 | 2001-03-20 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2002053171A2 true WO2002053171A2 (de) | 2002-07-11 |
| WO2002053171A3 WO2002053171A3 (de) | 2003-03-20 |
Family
ID=26008117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2001/015317 Ceased WO2002053171A2 (de) | 2000-12-28 | 2001-12-27 | Verwendung von 'intermediate-conductance kaliumkanälen und modulatoren zur diagnose und behandlung von krankheiten mit gestörter keratinozytenaktivität |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1345618B1 (https=) |
| JP (1) | JP2004530642A (https=) |
| AT (1) | ATE291435T1 (https=) |
| CA (1) | CA2433041A1 (https=) |
| WO (1) | WO2002053171A2 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004064835A1 (en) * | 2003-01-17 | 2004-08-05 | Neurosearch A/S | Use of ion channel modulating agents for treating pain |
| WO2004039409A3 (de) * | 2002-10-31 | 2004-09-10 | Switch Biotech Ag | Zusammensetzung enthaltend aktivatoren von ik-kaliumkanälen und calcineurin-antagonisten und deren verwendung |
| US7851431B2 (en) * | 2005-07-27 | 2010-12-14 | Prescription Dispensing Laboratories | Treatment of actinic keratoses with calcium channel blockers |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4569935A (en) * | 1983-03-17 | 1986-02-11 | University Of Tennessee Research Corp. | Topical treatment of psoriasis with imidazole antibiotics |
| EP0181793B1 (fr) * | 1984-10-16 | 1988-07-27 | Synthelabo | Dérivés de pipéridine, leur préparation et leur application en thérapeutique |
| GB2273873A (en) * | 1992-12-23 | 1994-07-06 | Univ Sheffield | Treatment of psoriasis |
| AU7733896A (en) * | 1995-11-13 | 1997-06-05 | Brandeis University | Regulation of cancer-causing tyrosine kinases by potassium ion conductance |
| ATE366260T1 (de) * | 1996-09-11 | 2007-07-15 | Univ Oregon Health Sciences | Kalzium-aktivierte kaliumkanäle mit niedriger und mittlerer leitfähigkeit und ihre verwendungen. |
| AU1224599A (en) * | 1997-11-14 | 1999-06-07 | Neurosearch A/S | Chemical compounds having ion channel blocking activity for the treatment of immune dysfunction |
| JPH11209302A (ja) * | 1998-01-21 | 1999-08-03 | Pola Chem Ind Inc | 抗掻痒剤 |
| JP2002531539A (ja) * | 1998-12-04 | 2002-09-24 | ニューロサーチ、アクティーゼルスカブ | イオンチャネル調節剤 |
| EP1135123B1 (en) * | 1998-12-04 | 2004-12-29 | Neurosearch A/S | Use of isatin derivatives as ion channel activating agents |
| EP1144387A1 (en) * | 1998-12-04 | 2001-10-17 | Neurosearch A/S | New benzimidazolone-, benzoxazolone-, or benzothiazolone derivatives as ion channel modulating agents |
| JP2002533318A (ja) * | 1998-12-22 | 2002-10-08 | ニューロサーチ、アクティーゼルスカブ | イオンチャネル調節剤 |
-
2001
- 2001-12-27 CA CA002433041A patent/CA2433041A1/en not_active Abandoned
- 2001-12-27 WO PCT/EP2001/015317 patent/WO2002053171A2/de not_active Ceased
- 2001-12-27 JP JP2002554120A patent/JP2004530642A/ja active Pending
- 2001-12-27 EP EP01272669A patent/EP1345618B1/de not_active Expired - Lifetime
- 2001-12-27 AT AT01272669T patent/ATE291435T1/de not_active IP Right Cessation
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004039409A3 (de) * | 2002-10-31 | 2004-09-10 | Switch Biotech Ag | Zusammensetzung enthaltend aktivatoren von ik-kaliumkanälen und calcineurin-antagonisten und deren verwendung |
| WO2004064835A1 (en) * | 2003-01-17 | 2004-08-05 | Neurosearch A/S | Use of ion channel modulating agents for treating pain |
| US7851431B2 (en) * | 2005-07-27 | 2010-12-14 | Prescription Dispensing Laboratories | Treatment of actinic keratoses with calcium channel blockers |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1345618B1 (de) | 2005-03-23 |
| JP2004530642A (ja) | 2004-10-07 |
| WO2002053171A3 (de) | 2003-03-20 |
| CA2433041A1 (en) | 2002-07-11 |
| EP1345618A2 (de) | 2003-09-24 |
| ATE291435T1 (de) | 2005-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Favaro et al. | DRP1-mediated mitochondrial shape controls calcium homeostasis and muscle mass | |
| US11559522B2 (en) | Methods for enhancing liver regeneration | |
| Calorio et al. | Impaired chromaffin cell excitability and exocytosis in autistic Timothy syndrome TS2‐neo mouse rescued by L‐type calcium channel blockers | |
| EP1176200A2 (de) | Verwendung von Polypeptiden oder diese kodierende Nukleinsäuren zur Diagnose oder Behandlung von Hauterkrankung oder Wundheilung sowie ihre Verwendung zur Indentifizierung von pharmakologisch aktiven Substanzen | |
| Yuan et al. | MicroRNA-494 promotes cyclosporine-induced nephrotoxicity and epithelial to mesenchymal transition by inhibiting PTEN | |
| DE10065475A1 (de) | Verwendung von "intermediate-conductance" Kaliumkanälen und Modulatoren zur Diagnose und Behandlung von Krankheiten mit gestörter Keratinozytenfunktion | |
| Zhang et al. | Transforming growth factor‐β1 mediates psoriasis‐like lesions via a Smad3‐dependent mechanism in mice | |
| Carlson et al. | Chronic treatment with agents that stabilize cytosolic IκB-α enhances survival and improves resting membrane potential in MDX muscle fibers subjected to chronic passive stretch | |
| DE10121254A1 (de) | MRP8/MRP14 Heterodimers oder seiner Einzelkomponenten alleine oder in Kombination zur Behandlung und/oder Prävention von Hauterkrankungen, Wunden und/oder Wundheilungsstörungen, die durch eine verringerte Menge an MRP8/MRP14 Heterodimeren gekennzeichnet sind | |
| US20090035275A1 (en) | Methods and formulations for protecting cells, and for treating diseases and conditions by optimizing the intracellular concentration of NAD | |
| Brockhausen et al. | Neural agrin increases postsynaptic ACh receptor packing by elevating rapsyn protein at the mouse neuromuscular synapse | |
| WO2003072126A2 (de) | Verwendung eines fibroblastenwachstumsfaktor-bindeproteins zur behandlung und diagnose von diabetischen wundheilungsstörungen | |
| EP1345618B1 (de) | Chlorzoxazon zur behandlung von psoriasis | |
| DE10121255A1 (de) | Verwendung von alpha 1-Antichymotrypsin Polypeptiden oder diese kodierende Nukleinsäuren, oder einer ein ACT Polypeptid oder diese kodierende Nukleinsäure exprimierende Zelle, zur Behandlung und/oder Prävention von diabetes-assoziierten und/oder arteriellen schlecht heilenden Wunden und zur Identifizierung von pharmakologisch aktiven Substanzen | |
| Beaumont et al. | The PDE1/5 inhibitor SCH-51866 does not modify disease progression in the R6/2 mouse model of Huntington’s disease | |
| EP1178053A2 (de) | Polypeptide oder diese kodierende Nukleinsäuren einer Familie von G-Protein gekoppelten Rezeptoren sowie deren Verwendung zur Diagnose oder Behandlung von Hautkrankheiten | |
| WO2004039409A2 (de) | Zusammensetzung enthaltend aktivatoren von ik-kaliumkanälen und calcineurin-antagonisten und deren verwendung | |
| Esquerro et al. | THE EFFECTS OF THE CALCIUM IONOPHORE, A23187, ON THE AXOPLASMIC TRANSPORT OF DOPAMINE β‐HYDROXYLASE | |
| DE60009333T2 (de) | Verfahren zur hemmung der atrophie oder förderung der hypertrophie | |
| KR101077179B1 (ko) | Pig3를 이용한 dna 손상 보호방법 | |
| EP1340507B1 (de) | Verwendung eines Fibroblastenwachstumsfaktor-Bindeproteins zur Behandlung und Diagnose von diabetischen Wundheilugnsstörungen | |
| Pham | Influence of Large Conductance Ca2+-and Voltage-Activated K+ Channels (BK) on Synaptic Plasticity in Young and Aged Mice | |
| EP1127576A1 (de) | Verwendungen von NM23-Polypeptiden bei Haut- und Darmerkrankungen | |
| DE10234901A1 (de) | Verwendung von am Mrp4 bindenden Substanzen zur Diagnose und Behandlung von Krebserkrankungen | |
| DE102008029072A1 (de) | Sgk3 als therapeutisches und diagnostisches Target für Alterserkrankungen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2001272669 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2433041 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002217160 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002554120 Country of ref document: JP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2001272669 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10451805 Country of ref document: US |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2001272669 Country of ref document: EP |