WO2002038763A1 - Pca2501 gene - Google Patents

Abstract

A gene containing a polynucleotide which encodes the amino acid sequence represented by SEQ ID NO:1; and the polynucleotide encoded by this gene. This is a schizophrenia-associated gene.

Description

 P C A 250 5 1 gene

Technical field

 The present invention relates to a novel gene PCA2501 highly expressed in peripheral blood of schizophrenic patients. Further, the present invention provides a method for encoding a gene by the polynucleotide of the gene.

A polypeptide comprising an amino acid sequence to be expressed, and an expression product of the gene;

New human genes that can be used for genetic diagnosis using offspring and the development of new therapeutic methods.

Background art

The genetic information of an organism is accumulated as a sequence of four bases A, C, G, and T (DNA) present in the nucleus of a cell. This genetic information is used to maintain the lineage and ontogeny of each organism. Is stored in In humans, the number of bases of about 3 000 000 000 (3 X 1 0 ⁹⁾ We gutter, it is estimated that in it there are 5 to 00,000 genes. This genetic information follows the flow in which mRNA is transcribed from a gene (DNA) and then translated into a protein, whereby regulatory proteins, structural proteins, or enzymes are made to maintain life phenomena. Abnormalities in the flow from the above genes to protein translation cause abnormalities in the life support system, such as cell proliferation and differentiation, and are thought to cause various diseases. From the results of the gene analysis to date, G protein-coupled receptors, insulin receptors, LDL receptors,

51-1 Receptors such as HT receptor and dopamine receptor and related to the proliferation and differentiation of cells.Tyrosine kinase, histidine kinase, arginine kinase, protease, ATase, superoxide dismutase, histidine kinase Many genes have been found to be useful as materials for diagnosing diseases such as metabolic enzymes such as ze, p450 and for screening compounds useful for drug development. Among these, Frizzled-3 (JP-A-11-253183), Frizzled- 4 (2000-93186), and genes related to nervous disorders such as schizophrenia and bipolar Z unipolar disorder. Genes such as Wnt-14 (JP-A-11-75872) and Wnt-6 (2000-60575) have recently been found. Human Frizzled-3 is mapped to 8pl2-p21 and is almost exclusively expressed in the brain and central nervous system. Kendeler (Kendler, et al., Am. J. Psychiatry. 153 (12): 1534-1540, 1996)) found a very significant link between schizophrenia and 8p21 of the 265 Irish family. Heading.

 However, studies on the analysis of human genes and the functions of the analyzed genes and the relationship between the analyzed genes and various diseases have only just begun, and there are many unclear points especially in the psychiatric and neurological fields. Analysis of new genes in the region, analysis of the function of those genes, research on the relationship between the analyzed genes and diseases, gene diagnosis of brain and nerve regions by using the analyzed genes, and the gene There is a need in the art for application research and the like for medical uses related to the brain and nerve areas. If a new human gene with the above-mentioned brain / nervous region, especially the region of schizophrenia can be provided, the gene expression level and its structure and function in each cell such as brain / nerve can be analyzed, and the expressed product It is thought that the analysis of the disease and the like will make it possible to elucidate, diagnose, and treat diseases related to the brain and nervous areas, particularly the schizophrenia area, for example, schizophrenia. The aim is to provide human genes related to various schizophrenia. Disclosure of the invention

The present inventors have conducted intensive studies and, as a result, have analyzed the genes PCA2501 and PCA2501 polypeptide highly expressed in the blood of schizophrenic patients, and found that these genes are closely related to nervous system disorders, particularly schizophrenia. The present inventors have found that they are useful for diagnosing these diseases and developing therapeutic agents, and have completed the present invention. That is, the present invention provides the following polynucleotide (a) or (b):

 (A) a polynucleotide encoding the amino acid sequence represented by SEQ ID NO: 1 or a complementary chain thereof,

 (b) a polynucleotide having at least 90% homology to a polynucleotide encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1, and the present invention provides the following (c), (d) or ( e) a gene comprising any of the following polynucleotides:

 The present invention also relates to any one of the following (c), (d) or (e):

 (c) the base sequence represented by SEQ ID NO: 2 or a complementary strand thereof,

 (d) a polynucleotide comprising the nucleotide sequence of (c) above and a stringent string

(e) a polynucleotide having at least 70% homology to the polynucleotide having the nucleotide sequence of SEQ ID NO: 2,

The present invention provides a gene consisting of

 Further, the present invention provides a polypeptide of the following (f) or (g):

 (f) a polypeptide comprising an amino acid sequence represented by SEQ ID NO: 1,

 (g) It provides a gene comprising an amino acid sequence in which one or more amino acids have been deleted, substituted or added in the amino acid sequence of (f) above, and encoding a polypeptide having PCA2501 activity.

 Further, the present invention provides a gene expression product of the above gene, a recombinant expression vector having the above gene, a host cell having the expression vector, and a gene.

It provides cloned cDNA and its fragments, derivatives and homologs thereof that express PCA2501.

Further, the present invention provides a polypeptide of the following (f) or (g): (f) a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1,

(g) It is intended to provide a polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of (f), and which has PCA2501 activity.

 The present invention further provides oligonucleotides, oligonucleotide probes and primers comprising at least 15 or 30 consecutive nucleotide sequences of the above-mentioned gene.

 Further, the present invention provides a method for detecting a PCA2501 gene or a gene expression product in a body fluid or a tissue sample, which binds to the oligonucleotide probe, using the above oligonucleotide probe. It provides a detection method.

 Furthermore, the present invention provides a method for screening for a drug that interacts with the gene or gene expression product, characterized by using the above gene or gene expression product.

 Furthermore, the present invention provides an antibody having a binding property to the gene expression product or a portion thereof.

 Furthermore, the present invention provides a diagnostic agent for schizophrenia containing the above oligonucleotide probe or primer.

 Further, the present invention relates to a gene therapy agent containing an antisense strand oligonucleotide containing at least 15 or 30 contiguous nucleotide sequences of the PCA2501 gene as an active ingredient, and / or a PCA2501 activity inhibitor or an antipsychotic. It is intended to provide a disease agent.

Furthermore, the present invention provides a PCA2501 activity inhibitor or an antischizophrenic agent comprising an anti-PCA2501 antibody or a part thereof as an active ingredient. Further, it is a homologue of the gene of the present invention, which is a human, a dog, a monkey, a pig, a pig, and a human. And a homologue of a mammalian gene selected from the group of litter and cats. Furthermore, the present invention provides a screening method for identifying a compound that stimulates or suppresses the function of a PCA2501 polypeptide or a PCA2.501 gene expression product,

 (a) direct binding of the candidate compound to the polypeptide or gene expression product (or the cell carrying the polypeptide or the gene expression product or its membrane) or a fusion protein thereof; A method of measuring with an indirectly bound label,

 (b) binding of the candidate compound to the polypeptide or the gene expression product (or the cell or the membrane carrying the polypeptide or the gene expression product) or the fusion protein thereof in the presence of a labeling competitor How to measure with

 (c) detecting whether the candidate compound produces a signal resulting from the activation or suppression of the polypeptide or gene expression product, by detecting the candidate compound suitable for a cell or cell membrane carrying the polypeptide or gene expression product Method to examine using the system,

 (d) simultaneously mixing a candidate compound and a solution containing the polypeptide or gene expression product to prepare a mixture, measuring the activity of the polypeptide or gene expression product in the mixture, and measuring the activity of the mixture. How to compare to a standard, and

(e) a screening method comprising a method selected from the group consisting of a method for detecting the effect of a candidate compound on the production of mRNA by encoding the polypeptide in a cell and the polypeptide.

 The present invention also provides use of the above oligonucleotide probe or primer for the production of a diagnostic agent for schizophrenia.

Furthermore, the present invention provides a method for diagnosing schizophrenia, which comprises detecting the PCA2501 gene or gene expression product in a body fluid or tissue sample using the above oligonucleotide probe or primer. Is what you do. BRIEF DESCRIPTION OF THE FIGURES

 FIG. 1 is a diagram showing a comparison of the expression level of the PCA2501 gene among healthy persons, schizophrenic patients, and other psychiatric patients.

 FIG. 2 shows the relationship between the expression level of the PCA 2501 gene in schizophrenic patients and the psychiatric symptoms of the patients. BEST MODE FOR CARRYING OUT THE INVENTION

 The abbreviations of amino acids, peptides, base sequences, nucleic acids and the like in this specification are indicated by

IUPAC—IUB Regulations [IUPAC-IUB Communication on Biological Nomenclature, Eur. J. Biochem., 138: 9 (1984)], “Guidelines for the preparation of specifications containing base sequences or amino acid sequences” (Patent Office Section) and conventional symbols in the relevant field.

 As a specific example of the gene of the present invention, “PCA250

1 "deduced from the DNA sequence of the PCR product, designated as" 1 ". Its nucleotide sequence is as shown in SEQ ID NO: 3. The gene is a novel schizophrenia-related protein (PCA2) having a 718 amino acid sequence shown in SEQ ID NO: 1.

It is a human cDNA that encodes a 501 protein, and is 3910 bases in length.

 The PCA2501 protein encoded by the gene PCA2501 of the present invention is a FAS

TA program (Person W. R., et al., Proc. Natl. Acad. Sci., USA., 85,

2444-2448 (1988)), a search of the GenBank / EMBL database revealed that exon 3-9 and the complete coding sequence of the human proto-oncogene (BCL3) gene

(ACCESSION U05681) or 31% homology at the amino acid level was detected in the complete coding sequence of human B-cell lymphoma 3_encoded protein (bcI3) mRNA (ACCESSION Μ3Π32), but its function has not yet been elucidated. Absent.

In the present invention, the gene is not only a double-stranded DNA, but also a component thereof. It is intended to include each single-stranded DNA such as a sense strand and an antisense strand, and the length is not limited at all. Therefore, unless otherwise specified, the gene (DNA) of the present invention includes a double-stranded DNA containing human genomic DNA, a single-stranded DNA (sense strand) containing cDNA, and a sequence complementary to the sense strand. Single-stranded DNA (antisense strand), and fragments thereof. In the present invention, the gene (DNA) includes a leader sequence, a coding region, exons, and introns. Examples of the polynucleotide include RNA and DNA. DNA includes cDNA, genomic DNA, and synthetic DNA. A polypeptide having a specific amino acid sequence includes fragments, homologues, derivatives and variants thereof. Variants are naturally occurring allelic variants, non-naturally occurring variants, deletions, substitutions, additions, and insertions; polynucleotide sequences that do not substantially alter the function of the encoded polypeptide. Means

 In addition, these amino acid sequence alterations (mutations, etc.) may occur in nature, for example, due to mutations or post-translational modifications, etc., but may be artificially performed using naturally-occurring genes (for example, genes of the present invention). This can be done in a specific way. The polypeptides include alleles, homologs, and naturally occurring variants that are at least 90%, preferably 95%, more preferably 98%, and even more preferably 99% homologous. Further, the gene expression product of the present invention has structural features that are commonly conserved, and the gene expression product of the present invention can be used for biological activity, for example, PCA2501 activity based on overexpression of the PCA2501 gene, or dopamine 1, dopamine 2, and noradrenaline in the brain. It has an overproduction activity of a sympathetic stimulant such as serotonin (5-HT;) and acetylcholine, a receptor stimulating activity of a sympathetic neurotransmitter receptor, and a transmission impairment activity of these neurotransmitters. The homology of polypeptides can be determined by measurement using sequence analysis software, for example, FASTA program (Clustal, V., Methods Mol. Biol., 25, 307-318 (1994)), or by SWISS-PROT. Can be analyzed.

Variant DNA means a silent or conservative variant of an amino acid substitution, Indicates a mutation in the base sequence in which the amino acid residue encoded by the base sequence does not change.

The number of conservative amino acid substitutions is shown below:

Table 1 Original amino acid residues Conservatively substituted amino acid residues

 Ala Ser

 Arg Lys

 Asn Gin, His

 Asp Glu

 Cys Ser

 Gin Asn

 Glu Asp

 Gly Pro

 His Asn or Gin

l ie Leu or Val

 Leu lie or Val

 Lys Arg or Glu

 Met Leu or l ie

 Phe Met, Leu or Tyr

 Ser Thr

 Thr Ser

 Trp Tyr

 Tyr Trp or Phe

 In addition to Valie or Leu, it is generally possible to delete or replace cysteine residues because one or more codons encoding a cysteine residue affect the disulfide binding of a particular polypeptide.

 Substantial changes in function made by the choice of substituents are slightly less conservative than those listed in the amino acid list above. For example: a) structural background of the polypeptide in the region of the substituents,

b) the charge or hydrophobicity of the polypeptide at the target site,

c) The size (volume) of the amino acid side chain.

Substitutions that are generally expected to produce the greatest change in protein properties are: a) a hydrophilic residue, for example, seryl or threonine, is substituted for a hydrophobic residue, for example, leucyl, isoleucyl, fanylalanil, 'valyl, or arayl;

b) Cysteine or proline is substituted for any other residue; c) Residues having an electropositive side chain, for example, lysyl, arginyl, hissyl are electronegative residues, For example, replaced by baltamyl or aspartyl,

d) Residues with very large side chains, for example phenylalanine, can be replaced by those without side chains, such as glycine.

 As described above, the provision of the gene PCA2501 of the present invention and its gene product provides extremely useful information and means for elucidation, understanding, diagnosis, prevention, and treatment of schizophrenia. Further, the gene of the present invention can also be suitably used in the development of a novel drug that suppresses the induction of the expression of the gene of the present invention, which is used for the treatment of schizophrenia. Furthermore, detection of the expression of the gene of the present invention or expression of a product thereof in an individual or body fluid or tissue, and detection of mutation (deletion or point mutation) or abnormal expression of the gene can be performed by analyzing the above-mentioned schizophrenia, It can be suitably used in diagnosis.

 The gene of the present invention specifically includes a gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding the amino acid sequence represented by SEQ ID NO: 1, or a polynucleotide comprising the entire nucleotide sequence represented by SEQ ID NO: 2 or a complementary strand thereof However, the gene is not particularly limited to these, and may be, for example, a gene encoding an amino acid sequence having a certain modification in the above specific amino acid sequence, or a gene encoding the above specific amino acid sequence or base sequence. Can be a gene having the homology of The certain homology with the specific amino acid sequence or base sequence is, for example, at least 90% or more, preferably 9% or more.

It has a homology of 5% or more, more preferably 98% or more, and still more preferably 99% or more, and includes these homologs.

Regarding the gene variant of the present invention, the amino acid sequence shown in SEQ ID NO: 1 A gene including a nucleotide sequence encoding an amino acid sequence in which one or more amino acids have been deleted, substituted or added (modified amino acid sequence) is also included. Here, the degree of “deletion, substitution or addition of amino acids” and their positions are determined by the fact that the modified protein has the same function as the protein consisting of the amino acid sequence represented by SEQ ID NO: 1 (PCA2501 protein). It is not particularly limited as long as it has the same effect as above, but preferably 1 to more than 10 and more preferably about 1 to several are preferably exemplified as having the same function as PCA2501 protein.

 Here, “similar function” means that the cause of schizophrenia is overproduction of sympathetic stimulants such as dopamine 1, dopamine 2, noradrenaline, serotonin (5-HT), and acetylcholine in the brain, and sympathetic neurotransmitters. Abnormalities in the midbrain cortex and limbic system are caused by various causes such as receptor abnormalities and impaired transmission of these neurotransmitters, causing the appearance of mental illness and mental dysfunction. Since it is said that the hypothalamic-pituitary system causes an impairment of the motor function in the extracorporeal system and the hypothalamus-pituitary system, it can be said to be an activity similar to the activity of these PCA2501.

 Therefore, the PCA2501 activity includes, based on the overexpression of the PCA2501 gene, the overproduction activity of sympathetic stimulants such as dopamine 1, dopamine 2, noradrenaline, serotonin (5_HT) and acetylcholine in the brain, and the sympathetic neurotransmitter receptor. Examples include the activity of stimulating the receptor of the body and the activity of causing the impairment of the transmission of these neurotransmitters.

Thus, PCA2501 is a strong candidate for schizophrenia-related nervous system disorders. These properties are hereinafter referred to as “PCA2501 activity” or “PCA2501 polypeptide activity” or “biological activity of PCA2501”. Among these activities are also the antigenic and immunogenic activities of the PCA2501 polypeptide, especially the antigenic and immunogenic activities of the polypeptide of SEQ ID NO: 1. Preferably, the polypeptides of the present invention exhibit at least one biological activity of PCA2501. The gene encoding the modified amino acid sequence is The PCA2501 gene of the present invention encoding the amino acid sequence before modification may be detectable.

 Further, examples of the DNA molecule of the present invention include a PCA2501 gene having a base sequence encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1, but the PCA2501 gene is not particularly limited thereto. Genetic homologs are also included. .

 As used herein, the term "homolog of PCA2501 gene" means having homology to the PCA2501 gene of the present invention (or a gene product thereof), having the above-mentioned structural characteristics and commonality in gene expression patterns, and It refers to a series of related genes that are recognized as one gene family based on their similarity in biological function, and naturally includes alleles (alleles) of the PCA2501 gene.

 The above-mentioned modification (mutation) of the amino acid sequence may occur in nature, for example, due to mutation or modification after translation. However, in the case of a naturally derived gene (for example, the human PCA2501 or human PCA2501 gene of the present invention), It can be artificially modified based on this. The present invention encompasses all modified genes having the above-mentioned properties, irrespective of the cause and means of such modification and mutation. The gene (human PCA2501 gene) of the present invention also includes an allele (allele) of a gene encoding a protein having the amino acid sequence represented by SEQ ID NO: 1.

 The above-mentioned artificial means include, for example, CytoSpecific Mutagenesis

[Methods in Enzymology, 154, 350, 367-382 (1987); 100, 468 (1983);

Nucleic Acids Res., 12, 9441 (1984);

II ", edited by The Biochemical Society of Japan, P105 (1986)], and chemical synthesis methods such as the triester phosphate method and the phosphate amidite method [; L Am. Chem. Soc, 89,

4801 (1967); id. 91, 3350 (1969); Science, 150, 178 (1968); Tetrahedron

Lett., 22, 1859 (1981); and 24, 245 (1983)) and methods of combining them. More specifically, DNA synthesis is performed by the phosphoramidite method or It can be carried out by a chemical synthesis by the triester method, or can be carried out on a commercially available automatic oligonucleotide synthesizer. Double-stranded fragments are chemically synthesized by synthesizing a complementary strand and either annealing the strand together under appropriate conditions, or adding a complementary strand using a DNA polymerase with the appropriate primer sequence. It can also be obtained from single stranded products.

 As a specific embodiment of the gene of the present invention, a gene having the base sequence shown in SEQ ID NO: 2 can be exemplified. The coding region in this nucleotide sequence shows one combination example of codons indicating each amino acid residue in the amino acid sequence shown in SEQ ID NO: 1. The gene of the present invention is not limited to a gene having such a specific base sequence, but may have a base sequence selected by combining arbitrary codons with each amino acid residue. Codons can be selected according to a conventional method, for example, considering the frequency of codon usage of the host to be used, CNcleic Acids Res., 9, 43 (1981)].

 As described above, the DNA molecule of the present invention also includes a DNA molecule having a certain homology with the base sequence shown in SEQ ID NO: 2.

 The above-mentioned homology refers to a polynucleotide having at least 70% identity, preferably at least 90% identity, more preferably at least 95% identity with the nucleotide sequence shown in SEQ ID NO: 2 and a polynucleotide complementary thereto. To tell.

 Such genes include, for example, those set forth in SEQ ID NO: 2 under stringent conditions of 50 ° C in 0.2XS SC containing 0.1% SDS or 60 ° C in 1XS SC containing 0.1% SDS. A gene having a base sequence that hybridizes with DNA consisting of a base sequence to be used can also be exemplified.

The gene of the present invention can be easily produced and obtained by general genetic engineering techniques on the basis of sequence information on specific examples of the gene of the present invention disclosed by the present invention [Molecular Cloning 2d Ed, Cold Spring Harbor Lab. Press (1989); See Sequential Chemistry Laboratory Course "Gene Research Methods I, II and III", edited by The Biochemical Society of Japan (1986)]. Specifically, from an appropriate source for expressing the gene of the present invention, c A DNA library can be prepared and the desired clone can be selected from the library using an appropriate probe or antibody specific to the gene of the present invention (Proc. Natl. Acad. Sc USA., 78, 6613 ( 1981); Science, 222, 778 (1983) and the like]. In the above, examples of the origin of cDNA include various cells and tissues expressing the gene of the present invention, and cultured cells derived therefrom. Separation of total RNA therefrom, isolation and purification of mRNA, acquisition of cDNA, and cloning thereof can all be carried out in accordance with conventional methods. In addition, cDNA libraries are commercially available. In the present invention, cDNA libraries such as various cDNA libraries commercially available from Clontech Lab. Inc. and the like are used. Can also.

 The method for screening the gene of the present invention from a cDNA library is not particularly limited, either, and ordinary methods can be followed. Specifically, for example, for a protein produced by cDNA, a method of selecting a corresponding cDNA clone by immunoscreening using a specific antibody of the protein, a method of selectively selecting a target DNA sequence Examples include plaque hybridization, colony hybridization using a probe to be bound, and a combination thereof.

 As the probe used here, DNA or the like chemically synthesized based on the information on the nucleotide sequence of the gene of the present invention can be generally used, but the gene of the present invention or a fragment thereof which has already been obtained can also be used favorably. it can. In addition, sense primers and antisense primers set based on the nucleotide sequence information of the gene of the present invention can also be used as screening probes.

 The nucleotide sequence used as the probe is a partial nucleotide sequence corresponding to SEQ ID NO: 2, and has at least 15 consecutive bases, preferably 2

0 contiguous bases, more preferably 30 contiguous bases, most preferably 5

A probe having 0 consecutive bases is also included, or a positive clone having the above sequence itself can be used as a probe. In obtaining the gene of the present invention, a DNAZRNA amplification method by a PCR method [Science, 230, 1350 (1985)] can be suitably used. In particular, when it is difficult to obtain full-length cDNA from the library, the RACE method (Rapid amplification of cDNA ends; Experimental Medicine, 12 (6), 35 (1994)), especially the 5'-RACE method [ Natl. Acad. Sci., USA., 8, 8998 (1988)].

 Primers to be used when employing such a PCR method can be appropriately set based on the sequence information of the gene of the present invention revealed by the present invention, and can be synthesized according to a conventional method. In addition, isolation and purification of the amplified DNAZRNA fragment can be performed by a conventional method as described above, for example, by gel electrophoresis.

 The gene or various DNA fragments of the present invention obtained as described above can be prepared by a conventional method, for example, the dideoxy method OProc. Natl. Acad. Sci., USA., 74, 5463 (1977)] or the Maxam-Gilbert method CMethods in Enzymology, 65, 499 (1980)], or simply using a commercially available sequence kit or the like.

 According to the gene of the present invention thus obtained, for example, the presence or absence of the expression of the gene of the present invention in an individual or various tissues can be specifically detected by utilizing a part or all of the nucleotide sequence of the gene. be able to.

 Such detection can be performed by a conventional method, for example, RT-PCR [Reverse transcribed-Polymerase chain reaction; E. S. Kawasaki, et al.,

Amplification of RNA.In PCR Protocol, A Guide to methods and applications, Academic Press, Inc., SanDiego, 21-27 (1991) 3 RNA amplification and Northern blotting analysis (Molecular Cloning, Cold Spring Harbor

Lab. (1989)], in situ RT—PCR [Nucl. Acids Res., 21, 3159-3166

(1993)), cell-level measurement using in situ hybridization, etc., NASBA method [Nucleic acid sequence-based amplification, Nature, 350, 91-92 (1991) 3 and various other methods. Preferably, a detection method by RT-PCR can be mentioned.

 The primers used in the case of employing the PCR method are not particularly limited as long as they are specific to the gene of the present invention and can specifically amplify only the gene of the present invention. And can be set appropriately. Usually, primers include those having a partial sequence of the gene of the present invention having a length of about 10 to 35 nucleotides, preferably about 15 to 30 nucleotides. As described above, the gene of the present invention also includes a DNA fragment used as a specific primer and / or a specific probe for detecting the PCA2501 gene according to the present invention.

 The DNA fragment can be defined as DNA characterized in that it hybridizes under stringent conditions to DNA consisting of the nucleotide sequence shown in SEQ ID NO: 2. Here, examples of the stringent conditions include ordinary conditions used as a primer or a probe, and are not particularly limited, and include, for example, 0.2% SDS containing 0.1% SDS as described above. An example is a condition of 50 ° C or a condition of 60 ° C in 33 ° per one hour containing 0.1% 303. According to the PCA2501 gene of the present invention, the gene product (PCA2501 protein) or a protein containing the gene product can be easily and stably produced in a large amount by using ordinary genetic engineering techniques.

 Accordingly, the present invention relates to a protein such as a PCA2501 protein encoded by the gene of the present invention, a vector for producing the protein, for example, a vector containing the gene of the present invention, a host cell transformed with the vector, The present invention also provides a method for producing the protein of the present invention by culturing the host cell.

 A specific embodiment of the protein of the present invention has the amino acid sequence shown in SEQ ID NO: 1.

PCA2501 protein may be mentioned, and the protein of the present invention includes the PCA2

Not only the 501 protein but also its homologues are included. Such homologues include In the amino acid sequence shown in SEQ ID NO: 1, there may be mentioned a protein having an amino acid sequence in which one or several or a plurality of amino acids are deleted, substituted or added, and having the above-mentioned activity of PCA2501. Here, the PCA2501 activity refers to dopamine 1, dopamine 2, noradrenaline, and seroto in the brain based on the overexpression of the PCA2501 gene. Excessive activity of sympathetic stimulants such as acetylcholine (5-HT), acetylcholine, etc., receptor stimulating activity of sympathetic neurotransmitter receptors, and activity of these neurotransmitters to cause impaired transmission can be exemplified. Specific examples include gene products of homologues of the PCA2501 gene (PCA2501-equivalent genes including alleles).

 In addition, homologs of the PCA2501 protein of the present invention include mammals, such as humans, pests, higgies, pests, dogs, monkeys, which have the same activity as the PCA2501 protein having the amino acid sequence shown in SEQ ID NO: 1. It also includes rodent proteins such as cats, bears, rats, and egrets.

 The protein of the present invention can be obtained by a conventional gene recombination technique [for example, Science, 224, 1431 (1984); Biochem. Biophys. Res. Comm., Based on the PCA2501 gene sequence information provided by the present invention. 130, 692 (1985); Proc. Natl. Acad. Sci., USA., 80, 5990 (1983), etc.].

 More specifically, the production of the protein is carried out by preparing a recombinant DNA (expression vector) capable of expressing the gene encoding the desired protein in a host cell, introducing this into a host cell, and transforming the host. This is carried out by culturing the transformant and then recovering the resulting culture.

 Both prokaryote and eukaryote can be used as the host cell.Examples of prokaryote hosts include a wide range of commonly used hosts such as Escherichia coli and Bacillus subtilis. Escherichia Kori among others

(Escherichia coli) K12 strain can be exemplified. In addition, eukaryotic host cells include cells of vertebrates, yeast, and the like. COS cells [Cell, 23: 175 (1981)] and Chinese hamster ovary cells and their dihydrofolate reductase-deficient strains [Pro Natl. Acad. Sci., USA., 77: 4216 (1980) As the latter, Saccharomyces yeast cells and the like are preferably used. Of course, it is not limited to these.

 When a prokaryotic cell is used as a host, a promoter capable of expressing the gene of the present invention in this vector using a vector capable of replicating in the host cell is used to promote the promoter and the SD (Shine). ········································ Drug and an expression plasmid that is provided with a base sequence and an initiation codon (eg, ATG) necessary for initiation of protein synthesis. As the vector, a plasmid derived from Escherichia coli, for example, pBR322, pBR325, pUC12, pUC13, etc., is often used. However, the present invention is not limited thereto, and various known vectors can be used. Examples of commercial products of the above vector used in an expression system using Escherichia coli include, for example, pGEX-4T (Amers am Pharmacia Biotech II) pMAL-C2, pMA1-P2 (New England Biolabs) , PET21, pET21 / 1 acq (Invitrogen), pBAD / His (Invitrogen) and the like.

 When a vertebrate cell is used as a host, the expression vector usually includes a promoter, an RNA splice site, a polyadenylation site, and a transcription termination sequence located upstream of the gene of the present invention to be expressed. It may also have a replication origin if desired. Specific examples of the expression vector include, for example, pSV2dhfr (Mol.Cell.

Biol., 1: 854 (1981)]. In addition to the above, various known sales vectors can be used. Commercially available such vectors used in expression systems using animal cells include, for example, pEGFP-N, pEGFP-C (Clontech), pIND (Invitrogen), pcDNA3.1 / H animal cell vectors such as is (Invitrogen), pFast Bac HT (GibcoBRL), pAc GHL

T (PharMingen), pAc 5 / V5-H is, pMT / V 5 -H is, pMT And insect cell vectors such as / Bip / V 5-his (all from Invitrogen).

 A specific example of an expression vector when a yeast cell is used as a host is, for example, PAM82 having a promoter for an acid phosphatase gene (Proc. Natl. Acad. Sci., USA., 80: 1 (1983) And the like. Commercially available expression vectors for yeast cells include, for example, pPICZ (Invitrogen) and pPICZ (Invitrogen).

No particular limitation is imposed on the promoter. When Escherichia genus is used as a host, for example, tryptophan (trp) promoter, 、 ρρ promoter, lac promoter, recA promoter, PLZPR promoter and the like can be preferably used. When the host is Bacillus, SP 0 1 promoter one, SP 0 2 flops port motor - and p _en p promoter are preferred. When yeast is used as a host, for example, a pHO5 promoter, a pgk promoter, a GAP promoter, an ADH promoter and the like can be suitably used. When animal cells are used as a host, preferred promoters include SV40-derived promoters, retrovirus promoters, metamouth thionein promoters, heat shock promoters, cytomegalovirus promoters, and SR promoters. The CK promoter can be exemplified.

 As a vector for expressing the gene of the present invention, a normal fusion protein expression vector can also be preferably used. Specific examples of the vector include pGEX (Promega) for expression as a fusion protein with dalhithion-S-transferase'ase (GST).

In addition, examples of the polynucleotide sequence whose coding sequence of the mature polypeptide assists the expression and secretion of the polypeptide from a host cell include a secretory sequence and a leader sequence, and are used for purification of a fusion mature polypeptide from a bacterial host. Marker sequence (hexahistidine 'tag, histidine' tag), and in the case of mammalian cells, hemagglutinin (HA) · Illustrate tags.

 A method for introducing a desired recombinant DNA (expression vector) into a host cell and a method for transforming the same are not particularly limited, and various general methods can be employed.

 The resulting transformant can be cultured according to a conventional method, and the target protein of the present invention encoded by a gene designed as desired by the culture is expressed in the transformant, outside the cell or on the cell membrane of the transformant. Produced (accumulated, secreted).

 As the medium used for the cultivation, various types of media commonly used depending on the host cells used can be appropriately selected and used, and the cultivation can be carried out under conditions suitable for the growth of the host cells. The recombinant protein of the present invention thus obtained can be subjected to various separation operations utilizing its physical properties, chemical properties, and the like [“Biochemical Data Book II”, pp. 1175-1259, 1st edition, 1st edition, if desired. Press, June 23, 1980, issued by Tokyo Chemical Dojin, Ltd .; see Biochemistry, 25 (25), 8274 (1986); Eur. J. Biochem., 163, 313 (1987), etc.). .

 Specific examples of the method include ordinary reconstitution treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic shock method, ultrasonic crushing, ultrafiltration, molecular sieve chromatography (gel filtration). , Adsorption chromatography, ion-symmetry chromatography, affinity chromatography, various liquid chromatography such as high performance liquid chromatography (HPLC), dialysis method, and combinations thereof. Affinity chromatography using a column to which a specific antibody against a protein is bound can be exemplified. In designing a desired gene encoding the protein of the present invention, the nucleotide sequence of the PCA2501 gene shown in SEQ ID NO: 2 can be used favorably. As the gene, a codon indicating each amino acid residue can be appropriately selected and changed as needed for use.

In the amino acid sequence encoded by the PCA2501 gene, When the amino acid residue or amino acid sequence is modified by substitution, deletion, addition or the like, it can be carried out by the above-mentioned various methods such as cytosolic mugenesis.

 The protein of the present invention can be produced by a general chemical synthesis method according to the amino acid sequence shown in SEQ ID NO: 1. The method includes a method for synthesizing a peptide by a usual liquid phase method and a solid phase method.

 More specifically, the peptide synthesis method includes a so-called stepwise gelation method in which amino acids are sequentially linked one by one based on amino acid sequence information to extend the chain, and a fragment comprising several amino acids. And a fragment condensation method in which each fragment is then subjected to a coupling reaction. The synthesis of the protein of the present invention may be performed by any of these methods.

 The condensation method employed in the above peptide synthesis can also be in accordance with a conventional method, for example, an azide method, a mixed acid anhydride method, a DCC method, an active ester method, a redox method, a DPPA (diphenyl phosphoryl azide) method, DCC + additive (1-hydroxybenzotriazole, N-hydroxysuccinamide, N-hydroxy-15-norpolneno, -2,3-dicarpoxyimide, etc.) method, Woodward method and the like can be exemplified. The solvent that can be used in each of these methods can also be appropriately selected from well-known general ones used in this kind of peptide condensation reaction. Examples thereof include dimethylformamide (DMF;), dimethylsulfoxide (DMS〇), hexaphosphoramide, dioxane, tetrahydrofuran (THF), ethyl acetate and the like, and a mixed solvent thereof.

In the above-mentioned peptide synthesis reaction, the hepoxyl group in the amino acid or peptide not involved in the reaction is generally converted into a lower alkyl ester such as a methyl ester, an ethyl ester or a tertiary butyl ester by esterification, for example, a benzyl ester, ρ- It can be protected as aralkyl esters such as methoxybenzyl ester and p-nitrobenzyl ester. In addition, the amino acid having a functional group in the side chain, for example, the hydroxyl group of a tyrosine residue may be protected with an acetyl group, a benzyl group, a benzyloxycarbonyl group, a tertiary butyl group, etc., but such protection is not always required. No need to do. Further, for example, the guanidino group of an arginine residue includes a nitro group, a tosyl group, a p-methoxybenzenesulfonyl group, a methylene-12-sulfonyl group, a benzyloxycarbonyl group, an isoporyloxycarbonyl group, and an adamantyl. It can be protected by a suitable protecting group such as an oxycarbonyl group.

 The deprotection reaction of these protecting groups in the amino acids and peptides having the above protecting groups and the finally obtained protein of the present invention can also be carried out by commonly used methods such as catalytic reduction method, liquid ammonia / sodium, hydrogen fluoride, bromide, etc. It can be carried out according to a method using hydrogen, hydrogen chloride, trifluoroacetic acid, acetic acid, formic acid, methanesulfonic acid and the like.

 The protein of the present invention thus obtained is appropriately purified according to the above-mentioned various methods, for example, a method widely used in the field of peptide chemistry such as ion-exchange resin, partition chromatography, gel chromatography, and countercurrent partition method. It can be carried out.

 The PCA2501 protein of the present invention can be suitably used as an immunizing antigen for producing a specific antibody thereof. By using this antigen, a desired antiserum (polyclonal antibody) and monoclonal antibody can be used. An antibody can be obtained.

 The method of producing the antibody itself is well understood by those skilled in the art, and the present invention can also follow these conventional methods [for example, in the Seismic Chemistry Laboratory Course “Research Methods for Immunobiochemistry”, (Ed. By the Society (1986)).

The antibody thus obtained can be advantageously used, for example, for purification of the PCA2501 protein and for its determination by immunological techniques without discrimination. More specifically, since amplification and enhanced expression of the gene of the present invention have been confirmed in a blood sample of a schizophrenic patient, the antibody can be used to diagnose schizophrenia or schizophrenia. Can be used to determine the degree of progress. The PCA2501 antibody of the present invention obtained as described above is useful in the pharmaceutical field as a pharmaceutical containing the PCA2501 antibody as an active ingredient. Therefore, the present invention also provides a pharmaceutical composition comprising the PCA2501 antibody of the present invention as an active ingredient.

 As described above, the usefulness of the PCA2501 antibody of the present invention as a medicine is, as described above, an overproduction effect of a sympathetic stimulant possessed by a specific polypeptide of a schizophrenic patient, and a receptor of a sympathetic neurotransmitter receptor. Examples of the action include an abnormal body stimulating action and an active action of suppressing or reducing a disorder caused by a neurotransmitter transmission disorder. Confirmation of these antibody activities can be confirmed by a usual immunological antigen-antibody reaction test.

 The protein as an active ingredient in the pharmaceutical composition also includes a pharmaceutically acceptable salt thereof. Such salts include non-toxic alkali metal salts such as sodium, potassium, lithium, calcium, magnesium, barium, ammonium, alkaline earth metal salts, ammonium salts, etc., prepared by methods well known in the art. Included. Further, the above salts also include non-toxic acid addition salts obtained by reacting the protein of the present invention with an appropriate organic or inorganic acid. Representative non-toxic acid addition salts include, for example, hydrochloride, hydrochloride, hydrobromide, sulfate, bisulfate, acetate, oxalate, valerate, oleate, laurate, Borate, benzoate, lactate, phosphate, p-toluenesulfonate (tosylate), citrate, maleate, fumarate, succinate, tartrate, sulfonate, glycolic acid Salts, maleates, ascorbates, benzenesulfonates and napsylates are exemplified.

 The above-mentioned pharmaceutical compositions include those containing the protein of the present invention as an active ingredient and a pharmaceutically effective amount thereof together with a suitable non-toxic pharmaceutical carrier or diluent.

Pharmaceutical carriers that can be used in the above pharmaceutical composition (pharmaceutical formulation) include fillers, bulking agents, binders, humectants, disintegrants, surfactants, and lubricants that are usually used depending on the use form of the formulation For example, diluents or excipients such as a preparation can be exemplified. It is appropriately selected and used depending on the given unit form.

 Particularly preferred pharmaceutical preparations of the present invention include various components which can be used in ordinary protein preparations, such as stabilizers, bactericides, buffers, isotonic agents, chelating agents, pH regulators, surfactants It is prepared by using such as appropriate.

 Examples of the stabilizer include human serum albumin, ordinary L-amino acids, saccharides, and cellulose derivatives. These can be used alone or in combination with a surfactant. In particular, according to this combination, there are cases where the stability of the active ingredient can be further improved.

 The L-amino acid is not particularly limited, and may be, for example, any of glycine, cysteine, and glumic acid.

 There is no particular limitation on the above-mentioned sugars, and for example, monosaccharides such as glucose, mannose, galactose and fructose, sugar alcohols such as mannitol, inositol and xylitol, disaccharides such as sucrose, maltose and lactose, dextran, hydroxypropyl starch And polysaccharides such as chondroitin sulfate and hyaluronic acid, and derivatives thereof.

 The surfactant is not particularly limited, and both ionic and nonionic surfactants can be used. For example, polyoxyethylene glycol sorbitan alkyl ester, polyoxyethylene alkyl ether, sorbitan monoester Or fatty acid glyceride.

 There is no particular limitation on the cellulose derivative, and methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose and the like can be used.

The amount of the saccharide to be added is about 0.001 mg or more per l ^ g of the active ingredient, and preferably about 0.01 to 1 Omg. The amount of the surfactant added is about 0.001 mg or more, preferably about 0.01 mg, per 1 g of the active ingredient. It is appropriate that the range is about 0001 to 0.0 lmg. The amount of human serum albumin to be added is about 0.001 mg or more, preferably about 0.001 to 0.1 mg per tg of the active ingredient. The amino acid is suitably used in an amount of about 0.001 to 1 Omg per 18 active ingredients. The amount of the cellulose derivative to be added is suitably about 0.000 lmg or more, preferably about 0.001 to 0.1 mg per 1 g of the active ingredient.

 The amount of the active ingredient contained in the pharmaceutical preparation of the present invention is appropriately selected from a wide range, but is usually about 0.0001 to 70% by weight, preferably about 0.0001 to 5% by weight. is there.

 Further, various additives such as a buffer, an isotonic agent, a chelating agent and the like can be added to the pharmaceutical preparation of the present invention. As the buffer, boric acid, phosphoric acid, acetic acid, citric acid, ε-aminocaproic acid, glutamic acid and / or a salt thereof (for example, sodium salt, potassium salt, calcium salt, magnesium salt) Alkali metal salts such as salts and alkaline earth metal salts). Examples of the isotonic agent include sodium chloride, potassium chloride, saccharides, glycerin and the like. Examples of the chelating agent include sodium edetate and citric acid.

 The pharmaceutical preparation of the present invention can be used not only as a solution preparation, but also by lyophilizing it to make it storable, dissolving it in a buffer solution containing water for use, a saline solution, or the like, at an appropriate concentration. It is also possible to use it after preparing it.

As the dosage unit form of the pharmaceutical preparation of the present invention, various forms can be selected according to the purpose of treatment, and typical examples are tablets, pills, powders, powders, granules, capsules and the like. Solid dosage forms, and liquid dosage forms such as solutions, suspensions, emulsions, syrups, and elixirs, depending on the route of administration. These also include oral, parenteral, nasal, vaginal, and suppository forms. Preparations, sublingual preparations, ointments and the like, and can be prepared, molded or prepared according to the usual methods. For example, in the case of molding into a tablet form, the above-mentioned preparation carrier may be, for example, lactose, sucrose, sodium chloride, glucose, urea, starch, calcium carbonate, kaolin, crystalline cellulose, caiiic acid, potassium phosphate, etc., water, etc. Binders such as ethanol, propanol, simple syrup, glucose solution, starch solution, gelatin solution, propyloxymethylcellulose, hydroxypropylcellulose, methylcellulose, polyvinylpyrrolidone, sodium carboxymethylcellulose, carboxymethylcellulose calcium, low substitution degree Disintegrators such as hydroxypropylcellulose, dried starch, sodium alginate, powdered agar, powdered laminar, sodium hydrogencarbonate, calcium carbonate, polyoxyethylene sorbitan fat Surfactants such as acid esters, sodium lauryl sulfate, and monoglyceride stearate; crushing inhibitors such as sucrose, stearin, cocoa batata, and hydrogenated oil; quaternary ammonium bases; and absorption promoters such as quaternary ammonium base and sodium lauryl sulfate Uses humectants such as glycerin and starch, adsorbents such as starch, lactose, kaolin, bentonite, and colloidal acid, lubricants such as purified talc, stearates, boric acid powder, polyethylene glycol, etc. it can.

 Further, the tablets can be tablets coated with a usual coating as required, such as sugar-coated tablets, gelatin-coated tablets, enteric-coated tablets, film-coated tablets, and double tablets or multilayer tablets. it can.

 In the case of molding into pill form, as a pharmaceutical carrier, excipients such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, kaolin, talc, etc., binders such as gum arabic powder, tragacanth powder, gelatin, ethanol, etc. , Laminaran, agar and other disintegrating agents can be used.

Capsules are usually prepared by mixing the active ingredient of the present invention with the various pharmaceutical carriers exemplified above and filling the mixture into hard gelatin capsules, soft capsules and the like according to a conventional method. Liquid dosage forms for oral administration include pharmaceutically acceptable solutions including conventional inert diluents such as water, emulsions, suspensions, syrups, elixirs and the like. In addition, auxiliaries such as wetting agents, emulsions, and suspending agents can be added, and these are prepared according to a conventional method.

 For preparing liquid dosage forms for parenteral administration such as sterile aqueous to non-aqueous solutions, emulsions and suspensions, diluents such as water, ethyl alcohol, propylene glycol, polyethylene glycol, ethoxylated isostearyl Vegetable oils such as alcohol, polyoxylated isostearyl alcohol, polyoxyethylene sorbitan fatty acid ester and olive oil can be used, and injectable organic esters such as ethyl oleate can be blended. These may further contain conventional solubilizers, buffers, wetting agents, emulsifiers, suspending agents, preservatives, dispersants, and the like.

 Sterilization can be performed by, for example, a filtration operation of passing through a bacteria-retaining filter, combination of a bactericide, irradiation treatment, and heat treatment. They can also be prepared in the form of sterile solid compositions which can be dissolved in sterile water or a suitable sterilizable medium immediately before use.

 For shaping in the form of suppositories or preparations for vaginal administration, preparation carriers such as polyethylene glycol, cocoa butter, higher alcohols, esters of higher alcohols, gelatin and semisynthetic dalyceride can be used.

 When forming into ointments such as pastes, creams and gels, diluents such as white petrolatum, paraffin, glycerin, cellulose derivatives, propylene glycol, polyethylene glycol, silicon, bentonite and oil of olive oil Vegetable oils and the like can be used.

 The composition for nasal or sublingual administration can be prepared according to a conventional method using well-known standard excipients.

 The drug of the present invention may contain a coloring agent, a preservative, a fragrance, a flavoring agent, a sweetening agent, and other pharmaceuticals, if necessary.

There are no particular restrictions on the method of administration of the above pharmaceutical preparations, various formulation forms, patient age, sex It is determined according to other conditions and the degree of the disease. For example, tablets, pills, solutions, suspensions, emulsions, granules and capsules are administered orally, injections are administered intravenously alone or in admixture with normal replenishers such as glucose and amino acids. Intramuscularly, intradermally, subcutaneously or intraperitoneally, suppositories are administered rectally, vaginal agents are administered intravaginally, nasal agents are administered intranasally, and sublingual agents are administered orally Ointments are topically administered transdermally.

 The amount of the active ingredient to be contained in the above pharmaceutical preparation and the dose thereof are not particularly limited, and may vary widely depending on the desired therapeutic effect, administration method, treatment period, patient age, gender and other conditions. It is appropriately selected. In general, the dose is usually about 0.01 g to 10 mg, preferably about 0.1 ng to 1 mg per kg of body weight per day. Can be administered in one or several divided doses per day.

 In addition, as shown in Examples described later, the gene of the present invention is highly expressed in the peripheral blood of schizophrenic patients, so that the whole or part of the antisense strand of the PCA2501 gene of the present invention is expressed. By constructing an arbitrary gene expression vector including the following, and forcibly expressing the expression vector in these tissues, dopamine 2 and dopamine 2 in the brain based on overexpression of the PCA2501 gene Causes excessive production of sympathetic stimulants such as noradrenaline, serotonin (5-HT), and acetylcholine, causes stimulatory activity of sympathetic neurotransmitter receptors, or causes impairment of transmission of these neurotransmitters Suppresses activity and consequently improves functional findings such as neuropsychiatric symptoms, motor function, endocrine function, etc. in schizophrenic patients As gene therapy composition having ability antipsychotic activity or anti-P C A 2 5 0 1 activity, or considered to be utilized as a gene therapy agent.

Accordingly, the present invention provides a gene therapy vector containing the whole or part of the antisense strand of the PCA2501 gene, and a cell into which the antisense strand of the PCA2501 gene has been introduced using the vector as an active ingredient. To provide medical supplies It is.

 That is, according to the present invention, the vector for gene therapy introduction comprising the antisense strand of the PCA2501 gene containing all or a part of the nucleotide sequence represented by SEQ ID NO: 2 and the PCA2501 gene antisense strand And a gene therapy agent comprising, as an active ingredient, a cell into which PCA2501 gene antisense strand has been introduced, and a cell into which PCA2501 gene antisense strand has been introduced by the vector and the vector for gene therapy. In addition, according to the present invention, the PCA2501 gene containing the antisense strand of the PCA2501 gene containing the whole or part of the nucleotide sequence of SEQ ID NO: 2 By administering cells into which antisense chains have been introduced into the brain of a schizophrenic patient or to the vascular tissue site of the patient, the overactive activity of sympathetic stimulants in these tissues, the receptor for the sympathetic neurotransmitter receptor A treatment for schizophrenia characterized by suppressing the stimulating activity or the activity of impairing the transmission of these neurotransmitters or suppressing the expression level of the PCA2501 gene in these cells, and a PCA2501 activity inhibitor or antipsychotic drug Can be provided.

 Furthermore, according to the present invention, there is provided a medicine containing, as an active ingredient, a viral vector for gene therapy introduction containing the PCA2501 gene antisense chain, in particular, an effect of overproducing PCA2501 activity or a sympathomimetic substance. The present invention also provides a medicament for use in a treatment for suppressing a receptor stimulating activity of a sympathetic neurotransmitter receptor or a transmission impairment activity of these neurotransmitters.

 Hereinafter, the gene therapy will be described in detail. Unless otherwise specified, conventional methods of chemistry, molecular biology, microbiology, recombinant DNA, genetics, and immunology can be used in the following gene therapy. These are, for example, Maniatis, T., et al., Molecular cloning: A laboratory manual (Cold

Spring Harbor Laboratory, Cold Spring Harbor, New York (1982)), Sambrook, J., et al., Molecular cloning: A laboratory manual, 2nd Ed. (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1981)), Ausbel, FM., Et al., Current Protocols in Molecular Biology, John Wiley and Sons, New York, New York, (1992)), Glover, D., DNA Cloning, I and II (Oxford Press) (1985)), Anand, Techniques for the Analysis of Complex Genomes, (Academic Press (1992) ), Guthrie, G., et al., Guide to Yeast Genetics and Molecular Biology, (Academic Press) (1991)) and Fink, Fink, et al., Hum. Gene Ther., 3, 11-19 ( 1992).

 The present invention relates to a cell expressing the PCA2501 gene of the present invention, which has a sequence complementary to intracellular mRNA: an antisense drug for producing RNA, inhibiting translation and suppressing PCA2501 gene expression To provide a gene therapy method that suppresses the activity of PCA2501 activity or suppresses the overproduction of sympathetic stimulants, suppresses the activity of stimulating sympathetic neurotransmitter receptors, or suppresses the effects of these neurotransmitters on transmission disorders I do. The therapy may involve inhibiting the transcription or translation process, for example, by binding to the native mRNA of the PCA2501-expressing cell carrying the PCA2501 gene, or by intercalating between the DNA duplexes to form a triplex. This is a method for suppressing the expression of a target gene. For this purpose, it can be considered as a method for producing an antisense oligonucleotide complementary to the mRNA of the gene and supplying the antisense oligonucleotide to target cells.

 By providing such an action of suppressing the expression function of the PCA2501 gene, the PCA2501 activity in the recipient cell / target cell can be suppressed. The vector can be maintained outside the chromosome using a vector or a plasmid containing the antisense oligonucleotide, and introduced into a target cell.

According to the above antisense schizophrenia gene therapy using antisense oligonucleotides, retrovirus, adenovirus and AAV-derived vectors A desired inhibitory effect can be obtained by incorporating a sense oligonucleotide and infecting the cells expressing PCA2501 activity with this to overexpress the antisense oligonucleotide.

 When the antisense oligonucleotide is introduced into cells having the PCA2501 gene to suppress the expression of the PCA2501 protein, the antisense oligonucleotide does not need to correspond to the full length of the corresponding PCA2501 gene. For example, as long as the PCA2501 gene retains a function that is substantially the same as the function of suppressing the expression function of the PCA2501 gene, even if it is the above-described variant, it also uses a gene consisting of a partial sequence that retains a specific function. You can also.

 Vectors for the introduction of the desired gene for both recombination and extrachromosomal maintenance are already known in the art, and any of the known vectors can be used in the present invention. For example, a viral vector or a plasmid vector containing a copy of the antisense oligonucleotide of PCA2501 linked to an expression control element and capable of expressing the antisense oligonucleotide product in a target cell can be mentioned. it can. As such a vector, the above-mentioned expression vector can be usually used, but preferably, for example, as an origin vector, US Pat. No. 5,252,479 and PCT International Publication WO 93/07282 Using the disclosed vectors (such as pWP-7A, pwP-19, pWU-1, pWP-8A, pWP-21 and Z or pRSVL) or pRC / CMV (Invitrogen), etc. The prepared vector can be mentioned. More preferred are various virus vectors described below.

 As a promoter used in a vector used in gene transfer therapy, a promoter specific to an affected tissue to be treated for various diseases can be suitably used.

Specific examples include, for liver, albumin, -fetoprotein, 1-antitrypsin, transferrin, transstyrene, etc. Can be illustrated. For the colon, examples thereof include carboxylate anhydrase I and carcinoenprogen antigen. For the uterus and placenta, estrogen, aromatase cytochrome p450, cholesterol side chain cleavage P450, 17-alpha hydroxylase P450 and the like can be exemplified.

 For the prostate, prostate antigen, gp91-fox gene, prostate-specific kallikrein and the like can be exemplified. For the breast, erb-B2, erb_B3, / 3-casein, 3-lactoglobin, whey protein and the like can be exemplified. For the lung, the activator protein C-globulin can be exemplified. For skin, examples include K-141-keratin, human keratin 1 or 6, and leucrin.

 For the brain, examples include glial fibrillary acidic protein, mature astrocyte specific protein, myelin basic protein, tyrosine hydroxylase, and the like. In the kidney, examples include villin, glucagon, and amyloid polypeptide of the islet of Langerhans. For the thyroid gland, thyroglobulin, calcitonin and the like can be exemplified. For bone, α-collagen, osteocalcin, bone sialoglycoprotein and the like can be exemplified. For the kidney, renin, liver, bone, kidney alkaline phosphatase, erythropoietin, etc., and for the kidney, amylase, PAP1, etc. can be exemplified.

 In the production of the antisense oligonucleotide introduction vector, the antisense oligonucleotide to be introduced (all or a part of the complementary sequence corresponding to the PCA2501 gene sequence) is determined based on the base sequence information of the PCA2501 gene of the present invention. As described above, it can be easily produced and obtained by general genetic engineering techniques.

The introduction of such antisense oligonucleotide introduction vectors into cells is already known in the art for introducing DN に into cells, including, for example, electorifice poration, calcium phosphate coprecipitation, virus transduction, etc. This can be done according to various methods. PCA2501 anti-sense- The cells transformed with the oligonucleotide can be used as a drug for suppressing PCA2501 activity in a state of isolation in itself, or as a model system for therapeutic research.

 In gene therapy, the antisense oligonucleotide introduction vector described above can be introduced into a patient's target cells by local or systemic injection into the target tissue site of the patient. it can. At this time, by systemic administration, it is possible to reach any cells that can express PCA250mRNA at other sites. If the transduced gene is not permanently incorporated into the chromosome of each target cell, this can be achieved by repeating the administration periodically.

 The gene therapy method of the present invention includes an in vivo method in which the material for introducing an antisense oligonucleotide (the vector for introducing an antisense oligonucleotide) described above is directly injected into the body. It includes both the ex vivo method, in which the target cell is once removed, the gene is introduced outside the body, and the cell is then returned to the body.

 In addition, gene therapy using lipozyme, which is an active molecule that cleaves an RNA chain by introducing an antisense oligonucleotide directly into PCA2501 into a cell, is also possible.

 A vector for gene transfer containing all or a fragment of an antisense oligonucleotide of a sequence corresponding to PCA2501 of the present invention, which will be described later, and a human PCA2501 being transformed by the vector into an antisense oligonucleotide. The gene therapy agent of the present invention containing the nucleotide-introduced cell as an active ingredient is particularly intended for schizophrenic patients, but the above-described gene therapy (treatment) is not limited to schizophrenic patients. Can also be used for the treatment of schizophrenia complications, as well as for gene labeling.

 In addition, target cells into which antisense oligonucleotides are introduced

(Measure) can be appropriately selected depending on the target. For example, as a target cell, In addition to brain and nervous tissue, brain cells, brain nerve cells, and cells of tissues where PCA2501 expression is observed, heart, placenta, lung, liver, spleen, spleen, small intestine, peripheral blood tissues, nerve cells, lymphocytes , Fibroblasts, hepatocytes, hematopoietic stem cells, and the like.

 The method of introducing antisense oligonucleotides in the above gene therapy includes a viral introduction method and a non-viral introduction method.

 An example of a viral introduction method includes a method using a retrovirus vector as a vector in consideration of the fact that PCA2501 is a foreign substance whose antisense oligonucleotide is expressed in normal cells. Other viral vectors include adenovirus vectors, HIV (human immunodeficiency virus) vectors, and adeno-associated virus vectors (AAV, adeno-associated virus), and simple virus-less virus (AAV, adeno-associated virus). HS V) vector and Epstein-Barr virus (EBV) vector.

 Non-viral gene transfer methods include calcium phosphate coprecipitation; fusion of ribosomes encapsulating DNA with inactivated Sendai virus whose genes have been disrupted in advance by ultraviolet light to produce membrane-fused ribosomes, which are directly fused with cell membranes. Membrane fusion ribosome method for introducing DNA into cells CKato,., Et al., J. Biol. Chem., 266, 22071-

22074 (1991)]; A method of coating plasmid DNA with gold and physically introducing the DNA into cells by high-pressure discharge [Yang, NS et al., Proc. Natl. Acad. Sci., 87 , 9568-9572 (1990)]; naked DNA method for injecting plasmid DNA directly into organs and tumors in vivo [Wolff, LA., Et al., Science, 247, 1465-1467 (1990) 3; Cationic ribosome method for introducing genes embedded in multi-layer positively charged ribosomes into cells [Kunio Yagi, History of Medicine,

Vol.175, No.9, 635-637 (1995)]; In order to introduce a gene only into a specific cell and prevent it from entering other cells, it binds to the receptor expressed in the target cell. Riga to do Ligand-DNA complex method for binding and administering DNA to DNA CFrindeis, et al., Trends Biotechnol., 11, 202 (1993); Miller, et al., FASEB J., 9, 190 (1995)] Etc. can be used.

 The above-described ligand-DNA complex method includes, for example, a method using asia ligand glycoprotein as a ligand targeting asia mouth glycoprotein receptor expressed by hepatocytes [Wu, et al., J. Biol. Cem., 266 , 14338 (1991); Ferkol, et al., FASEB J., 7, 1081-1091 (1993)) and a method using transferrin as a ligand targeting transferrin receptor strongly expressed in tumor cells [Wagner et al. al., Proc. Natl. Acad. Sci., USA., 87, 3410 (1990)].

 The gene transfer method used in the present invention may be a combination of various biological and physical gene transfer methods as described above. Examples of the method by the combination include a method of combining a plasmid DNA of a certain size with a polylysine-conjugated antibody specific to an adenovirus / hexon protein. According to the method, the antisense oligonucleotide of the present invention can be introduced by binding the obtained complex to an adenovirus vector and infecting the cell with the thus obtained trimolecular complex. This method allows for efficient binding, internalization, and endosome degradation before the DNA coupled to the adenovirus vector is damaged. In addition, the ribosome ZDNA complex can mediate gene transfer directly in vivo.

 Hereinafter, a specific method for producing a virus vector for introducing antisense oligonucleotides of the present invention and a method for introducing antisense oligonucleotides into target cells or target tissues will be described.

 The retroviral vector system consists of a viral vector and helper cells (packaging cells). The helper cells are the retroviral structural proteins g ag (structural protein in the virion), p o1 (reverse transcriptase), and e n

V (envelope protein) and other genes are expressed in advance, Say no cells. On the other hand, virus vectors have packaging signals and LTRs (long terminal repeats) but do not have structural genes such as gag, po1, and env required for virus replication. The packaging signal is a sequence that serves as a tag during the assembly of the virus particles. The selected gene (neo, hyg) and the desired introduced antisense oligonucleotide (PCA2501 corresponding to PCA2501) are integrated into the cloning site. A sense oligonucleotide or a fragment thereof) is inserted in place of the viral gene. Here, in order to obtain high-titer virus particles, it is important to make the insert as short as possible, widen the packaging signal including part of the gag gene, and avoid leaving the ATG of the gag gene. It is.

 By transferring vector DNA incorporating the desired PCA2501 into the antisense oligonucleotide into the helper cells, the viral structural proteins produced by the helper cells package the vector-genomic RNA and form virus particles. Secreted. After the virus particle as a recombinant virus infects target cells, the DNA reversely transcribed from the viral genome RNA is integrated into the cell nucleus, and the antisense gene inserted into the vector is expressed.

 As a method for increasing the efficiency of introduction of a desired gene, a method using a fragment containing a cell attachment domain of fibronectin, a heparin binding site and a junction segment CHanenberg, H., et al., Exp.Hemat., 23 , 747 (1995) 3. One of the vectors used in the retroviral vector system is, for example, a retrovirus CMcLachlin, JR, et al., Proc. Natl. Acad. Res. Molec. Biol., Derived from mouse leukemia virus. 38, 91-135 (1990)].

 The method of using an adenovirus vector will be described in detail. The production of the adenovirus vector is performed by the method of Noknell [Berkner, K.L., Curr.

Microbiol. Immunol., 158, 39-66 (1992)], Yasuhiro Setoguchi et al. [Setoguchi, Y., et al., Blood, 84, 2946-2953 (1994)], Hiromi Kaneka et al. [Experimental Medicine, 12, 28-34 (1994)], and Kena et al. [Ketner, G., et al., Proc. Natl. Acad. Sci., USA., 91, 6186-6190 (1994)].

 For example, to produce a non-competent adenovirus vector, the E1 and / or E3 gene region of the adenovirus early gene is first removed. Next, the desired exogenous gene expression unit (the desired introduced antisense oligonucleotide, ie, the PCA2501 of the present invention, the antisense oligonucleotide, a promoter for transcribing the antisense oligonucleotide). And a plasmid vector containing a portion of the adenovirus genome and a plasmid containing the adenovirus genome, for example, simultaneously transfected into 293 cells.ヱ I will do it. The vector of the present invention includes a desired PCA2501 antisense oligonucleotide by causing homologous recombination between the two and replacing the gene expression unit with E1. A non-competent adenovirus vector can be generated. In addition, a 3 'adenovirus vector having a terminal protein added thereto can be prepared by incorporating adenovirus genomic DNA into a cosmid vector. In addition, a YAC vector can also be used to construct a recombinant adenovirus vector.

 Briefly describing the production of the adeno-associated virus (AAV) vector, AAV was found to be a small virus contaminating the adenovirus culture system. It has been confirmed that there is a genus of parvovirus that grows autonomously in host cells without requiring a helper virus for virus replication and a genus of debendvirus that requires a helper virus. The AAV is a common virus that has a wide host range and infects various cells, and the viral genome has a linear single-stranded DNA of 468 bases in size.

It consists of A, and the 145 bases at both ends exist with a characteristic sequence called ITR (inverted terminal repeat). This part of the ITR serves as a replication origin and serves as a primer. Packaging to virus particles-staining of host cells The ITR is also essential for integration into chromosomal DNA. For viral proteins, the left half of the genome encodes a non-structural protein, a regulatory protein that regulates replication and transcription, Rep.

 Recombinant AAV can be prepared by utilizing the property of AAV to be integrated into chromosome DNA, and thus a desired gene transfer vector can be prepared. More specifically, this method first leaves the ITRs at both the 5 'and 3' ends of the wild-type AAV, and inserts the desired antisense oligonucleotide (PCA 2501 antisense oligonucleotide) between them. Create a plasmid (AAV vector plasmid). On the other hand, virus proteins required for virus replication and virus particle formation are supplied by another helper plasmid. It is necessary to ensure that there is no common base sequence between the two and that no wild-type virus is produced by genetic recombination. Thereafter, both plasmids are introduced by transfection into, for example, 293 cells, and further infected with adenovirus (or non-proliferative type when 293 cells are used) as a helper virus. Recombinant AAV is produced. Subsequently, since the recombinant AAV is present in the nucleus, the cells are recovered by freezing and thawing, and the contaminating adenovirus is inactivated by heating at 56 ° C. If necessary, the recombinant AAV is separated and concentrated by ultracentrifugation using cesium chloride. As described above, a desired recombinant AV for gene introduction can be obtained.

 The EBV vector can be produced, for example, according to the method of Shimizu et al. [Norio Shimizu, Cell Engineering, 14 (3), 280-287 (1995)].

 Briefly describing the production of the EBV vector for introducing an antisense oligonucleotide according to the present invention, Epstein-Barr virus (EBV) was derived from Burkitt's lymphoma in 1964 by Epstein et al. [Kieff, E. and Liebowitz, D .;

Virology, 2nd ed. Raven Press, New York, 1990, pp. 1889-1920]. To the EBV Has the activity of transforming cells, so a virus lacking this transforming activity must be prepared in order to use it as a vector for gene transfer. This can be done as follows.

 That is, first, the EBV genome near the target DNA into which the desired foreign gene is to be integrated is cloned. The DNA fragment of the exogenous gene and the drug resistance gene are then inserted into the vector to produce a recombinant virus. Next, the vector for recombinant virus production cut out with an appropriate restriction enzyme is transfected into EBV-positive Akata cells. Recombinant virus generated by homologous recombination can be recovered together with wild-type Akat EBV by stimulating virus production by anti-surface immunoglobulin treatment. By infecting this with EBV-negative Ak ata cells and selecting a resistant strain in the presence of the drug, Ak ata cells infected with only the desired recombinant virus free of wild-type EBV can be obtained. Furthermore, by inducing the virus activity into recombinant virus-infected Akta cells, a large amount of the desired recombinant viral vector can be produced.

 Production of a non-viral vector that introduces a desired antisense oligonucleotide into a target cell without using a recombinant viral vector can be performed, for example, by a gene transfer method using a membrane fusion liposome. In this method, membrane ribosomes (vesicles composed of lipid bilayer membranes) have a fusion activity with the cell membrane, thereby directly introducing the contents of liposomes into cells.

 Introduction of the antisense oligonucleotide by the membrane fusion ribosome can be performed, for example, by the method of Nakanishi et al. [Nakanishi, M., et al., Exp. Cell.

Res., 159, 399-499 (1985); Nakanishi, M., et al., Gene introduction into animal tissues.In Trends and Future Perspectives in Peptide and Protein

Drug Delivery (ed. By Lee, V.H. et al.)., Harwood Academic Publishers

Gmb. Amsterdam, 1995, pp. 337-349].

Hereinafter, a method of introducing an antisense oligonucleotide using the membrane fusion ribosome The outline is briefly described. That is, Sendai virus whose gene is inactivated by ultraviolet rays and ribosomes encapsulating polymer substances such as desired antisense oligonucleotides and expressed proteins are fused at 37 ° C. This membrane-fused ribosome has a structure called a pseudo or virus with a ribosome-derived cavity inside and a spike on the outside with the same spike as the virus envelope. After purification by sucrose density gradient centrifugation, the membrane fusion ribosome is adsorbed at 4 ° C to the target cultured cells or tissue cells. Then, at 37 ° C., the contents of the ribosome are introduced into the cells, and the desired antisense oligonucleotide can be introduced into the target cells. Here, as the lipid used as the ribosome, it is preferable to use a monolayer ribosome having a diameter of 30 O nm made of 50% (molar ratio) cholesterol, lecithin and a synthetic phospholipid having a negative charge.

 In addition, as a method for introducing an antisense oligonucleotide into a target cell using another ribosome, a method for introducing an antisense oligonucleotide using a cationic ribosome can be mentioned. This method can be carried out according to the method of Yagi et al. [Yagi, K., et al., BBRC, 196, 1042-1048 (1993)]. This method focuses on the fact that both the plasmid and the cell are negatively charged, giving a positive charge to both the inner and outer surfaces of the ribosome membrane, increasing plasmid uptake by static electricity and enhancing interaction with the cell. It is assumed that. The ribosome used here is a multilamellar large vesicles (MLV) with a positive charge, but large unilamellar vesicles (LUV) or small unilamellar ribosomes (LUV) are useful. It is also possible to introduce a desired antisense oligonucleotide by forming a complex with a plasmid using small unilamellar vesicles (SUV).

The method of preparing plasmid-embedded catholic MLV is summarized as follows.First, it is TMA (Na-trimethylammonioacetyl) -didodecyl-D-glutamate chloride), DLPC (dilauroyl phosphatidylcholine) and DOPE. Prepare a mouth-mouthed form solution (imM as lipid concentration) containing (dioleoyl pospatidylethanolamine) at a molar ratio of 1: 2: 2. Next, a total of 1 xmol of lipid is placed in a spicy test tube, and chloroform is removed under reduced pressure using a single-mouth evaporator to prepare a lipid thin film. Further, remove the form under the reduced pressure completely and dry. Then, add 0.5 ml of Dulbecco's phosphate buffered saline containing Mg and Ca containing 20 g of the plasmid for gene transfer, replace with nitrogen gas, and stir with a Portex mixer for 2 minutes. Thus, a plasmid-embedded cationic MLV suspension containing the desired antisense oligonucleotide can be obtained. As an example of using the plasmid-embedded catonic MLV obtained above as a gene therapy agent, for example, an expression plasmid incorporating an antisense oligonucleotide for expression in an amount of 0.6 g as a DNA amount in the above-described catonic MLV, A method of embedding liposomal lipid to a concentration of 3 Onmol, suspending it in 21 phosphate buffered saline, and administering it to target cells or patient tissues extracted from patients every other day Can be exemplified.

 By the way, gene therapy is defined in the Ministry of Health and Welfare guidelines as "administering a gene or a cell into which a gene is introduced into a human body for the purpose of treating a disease". However, the gene therapy in the present invention means, in addition to the definition of the guideline, the introduction of an antisense oligonucleotide characterized as a PCA2501 expression-suppressing antisense DNA of the PCA2501 antisense oligonucleotide into the aforementioned target cells. Not only the treatment of schizophrenia but also the introduction of a marker gene or cells transfected with a marker gene into the human body.

 In the gene therapy of the present invention, the method of introducing a desired gene into a target cell or target tissue typically includes two types of methods.

In the first method, after collecting target cells from a patient to be treated, the cells are cultured outside the body in the presence of, for example, interleukin-2 (IL-12), and retroviruses are added. This is a method (ex vivo method) of introducing the desired PCA2501 contained in a virus vector into an antisense oligonucleotide and then re-transplanting the obtained cells. It has been reported that the method is suitable for treating ADA deficiency, genetic diseases caused by defective genes, arteriosclerosis, cancer, AIDS, and the like.

 The second method is a direct gene transfer method in which the target antisense oligonucleotide (PCA2501 antisense oligonucleotide) is directly injected into the patient's brain or a target site such as lung, liver, or small intestine. Law).

 More specifically, the first method of the gene therapy is performed, for example, as follows. That is, mononuclear cells collected from a patient are collected from monocytes using a blood separator, and the collected cells are cultured for about 72 hours in an appropriate medium such as AIM-V medium in the presence of IL-12. A vector containing the antisense oligonucleotide to be introduced (PCA2501 antisense oligonucleotide) is added. To increase the transfection efficiency of antisense oligonucleotides, centrifuge at 32 ° C for 1 hour and 2500 rpm in the presence of prominin, then at 37 ° C under 10% CO2 For 24 hours. After repeating this operation several times, the cells are further cultured for 48 hours in an AIM-V medium or the like in the presence of IL-12, the cells are washed with physiological saline, the number of living cells is counted, and the antisense oligonucleotide The transfection efficiency can be measured by the in situ PCR or, for example, by measuring the degree of the desired antisense and oligonucleotide transfection by measuring the degree of the PCA 2501 activity if the desired target is -as in the present invention. Confirm. The degree of the activity is based on the PCA2501 activity, that is, based on overexpression of the PCA2501 gene, such as brain dopamine 1, dopamine 2, noradrenaline, serotonin (5-HT), acetylcholine, etc. The degree of the overproduction activity of the sympathetic stimulant, the activity of stimulating the sympathetic neurotransmitter receptor, and the activity of these neurotransmitters that cause the impaired transmission may be measured.

In addition, the safety level is checked by culturing bacteria and fungi in cultured cells, detecting the presence of mycoplasma infection, searching for endotoxin, etc. The cultured cells into which the effective dose of antisense oligonucleotide (PCA2501 antisense oligonucleotide) has been introduced are returned to the patient by intravenous drip. Gene therapy is performed by repeating such a method at intervals of, for example, weeks to several months.

Here, the dose of the viral vector is appropriately selected depending on the target cells to be introduced. In general, it is preferable to adopt a virus titer in a dose ranging from 1 × 10 ³ cfu to 1 × 10 ⁸ cfu for 1 × 10 ⁸ target cells, for example.

 As an alternative to the first method, a virus-producing cell containing a retroviral vector containing the desired antisense oligonucleotide (PCA2501 antisense oligonucleotide) is co-cultured with, for example, a patient's cell. It is also possible to adopt a method of introducing an antisense oligonucleotide (PCA2501 antisense oligonucleotide) into a cell.

 In the implementation of the second method (direct method) of gene therapy, the target antisense oligonucleotide (PCA2501 antisense oligonucleotide) is actually introduced by the gene transfer method, especially through preliminary experiments in vitro. Whether the desired treatment is based on the search for the vector gene cDNA by PCR or in situ PCR in advance, or the desired treatment based on the introduction of the desired antisense oligonucleotide (PCA2501 antisense oligonucleotide). It is desirable to confirm the effects such as an increase in specific activity, an increase in growth of target cells, and suppression of growth. When a viral vector is used, search for proliferative retroviruses by PCR method, measure reverse transcriptase activity, or monitor membrane protein (env) gene by PCR method. Needless to say, it is important to confirm the safety of antisense oligonucleotide introduction in gene therapy.

In the gene therapy method of the present invention, particularly when targeting schizophrenia or schizophrenia complications, for example, after collecting peripheral blood cells (PCA2501-expressing cells) from a patient, the enzyme After treatment, the cultured cells are established, and then introduced into peripheral blood cells (PCA2501-expressing cells) targeting the desired antisense oligonucleotide using, for example, a retrovirus. After screening for schizophrenia, the expression levels of IL-112 etc. are measured (in vivo), and then radiation treatment is performed to inoculate the patient's peripheral blood, lung, liver, small intestine or brain. One example is the treatment of complications.

 The present invention also provides, as an active ingredient, a cell into which the antisense oligonucleotide introduction vector or the intended antisense oligonucleotide (PCA2501 antisense oligonucleotide, etc.) of the present invention has been introduced. Or a pharmaceutical composition (gene therapeutic agent) containing a pharmaceutically effective amount of the compound and a suitable nontoxic pharmaceutical carrier or diluent.

 Pharmaceutical carriers that can be used in the pharmaceutical composition (pharmaceutical formulation) of the present invention include fillers, bulking agents, binders, humectants, disintegrants, surfactants, which are usually used according to the use form of the formulation. Diluents and excipients such as lubricants can be exemplified, and these can be appropriately selected and used depending on the dosage unit form of the obtained product.

 As the dosage unit form of the pharmaceutical preparation of the present invention, the above-mentioned preparation examples of the PCA2501 protein antibody preparation can be similarly mentioned, and it can be appropriately selected from various forms according to the purpose of treatment.

 For example, a pharmaceutical preparation containing the vector for introducing an antisense oligonucleotide of the present invention can be used in a form in which the vector is embedded in ribosomes or a virus containing a retrovirus vector containing a desired antisense oligonucleotide. Thus, it is prepared in the form of infected cultured cells.

These can be prepared in the form of a mixture in a phosphate buffered saline (PH 7.4), Ringer's solution, injection for intracellular composition, or a substance that enhances gene transfer efficiency such as protamine. It can also be prepared in such a form that it is administered together with it. There are no particular restrictions on the method of administration of the above pharmaceutical preparations, various formulation forms, patient age, sex It is determined according to other conditions and the degree of the disease.

 The amount of the active ingredient to be contained in the above pharmaceutical preparation and the dose thereof are not particularly limited, and may vary widely depending on the desired therapeutic effect, administration method, treatment period, patient age, gender and other conditions. It is appropriately selected.

In general, the dosage of the desired antisense O Rigo nucleotide-containing Leto Rowirusu base Kuta one as a pharmaceutical formulation per day of body weight l kg per, for example, about 1 X 10 ³ pfu mosquito et 1 X as mosquito-valent Retro Virus It should be about 10 ¹⁵ pfu. In the case of cells into which a desired antisense oligonucleotide for introduction has been introduced, it is appropriate to select from a range of about 1 × 10 ⁴ cells / body to about 1 × 10 ¹⁵ cells / Zbody.

 The preparation may be administered once or several times a day, or may be administered intermittently at intervals of one to several weeks. Preferably, it can be co-administered with a substance that enhances gene transfer efficiency, such as promin, or a preparation containing the same.

 When the gene therapy according to the present invention is applied to the treatment of schizophrenia, the above-mentioned various gene therapies can be appropriately combined (combined gene therapy). Pharmacotherapy, occupational therapy, etc. can be combined. Furthermore, the gene therapy of the present invention, including its safety, can be performed with reference to the guidelines of NIH [Recombinant DNA Advisory Committee, Human Gene Therapy, 4, 365-389 (1993)].

 According to the present invention, in order to detect the presence of the PCA2501 gene, a biological sample such as a tissue or a body fluid (for example, blood or serum) is prepared, and if necessary, nucleic acid is extracted to detect the presence of the PCA2501 gene. It is possible to analyze whether or not. The detection method includes, for example, preparing a PCA2501 DNA fragment,

Designed to be used for screening and / or amplification of 2501 genes. More specifically, for example, in plaque hybridization, colony hybridization, Southern plotting, Northern plotting, etc. It has properties as a probe, and as a probe to be able to obtain all or a part of the amplified DNA fragment of PCA2501 by polymerase chain reaction (PCR) that amplifies nucleic acid sequence with polymerase. Can create something with properties. For this purpose, first, a primer having the same sequence as PCA2501 is prepared, used as a screening probe, and reacted with a biological sample (nucleic acid sample) to confirm the presence of the gene having the PCA2501 sequence. Wear. The nucleic acid sample may be prepared by various methods that facilitate detection of the target sequence, for example, denaturation, restriction digestion, electrophoresis or dot blotting.

 As the screening method, the PCR method is particularly preferred in terms of sensitivity. The method is not particularly limited as long as the method uses the PCA2501 fragment as a primer. , 1350-1354 (1985)) and a newly developed or future modified PCR method (Yoshiyuki Sakaki, et al., Ed., Yodosha, Experimental Medicine, extra edition, 8 (9) (1990); Proteins and nucleic acids · Enzymes, extra editions, Kyoritsu Shuppan Co., Ltd., '35 (17) (1990)) can be used.

The DNA fragment used as a primer is a chemically synthesized oligo DNA, and these oligo DNAs are synthesized using an automatic DNA synthesizer or the like, for example, a DNA synthesizer (Pharmacia LKB Gene Assembler Plus: manufactured by Pharmacia). can do. The length of the synthesized primer (sense primer or antisense primer) is preferably about 10 to 30 nucleotides. A probe used for the above-mentioned screening is usually a labeled probe, but may be unlabeled or may be detected by specific binding to a directly or indirectly labeled ligand. Suitable labels, as well as methods for labeling probes and ligands, are known in the art and can be incorporated by known methods, such as nick translation, random priming, or kinase treatment. These techniques include radioactive labels, biotin, fluorescent groups, chemiluminescent groups, enzymes, antibodies, and the like. As the PCR method used for the detection, for example, an RT-PCR method is exemplified, and various modifications used in the art can be applied.

 Further, the measurement method of the present invention can be easily carried out by using a reagent kit for detecting the PCA2501 gene in a sample.

 Therefore, the present invention provides a reagent kit for detecting PCA2501, comprising the PCA2501 DNA fragment.

 If the reagent kit contains, as an essential component, a DNA fragment that hybridizes to at least a part or all of the nucleotide sequence shown in SEQ ID NO: 2 or its complementary nucleotide sequence, a labeling agent may be used as another component. In addition, reagents essential for the PCR method (for example, TaqDNA polymerase, deoxynucleotide diphosphate, primer, etc.) may be contained.

 Examples of the labeling agent include a chemical modifying substance such as a radioisotope or a fluorescent substance, and the DNA fragment itself may be conjugated with the labeling agent in advance. Further, the reagent kit may contain a reaction diluent, a standard antibody, a buffer, a detergent, a reaction stop solution, etc., which are suitable for the benefit of performing the measurement.

 Further, the present invention also provides a method for diagnosing schizophrenia using the above-mentioned measurement method, a diagnostic agent and a diagnostic kit used for the method.

 In addition, by using the method described above, by directly or indirectly sequencing the PCA2501 sequence obtained from the test sample, a new PCA2501 gene having a high homology with the wild-type PCA2501 can be obtained. Related genes can be found.

 Accordingly, the present invention also provides a method for screening related genes related to the human PCA2501 gene in a test sample by such measurement and sequencing of the PCA2501 DNA in the test sample.

Further, a protein encoded by the human PCA2501 gene represented by SEQ ID NO: 1 of the present invention, or one or several to a plurality of amino acids in SEQ ID NO: 1 By synthesizing a protein from the deleted, substituted or added amino acid sequence, or a fragment thereof, or synthesizing an antibody against the protein, wild type PCA2501 and / or mutant PCA2501 can be measured.

 Therefore, the present invention provides a method for assaying an antibody and an antigen for wild-type PCA2501 and / or mutant PCA2501. By this method, it is also possible to detect the degree of schizophrenia disorder or the degree of schizophrenia progression based on a change in wild-type PCA2501 polypeptide. Such alterations can also be determined by PCA 2501 sequence analysis by conventional techniques in the art, but more preferably by using antibodies (polyclonal or monoclonal antibodies) to determine differences in the PCA 2501 protein or PCA 2501 protein. Can be detected. As a specific example of the measurement method of the present invention, the PCA2501 antibody is obtained by immunoprecipitating the PCA2501 protein from a solution containing a biological material sample collected from a human such as blood or serum, and Western plotting a polyacrylamide gel. Alternatively, it can react with the PCA2501 protein on an immunoblot. The PCA2501 antibody can also detect PCA2501 protein in paraffin or frozen tissue sections using immunohistochemical techniques.

Since antibody production technology and purification technology are well known in the art, these technologies can be appropriately selected.

 More preferred examples related to methods for detecting wild-type PCA 2501 or a mutant thereof include enzyme-linked immunosorbent assays (ELI), including sandwich methods using monoclonal antibodies and Z or polyclonal antibodies. SA), radioimmunoassay (RIA), immunoradiometric assay (IRMA), and immunoenzymatic assay (IEMA).

Further, the present invention can also provide a PCA2501 receptor present on the cell membrane fraction or the cell surface, which has a PCA2501 binding activity to the PCA2501 protein. Acquisition of the PCA2501 receptor includes the cell membrane fraction This is achieved by conjugating the labeled PCA2501 protein in a biomaterial sample, extracting, isolating and purifying a PCA2501 binding reaction, and specifying the amino acid sequence of the isolated product, thereby obtaining the PCA2501 receptor protein. As well as sequencing can be readily accomplished by those skilled in the art.

 Further, the present invention provides a method for screening a PCA2501 receptor protein or a binding fragment thereof for any of various drugs by using the compound (PCA2501 receptor protein: a low molecular compound, a high molecular compound, Protein, partial protein fragment, antigen, or antibody). Preferably, PCA2501 Reception is used. The PCA2501 receptor polypeptide or a fragment thereof used in such a screening test may be a free substance in a solution attached to a solid support or transported to the cell surface.

 Examples of drug screening include, for example, the use of prokaryotic or eukaryotic host cells stably transformed with a recombinant protein expressing the PCA2501 protein or a fragment thereof, preferably in a competitive binding assay. it can. Such cells in free or fixed form can also be used for standard binding assays. More specifically, the formation of a complex between the PCA2501 receptor protein or fragment thereof and the substance to be tested is measured, and the complex between the PCA2501 receptor protein or fragment thereof and the PCA2501 protein or fragment thereof is measured. Compounds can be screened by detecting the extent to which body formation is inhibited by the substance being tested.

 Thus, the present invention provides for the use of such materials with PC A2 by methods known in the art.

Contacting the 501 receptor protein or a fragment thereof, and then contacting the substance with PCA

The presence of a complex between the 2501 receptor protein and a fragment thereof, or PCA

The present invention can provide a drug screening method characterized by measuring the presence of a complex between a 2501 receptor protein or a fragment thereof and a ligand. You. In addition, the activity of the PCA2501 receptor was measured and the substance was identified as PCA2

Is it possible to inhibit the 501 receptor and thus modulate the activity of PCA2501 as defined above, for example, a sympathetic nerve stimulating action such as dopamine, a receptor stimulating action such as a dopamine receptor, or a sympathetic stimulating action such as noradrenaline? Or whether it is possible to regulate protein-protein interaction or to control complex formation. In the competitive binding assay, more specifically, the PCA2501 receptor protein or a fragment thereof is labeled. Free PC A

The 2501 receptor protein or a fragment thereof is separated from that present in the protein: protein complex, and the amount of free (uncomplexed) label is determined by the P

Binding to CA2501 receptor or PCA2501 receptor: PCA

It is a measure of the inhibition of 2501 protein binding. A small peptide (peptide mimetic) of the PCA2501 protein can be analyzed in this way, and the PCA2501 receptor inhibitory activity can be measured (b).

 In the present invention, another method for drug screening is a screening method for compounds having an appropriate binding affinity for the PCA2501 receptor protein, which, in short, may comprise a number of different peptide test compounds. Is synthesized on a solid support, such as the surface of a plastic pin or other material, and then the peptide test compound is reacted with the PCA2501 receptor protein and washed. Next, a method of detecting the reaction-bound PCA 2501 receptor protein using a known method can be exemplified (PCT Patent Publication No. WO 84-03564). Purified PCA2

The 501 receptor can be coated directly on plates used in the drug screening techniques described above. However, the PCA2501 receptor protein can be immobilized on a solid phase by supplementing the antibody with a non-neutralizing antibody against the polypeptide. The present invention is also directed to the use of a competitive drug screening assay to determine the binding to the PCA2501 receptor protein or a fragment thereof.

A neutralizing antibody capable of specifically binding to the PCA2501 receptor protein and a test compound To compete. The competition by the antibodies makes it possible to detect the presence of any peptide having one or more antigenic determinants of the PCA2501 receptor protein. .

 Further, in the method of screening a candidate compound for a drug that inhibits the activity of PCA2501 of the present invention, for example, a PCA2501 gene expression product or a PCA2501 protein (hereinafter, also referred to as PCA2501 protein), or an antibody against fragments thereof And a test solution and a labeled PCA2501 protein, a partial peptide of the PCA2501 protein or a salt thereof in a competitive manner, and a labeled PCA2501 protein or a partial peptide of the PCA2501 protein bound to the antibody is reacted. A screening method for quantifying a PCA2501 protein, a partial peptide of PCA2501 protein or a salt thereof in a test solution, which comprises measuring the ratio of a tide or a salt thereof, is also possible (b).

 After reacting the test solution with the antibody insolubilized on the carrier and another labeled antibody against the different PCA2501 protein simultaneously or continuously, the activity of the labeling agent on the insolubilized carrier is measured. A method for quantifying PCA2501 protein, a partial peptide of PCA2501 protein, or a salt thereof in a test solution, characterized by the following features, is also possible.

 Further, the PCA2501 protein, the PCA2501 protein when the substrate is brought into contact with the partial peptide of the PCA2501 protein or a salt thereof and the PCA2501 protein, the PCA2501 protein when the substrate and the test compound are brought into contact with the partial peptide of the PCA2501 protein or a salt thereof, By measuring and comparing the activity of partial peptides of PCA2501 protein or their salts, compounds or salts thereof that inhibit the activity of PCA2501 protein or its salts (eg, PCA2501 activity) can be screened. It is possible (see d below).

According to the present invention, a screening method for identifying a compound that stimulates or suppresses the function of a PCA2501 polypeptide or a PCA2501 gene expression product is provided. (A) binding of the candidate compound to the polypeptide or gene expression product (or the cell carrying the polypeptide or the gene expression product or its membrane) or a fusion protein thereof; (B) a method of measuring by a label directly or indirectly bound to a compound; (b) a candidate compound and the polypeptide or gene expression product (or the cell or the cell carrying the polypeptide or gene expression product); Membrane) or its fusion protein, in the presence of a labeled competitor (PCA2501 antibody or PCA2501 receptor), and (c) the candidate compound is the polypeptide or Whether the activation or repression of the gene expression product results in a signal or not is determined by the cell or cell membrane carrying the polypeptide or gene expression product. (D) preparing a mixture by simultaneously mixing a candidate compound and a solution containing the polypeptide or the gene expression product according to claim 1, wherein the polypeptide in the mixture is prepared. Alternatively, measuring the activity of the gene expression product and comparing the activity of the mixture with a standard; and (e) detecting the effect of the candidate compound on the mRNA encoding the polypeptide and the production of the polypeptide in cells. There is provided a screening method comprising a method selected from the group consisting of:

 Also, with respect to drug screening, additional methods include the use of host eukaryotic cell lines or cells that contain a non-functional PCA2501 gene. After a host cell line or cell is grown for a period of time in the presence of the drug compound, the rate of growth of the host cell is measured to determine whether the compound is capable of regulating cell growth, or Confirm whether the ability to regulate mutual binding or complex formation can be controlled. As one means of measuring the growth rate, the biological activity of the PCA 2501 receptor can be measured.

Also, according to the present invention, a more active or stable form of the PCA2501 protein derivative or, for example, an agent that enhances or interferes with the function of the PCA2501 protein in vivo. The organisms with which they interact to develop It is possible to produce a chemically active protein or structural analog, for example, a PCA2501 agonist, a PCA2501 antagonist, a PCA2501 inhibitor, and the like. The structural analog can be determined by, for example, X-ray crystallography, computer modeling, or a combination of these methods for determining the three-dimensional structure of a complex of PCA 2501 and another protein. In addition, information on the structure of a structural analog can be obtained by modeling a protein based on the structure of a homologous protein.

 As a method for obtaining a PCA 2501 protein derivative in an active or stable form as described above, for example, analysis can be performed by alanine 'scan. The method involves substituting Ala for an amino acid residue and analyzing each amino acid residue of the peptide in this way by measuring its effect on the activity of the peptide, and identifying regions important to the activity and stability of the peptide. How to decide. By this method, a more active or stable PCA2501 derivative can be designed.

 It is also possible to isolate the target-specific antibody selected by the functional assay and then analyze its crystal structure. In principle, this approach provides the pharmacore that is the basis for subsequent drug design. By generating anti-idiotypic antibodies to functional pharmacologically active antibodies, it is possible to identify and isolate peptides from punctures of chemically or biologically generated peptides . Therefore, the selected peptide is also expected to act as a pharmacore.

 Thus, a drug having improved PCA2501 activity or stability or action as an inhibitor, agonist, antagonist or the like of PCA2501 activity can be designed and developed.

Further, according to the present invention, by producing a knockout mouse (mutant mouse) containing the PCA2501 gene, which part of the PCA2501 gene sequence affects in vivo various PCA2501 activities as described above, PCA The functions of the 2501 gene product and the modified PCA2501 gene product in vivo can be confirmed.

 This method is a technique for intentionally modifying the genetic information of an organism by utilizing homologous recombination of genes, and can be exemplified by a method using mouse embryonic stem cells (ES cells) (Capeccchi, M. et al. , Science, 244, 1288-1292 (1989)).

 The method for producing the mutant mouse is already a common technique for those skilled in this field, and this modified technique (Tetsuo Noda, edited by Experimental Medicine, extra edition, 14 (20) (1996), Yodosha), A mutant mouse can be easily prepared by adapting the human wild-type PCA2501 gene and the mutant PCA2501 gene of the present invention. Therefore, by applying the above technology, it is possible to design and develop a drug having improved PCA2501 activity or stability or an action as an inhibitor, agonist, antagonist or the like of PCA2501 activity. Example

 Hereinafter, the present invention will be described in more detail by way of examples, but the present invention is not limited thereto.

Example 1

Gene Isolation by Differential mRNA Display>

 (1) To confirm human genes expressed in a patient-specific manner

^The expression method labeled with [33P] ATP was used. The procedure of the method used essentially the method of Liang (Liang, P. et al., Science, 257, 967-971 (1992)).

 Of the schizophrenic patients, the mRNA extracted from peripheral blood mononuclear cells of the treatment group (7 cases), the non-treatment group (3 cases), and the healthy subjects (11 cases) was determined by the conventional method.

1 (1 ng) in 25 ml of 1,3-anchored oligo dT primer G (T) 15 MA (M is G, A and C) And heated at 72 ° C. for 2 minutes. Then, 4 1 of 5X first-strand buffer (manufactured by BRL), 0.1 M of DTT (manufactured by BRL), 1 \ of 250 MdNTPs (manufactured by BRL), and 11 of liponuclease were added to this solution. · Inhibitor (40 units; TOY〇BO) and 11 superscriptsΠ reverse transcriptase (200 units; BRL) were added and reacted at 42 ° C for 1 hour to synthesize cDNA. Diluted by a factor of 2.5 by addition of distilled water and stored at -20 ° C until use.

The synthesized cDNA was amplified by P CR in the presence of anchored primer - [§ - ³³ P] ATP 3 were labeled with (Amersham) '. PCR amplification of this cDNA was performed as follows.

That is, 25 1 PCR mixed solution for 21 cDNAs was obtained by mixing 2 1 single reaction mixture, 2 1 10 XPCR buffer (Yukara), and 2.5 mM dNTP. s, 0. 25 1 of £ Ding & (1 DN a polymerase Ichize (5 units Zm 1: evening made Kara Co., Ltd.), 1 1 of [§ - ³³ P] 3 of 25pmol labeled with ATP '- anchor over de · Oligo-25 pmol of dT primer and 11 1, 5-primer-1 primer (29 primers, SEQ ID NO: 4: 5 '-CTGATCCATG-10-mer with an arbitrary sequence of the sequence shown in 3' (Deoxyoligonucleotide primer) and 10.251 distilled water The PCR reaction was performed under the following conditions: 95 ° C for 5 minutes followed by 95 ° C For 3 minutes, 40 ° C for 5 minutes and 72 ° C for 5 minutes, then 95 for 0.5 minutes, 25 cycles of 40 ° C for 2 minutes and 72 ° C for 1 minute, and finally At 7 2 in The reaction was performed for 5 minutes.

The PCR reaction sample was extracted with ethanol, resuspended in formamide sequencing dye, applied on a 6% acrylamide, 7.5 M rare-sequencing gel, and subjected to electrophoresis. The gel was dried without fixing, and autoradiography was performed. A radioactive ink is marked on a 3 MM filter paper on which a dried gel has been placed in advance, and by combining this with the autoradiogram, the target schizophrenic patient group (dosing group, unmedicated) The specific band containing the cDNA expressed in both groups was cut out from the dried gel together with 3 MM filter paper, and stirred for 1 hour at 3001 dH ₂ 〇. After removal of the polyacrylamide gel and filter paper, cDNA and in the presence of 0. 3M NaOAc and 1 1 of 1 OmgZm 1 glycogen as a carrier, again collected by ethanol precipitation and redissolved in dH ₂ 0 10 1. For re-amplification, 51 of this solution was used to re-amplify the target fragment by PCR under the same conditions as the first time. Next, after electrophoresis, the PCR product was purified from the band similarly excised from the gel, and a third PCR was performed under the same conditions. The PCR product is subcloned into the Hinc II site of pUC118 vector (Yukara) and the base sequence is sequenced by ABI377 auto-sequencer (Applied Biosystems). Were determined.

 This product consists of 98 nucleotides and was named PCA2501.

 DNA sequence in GenBank / EMB L data base using the FASTA program (Person WR, et al., Proc. Natl. Acad. Sci., USA, 85, 2444-2448 (1988)). Comparison with the nucleotide data revealed that the PCR product had no homology to any other known DNA sequence.

 (2) Full-length cDNA isolation

 The human normal heart cDNA library (Stratagene) is composed of oligo (dT) + random hexoma-11-primed human normal heart cDNA and Uni-ZAP tmX.

It was constructed using R (Stratagene). CDN the entire 1 X 10 ⁶ clones were labeled with the DD method [§ one ³³ P] The obtained gene fragment by dCTP

Screening was performed using the A fragment as a probe. Positive clones were selected and their imported cDNAs were cloned into pB1uescript II SK (-) Cut out.

 As a result, the present inventors confirmed about 5 plaques for PCA2501. From these results, the amount of transcription between the total RNAs was calculated to be about 0.00001%.

 Next, primers were designed based on the nucleotide sequence of the gene fragment, and the 5'-RACE (Rapid Amplification of cDNA End) method (MA From man, et al., Proc. Natl. Acad. Sci., USA., 8, 8998 (1988)). That is, the isolation and analysis of the cDNA clone containing the 5 'part of the gene of the present invention was performed by partially modifying the protocol for using the product, and using a commercially available kit (5'-Rapid AmpliFinder RACE Kit, Clontech). According to the method, it was isolated as follows.

 The gene-specific primers P1 and primer P2 used here were synthesized according to a conventional method, and their base sequences are shown in Table 2 below (P1 is shown in SEQ ID NO: 5 and P2 is shown in SEQ ID NO: 6) As shown in FIG. The anchor and primer used were those attached to a commercially available kit.

 Table 2

 P1 primer: 5, -GACCCAGTATGTCTTGTAGACA- 3,

 P2 primer: 5,-CCATCAGTTTTTCCAATGTGA-3,

 Using a human normal heart and lung cDNA library (Marathon-Ready cDNA: manufactured by Clontech) as type II, the cDNA was amplified by PCR using P1 primer and P2 primer. Was. The PCR reaction conditions were: 95 ° C for 2 minutes, followed by a cycle of 95 ° C for 30 seconds and 68 ° C for 4 minutes. The PCR product was analyzed by 1.5% agarose gel electrophoresis.

 A band with a size of about 1000 bases was detected by agarose gel electrophoresis, and the product of this band was inserted into pT7B1ueT vector (Novagen), and insertion of an appropriate size was observed. Several clones were selected.

Five of the 5 'race clones obtained from the PCR reaction have the same sequence. But different lengths. PCA2501—5-1 and PCA2501—15 Sequences encoding the protein, 5 ′ and 3 ′ flanking sequences and full length by sequencing cDNA clones The sequence of 3910 bases was determined, the gene was named schizophrenia-related gene (PCA2501 gene), and the DNA sequence thus obtained was named PCA2501.

 This PCA2501 cDNA contains an open reading frame of the 2157 nucleotide sequence represented by SEQ ID NO: 2 which encodes a protein consisting of the 718 amino acid sequence represented by SEQ ID NO: 1 having a calculated molecular weight of 77972 Da. It contained the full-length 3910 nucleotide sequence shown in 3. In the sequence shown in SEQ ID NO: 3, the position of the start codon was ATG at position 99 to position 101 of the sequence number, and the position of the stop codon was TAG at position 2253 to position 2255.

 Structural analysis was performed on the amino acid sequence (718 amino acid residues) predicted from the full-length cDNA using SMART (Simple Molecular Artificeture Research Tool V3.1) of EMBL.

 As a result of the analysis, six ankyrin repeats (C-terminal 443-472, 479—508, 512—543, 551—581, 612—641, and 648-681 amino acid residues ( Ankyr in repeats) motif was observed.

 (3) Homology search

 FASTA program (Person W. R., et al., Proc. Natl. Acad. Sci., USA,

85, 2444-2448 (1988)), and the DNA sequence in the base was compared with the data for this nucleotide by homology search. oncogene (BCL3) gene, exons 3-9 and co immediately lete cds. (ACCESSION U05681) or Human B-cell lymphoma 3-encoded protein (be 1-3) mRNA, complete cds. (ACCESSION M31732) A homology of 31% was detected at the acid level, but its function has not yet been determined.

Example 2

Northern blot analysis and chromosome localization>

 (1) It was confirmed by Northern blot analysis whether the gene was derived from mRNA having a different expression level.

 To examine the expression profile of PCA2501 in tissues, Northern blot analysis was performed using various human tissues.

For Northern blot analysis, human MTN (Multiple-Tissue Northern) blots I and II (Clontech) were used. cDNA fragments, T3 and T7 using primers' set of promoter sequences, PCR by [§ one ³³ P] prehybridized da I's The membrane containing the PCR amplification product obtained in Example 1 were labeled in one d CTP (The conditions were in accordance with the product protocol), and then hybridization was performed in accordance with the product protocol.

 After hybridization, the washed membrane was exposed to a radiograph at 180 ° C. for 24 hours. The human tissues used were heart (heart), brain (brain), placenta (Placenta), lung (Lung), liver (Liver), skeletal muscle (S. muscle), kidney (Kidney), kidney (Pancreas), They are spleen (Spleen), thymus (Thymus), prostate (Prostate), testis (Testis), ovary (Ovary), small intestine (Small intestine), colon (Colon) and peripheral blood leukocytes (PBL).

 As a result, a 4 kb transcript homologous to PCA2501 was expressed in the heart, placenta, lung, liver, 塍 齓 spleen, small intestine, peripheral blood, and lymphocytes, but the level of expression was not so significant.

 (2) Radiation Hybrid Mapping using chromosome radiation hybrid panel

Radiation hybrid mapping allows you to The localization of the chromosome of the loan was determined (Cox, DR, et al., Science, 250, 245-250. That is, two types of primers were designed from the nucleotide sequence of the gene fragment obtained by the DD method, I purchased a 4-radiation hybridization panel (GeneBridge4; manufactured by Research Genetics), and according to the manufacturer's instructions, used this as a template to set the bases shown in SEQ ID NO: 5 and SEQ ID NO: 6. PCR (30 cycles) was performed using the P1 and P2 primers of the sequence, and a PCR reaction for chromosome mapping analysis was performed.

 The obtained results were analyzed by software available on the Internet (Boehnke, M., et al., Am. J. Hum. Genet., 46, 581-586 (1991)).

 As a result, the PCA2501 gene was located at the marker AFM126ZC5. Since this marker is a marker localized at 3q11-q12 on the chromosome, it was confirmed that PCA2501 was localized at chromosome position 3q11-q12. .

Example 3

 <Screening by RT-PCR>

 After designing primers from each nucleotide sequence of the gene fragment obtained by the DD method, competitive reverse transcription PCR (Competitive RT-PCR) was performed using mRNA extracted from peripheral blood mononuclear cells of patients and healthy subjects. Method).

 (1) Preparation of DNA competitor

 First, DNA competitors for PCA2501 and GAPDH (Housekeeping gene) were prepared using a competitive DNA construction kit.

 To create the DNA Competitive DNA Competitive DNA Construction Kit (Competitive DNA)

Construction Kit: TaKaRa (Yukara Co., Ltd .: TaKaRa) was used to perform PCR with ADNA as type II DNA, and DNA competition of PCA2501 and GAPDH (housekeeping gene) was performed using SUPREC-2 (Takara). Refine Yuichi each did.

 That is, for the preparation of the PCA2501 DNA competition, 25 1 2 Premix solution, the sense primers for the production of 0.51 20 pmol / H1 DNA competitor shown in SEQ ID NO: 7, and SEQ ID NO: 8 The final volume was 50 ^ 1 consisting of the antisense primer for the production of 20 pmo \ / n 1 DNA competition of 0.5 1 and 24 1 water, as indicated by. GAPDH DNA Competitive DNA was prepared using the same solution using a sense primer for producing DNA Competitive DNA shown in SEQ ID NO: 9 and an antisense primer for producing DNA Competitor shown in SEQ ID NO: 10. Was used to carry out a PCR reaction. For the PCR reaction, 30 cycles of 94 ° C. for 30 seconds and then 60 ° C. for 30 seconds and 72 ° C. for 30 seconds were performed.

 The fission products were separated on a 1.5% agarose gel and stained with ethidium bromide. The desired PCA2501 Competition Yuichi (116bp) and GAPDH Competition Yuichi (400bp) were recovered from the gel using SUPREC-2 (Yukara).

(2) Calculation of copy number of DNA competitor

The absorbance (0D _{26 fl} ) of the purified _DNA competitor was measured, and the number of _copies was calculated by the following formula.

 Number of copies / 1 =

OD ₂₆₀ (a value) X 50 ng /; it l X 1 0- 9 X 6 X 1 0 23 / (b pX 660)

 (3) Quantification of PCA2501 gene expression by competitive PCR

Competitive PCR was performed using the purified DNA competition and cDNA synthesized from the patient's total RNA (normal (n = 21), schizophrenic (n = 27), and other psychiatric patients (n = 27). n = 20)). In other words, after isolating total RNA from peripheral blood mononuclear cells of healthy subjects, schizophrenic patients, and other psychiatric patients using ISOGEN (manufactured by Wako), 10 units of RNase-free 30 with DNa se I (Boehringer Mainheim) For 2 min, extracted twice with chloroform and precipitated with ethanol. Next, single-stranded cDNA was synthesized from 5 g of the purified total RNA using Superscript II ™ RNase H-reverse transcriptase (Life's Technology) using oligo d (T). Each resulting cDNA product was used for competitive PCR amplification.

 Competitive PCR was performed by mixing cDNA from the sample with the prepared DNA competitor.At this time, in order to create a calibration curve for calculating the copy number of the target PCA2501 gene, Shake the concentration.

The PCR reaction consisted of 25 1 final volumes of 2.5 ng of 50 ng Z1 cDNA from each of the above samples, 2.51 DNA competitors (10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 1 0 ^7, 1 0 ⁸ copies / 2. 5 / xl), 2. 1 OX buffer 5 1 (manufactured by T0Y0B0 companies), 2. 5 l of 2. 5 mM d TNP s (manufactured by T0Y0B0 companies), 0 .5 IOMP CA2501 Sense 'primer (SEQ ID NO: 11), 0.51 10 MPCA2501 Antisense' primer (SEQ ID NO: 12), 0.25 n1 Pyrococcus A reaction mixture of KODash (2.5 units / 1, manufactured by T0Y0B0) of DNA polymerase derived from K 1D1 strain and distilled water (manufactured by Nippon Gene) was prepared.

 PCR reaction conditions were 95 ° C, 2 minutes, followed by 95 ° C, 0.5 minutes, 60 ° (30 minutes, 0.5 minutes, 75 ° C, 0.5 minutes). The amplified product was 98 base pairs for the PAC2501 gene.

 For GAPDH used as a control, GAPDH sense 'primer (SEQ ID NO: 13) and GAPDH antisense primer (SEQ ID NO: 1)

4) was used, and the PCR reaction condition for the GAPDH was 95 ° C for 2 minutes, followed by

The reaction was performed at 95 ° C, 0.5 min, 55 ° (:, 0.5 min, 75 ° C, 0.5 min under 30 cycles. The amplified product was reacted against GAPDH. Each PCR product thus obtained was subjected to 5% polyacrylamide gel electrophoresis. Separated and dried on a filter paper using a gel dryer. After drying, exposure to an image plate was performed, and image data was captured using a Molecular Imager GS-525 (Molecular Imager GS-525: manufactured by Bio-Rad). Data analysis was performed using a molecular analyst (Molecular Analyst: manufactured by Pio Rado).

 The expression amount was calculated by the expression PCA2501 copy number per unit GAPDH copy number (expression amount = PCA2501 copy number / GAPDH copy number).

 Figure 1 shows the results.

 As shown in FIG. 1, the candidate gene PCA 2501 was significantly expressed in schizophrenic patients compared to healthy subjects or non-schizophrenic patients.

 From the above results, the isolated PCA2501 gene of the present invention is specifically highly expressed in schizophrenic patients, and is useful for diagnosis of schizophrenic patients.

Example 4

 We examined the relationship between psychiatric symptoms and PCA2501 gene expression in schizophrenic patients (22 patients).

 The psychiatric symptoms were evaluated by the PAN SS (Positive and Negative Syndrome Scale; Schizophr. Bull., 13, 261-276 (1987)). The composition scale is the value obtained by subtracting the negative symptom scale from the PAVS S positive symptom scale. PCA2501 gene expression is expressed in peripheral blood mononuclear cells collected.

(PCA2501 / GAPDH) was measured according to Example 3 above.

 The result is shown in figure 2.

 In FIG. 2, the vertical axis represents the expression level of the PCA2501 gene, and the horizontal axis represents the composition scale of PANSS.

According to Figure 2, the expression level of the PCA2501 gene increased as the composition scale increased (positive symptoms became dominant), and a correlation was observed between the ^two (R2 = 0.2318). From the above, it can be seen that the PCA2501 gene is a gene closely related to the symptoms of schizophrenia, and that its expression measurement is also useful in determining the psychiatric symptoms of schizophrenia.

Example 5

 <Preparation of histidine-tagged protein and preparation of antibody>

 Using the cDNA synthesized from healthy human peripheral blood mononuclear cells as type I DNA, the following primers shown in SEQ ID NO: 15 to SEQ ID NO: 28 designed from PCA2501 gene were synthesized (A: SEQ ID NO: 15 and B: SEQ ID NO: 16, C: SEQ ID NO: 17 and D: SEQ ID NO: 18, E: SEQ ID NO: 19 and F: SEQ ID NO: 20, G: SEQ ID NO: 21, and H: SEQ ID NO: 22, I: SEQ ID NO: 23 and J: SEQ ID NO: 24, K: SEQ ID NO: 25 and L: SEQ ID NO: 26, M: SEQ ID NO: 27 and N: SEQ ID NO: 28) These were used for PCR. Fl_, F2-, F3-, N1-, N2-, N3_, and C-PCA 250 1 (2173, 2098, 1876, 1300, 1225, 1003, 911 base pairs) gene fragments were obtained. The obtained gene fragment was subcloned into PCR 2.1 (Invitrogen). After digestion with restriction enzymes BamHI and PstI, expression vectors pQE31 (F, F2-, F3-, N1-, N2-, N3-PCA2501) and pQE30 (C-PCA2501) ( QIAGEN). The resulting vector was transfected into Escherichia coli M15. The transfected E. coli was cultured for 4 hours in the presence of IPTG to recover the E. coli. After recovery, F1-, F2-, F3_, Nl_, N2-, N3-, and C-PCA 2501 (730) were analyzed by affinity chromatography using Ni-NT A agarose (manufactured by QIAGEN). , 705, 631, 447, 422, 348, 310 amino acid sequences) were purified. Using these as immunogens, anti-PC A2501 antibodies were prepared by a conventional method.

 The following shows the primer sequences and the lengths of the obtained DNA fragments, respectively:

 A: 5'-TAGGATCCATGATTGTGGACAAGCTGCTGG-3 '(F1-PCA2501 Foard) 2173bp

B: 5'-TGCTGCAGCTAATACGGTGGAGCTCTCTG-3 '(F1-PCA2501 Reverse) C: 5'_TAGGATCCATGACCAGCCCGCTCAACCT -3 '(F2-PCA2501 Forward) 2098bp D: 5'-TGCTGCAGCTAATACGGTGGAGCTCTCTG-3' (F2-PCA2501 Reverse)

E: 5'-TAGGATCCCATATGGGGGTTGGCAGGCA-3 '(F3-PCA2501 Forward) 1876 bp

F: 5'-TGCTGCAGCTAATACGGTGGAGCTCTCTG-3 '(F3-PCA2501 Reverse)

G: 5'-TAGGATCCATGATTGTGGACAAGCTGCTGG -3 '(N1-PCA2501 Forward) 1300bp H: 5'-TGCTGCAGTTTGCTTTCTTCCTGCTCCACC _3' (N1-PCA2501 Reverse)

1: 5'-TAGGATCCATGACCAGCCCGCTCAACCT -3 '(N2-PCA2501 Forward)

 J: 5'-TGCTGCAGTTTGCTTTCTTCCTGCTCCACC -3 '(N2-PCA2501 Reverse) 1225bp

K: 5'-TAGGATCCCATATGGGGGTTGGCAGGCA-3 '(N3-PCA2501 Forward)

 L: 5'-TGCTGCAGTTTGCTTTCTTCCTGCTCCACC -3 '(N3-PCA2501 Reverse) 1003bp

M: 5'-TAGGATCCGGTGGAGCAGGAAGAAAGCAAA-3 '(C-PCA2501 Forward) 911bp

N: 5'-TGCTGCAGCTAATACGGTGGAGCTCTCTG-3 '(C-PCA2501 Reverse)

 According to the use of the anti-PCA2501 antibody thus obtained, the reaction of the anti-PCA2501 antibody with a sample obtained from a patient sample can be used for diagnosis of schizophrenia.

 In addition, the use of the PCA2501 gene of the present invention may make it possible to treat schizophrenia using an antibody against PCA2501 and an antisense DNA. Real-time PCR (ABI PRISM (im)

7700 Sequence Detection System User's Manual: 5.10.5.13 (1996), Patent Registration No. 2825 976, etc.) The expression of PCA2501 can be easily measured by a simple method using this method, and this can be used for diagnosis of schizophrenia. Industrial Applicability ·

 According to the present invention, there is provided a novel PCA2501 gene which is specifically developed in schizophrenic patients. According to the present invention, a detection method and a detection method for detecting schizophrenia by detecting a PCA2501 gene or a gene product in a sample that binds to the oligonucleotide 'probe using the PCA2501 oligonucleotide as a probe Kit is provided.

 According to the use of the gene of the present invention, an antibody using the gene expression product as an antigen can be produced. According to the present invention, there is provided a diagnosis of schizophrenia using the antibody, and a pharmaceutical composition and a drug for schizophrenia containing the antibody as an active ingredient.

 According to the provision of the PCA2501 gene, the PCA2501 protein encoded by the gene can be produced in large quantities by genetic engineering. According to the provision of the protein, the PCA2501 protein activity and the binding of Functions such as activity can also be examined.

 The PCA2501 protein is also useful for elucidating the pathology, diagnosing, and treating diseases involving the PCA2501 gene and its product (eg, schizophrenia and schizophrenia complications).

 According to the present invention, further, a gene transfer vector useful for gene therapy containing the PCA2501 antisense oligonucleotide, the cell into which the PCA2501 antisense oligonucleotide has been introduced, and the vector or the cell as an active ingredient The present invention provides a gene therapy agent and a gene therapy method using the same.

 According to the present invention, there is provided a method for screening an interaction product using the PCA2501 gene or gene expression product.

Claims

The scope of the claims

1. A gene containing the following polynucleotide (a) or (b):

 (a) a polynucleotide encoding the amino acid sequence represented by SEQ ID NO: 1 or a complementary chain thereof,

 (b) a polynucleotide having at least 90% homology to a polynucleotide encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1,

2. A gene consisting of one of the following polynucleotides (c;), (d) or (e):

 (c) the base sequence represented by SEQ ID NO: 2 or a complementary strand thereof,

 (d) a polynucleotide that hybridizes under stringent conditions with the polynucleotide consisting of the nucleotide sequence of (c) above,

 (e) A polynucleotide having at least 70% homology to the polynucleotide having the nucleotide sequence of SEQ ID NO: 2.

 3. A gene consisting of the nucleotide sequence of SEQ ID NO: 3.

 4. A gene encoding the following polypeptide (f) or (g):

 (f) a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1,

 (g) A polypeptide having an amino acid sequence in which one or more amino acids have been deleted, substituted or added in the amino acid sequence of (f), and having PCA2501 activity.

 5. A gene expression product of the gene according to any one of claims 1 to 4.

 6. A recombinant expression vector having the gene according to any one of claims 1 to 4.

7. A host cell having the recombinant expression vector according to claim 6.

8. An oligonucleotide comprising at least 15 contiguous nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 2.

9. The oligonucleotide according to claim 8, comprising at least 30 consecutive nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 2.

 10. An oligonucleotide probe or primer comprising the nucleotide sequence according to claim 2.

 11. An oligonucleotide probe or primer comprising at least 15 contiguous nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 2.

 12. The oligonucleotide probe or primer according to claim 11, comprising at least 30 consecutive nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 2.

 13.Using the oligonucleotide probe according to claim 11 or 12, detecting a PCA2501 gene or gene expression product in a body fluid or a tissue sample that binds to the oligonucleotide probe. To detect body fluids or tissues in patients with schizophrenia.

 14. A method for screening a drug that interacts with the gene or gene expression product, comprising using the gene or gene expression product according to any one of claims 1 to 5.

 15. An antibody capable of binding to the gene expression product according to claim 5 or a portion thereof.

16. A diagnostic agent for schizophrenia, comprising the oligonucleotide probe or the primer according to any one of claims 9 to 12.

 17. Use of the oligonucleotide probe or primer according to any one of claims 9 to 12 for producing a diagnostic agent for schizophrenia.

18. Use of the oligonucleotide probe or primer according to any one of claims 9 to 12 to detect a PCA2501 gene or a gene expression product in a body fluid or a tissue sample. Schizophrenia diagnosis method. Claims of amendment

 [January 31, 2002 (3.1.1.02) Accepted by the International Bureau: Claims at the time of filing

 8, 9, 11 and 12 have been withdrawn; claims 1, 2, 4, 13 and 13

 16, 17, and 18 have been amended; other claims remain unchanged. (2 pages)]

1. (After correction) Gene containing the following polynucleotide (a):

 (a) A polynucleotide encoding the amino acid sequence represented by SEQ ID NO: 1 or a complementary strand thereof.

 2. (after correction) a gene consisting of any of the following polynucleotides (c) or (d):

 (c) the base sequence represented by SEQ ID NO: 2 or a complementary strand thereof,

 (d) A polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of the nucleotide sequence of (c) above.

 3. A gene consisting of the nucleotide sequence of SEQ ID NO: 3.

 4. (After correction) Gene encoding the following polypeptide (ί):

 (f) A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1.

 5. A gene expression product of the gene according to any one of claims 1 to 4.

 6. A recombinant expression vector having the gene according to any one of claims 1 to 4.

7. A host cell having the recombinant expression vector according to claim 6.

 8. (Delete)

 9. (Delete)

 10. An oligonucleotide probe or primer comprising the nucleotide sequence according to claim 2.

 11. (Delete)

 12. (Delete)

 13. (After correction) PCA 2501 gene in a body fluid or tissue sample that binds to the oligonucleotide probe using an oligonucleotide probe containing at least 15 consecutive nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 2 Or Detection of body fluid or tissue of a schizophrenic patient, characterized by detecting a gene expression product

 69

Revised j paper (Article 19 of the Convention) Method.

 14. A method for screening a drug that interacts with the gene or gene expression product, wherein the method uses the gene or gene expression product according to any one of claims 1 to 5.

 15. An antibody capable of binding to the gene expression product according to claim 5 or a portion thereof.

 16. (After correction) A diagnostic agent for schizophrenia comprising an oligonucleotide probe or primer comprising at least 15 consecutive nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 2.

 17. (After correction) Use of an oligonucleotide probe or a primer comprising at least 15 contiguous nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 2 for production of a diagnostic agent for schizophrenia.

 18. (After correction) PCA2501 gene or gene in a body fluid or tissue sample using an oligonucleotide probe or primer containing at least 15 contiguous nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 2 A method for diagnosing schizophrenia, characterized by detecting an expression product.

70

 Revised j paper (Article 19 of the Convention)