JP2001046072A - Ace-like gene - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a gene which contains a polynucleotide coding for a specific polypeptide and so on, enhances an angiotensin transferase activity or bradykinin-inactivating activity, and is useful as an antihypertensive agent and for diagnosing hypertension and so on. SOLUTION: This gene contains (A) a polynucleotide coding for the polypeptide having the amino acid sequence shown by formula I, (B) a polypeptide having a homology of 95% or more to the polynucleotide coding for the polypeptide having the amino acid sequence shown by formula I, or (C) a polynucleotide complementary to polynucleotide A or B. This gene consists of (C) a base sequence shown by formula II, or (D) a polynucleotide hybridizing to the polynucleotide having the base sequence shown by formula II under a stringent condition. It is preferable to produce an antihypertensive agent containing, as an effective ingredient, the protein having the amino acid sequence shown by formula I.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a renin-angiotensin system which is involved in the regulation of blood pressure.
To convert activated to angiotensin II (Angiotensin Converting Enzyme)
me) (ACE gene). More specifically, the expression of ACE is particularly high in the kidney, testis and small intestine, and it is known that ACE of mammals including humans is known.
A gene having about 40% similarity to a gene.

[0002] The present invention also relates to a novel protein (gene expression product) encoded by such a gene, an expression vector for producing the same, a host cell, a specific antibody against the protein, and a disease such as hypertension using the protein. The present invention also relates to diagnostic methods and diagnostic agents, cDNA fragments of the above genes (antisense strand, sense strand, probe, etc.), and pharmaceutical compositions containing these as active ingredients.

[0003]

2. Description of the Related Art Angiotensin converting enzyme (ACE) is one of carboxypeptidases,
It belongs to the renin-angiotensin system enzymes involved in electrolyte regulation. It also replaces angiotensin I, an inactive peptide with 10 amino acid residues produced by renin from angiotensin nogen, with angiotensin II, a bioactive peptide with 8 amino acid residues.
Widely known to have the effect of converting
riendling, KK, et al., Circulation, 87 , 1816-182
8 (1993): Tamura, K., et al., Hypertens Res., 18 ,
7-18 (1995)).

[0004] ACE is also called kininase II and has an inactivating effect on bradykinin, a hypotensive peptide.

[0005] The ACE is 4.3 kb in length and consists of 1306 amino acid residues. Among them, 29 N-terminal amino acid residues are a signal peptide and are composed of two domains having a homologous structure in the primary sequence.
There is a sugar chain attachment site at the position, and a cysteine residue at 13 positions. The ACE has two isozymes, one of which is a large molecular weight (1) produced in somatic cells such as lung and kidney.
(50 kDa) somatic cell type ACE, and the other is molecular weight (92 kDa).
Da) is a small testicular ACE.

[0006] The somatic ACE has two domains, an N domain and a C domain, and the testis ACE consists of only the C-terminal domain. Two mRNAs, somatic ACE and testis ACE, are supposed to be transcribed from the same gene by two different transcription units having partially overlapping structures by alternative initiation and alternative splicing. (Howar
d, T., et al., Mol.Cell Biol. 13 , 4294-4302 (199
0): Thekkumara, TJ et al., Nucleic Acids Res., 2
0 , 683-687 (1992): Howard, T., et al., Mol. Cell Bi.
ol., 13 , 18-27 (1993): Koichi Tamura, History of Medicine, 169 ,
437-442 (1994)).

[0007] The above-mentioned somatic ACE is abundant in the intima of blood vessels, particularly in the pulmonary vascular bed, and is also present in renal tubular epithelium, gastrointestinal villous epithelium, neuroepithelium in the brain, T cells and macrophages. It is a combined ACE. A large amount of soluble ACE is present in the circulating blood. In testicular sperm cells,
Testicular ACE exists as a membrane-bound form. In recent years, therapeutic agents for hypertension based on ACE inhibitory activity have been developed and widely provided to clinical practice. In addition, it has been revealed that ACE is involved not only in hypertension but also in the onset and progress of hypertension complications such as cardiac hypertrophy, arteriosclerosis, and renal disorder.

[0008] As described above, the relationship between ACE and hypertension has been widely studied, and as ACE inhibitors have already been put on the market,
To investigate the relationship between ACE gene and blood pressure regulation, ACE
ACE gene deficient mice with defective function
(Krege, JH, et al., Nature, 375 , 146-148 (199
6)), experiments have been conducted on the above-mentioned relationship, but the physiological role of ACE has not yet been sufficiently studied.

[0009] If a new gene related to ACE can be isolated, it will be possible to subsequently study the relationship between the gene expression product and the regulation of blood pressure, thereby sufficiently studying the relationship between ACE and hypertension. It will be possible to develop a therapeutic agent for hypertension and the like having an additional ACE inhibitory effect by utilizing the results.
Accordingly, there is a need in the art for isolation of such novel ACE-related or similar genes.

[0010]

SUMMARY OF THE INVENTION The present inventors have proposed the above A
CE, especially human testis ACE, human somatic ACE, mouse testis ACE, mouse somatic ACE, rat testis ACE, rat somatic, chicken ACE, rabbit testis ACE, homologous to rabbit somatic ACE It is an object of the present invention to provide a gene encoding a novel human protein homologue having sex.

The present inventors have repeatedly searched for genes derived from various human tissues based on the above objects, and as a result, have succeeded in isolating and identifying new genes meeting the objectives, and have completed the present invention. Was.

[0012]

That is, the present invention provides a gene containing the following polynucleotide (a), (b) or (c). (A) a polynucleotide encoding the polypeptide having the amino acid sequence represented by SEQ ID NO: 1, (b) SEQ ID NO:
A polynucleotide having at least 95% homology to a polynucleotide encoding a polypeptide having the amino acid sequence represented by (1), (c) the above (a) or (b)
A polynucleotide complementary to the polynucleotide of

Further, the present invention provides a gene comprising the following polynucleotide (a) or (b). (A) a nucleotide sequence represented by SEQ ID NO: 2, and (b) a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of (a).

Further, the present invention provides a gene encoding the following polypeptide (a) or (b). (A) a polypeptide having the amino acid sequence represented by SEQ ID NO: 1, (b) an amino acid sequence in which one or more amino acids have been deleted, substituted or added in the amino acid sequence of (a), and ACE activity or bradykinin A polypeptide having an inactivating activity.

The present invention also provides a gene expression product having the above amino acid sequence; a recombinant expression vector having each of the above genes; and a host cell having the recombinant expression vector.

The present invention also provides an oligonucleotide comprising at least 15, more preferably at least 30, contiguous nucleotide sequences in the nucleotide sequence represented by SEQ ID NO: 2.

Further, according to the present invention, the following antisense strands, vectors containing the same, pharmaceutical uses thereof, sense strands (probes), proteins, antihypertensive agents, methods for screening compounds, active substances obtained by the methods And a method for diagnosing hypertension, a diagnostic agent, and the like. (1) an antisense strand oligonucleotide to the nucleotide sequence of SEQ ID NO: 2; (2) at least 15 and more preferably at least 30
(3) a vector containing any of the above antisense strand oligonucleotides; (4) containing the above antisense strand oligonucleotide or a vector containing the same as an active ingredient (5) a hypotensive agent containing the antisense strand oligonucleotide or a vector containing the same as an active ingredient; (6) a base sequence represented by SEQ ID NO: 2. (7) at least one nucleotide in the base sequence represented by SEQ ID NO: 2
5, preferably at least 30, an oligonucleotide probe comprising a continuous nucleotide sequence; (8) a protein of the following (a) or (b): (a) a protein having an amino acid sequence represented by SEQ ID NO: 1,
(B) a protein comprising an amino acid sequence in which one or more amino acids have been deleted, substituted or added in the amino acid sequence of (a) and having an ACE activity or a bradykinin inactivating activity; (10) Effectively use the gene of the present invention, in particular, a gene consisting of a polynucleotide encoding the amino acid sequence of SEQ ID NO: 1, a polynucleotide having the base sequence shown in SEQ ID NO: 2, or an expression product of such gene. Antihypertensive agent as a component; (11) culturing the gene of the present invention or its expression product in a medium containing a test substance, and then measuring an ACE activity or a bradykinin activity of the cells; screening for an ACE inhibitor or an activator of bradykinin; (12) ACE inhibitor or bradykinin activator obtained by the above screening; (1 3) an antihypertensive agent containing an ACE inhibitor or an activator of bradykinin obtained by the above screening as an active ingredient; (14) a method for diagnosing hypertension by measuring the amount of the gene of the present invention or its expression product in a sample; (15) A gene diagnostic agent for hypertension comprising the gene of the present invention or an expression product thereof as an active ingredient; (16) a homolog of the gene of the present invention, which is a non-human dog;
A mammalian gene homologue selected from monkey, horse, pig, sheep, cat, rat, mouse and guinea pig; (17) an antibody having a binding property to the gene expression product of the present invention and a fragment thereof; (19) An antihypertensive agent comprising the above antibody and a fragment thereof as an active ingredient.

Hereinafter, the abbreviations of amino acids, peptides, base sequences, nucleic acids and the like in the present specification are referred to as IUPAC.
-IUB regulations [IUPAC-IUB Communication on Biologi
calNomenclature, Eur.J. Biochem., 138 : 9 (198
4)], "Guidelines for preparation of specifications containing base sequences or amino acid sequences" (edited by the Patent Office) and conventional symbols in the relevant field.

[0019]

BEST MODE FOR CARRYING OUT THE INVENTION As a specific example of the gene of the present invention, a gene deduced from a DNA sequence of a PCR product named “kais7” shown in Examples described later can be mentioned. Its nucleotide sequence is as shown in SEQ ID NO: 2, and has an open reading frame (ORF) of 2415 bases.

The gene is a novel angiotensin converting enzyme (ACE) having the 805 amino acid sequence shown in SEQ ID NO: 1 encoded by the nucleotide sequence of the ORF.
Is a human cDNA that encodes a protein similar to the above (referred to as “ACE-like protein”), and has a total length of 2599 bases.

AC encoded by the gene of the present invention, kais7
E-like proteins are available from the BLASTP program (Altschu,
SF, et al., Nucleic Acids Res., 25 , 3389-3402 (1
997), the results of a search of the GenBank / EMBL database indicate that the ACE of mammals such as humans, mice, rats, chickens, rabbits, etc., which affects blood pressure regulation
It was confirmed to have homology with an enzyme having activity (ACE protein, see the above-mentioned literature).

However, the ACE is known to have a blood pressure regulating action, particularly a blood pressure increasing action. From this, it is considered that the gene of the present invention functions as a blood pressure-regulating factor and functions as a hypertension-causing factor (see the above literature).

Since the gene of the present invention has high expression in normal kidney, testis and small intestinal tissues, it is considered that it has a blood pressure regulating action (pressor action) or a bradykinin inactivating action similarly to known ACE.

The expression product obtained by expressing all or a part of the kais7 gene of the present invention can be used for production of an antibody that binds to ACE and diagnosis of an ACE-related disease using the antibody.

By examining the expression level, activity, polymorphism (gene polymorphism), etc. of the expression product of the kais7 gene expression product of the present invention, the gene of the present invention or its expression product can be subjected to various diagnoses including gene diagnosis for hypertension and other diseases. Target molecule.

Further, the present invention can provide a gene therapy agent comprising a kais7 gene sequence or an antisense sequence and a vector containing the same as an active ingredient.

Further, according to the provision of the gene of the present invention, a sense fragment of the gene sequence and an expression product thereof can be used as a blood pressure regulating factor.

The whole or a part of the kais7 gene of the present invention can be used as a probe, and the use can diagnose hypertension and other related diseases. That is,
These can be used as a part of the diagnostic kit.

The kais7 gene or its expression product of the present invention can also be used for screening for agonists, antagonists and inhibitors of the kais7 protein (ACE-like protein). The present invention can also provide such a screened therapeutic agent for hypertension.

In the present specification, the term "gene" is used to include not only a double-stranded DNA but also a single-stranded DNA such as a sense strand and an antisense strand constituting the same. There is no restriction on its length.
Therefore, unless otherwise specified, the gene (DNA) of the present invention includes double-stranded DNA including human genomic DNA and cDN.
A single-stranded DNA containing A (sense strand) and single-stranded DNA having a sequence complementary to the sense strand (antisense strand)
And any of their fragments.

The gene (DNA) of the present invention may further comprise a leader sequence,
It can include coding regions, exons, introns. Polynucleotides include RNA and DNA. The DNA includes cDNA, genomic DNA, and synthetic DNA. Polypeptides include fragments, homologues (homologs), derivatives and variants thereof. The variants include naturally occurring allelic variants, non-naturally occurring variants, variants having an amino acid sequence modified by deletion, substitution, addition and insertion, conservative amino acids having substantially the same function. Variants having amino acid sequences altered by substitution are included.

Incidentally, these amino acid sequence alterations (mutations, etc.) may occur in nature, for example, due to mutations or post-translational modifications. However, naturally occurring genes (eg, specific examples of the present invention) are used. You can also do this artificially.

[0033] The variant may be at least 70%, preferably 80%, more preferably 95%, even more preferably 97% homologous to the unmutated polypeptide.

The above-mentioned polypeptides, including mutants, homologs, etc., all have structural features that are conserved in common. It can have inactivating activity. Note that the homology of the polypeptides can be determined by using sequence analysis software such as FA
Method using STA program (Clustal, V., Method
s Mol. Biol., 25 , 307-318 (1994)).

The gene encoding the above mutant is silent or conserved for amino acid substitution. That is,
The amino acid sequence residue encoded by the nucleotide sequence does not change.

Conservatively substituted amino acid residues, that is, substitutions that would replace the original amino acid residue with another amino acid residue but would preserve the activity of the polypeptide having the original amino acid residue. Possible amino acid residues are as shown below for each amino acid residue (original amino acid residue). Original amino acid residue Conservatively substituted amino acid residue Ala Ser Arg Lys Asn Gln, His Asp Glu Cys Ser Gln Asn Glu Asp Gly Pro His Asn or Gln Ile Leu or Val Leu Ile or Val Lys Arg, Aln, or Glu Met Leu or Ile Phe Met, Leu or Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp or Phe Val Ile or Leu cysteine residue (Cys) can be replaced with other amino acid residues such as alanine residue (Ala), valine residue (Val) or the like. According to this, the disulfide bond of the specific polypeptide can be generally affected.

Substitutions which are generally considered to give a favorable change in the properties of the desired polypeptide are, for example: a) a hydrophilic residue, such as a Ser or Thr hydrophobic residue, such as Leu, Ile, Phe, Val or Ala; b) Cys or Pro, which is replaced with various other amino acid residues. C) an amino acid residue having an electropositive side chain, such as Ly
Substitution of s, Arg, His for electronegative residues, eg, Val or Asp, d) Substitution of residues with large side chains, eg, amino acids without side chains such as Gly of Phe.

As described above, the provision of the gene kais7 of the present invention and its gene product provides extremely useful information and means for elucidating, grasping, diagnosing, preventing and treating various diseases such as hypertension. In addition, the gene of the present invention can be suitably used in the development of a novel drug that suppresses or antagonizes the expression of the gene of the present invention, which is used for the antihypertensive action of hypertension. Furthermore, detection of the expression of the gene of the present invention or expression of a product thereof in an individual or tissue, and detection of mutation (deletion or point mutation) or abnormal expression of the gene can be suitably used in elucidation and diagnosis of the above-mentioned diseases. .

The gene of the present invention is specifically SEQ ID NO: 1.
A gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding the amino acid sequence represented by, for example, a gene having the nucleotide sequence of SEQ ID NO: 3 (kais7 gene) or all or all of the nucleotide sequence represented by SEQ ID NO: 2 Although shown as a gene consisting of a polynucleotide containing its complementary strand, it is not particularly limited to these. For example, the gene of the present invention may be a gene encoding an amino acid sequence having a certain modification in the specific amino acid sequence, a gene encoding an amino acid sequence having a certain homology with the specific amino acid sequence, or a base of these genes. It may be a gene having a base sequence having a certain homology with the sequence. For example, at least 70% or more, preferably 90% or more, more preferably 95% or more, and still more preferably 97% or more of the specific amino acid sequence or base sequence.
It may have the above homology. The present invention includes homologs having such homology (gene homologs and protein homologs).

The gene of the present invention also includes a polypeptide encoding a polypeptide comprising an amino acid sequence in which one or more amino acids have been deleted, substituted or added (modified amino acid sequence) in the amino acid sequence shown in SEQ ID NO: 1. Genes that do ". Here, the degree of “deletion, substitution or addition of amino acids” and their positions are determined by modifying the polypeptide of the amino acid sequence with a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1 (kais
7) is not particularly limited as long as it has the same biological function as that of the protein 7), preferably conservative substitution of amino acid residues or modification of dozens of amino acid residues, more preferably several amino acid residues. The modification may be an amino acid residue. Here, the “similar function” can be exemplified by ACE activity, in particular, pressurizing activity or bradykinin inactivating activity. Also,
The gene encoding the polypeptide comprising the modified amino acid sequence may be a gene capable of detecting the Kais7 gene of the present invention encoding the polypeptide having the amino acid sequence before modification by its use.

A homologue of the kais7 gene of the present invention (and a homologue of the gene product) has sequence homology with the kais7 gene of the present invention (or a gene product thereof) and has a common structural characteristic and gene expression pattern. Gender, a series of related genes (and their expression products) that are recognized as one gene family by their similarity in biological function as described above. This naturally includes alleles (alleles) of the kais7 gene of the present invention.

As an artificial means for altering (mutating) the amino acid sequence, for example, cytospecific mutagenesis [Methods in Enzymology, 154 , 350, 36]
7-382 (1987); id. 100 , 468 (1983); Nucleic Acids Re
s., 12 , 9441 (1984); Genetic engineering techniques such as the Seismic Chemistry Laboratory Course 1 "Genetic Research Method II", edited by The Japanese Biochemical Society, p105 (1986)], the phosphate triester method and the phosphate amidite method. Chemical synthesis means (J. Am. Chem. Soc., 89 , 4801).
91 , 3350 (1969); Science, 150 , 178 (196
8); Tetrahedron Lett., 22 , 1859 (1981); 24 , 245
(1983)] and methods for combining them. More specifically, the synthesis of DNA can be performed by a chemical synthesis using a phosphoramidite method or a triester method, or can be performed on a commercially available automatic oligonucleotide synthesizer. The double-stranded fragment synthesizes a complementary strand,
It can also be obtained from chemically synthesized single-stranded products by annealing the strands together under appropriate conditions or adding a complementary strand using a DNA polymerase with an appropriate primer sequence.

As a specific embodiment of the gene of the present invention, a gene having the nucleotide sequence shown in SEQ ID NO: 3 can be exemplified. The coding region in this nucleotide sequence (SEQ ID NO: 2
Shows an example of one combination of codons indicating each amino acid residue in the amino acid sequence shown in SEQ ID NO: 1. The gene of the present invention is not limited to a gene having such a specific base sequence, and may have a base sequence selected by combining arbitrary codons for each amino acid residue. Codons can be selected according to a conventional method, for example, by considering the codon usage of the host to be used [Ncleic Acids Res., 9 , 43 (1981)].

As described above, the gene of the present invention also includes a gene comprising a nucleotide sequence having a certain homology with the nucleotide sequence shown in SEQ ID NO: 2.

The above-mentioned homology is at least 70% identity, preferably at least 90% identity, more preferably at least 95% identity with the nucleotide sequence shown in SEQ ID NO: 2.
And their complementary strand polynucleotides.

Examples of such homologous genes include, for example, stringent conditions at 50 ° C. in 0.2 × SSC containing 0.1% SDS or at 60 ° C. in 1 × SSC containing 0.1% SDS. A gene having a nucleotide sequence that hybridizes with the DNA having the nucleotide sequence shown in SEQ ID NO: 2 can also be exemplified.

The gene of the present invention can be prepared based on the sequence information on the specific examples of the gene of the present invention disclosed by the present invention.
It can be easily produced and obtained by general genetic engineering techniques [Molecular Cloning 2d Ed, Cold Spring H
arbor Lab. Press (1989); see Seismic Chemistry Laboratory Course "Gene Research Methods I, II, III", edited by The Biochemical Society of Japan (1986), etc.).

Specifically, a cDNA library is prepared from an appropriate source expressing the gene of the present invention in accordance with a conventional method, and the desired library is prepared from the library using an appropriate probe or antibody specific to the gene of the present invention. can be carried out by selecting clones [Proc. Natl. Acad. Sci. , USA., 7
8 , 6613 (1981); Science, 222 , 778 (1983) and the like].

In the above, the origin of cDNA is as follows:
Examples include various cells and tissues expressing the gene of the present invention, and cultured cells derived therefrom. Separation of total RNA therefrom, separation and purification of mRNA, acquisition of cDNA, and cloning thereof can all be carried out according to conventional methods. In addition, cDNA libraries are commercially available, and in the present invention, such cDNA libraries, for example, Clontech Lab.
Various cDNA libraries commercially available from c.) can also be used.

The method for screening the gene of the present invention from a cDNA library is not particularly limited, either, and any conventional method can be used.

Specifically, for example, a method for selecting a corresponding cDNA clone from a protein produced by cDNA by immunoscreening using an antibody specific to the protein, and selectively binding to a target DNA sequence Examples include plaque hybridization and colony hybridization using a probe, and combinations thereof.

As the probe used herein, DNA or the like chemically synthesized based on the information on the nucleotide sequence of the gene of the present invention can be generally used. Available. In addition, sense primers and antisense primers set based on the nucleotide sequence information of the gene of the present invention can be used as screening probes.

The nucleotide sequence used as the probe is a partial nucleotide sequence corresponding to SEQ ID NO: 2, and comprises at least 15 contiguous bases, preferably 20 contiguous bases, more preferably 30 contiguous bases. Included are contiguous bases, most preferably those having 50 contiguous bases. Further, a positive clone having the above sequence itself can be used as a probe.

When obtaining the gene of the present invention, the PCR method
[Science,230, 1350 (1985)]
The width method can be suitably used. Especially from library to full length
If it is difficult to obtain cDNA of RACE,
[Rapid amplification of cDNA ends; experimental medicine,12
(6), 35 (1994)], especially the 5′-RACE method [M.A.
n, etal., Proc. Natl. Acad. Sci., USA.,8, 8998 (198
8)] is suitable.

The primers used when employing the PCR method can be appropriately set based on the sequence information of the gene of the present invention revealed by the present invention, and can be synthesized according to a conventional method. The isolation and purification of the amplified DNA / RNA fragment can be carried out according to a conventional method as described above, for example, by gel electrophoresis.

The gene of the present invention or various DNA fragments obtained as described above can be obtained by a conventional method, for example, the dideoxy method [Proc.
Natl. Acad. Sci., USA., 74 , 5463 (1977)) or the Maxam-Gilbert method (Methods in Enzymology, 65 , 499 (1977)).
980)], or simply using a commercially available sequencing kit or the like.

More specifically, for obtaining the gene of the present invention, for example, RNA is isolated from human tissue,
After obtaining poly (A) ⁺ RNA, the oligocapping method (Szuk
i, Y., and Sugano, S., et al., Gene, 200 , 149-156 (19
97)), a full-length cDNA library was prepared.
The clones in the library were subjected to 5 ′ EST (Expreq) using a 5 ′ random sequence using a commercially available automatic sequencer.
ssed Sequence tag) clones having the desired sequence by analysis to a specific program (`PSORT` program, PROTEINS:
Structure, Function, and Genetics, 11 , 95-110 (199
This can be achieved by selecting with a computer using 1)) and performing full-length analysis on the obtained clones.

According to the gene of the present invention thus obtained, the presence or absence of the expression of the gene of the present invention in an individual or various tissues can be specifically detected, for example, by utilizing a part or all of the nucleotide sequence of the gene. can do.

Such detection can be performed according to a conventional method, for example, RT-PCR [Reverse transcribed-Polyme
rase chain reaction; ES Kawasaki, et al., Amplif
ication of RNA.In PCR Protocol, A Guide to method
s and applications, AcademicPress, Inc., SanDiego, 2
RNA amplification and Northern blotting analysis [Molecular Cloning, Cold Spring Harbor La.
b. (1989)], in situ RT-PCR [Nucl.
s., 21 , 3159-3166 (1993)] and cell-level measurement using in situ hybridization, NASB
Method A [Nucleic acid sequence-based amplification, N
, 350 , 91-92 (1991)] and various other methods. Preferably, a detection method by RT-PCR can be mentioned.

The primer used in the case of employing the PCR method is not particularly limited as long as it is specific to the gene of the present invention and can specifically amplify only the gene of the present invention. Can be set appropriately based on Usually, primers having a partial sequence of the gene of the present invention having a length of about 10 to 35 nucleotides, preferably about 15 to 30 nucleotides can be mentioned.

As described above, the gene of the present invention includes DN used as a specific primer and / or a specific probe for detecting the kais7 gene of the present invention.
A fragment is also included.

The DNA fragment can be defined as a polynucleotide that hybridizes under stringent conditions to the polynucleotide having the nucleotide sequence of SEQ ID NO: 2. Here, examples of the stringent conditions include ordinary conditions used as primers or probes, and are not particularly limited. For example, 0.2 × S containing 0.1% SDS as described above may be used.
1 × S containing 50% in SC or 0.1% SDS in SC
The condition of 60 ° C. in SC can be exemplified.

According to the kais7 gene of the present invention, the gene product (kais7 protein) or a protein containing the same can be easily and stably produced in a large amount by using ordinary genetic engineering techniques.

Accordingly, the present invention also provides a polypeptide having an amino acid sequence encoded by the gene of the present invention (expression product of the gene of the present invention). A vector containing the same, a host cell transformed with the vector,
The present invention also provides a method for producing the polypeptide of the present invention by culturing the host cell.

As a specific embodiment of the polypeptide of the present invention, a polypeptide having the amino acid sequence represented by SEQ ID NO: 1 (kais7 protein) can be mentioned. Homologs are also included. As the homolog, a polypeptide consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1 and having the same function as the Kais7 protein, preferably Examples of the polypeptide include conservative amino acid residue substitution or modification of dozens of amino acids, more preferably modified polypeptide of several amino acids. Specifically, there may be mentioned gene products of homologs of the kais7 gene (kais7 equivalent genes including alleles).

Also, homologs of the kais7 protein of the present invention include mammals such as horses, sheep, cows, dogs, monkeys, cats and bears having the same activity as the polypeptide having the amino acid sequence represented by SEQ ID NO: 1. , Rats, mice,
Also included are proteins of rodents such as rabbits and guinea pigs.

The polypeptide of the present invention can be prepared by a conventional gene recombination technique (eg, Science, 224 , 1431 (1984); Biochem. B) based on the sequence information of the gene provided by the present invention.
iophys. Res. Comm., 130 , 692 (1985); Proc. Natl. Ac
ad. Sci., USA., 80 , 5990 (1983), etc.].

The production of the polypeptide is more particularly described
A recombinant DNA (expression vector) capable of expressing the gene encoding the desired protein in a host cell is prepared, introduced into a host cell, transformed, and the transformant is cultured.
It is then performed by recovery from the resulting culture.

As the above host cells, both prokaryotes and eukaryotes can be used. For example, prokaryotic hosts include a wide range of commonly used hosts such as Escherichia coli and Bacillus subtilis, and preferred examples include Escherichia coli, particularly those contained in Escherichia coli K12 strain. In addition, eukaryotic host cells include vertebrates, yeast and other cells, and as the former,
For example, COS cells [Cell, 23 : 175 (1
981)) and Chinese hamster ovary cells and their dihydrofolate reductase-deficient strains (Proc. Natl. Acad. Sc.
i., USA., 77 : 4216 (1980)).
Saccharomyces yeast cells and the like are preferably used. Of course, it is not limited to these.

When a prokaryotic cell is used as a host, a promoter and an SD (Shine and Shine & Co.) are used upstream of the gene so that the gene of the present invention can be expressed in the vector using a vector replicable in the host cell. (Dalgarno) An expression plasmid having a base sequence and an initiation codon (eg, ATG) necessary for initiation of protein synthesis can be suitably used. The above-mentioned vector is generally a plasmid derived from Escherichia coli, for example, pBR322, pBR325, pU
C12, pUC13 and the like are often used, but not limited thereto, and various known vectors can be used. Commercially available products of the above-mentioned vectors used in expression systems using Escherichia coli include, for example, pGEX-4T (Amersham P.
harmacia Biotech), pMAL-C2, pMAl-P
2 (New England Biolabs), pET21, pET2
1 / lacq (Invitrogen), pBAD / His (In
vitrogen).

In the case of using a vertebrate cell as a host, the expression vector usually has a promoter, an RNA splice site, a polyadenylation site, and a transcription termination sequence located upstream of the gene of the present invention to be expressed. Which may optionally have a replication origin. Specific examples of the expression vector include, for example, pS having the early promoter of SV40.
V2dhfr [Mol. Cell. Biol., 1 : 854 (1981)]. In addition to the above, various known commercial vectors can be used. Commercially available products of such vectors for use in animal cell-based expression systems include, for example, pE
GFP-N, pEGFP-C (Clontrech), pIN
D (Invitrogen), pcDNA3.1 / His (Invitrogen)
animal cells such as trogen) and pFastB
acHT (GibciBRL), pAcGHLT (Ph
arMingen), pAc5 / V5-His, pMT / V5
-His, pMT / Bip / V5-his (hereafter Invitr
ogen) and the like.

Further, as a specific example of an expression vector when a yeast cell is used as a host, for example, pAM82 having a promoter for the acid phosphatase gene [Proc.
Natl. Acad. Sci., USA., 80 : 1 (1983)]. Commercially available expression vectors for yeast cells include, for example, pP
ICZ (Invitrogen), pPICZα (Invitrogen
Company).

The promoter is not particularly limited. When Escherichia is used as a host, for example, tryptophan (trp) promoter, lpp promoter, la
c promoter, recA promoter, PL / PR promoter and the like can be preferably used. When the host is a bacterium belonging to the genus Bacillus, SP01 promoter, SP02 promoter, penP promoter and the like are preferable. As a promoter when yeast is used as a host, for example, p
H05 promoter, PGK promoter, GAP promoter, ADH promoter and the like can be suitably used. When an animal cell is used as a host, preferable promoters include an SV40-derived promoter, a retrovirus promoter, a metallothionein promoter, a heat shock promoter, a cytomegalovirus promoter, and an SRα promoter.

[0074] As an expression vector for the gene of the present invention, an ordinary fusion protein expression vector can also be preferably used. Specific examples of the vector include glutathione-S-
Examples include pGEX (Promega) for expression as a fusion protein with transferase (GST).

Examples of the polynucleotide sequence whose coding sequence of the mature polypeptide assists the expression and secretion of the polypeptide from the host cell include a secretory sequence and a leader sequence. Marker sequence (hexahistidine tag, histidine tag), in the case of mammalian cells, hemagglutinin (H
A) ・ Tags can be exemplified.

The method for introducing a desired recombinant DNA (expression vector) into a host cell and the method for transforming the same are not particularly limited, and various general methods can be employed.

The resulting transformant can be cultured according to a conventional method, and the polypeptide of interest of the present invention encoded by a gene designed as desired by the culture can be used to transform the intracellular, extracellular or cell membrane of the transformant. Is expressed and produced (accumulated, secreted).

As the medium used for the culture, various types of media commonly used depending on the host cells used can be appropriately selected and used, and the culture can be carried out under conditions suitable for the growth of the host cells.

The recombinant protein of the present invention thus obtained may be subjected to various separation operations utilizing its physical properties, chemical properties and the like [“Biochemical Data Book II”,
1175-1259, 1st edition, 1st printing, June 23, 1980, issued by Tokyo Chemical Co., Ltd .; Biochemistry, 25 (25), 8274 (198
6); Eur. J. Biochem., 163 , 313 (1987)).

The method includes, for example, ordinary reconstitution treatment, treatment with a protein precipitant (salting out method), centrifugation,
Osmotic shock method, sonication, ultrafiltration, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, high-performance liquid chromatography (HPL
Examples thereof include various types of liquid chromatography such as C), dialysis methods, and combinations thereof. Particularly preferred methods include affinity chromatography using a column to which a specific antibody against the polypeptide of the present invention is bound. Can be.

In designing a desired gene encoding the polypeptide of the present invention, k
The base sequence of the ais7 gene can be used favorably. The gene can be used by appropriately selecting and changing codons indicating each amino acid residue, if desired.

In the case where a part of the amino acid sequence or the amino acid sequence in the amino acid sequence encoded by the kais7 gene is modified by substitution, deletion, addition, or the like, the amino acid sequence may be modified as described in, for example, cytospecific mutagenesis. This can be done in various ways.

The polypeptide of the present invention also comprises
According to the amino acid sequence shown in No. 1, it can be produced by a general chemical synthesis method. The method includes a conventional liquid phase method and a solid phase method for peptide synthesis.

[0084] Such a peptide synthesis method is described in more detail below.
Based on the amino acid sequence information, a so-called stepwise elongation method in which each amino acid is sequentially linked one by one to extend the chain, a fragment consisting of several amino acids is synthesized in advance, and then each fragment is subjected to a coupling reaction. And the fragment condensation method, and the synthesis of the polypeptide of the present invention may be performed by any of them.

The condensation method adopted for the peptide synthesis described above also includes
Conventional methods can be followed, for example, azide method, mixed acid anhydride method, DCC method, active ester method, redox method, DPP
A (diphenylphosphoryl azide) method, DCC + additive (1-hydroxybenzotriazole, N-hydroxysuccinamide, N-hydroxy-5-norbornene-
2,3-dicarboximide) method and Woodward method.

The solvent that can be used in each of these methods can also be appropriately selected from well-known general solvents used in this kind of peptide condensation reaction. Examples thereof include dimethylformamide (DMF), dimethylsulfoxide (DMSO), hexaphosphoramide, dioxane, tetrahydrofuran (THF), ethyl acetate and the like, and a mixed solvent thereof.

In the above peptide synthesis reaction, carboxyl groups in amino acids or peptides not involved in the reaction are generally esterified to lower alkyl esters such as methyl ester, ethyl ester and tertiary butyl ester such as benzyl ester. And aralkyl esters such as p-methoxybenzyl ester and p-nitrobenzyl ester.

An amino acid having a functional group in a side chain, for example, a hydroxyl group of a tyrosine residue may be protected with an acetyl group, a benzyl group, a benzyloxycarbonyl group, a tertiary butyl group or the like. No need to do. Further, for example, a guanidino group of an arginine residue may be a nitro group, a tosyl group, a p-methoxybenzenesulfonyl group, a methylene-2-sulfonyl group, a benzyloxycarbonyl group, an isobornyloxycarbonyl group, an adamantyloxycarbonyl group or the like. Can be protected by various protecting groups.

The deprotection of these protecting groups in the amino acids and peptides having the above protecting groups and the finally obtained polypeptide of the present invention can also be carried out by a conventional method such as a catalytic reduction method, liquid ammonia / sodium, fluoride, etc. It can be carried out according to a method using hydrogen, hydrogen bromide, hydrogen chloride, trifluoroacetic acid, acetic acid, formic acid, methanesulfonic acid and the like.

The polypeptide of the present invention thus obtained is
Various methods described above, for example, ion-exchange resin, partition chromatography, gel chromatography, according to methods commonly used in the field of peptide chemistry such as countercurrent distribution method,
Purification can be performed as appropriate.

The polypeptide of the present invention can be suitably used as an immunizing antigen for preparing a specific antibody thereof. By using this antigen, desired antisera (polyclonal antibody) and monoclonal antibody can be obtained. it can.

The method of producing the antibody itself is well understood by those skilled in the art, and the present invention can also follow these conventional methods [for example, Seijisei Kagaku Kenkyusho “Immunobiochemical Research Method”, Japan See Biochemical Society (ed., 1986).

The antibody (the antibody of the present invention) thus obtained is
For example, it can be advantageously used for purification of the kais7 protein and its measurement or identification by immunological techniques. More specifically, for a known ACE having homology to the amino acid sequence encoded by the gene (polynucleotide) of the present invention, the aortic wall ACE mRNA level is increased in experimental hypertensive rats (Shiota,
N. et al., Hypertension, 20 , 168-174 (1992)) and increased left ventricular wall ACE mRNA in hypertensive hearts (Schunkert, H., et al., J. Clin. Inves.
t., 86 , 1913-1920 (1990)), it is possible to diagnose hypertension or cardiac hypertrophy or judge the degree of malignancy of hypertension or cardiac hypertrophy by using the above antibody.

The antibody of the present invention obtained as described above is also useful in the pharmaceutical field as a drug containing the antibody as an active ingredient. Accordingly, the present invention also provides a pharmaceutical composition comprising an antibody or an antibody fragment against the present kais7 polypeptide or a fragment thereof as an active ingredient.

The usefulness of the antibody of the present invention is that the gene of the present invention is highly expressed in the kidney, testis and small intestine as described above, and the specific antibody against the gene is expressed in the kidney, testis, small intestine tissue and blood vessels around it. It is thought that it suppresses ACE activity, antagonizes the activity, or acts hypotensively on blood pressure regulation.

Further, a sequence homolog of the polypeptide having the amino acid sequence shown in SEQ ID NO: 1 (kais7 protein), that is, one or more amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1. A polypeptide having the same amino acid sequence as that of the kais7 protein, but having no function similar to that of the kais7 protein. It is thought to have a function of suppressing the activity, antagonizing the activity, or exerting a hypotensive effect on blood pressure regulation.

Accordingly, the present invention provides a pharmaceutical composition comprising the antibody of the present invention as an active ingredient together with a polyfunctional compound having a function of suppressing the activity of the ACE, antagonizing the activity, or acting on blood pressure regulation in a hypotensive manner. It also provides a pharmaceutical composition containing a peptide or a fragment thereof as an active ingredient. The pharmaceutical compositions are useful as antihypertensives and cardiac hypertrophy inhibitors.

The above activity can be confirmed, for example, according to the method of Kushman et al. (DWCushman, et al., B
iochem. Pharmacol., 20 (7), 1637-1648 (1971)).

[0099] In the pharmaceutical composition of the present invention, the polypeptide as an active ingredient also includes a pharmaceutically acceptable salt thereof. Such salts include those prepared by methods well known in the art, for example, sodium, potassium, lithium,
Non-toxic alkali metal salts such as calcium, magnesium, barium and ammonium, alkaline earth metal salts, ammonium salts and the like are included. Further, the above salts also include non-toxic acid addition salts obtained by reacting the polypeptide of the present invention with a suitable organic or inorganic acid. Representative non-toxic acid addition salts include, for example, hydrochloride, hydrochloride, hydrobromide, sulfate, bisulfate, acetate, oxalate, valerate, oleate, laurate, Borate, benzoate, lactate, phosphate, p-toluenesulfonate (tosylate), citrate, maleate, fumarate, succinate, tartrate, sulfonate, glycolate , Maleate, ascorbate, benzenesulfonate and napsylate.

The above-mentioned pharmaceutical compositions include those containing the polypeptide of the present invention as an active ingredient and a pharmaceutically effective amount thereof together with a suitable nontoxic pharmaceutical carrier or diluent.

Pharmaceutical carriers that can be used in the above-mentioned pharmaceutical composition (pharmaceutical preparation) include fillers, extenders, binders, humectants, disintegrants, and surfactants that are usually used according to the use form of the preparation. And diluents such as lubricants or excipients, which are appropriately selected and used according to the dosage unit form of the obtained preparation.

Particularly preferred pharmaceutical preparations of the present invention include various components which can be used in ordinary protein preparations, for example, stabilizers, bactericides, buffers, isotonic agents, chelating agents, pH adjusters, surfactants It is prepared by using such as appropriate.

Examples of the stabilizer include human serum albumin, ordinary L-amino acids, saccharides, cellulose derivatives and the like, and these can be used alone or in combination with a surfactant. In particular, according to this combination, there are cases where the stability of the active ingredient can be further improved.

The L-amino acid is not particularly limited and may be, for example, any of glycine, cysteine, glutamic acid and the like.

The above-mentioned sugars are not particularly limited. For example, monosaccharides such as glucose, mannose, galactose and fructose, sugar alcohols such as mannitol, inositol and xylitol, disaccharides such as sucrose, maltose and lactose, dextran and hydroxypropyl Polysaccharides such as starch, chondroitin sulfate, and hyaluronic acid and derivatives thereof can be used.

The surfactant is not particularly limited, and both ionic and nonionic surfactants can be used.
For example, polyoxyethylene glycol sorbitan alkyl ester type, polyoxyethylene alkyl ether type, sorbitan monoacyl ester type, fatty acid glyceride type and the like can be used.

The cellulose derivative is not particularly limited, and methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose and the like can be used.

The amount of the saccharide to be added is about 0.0001 mg or more, preferably about 0.01 to 0.01 mg / μg of the active ingredient.
Suitably, the range is about 10 mg. The amount of the surfactant added is about 0.00001 mg per 1 μg of the active ingredient.
It is appropriate that the amount is not less than about, preferably about 0.0001 to 0.01 mg. The amount of human serum albumin to be added is about 0.0001 mg or more, preferably about 0.001 to 0.1 mg per 1 μg of the active ingredient. The amino acid is suitably used in an amount of about 0.001 to 10 mg per 1 μg of the active ingredient.
The amount of the cellulose derivative to be added is about 0.00001 mg or more per 1 μg of the active ingredient, preferably about 0.00001 mg.
It is appropriate to set the range of about 01 to 0.1 mg.

The amount of the active ingredient contained in the pharmaceutical preparation of the present invention is appropriately selected from a wide range, but is usually about 0.00000.
It is appropriate that the content is in the range of about 1 to 70% by weight, preferably about 0.0001 to 5% by weight.

In the pharmaceutical preparation of the present invention, various additives,
For example, a buffer, an isotonic agent, a chelating agent and the like can be added. Here, as the buffer, boric acid, phosphoric acid, acetic acid, citric acid, ε-aminocaproic acid, glutamic acid and / or a salt corresponding thereto (for example, alkali salts such as sodium salt, potassium salt, calcium salt, magnesium salt and the like) Metal salts and alkaline earth metal salts). Examples of the tonicity agent include sodium chloride, potassium chloride, sugars, glycerin and the like. Examples of the chelating agent include sodium edetate and citric acid.

The pharmaceutical preparation of the present invention can be used in the form of a solution. Alternatively, the preparation can be freeze-dried to a state in which it can be stored, and then dissolved in a buffer containing water for use, a saline solution, or the like. It is also possible to use it after adjusting it to an appropriate concentration.

As the dosage unit form of the pharmaceutical preparation of the present invention, various forms can be selected according to the purpose of treatment, and typical examples are tablets, pills, powders, powders, granules, capsules Solid dosage forms, such as solutions, suspensions,
Includes liquid dosage forms such as emulsions, syrups and elixirs which, depending on the route of administration, may further be oral, parenteral,
They are classified into nasal preparations, vaginal preparations, suppositories, sublingual preparations, ointments and the like, and can be prepared, molded or prepared according to the usual methods.

For example, in the case of molding into a tablet form, the above-mentioned preparation carrier such as lactose, sucrose, sodium chloride, glucose, urea, starch, calcium carbonate, kaolin, crystalline cellulose, silicic acid, potassium phosphate, etc. Agent, water, ethanol, propanol, simple syrup, glucose solution, starch solution, gelatin solution, carboxymethylcellulose, hydroxypropylcellulose,
Methylcellulose, binders such as polyvinylpyrrolidone, sodium carboxymethylcellulose, calcium carboxymethylcellulose, low-substituted hydroxypropylcellulose, dried starch, sodium alginate, agar powder, laminaran powder, sodium hydrogen carbonate,
Disintegrators such as calcium carbonate, surfactants such as polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate and stearic acid monoglyceride, disintegrators such as sucrose, stearin, cocoa butter, and hydrogenated oil; quaternary ammonium bases; Absorption enhancers such as sodium lauryl sulfate, humectants such as glycerin and starch, adsorbents such as starch, lactose, kaolin, bentonite and colloidal silicic acid, and lubricants such as purified talc, stearates, boric acid powder, and polyethylene glycol Sourcing agents and the like can be used.

Further, the tablet may be a tablet coated with a usual coating, if necessary, for example, a sugar-coated tablet, a gelatin-encapsulated tablet, an enteric-coated tablet, a film-coated tablet, or a double tablet or a multilayer tablet. Can also.

In the case of molding into the form of pills, pharmaceutical carriers such as glucose, lactose, starch, cocoa butter,
Excipients such as hardened vegetable oil, kaolin, and talc, gum arabic powder, tragacanth powder, binders such as gelatin and ethanol, and disintegrants such as laminaran and agar can be used.

Capsules are prepared by mixing the active ingredient of the present invention with the various pharmaceutical carriers exemplified above and filling the resulting mixture into hard gelatin capsules, soft capsules, and the like, according to a conventional method.

Liquid dosage forms for oral administration include pharmaceutically acceptable solutions containing conventional inert diluents, such as water,
It includes emulsions, suspensions, syrups, elixirs and the like, and may further contain auxiliaries such as wetting agents, emulsions and suspensions, which are prepared according to a conventional method.

In preparing liquid dosage forms for parenteral administration, such as sterile aqueous to non-aqueous solutions, emulsions and suspensions, diluents such as water, ethyl alcohol, propylene glycol, polyethylene glycol,
Vegetable oils such as ethoxylated isostearyl alcohol, polyoxylated isostearyl alcohol, polyoxyethylene sorbitan fatty acid esters and olive oil can be used, and injectable organic esters such as ethyl oleate can be blended. These may further contain ordinary solubilizers, buffers, wetting agents, emulsifiers, suspending agents, preservatives, dispersants and the like. Sterilization can be performed by, for example, a filtration operation of passing through a bacteria-retaining filter, blending of a bactericide, irradiation treatment and heat treatment. They can also be prepared in the form of sterile solid compositions which can be dissolved in sterile water or a suitable sterilizable medium immediately before use.

For shaping in the form of a suppository or a preparation for vaginal administration, for example, polyethylene glycol, cocoa butter, higher alcohol, esters of higher alcohol, gelatin, semisynthetic glyceride and the like can be used as the preparation carrier.

When forming into the form of an ointment such as paste, cream, gel, etc., diluents such as white petrolatum, paraffin, glycerin, cellulose derivatives, propylene glycol, polyethylene glycol,
Silicone, bentonite and vegetable oils such as olive oil can be used.

A composition for nasal or sublingual administration can be prepared by a conventional method using well-known standard excipients.

The drug of the present invention may contain a coloring agent, a preservative, a fragrance, a flavor, a sweetener, and other pharmaceuticals, if necessary.

The administration method of the above-mentioned pharmaceutical preparation is not particularly limited, and is determined according to various preparation forms, patient's age, gender and other conditions, degree of disease, and the like. For example, tablets, pills,
Solutions, suspensions, emulsions, granules and capsules are administered orally, injections are administered intravenously alone or in admixture with normal replenishers such as glucose and amino acids, and further intramuscularly alone if necessary. Administered intradermally, subcutaneously or intraperitoneally,
Suppositories are administered rectally, vaginal agents are administered intravaginally, nasal agents are administered intranasally, sublingual agents are administered intraorally, and ointments are administered topically transdermally.

The amount of the active ingredient to be contained in the pharmaceutical preparation and the dosage thereof are not particularly limited, and may be determined according to the desired therapeutic effect, administration method, treatment period, patient age, sex and other conditions. It is appropriately selected from a wide range. Generally, the dose is usually about 0.01 μg to 10 mg, preferably about 0.1 μg per kg of body weight per day.
The dosage is preferably about 1 to about 1 mg, and the preparation can be administered once or several times a day.

Further, as will be shown in the examples described later, the gene of the present invention is highly expressed in kidney, testis and small intestine tissues, and therefore, any gene including all or a part of the antisense strand of the kais7 gene of the present invention. If the gene expression vector is prepared and the expression vector is forcibly expressed in these tissues, the hypertensive effect such as hypertension, cardiac hypertrophy and arteriosclerosis is suppressed as a result, thereby suppressing the blood pressure control effect. It is thought that it becomes possible to suppress. The present invention also provides a gene therapy composition or a gene therapy agent having such anti-ACE activity or anti-bradykinin inactivating activity, a gene therapy vector and a gene therapy cell therefor.

The above-described gene therapy composition or gene therapy agent according to the present invention is a gene transfer vector containing the antisense strand of the gene of the present invention, or a cell into which the antisense strand of the gene of the present invention is introduced by the vector. As an active ingredient.

The composition for gene therapy or the gene therapy agent of the present invention can be administered to, for example, kidney, testis and small intestine cells of a hypertensive patient or a vascular tissue site of a patient, thereby inducing ACE activity or bradykinin inactivation in these tissues. It is possible to suppress the activation activity or suppress the expression level of the Kais7 gene in these cells, and thus to treat hypertension.

Hereinafter, such gene therapy will be described in detail.
In the following gene therapy methods, conventional methods of chemistry, molecular biology, microbiology, recombinant DNA, genetics and immunology can be used unless otherwise specified.
Examples thereof include, for example, Maniatis,
T., et al., Molecular cloning: A laboratory manual
(Cold Spring Harbor Laboratory, Cold Spring Harbo
r, New York (1982)), Sambrook, J., et.
al., Molecular cloning: A laboratory manual, 2nd E
d. (Cold Spring Harbor Laboratory, Cold Spring Har
bor, New York (1981)), Ausbel (FM, et.
al., Current Protocols in Molecular Biology, John W
iley and Sons, New York, New York, (1992)), Glover, D., DNA Cloning, I and II (Oxford Press)
(1985)), Anand, Anand, Techniques for the Analysis
of Complex Genomes, (Academic Press (1992)), Guthrie, G., et al., Guide to Yeast Genetics and
Molecular Biology, (Academic Press) (1991)) and Fink (Fink, et al., Hum.Gene Ther., 3 , 11-19 (199)
2)) can be mentioned.

The gene therapy of the present invention can be performed, for example, by
In a cell in which the gene is expressed, an RNA having a sequence complementary to the mRNA of the cell is created to inhibit translation, and
It can be carried out by introducing the antisense pharmaceutical composition capable of suppressing the expression of the ais7 gene and suppressing ACE activity or suppressing bradykinin inactivating activity. That is, according to the treatment method, for example, ka
combining the mRNA of the ACE-expressing cell having the is7 gene with the above-mentioned antisense pharmaceutical composition;
By allowing the composition to penetrate between the NA double helices to form a triplex, the transcription or translation process can be inhibited, thus suppressing the expression of the targeted gene. For this purpose, an antisense oligonucleotide complementary to the mRNA of the gene is produced, and the antisense oligonucleotide is supplied to target cells. When such an action of suppressing the expression function of the kais7 gene is supplied to cells, ACE activity or bradykinin inactivating activity in recipient cells / target cells can be suppressed. The supply of the antisense oligonucleotide to the target cell can be carried out by maintaining a vector or plasmid containing the antisense oligonucleotide outside the chromosome of the target cell.

According to the hypertension gene therapy using the above antisense oligonucleotide, the antisense oligonucleotide is incorporated into a retrovirus, adenovirus, or AAV-derived vector, and the ACE activity-expressing cells are infected with the antisense oligonucleotide. By overexpressing the antisense oligonucleotide, a desired antihypertensive effect can be obtained.

As described above, the introduction of the antisense oligonucleotide into the cell having the kais7 gene
When suppressing the expression of the s7 protein, the antisense oligonucleotide does not need to correspond to the full length of the corresponding kais7 gene.
As long as it retains the function of suppressing the expression function of the s7 gene, it may be the above-described variant or a partial sequence retaining a specific function.

Vectors into which a desired gene is to be introduced for both such recombination and extrachromosomal maintenance are already known in the art, and any of such known vectors can be used in the present invention. Examples of the vector include a viral vector or a plasmid vector containing a copy of the antisense oligonucleotide of the kais7 gene linked to an expression control element and capable of expressing the antisense oligonucleotide in a target cell. Such a vector may be the above-mentioned expression vector of the gene of the present invention itself. For example, US Pat.
No. 52479 and PCT International Publication WO93 / 0
No. 7282 (pWP-7).
A, pWP-19, pWU-1, pWP-8A, pWP
-21 and / or pRSVL) or pRC /
A vector prepared using CMV (manufactured by Invitrogen) or the like may be used, and the latter is preferable. More preferred vectors include the various viral vectors described below.

As a promoter used in a vector used in gene transfer therapy, a promoter specific to an affected tissue to be treated for various diseases can be suitably used. Specific examples are as follows.

That is, for example, for the liver, albumin, α-fetoprotein, α1-antitrypsin,
Transferrin and transstyrene can be exemplified. For the colon, examples thereof include carboxylate anhydrase I and carcinoembrogen antigen. For the uterus and placenta, estrogen, aromatase cytochrome P450, cholesterol side chain cleavage P450,
17α-hydroxylase P450 and the like can be exemplified.
For the prostate, prostate antigen, gp91-fox gene, prostate-specific kallikrein and the like can be exemplified.
For the breast, erb-B2, erb-B3, β-casein, β-lactoglobin, whey protein and the like can be exemplified. For the lung, the activator protein C uroglobulin can be exemplified. For skin, K-14-keratin, human keratin 1 or 6, leucrin and the like can be exemplified. For the brain, glial fibrillary acidic protein, mature astrocyte-specific protein, myelin, tyrosine hydroxylase pancreatic villin, glucagon, amyloid polypeptide of the islet of Langerhans and the like can be exemplified. For the thyroid gland, thyroglobulin, calcitonin and the like can be exemplified. For bone, α1 collagen, osteocalcin, bone sialoglycoprotein and the like can be exemplified. For the kidney, renin, liver / bone / kidney alkaline phosphatase, erythropoietin and the like can be exemplified, and for the pancreas, amylase, PAP1 and the like can be exemplified.

In the production of the antisense oligonucleotide introduction vector, the introduced antisense oligonucleotide (all or a part of the complementary sequence corresponding to the kais7 gene sequence) contains the base sequence information of the kais7 gene of the present invention. As described above, it can be easily manufactured and obtained by a general genetic engineering technique.

The introduction of such a vector for introducing an antisense oligonucleotide into cells is already known in the art for introducing DNA into cells, including, for example, electroporation, calcium phosphate coprecipitation, and virus transduction. Can be performed according to various methods. The cells transformed with the antisense oligonucleotide of the kais7 gene can be used as a drug for suppressing ACE activity or bradykinin inactivating activity in an isolated state, or as a model system for therapeutic research. It is also possible.

In gene therapy, the antisense
The oligonucleotide introduction vector can be introduced into target cells by local or systemic injection administration to a target tissue site of a patient. At this time, by systemic administration, the vector can reach any cells that can express ACE mRNA. If the transduced gene is not permanently integrated into the chromosome of each target cell, the administration can be repeated periodically.

[0138] The gene therapy method of the present invention includes an in vivo method in which the above-described vector for introducing an antisense oligonucleotide is directly administered into a body, and a method in which a target cell is once taken out of a patient's body and the above-mentioned method is used outside the body. It includes both ex vivo methods in which a gene (vector) is introduced and the cells are then returned to the body. Also Kais7
Gene therapy using ribozyme, an active molecule that cleaves RNA strands, can also be performed by directly introducing the antisense oligonucleotides into cells.

A gene introduction vector containing all or a fragment of an antisense oligonucleotide having a sequence corresponding to the kais7 gene of the present invention, and an antisense oligonucleotide of the human kais7 gene
The gene therapy agent of the present invention containing a cell into which an oligonucleotide is introduced as an active ingredient is particularly intended for its use for hypertension, but in addition to the hypertension, for example, cardiac hypertrophy, myocardial infarction, arteriosclerosis For hypertension complications and gene labeling.

[0140] The target cells into which the antisense oligonucleotide is introduced can be appropriately selected depending on the target of gene therapy (treatment). Examples thereof include cells in which ACE expression is observed as target cells, in particular, kidney cells, kidney, testis, small intestine tissues, and cells such as lymphocytes, fibroblasts, hepatocytes, hematopoietic stem cells, and the like. .

The method of introducing an antisense oligonucleotide in the above gene therapy includes a viral introduction method and a non-viral introduction method.

[0142] As a viral introduction method, Kais7
In view of the fact that the antisense oligonucleotide of the gene is a foreign substance expressed in normal cells, a method using a retrovirus vector as a vector can be mentioned. Other viral vectors include adenovirus vectors, HIV (human immunodeficiency vi)
rus) vector, adeno-associated virus vector (AA)
V, adeno-associated virus), herpes virus vector, herpes simplex virus (HSV) vector, and Epstein-Barr virus (EBV).
irus) vector.

As a non-viral gene transfer method,
Calcium phosphate coprecipitation method: Membrane-fused liposome in which DNA-encapsulated liposome is fused with inactivated Sendai virus whose gene has been disrupted in advance by ultraviolet rays to produce a membrane-fused liposome, and directly fused with cell membrane to introduce DNA into cells Method [Kato, K., et al., J. Biol. Chem., 266 , 220
71-22074 (1991)]; a method of coating plasmid DNA with gold and physically introducing the DNA into cells by high-pressure discharge [Yang, NS et al., Proc. Natl. Acad. Sci.,
87 , 9568-9572 (1990)]; naked DN which injects plasmid DNA directly into organs and tumors in vivo.
Method A [Wolff, JA, et al., Science, 247 , 1465-1467
(1990)]; Cationic liposome method of introducing genes embedded in multilamellar positively charged liposomes into cells [Kunio Yagi, History of Medicine, Vol. 175, No. 9, 635-637 (1995)];
In order to introduce a gene only into a specific cell and prevent the gene from entering other cells, a ligand-DNA complex method in which a ligand that binds to a receptor expressed in a target cell is bound to DNA and administered is performed [ Frindeis, et al., Trend
s Biotechnol., 11 , 202 (1993); Miller, et al., FAS
EB J., 9 , 190 (1995)].

The ligand-DNA complex method includes, for example, a method using asialoglycoprotein as a ligand targeting asialoglycoprotein receptor expressed by hepatocytes [Wu, et al., J. Biol. Chem., 266 , 14338 (1991); F
erkol, et al., FASEB J., 7 , 1081-1091 (1993)],
A method using transferrin as a ligand targeting a transferrin receptor strongly expressed by tumor cells [Wagner et al., Proc. Natl. Acad. Sci., US
A., 87 , 3410 (1990)].

The gene transfer method used in the present invention is as follows.
Any of the various biological and physical gene transfer methods described above may be appropriately combined. Examples of the method by the combination include a method of combining a plasmid DNA of a certain size with a polylysine-conjugated antibody specific to an adenovirus hexon protein. According to this method, the antisense oligonucleotide of the present invention can be introduced by binding the obtained complex to the adenovirus vector and infecting the cell with the thus obtained trimolecular complex. This method allows for efficient binding, internalization, and endosomal degradation before DNA coupled to the adenovirus vector is damaged.
In addition, the liposome / DNA complex can directly mediate gene transfer in vivo.

Hereinafter, a specific method for preparing a virus vector for introducing an antisense oligonucleotide of the present invention and a method for introducing an antisense oligonucleotide into a target cell or target tissue will be described.

[0147] The retroviral vector system comprises a viral vector and a helper cell (packaging cell).
Consists of Here, the helper cells previously express genes such as retroviral structural proteins gag (structural protein in virus particles), pol (reverse transcriptase), and env (envelope protein). Say not cells. On the other hand, viral vectors use packaging signals or LTRs (long terminal repeats).
s), but gag, po necessary for virus replication
It does not have structural genes such as l and env. The packaging signal is a sequence that serves as a tag during assembly of the virion. The selected gene (neo, hyg) and the desired introduced antisense oligonucleotide (all antisense oligonucleotides corresponding to kais7) incorporated into the cloning site are included. Nucleotides or fragments thereof) are inserted in place of the viral genes. Here, in order to obtain a high titer virus particle, it is important to shorten the insert as much as possible, widen the packaging signal including a part of the gag gene, and not leave the ATG of the gag gene. is there.

The antisense of the desired kais7 gene
By transferring the vector DNA incorporating the oligonucleotide into the helper cell, the vector genomic RNA is packaged by the virus structural protein produced by the helper cell to form a virus particle and secrete it. After a virus particle as a recombinant virus infects a target cell, DNA reversely transcribed from viral genomic RNA is integrated into a cell nucleus, and an antisense gene inserted into a vector is expressed.

As a method for increasing the efficiency of introducing a desired gene, a method using a fragment containing a cell adhesion domain of fibronectin, a heparin binding site and a junction segment [Hanenberg, H., et al., Exp. Hemat., 23 , 747 (199
5)] can also be adopted. Examples of the vector used in the retrovirus vector system include:
For example, a retrovirus derived from mouse leukemia virus [McLachlin, JR, et al., Proc. Natl. Acad.
es. Molec. Biol., 38 , 91-135 (1990)].

The method using an adenovirus vector will be described in detail.
Berkner, KL, Curr.Topics Microbiol.
Immunol., 158 , 39-66 (1992)), Yasuhiro Setoguchi et al. (Setog
uchi, Y., et al., Blood, 84 , 2946-2953 (1994)),
Kaneka Yumi et al. (Experimental Medicine, 12 , 28-34 (1994)) and Kenner et al. (Ketner, G., et al., Proc. Natl. Acad. Sci., USA., 9
1 , 6186-6190 (1994)].

For example, to construct a non-competent adenovirus vector, the E.
The 1 and / or E3 gene region is removed. Next, the desired desired foreign gene expression unit (the desired antisense oligonucleotide for introduction, ie, the kai of the present invention)
a plasmid vector comprising an antisense oligonucleotide of the s7 gene, a promoter for transcribing the antisense oligonucleotide, polyA conferring stability of the transcribed gene) and a part of adenovirus genomic DNA; 293 cells are co-transfected with a plasmid containing the adenovirus genome. By causing homologous recombination between the two and replacing the gene expression unit with E1, a non-proliferative adenovirus vector of the present invention containing the antisense oligonucleotide of the desired kais7 gene Can be created. Also,
Adenovirus genomic DNA can be incorporated into a cosmid vector to produce a 3 'adenovirus vector to which a terminal protein has been added. Furthermore, a YAC vector can also be used for producing a recombinant adenovirus vector.

Briefly describing the production of the adeno-associated virus (AAV) vector, AAV was discovered as a small virus contaminating the adenovirus culture system. This confirms the existence of the genus Parvovirus, which grows autonomously in host cells without requiring a helper virus for virus replication, and the genus Dependovirus, which requires a helper virus. The AAV is a common virus that has a wide host range and infects a variety of cells. The virus genome is composed of linear single-stranded DNA having a size of 4680 bases, and 145 bases at both ends are ITRs (inverted terminal).
exists) with a characteristic sequence called "repeat". This ITR portion serves as an origin of replication and serves as a primer. Furthermore, the ITR is also essential for packaging into virus particles and integration into chromosomal DNA of host cells. As for viral proteins, the left half of the genome encodes a nonstructural protein, that is, Rep, a regulatory protein that controls replication and transcription.

[0153] Recombinant AAV was prepared by using AAV
It can be carried out using the property of being incorporated into NA, and thus a desired gene transfer vector can be prepared. More specifically, this method uses a plasmid (AAV) in which ITRs at both ends of 5 ′ and 3 ′ of wild-type AAV are left and a desired antisense oligonucleotide for introduction (kais7 antisense oligonucleotide) is inserted between them. Vector plasmid). On the other hand, viral proteins required for virus replication and virus particle formation are supplied by another helper plasmid. It is necessary to prevent a common base sequence from being present between the two, and to prevent the appearance of wild-type virus due to genetic recombination. Thereafter, both plasmids are introduced, for example, by transfection into 293 cells, and further infected with an adenovirus (if 293 cells are used, a non-proliferating type) may be used as a helper virus to obtain a desired non-proliferating set. A recombinant AAV is produced. Subsequently, since the recombinant AAV is present in the nucleus, the cells are freeze-thawed and recovered, and the contaminating adenovirus is inactivated by heating at 56 ° C. Further, if necessary, the recombinant AAV is separated and concentrated by ultracentrifugation using cesium chloride. As described above, a desired recombinant AAV for gene introduction can be obtained.

Production of the EBV vector can be carried out, for example, according to the method of Shimizu et al. [Norio Shimizu, Cell Engineering,
14 (3), 280-287 (1995)].

The outline of production of the EBV vector for introducing an antisense oligonucleotide of the present invention is as follows.
The virus (Epstein-Barr virus: EBV) is a virus belonging to the family Herpes isolated from cultured cells derived from Burkitt's lymphoma in 1964 by Epstein et al. [Kieff, E. and Liebowitz, D. .: Vir
ology, 2nd ed. Raven Press, New York, 1990, pp.188
9-1920]. Since the EBV has the activity of transforming cells, in order to use it as a vector for gene transfer,
Viruses lacking this transforming activity must be prepared. This can be done as follows.

That is, first, the EBV genome near the target DNA into which the desired foreign gene is to be incorporated is cloned. The DNA fragment of the foreign gene and the drug resistance gene are inserted therein, and used as a vector for producing a recombinant virus. Next, the EBV-positive Akata cells are transfected with the vector for producing a recombinant virus cut out by an appropriate restriction enzyme. Recombinant virus generated by homologous recombination can be recovered together with wild-type Akata EBV by stimulating virus production by anti-surface immunoglobulin treatment. This is EBV
By infecting negative Akata cells and selecting resistant strains in the presence of the drug, Akata cells infected with only the desired recombinant virus without wild-type EBV can be obtained. Further, by inducing the virus activity in the recombinant virus-infected Akata cells, a large amount of the desired recombinant virus vector can be produced.

The production of a non-viral vector in which a desired antisense oligonucleotide is introduced into a target cell without using a recombinant viral vector can be performed, for example, by a gene transfer method using membrane-fused liposomes. These are membrane liposomes (vesicles composed of lipid bilayers)
In this method, the content of the liposome is directly introduced into cells by giving the cell a fusion activity to the cell membrane.

The introduction of the antisense oligonucleotide using the membrane-fused liposome can be carried out, for example, by the method of Nakanishi et al. [Nakanishi, M., et al., Ex.
p. Cell Res., 159 , 399-499 (1985); Nakanishi, M.,
et al., Gene introductioninto animal tissues. In
Trends and Future Perspectives in Peptide and Prot
ein Drug Delivery (ed. by Lee, VH et al.)., Harw
ood Academic Publishers Gmbh.Amsterdam, 1995, pp.
337-349].

Hereinafter, introduction of the antisense oligonucleotide by the membrane-fused liposome will be briefly described. That is, a Sendai virus whose gene has been inactivated by ultraviolet rays and a liposome encapsulating a high molecular substance such as a desired antisense oligonucleotide or expressed protein are fused at 37 ° C. This membrane-fused liposome has a structure called pseudo or ils with a liposome-derived cavity on the inside and the same spikes as the virus envelope on the outside. After further purification by sucrose density gradient centrifugation, the membrane-fused liposome is incubated at 4 ° C. against the target cultured cells or tissue cells.
To adsorb. Then, at 37 ° C., the contents of the liposome are introduced into the cells, and the desired antisense oligonucleotide can be introduced into the target cells. Here, as the lipid used as the liposome, it is preferable to use a 50% (molar ratio) cholesterol, lecithin and a synthetic phospholipid having a negative charge to prepare a unilamellar liposome having a diameter of 300 nm.

As a method for introducing an antisense oligonucleotide into a target cell using another liposome, an antisense oligonucleotide using a cationic liposome is used.
An oligonucleotide introduction method can be mentioned. The method can be carried out according to the method of Yagi et al. [Yagi, K., et al.
al., BBRC, 196 , 1042-1048 (1993)]. This method focuses on the fact that both plasmids and cells are negatively charged, and gives a positive charge to both the inside and outside of the liposome membrane to increase plasmid uptake by static electricity and enhance interaction with cells. Is what you do. As the liposome used here, multilamellar large vesicles (MLV) having a positive charge are useful, but large unilamellar liposomes (large unilamellar veins) are used.
sicles: LUV and small unilamellar liposomes (small un
It is also possible to create a complex with the plasmid using ilamellar vesicles (SUV) and introduce the desired antisense oligonucleotide.

An outline of the method for preparing plasmito-embedded cationic MLV is as follows.
(α-trimethylammonioacetyl) -didodecyl-D-glutamate
chloride), DLPC (dilauroyl phosphatidylcholin)
e) and DOPE (dioleoylphosphatidylethanolamin)
A chloroform solution (1 mM in lipid concentration) containing e) in a molar ratio of 1: 2: 2 is prepared. Next, a total of 1 μmol of lipid is put into a Spitz-type test tube, and chloroform is removed under reduced pressure by a rotary evaporator to prepare a lipid thin film. Further, chloroform is completely removed under reduced pressure and dried. Then, 0.5 μl of Dulbecco's phosphate buffered saline containing Mg and Ca containing 20 μg of the gene transfer plasmid was added, and after purging with nitrogen gas, the mixture was stirred with a vortex mixer for 2 minutes to give the desired antisense DNA. A plasmid-embedded cationic MLV suspension containing the oligonucleotide can be obtained.

One example of using the plasmid-embedded cationic MLV obtained above as a gene therapy agent is as follows:
For example, an expression plasmid incorporating an antisense oligonucleotide for expression purpose is added to the above cationic MLV by D.
0.6 μg in NA amount and 30 in liposome lipid amount
A nanomolar embedding method, a method in which this is suspended in 2 μl of a phosphate buffered saline and administered every other day to target cells or patient tissues extracted from a patient can be exemplified.

By the way, gene therapy is defined in the Ministry of Health and Welfare guidelines as "administration of a gene or a cell into which a gene is introduced into a human body for the purpose of treating a disease". However, the gene therapy according to the present invention, in addition to the definition of the guidelines, introduces hypertension by introducing an antisense oligonucleotide of the kais7 gene into the above-mentioned target cells as an ACE expression-suppressing antisense DNA. It includes not only the treatment of various diseases, but also the introduction of a marker gene or cells into which a marker gene has been introduced into the human body.

In the gene therapy of the present invention, the method of introducing a desired gene into a target cell or target tissue typically includes two types of methods.

In the first method, target cells are collected from a patient to be treated, and the cells are cultured outside the body by adding, for example, interleukin-2 (IL-2) or the like, and contained in a retrovirus vector. This is a method (ex vivo method) of retransplanting the obtained cells after introducing an antisense oligonucleotide of the desired kais7 gene. The method is suitable for treating ADA deficiency, genetic diseases caused by defective genes, arteriosclerosis, cancer, AIDS, and the like.

The second method is a direct gene transfer method in which a desired antisense oligonucleotide (antisense oligonucleotide of the kais7 gene) is directly injected into a target site such as a patient's body, kidney, testis, and small intestine tissue ( Direct method).

The first method of the gene therapy is performed in more detail, for example, as follows. That is, mononuclear cells collected from a patient are collected from monocytes using a blood separator, and the collected cells are cultured in an appropriate medium such as AIM-V medium for about 72 hours in the presence of IL-2, A vector containing the antisense oligonucleotide to be introduced (antisense oligonucleotide of the kais7 gene) is added. In order to increase the introduction efficiency of the antisense oligonucleotide, in the presence of protamine at 32 ° C. for 1 hour,
After centrifugation at 2500 rpm, the cells may be cultured at 37 ° C. under a 10% carbon dioxide gas condition for 24 hours. After repeating this operation several times, the cells were further cultured for 48 hours in an AIM-V medium or the like in the presence of IL-2, the cells were washed with physiological saline, the number of viable cells was calculated, and the efficiency of introduction of the antisense oligonucleotide was increased. The in situ PCR or, for example, if the desired target is an ACE activity or a bradykinin inactivating activity as in the present invention, the degree of the activity is measured to confirm the effect of introducing the desired antisense oligonucleotide. I do.

Further, the safety is checked by, for example, culturing bacteria and fungi in cultured cells, detecting the presence or absence of mycoplasma infection, and searching for endotoxin. After confirming the safety, the antisense oligonucleotide at the anticipated effective dose is confirmed. (K
ais7 gene antisense oligonucleotide)
The cultured cells into which is introduced are returned to the patient by intravenous drip. Gene therapy is performed by repeating such a method at intervals of several weeks to several months, for example.

Here, the dose of the viral vector is appropriately selected depending on the target cells to be introduced. Usually, the virus titer is, for example, 1 × 10 ⁸ cells per 1 × 10 ⁸ target cells.
It is preferable to adopt a dose in the range of 0 ³ cfu to 1 × 10 ⁸ cfu.

As an alternative to the first method, a virus-producing cell containing a retroviral vector containing a desired antisense oligonucleotide (antisense oligonucleotide of the kais7 gene) and, for example, a patient's cell are co-cultured. Antisense and
A method of introducing an oligonucleotide (antisense oligonucleotide of the kais7 gene) can also be adopted.

In carrying out the second method (direct method) of gene therapy, a target antisense oligonucleotide (antisense oligonucleotide of the kais7 gene) is actually introduced by a gene transfer method, particularly by a preliminary experiment in vitro. Whether or not the desired therapeutic effect is confirmed by previously searching for the vector gene cDNA by PCR or in situ PCR, or by introducing a desired antisense oligonucleotide (antisense oligonucleotide of the kais7 gene). It is desirable to confirm the increase in specific activity, the increase in growth of target cells, and the suppression of growth. When a virus vector is used, search for proliferative retroviruses, etc.
It is important to confirm the safety by introducing antisense oligonucleotides in gene therapy, such as by performing the R method, measuring the reverse transcriptase activity, or monitoring the membrane protein (env) gene by the PCR method. Needless to say, there is.

In the gene therapy method of the present invention, particularly for hypertension and hypertension complications, for example, renal cells (ACE-expressing cells) are collected from patients, and cultured cells are enzymatically treated to establish cultured cells. For example, a retrovirus is introduced into a renal cell (ACE-expressing cell) targeting a desired antisense oligonucleotide, and after screening in G418 cells, the expression level of IL-12 or the like is measured (in vitro).
In vivo), followed by radiation treatment, and the patient's kidney, testis, small intestine or pararenal, testis, small intestine
One example is a method for treating hypertension and its complications inoculated with oligonucleotide-transfected cells.

The present invention also relates to a method for introducing a vector for introducing an antisense oligonucleotide of the present invention or a cell into which an objective antisense oligonucleotide (such as the antisense oligonucleotide of the kais7 gene) has been introduced as an active ingredient, and using the same as an active ingredient. Provided is a pharmaceutical composition or a pharmaceutical preparation (gene therapeutic agent) which contains a therapeutically effective amount together with a suitable non-toxic pharmaceutical carrier or diluent.

Pharmaceutical carriers which can be used in the pharmaceutical composition (pharmaceutical preparation) of the present invention include fillers, extenders, binders, humectants, disintegrants, and the like which are usually used depending on the use form of the preparation.
Diluents or excipients such as surfactants and lubricants can be exemplified, and these can be appropriately selected and used depending on the dosage unit form of the resulting preparation.

The dosage unit form of the pharmaceutical preparation of the present invention includes
The same ones as exemplified in the above-mentioned examples of the preparation of the kais7 protein antibody preparation can be exemplified, and can be appropriately selected from various forms according to the purpose of treatment.

For example, a pharmaceutical preparation containing the vector for introducing an antisense oligonucleotide of the present invention may be a virus containing a retrovirus vector in which the vector is embedded in a liposome or a desired antisense oligonucleotide is included. Prepared in the form of infected cells.

These are phosphate buffered saline (pH
7.4), can be prepared in a form mixed in Ringer's solution, injection for intracellular composition liquid, etc., or can be prepared in a form to be administered together with a substance such as protamine which enhances gene transfer efficiency. .

The administration method of the above pharmaceutical preparation is not particularly limited, and is determined according to various preparation forms, age, sex and other conditions of the patient, degree of disease, and the like.

The amount of the active ingredient to be contained in the pharmaceutical preparation and the dose thereof are not particularly limited, and may be selected according to the desired therapeutic effect, administration method, treatment period, patient age, sex and other conditions. It is appropriately selected from a wide range.

Generally, the dosage of the desired antisense oligonucleotide-containing retroviral vector as a pharmaceutical preparation is from about 1 × 10 ³ pfu to 1 × 10 ¹⁵ per kg of body weight per day, for example, as a retrovirus titer.
It is good to be about pfu.

In the case of cells into which the desired antisense oligonucleotide for introduction has been introduced, it is appropriate to select from the range of about 1 × 10 ⁴ cells / body to about 1 × 10 ¹⁵ cells / body.

The preparation may be administered once or several times a day, or may be administered intermittently at intervals of one to several weeks. Preferably, it can be co-administered with a substance such as protamine which enhances gene transfer efficiency or a preparation containing the substance.

When the gene therapy according to the present invention is applied to the treatment of hypertension, the above-mentioned various gene therapies can be appropriately combined (combined gene therapy). Diet therapy or the like can be performed in combination. Further, the gene therapy of the present invention can be carried out with reference to NIH guidelines including its safety [Recombinant DNA Advisory Committ
ee, Human Gene Therapy, 4 , 365-389 (1993)].

According to the present invention, a biological sample such as blood or serum is prepared, nucleic acid is extracted, if desired, and the susceptibility gene for kais7 is detected in order to detect the presence of the kais7 gene that promotes ACE activity of the cells. It can be analyzed for its presence. Further, according to the present invention, ACE activity level in cells or tissues, ACEmR
To detect the expression level of NA, progression to blood pressure regulation dysfunction or its presence as a prognostic indicator, a biological sample having blood pressure regulation dysfunction is prepared to determine whether the kais7 gene is present or its mRNA. Can be analyzed for quantity. By using this method, it is possible to detect the level of ACE activity in cells or tissues, the expression level of ACE mRNA, the progression to blood pressure regulation dysfunction, or the presence as an indicator of prognosis. In addition, it is possible to determine the therapeutic effect of hypertension and predict the prognosis.

In the detection method, for example, the DNA fragment is prepared based on information on the kais7 gene previously obtained from a patient sample having ACE activity, and is used for screening and / or amplification of the kais7 gene. Designed. More specifically, those having a property as a probe in, for example, plaque hybridization, colony hybridization, southern blotting, northern blotting, and the like, and the polymerase chain reaction (PC
R), D of all or a part of amplified
A probe having properties as a probe for obtaining an NA fragment can be prepared. First of all, Kai
A primer having the same sequence as s7 is prepared and used as a screening probe, and a biological sample (nucleic acid sample)
The presence of the gene having the kais7 sequence can be confirmed by reacting The nucleic acid sample is
Various methods to facilitate detection of the target sequence, such as denaturation,
It may be prepared by restriction digestion, electrophoresis or dot blotting.

As the screening method, in particular,
From the viewpoint of sensitivity, it is preferable to use the CR method.
as long as it is a method of using kais7 fragments as primers not particularly limited, conventionally known method (Science, 230, 135
0-1354 (1985)) and newly developed or future PCR variants (Yoshiyuki Sakaki, et al., Yodosha, Experimental Medicine,
Extra number, 8 (9) (1990); protein / nucleic acid / enzyme, extra number, Kyoritsu Shuppan Co., Ltd., 35 (17) (1990)) can be used.

The DNA fragment used as a primer is an oligo DNA chemically synthesized.
NA can be synthesized using an automatic DNA synthesizer or the like, for example, a DNA synthesizer (Pharmacia LKB Gene Assembler Plus: manufactured by Pharmacia). The length of the synthesized primer (sense primer or antisense primer) is preferably about 10 to 50 nucleotides, and more preferably about 15 to 30 nucleotides. The probe used for the above screening is usually a labeled probe, but may be unlabeled or may be detected by specific binding to a directly or indirectly labeled ligand. Suitable labels and methods for labeling probes and ligands are known in the art and can be incorporated by known methods, such as nick translation, random priming or kinase treatment. Radiolabels, biotin, fluorescent groups, chemiluminescent groups, enzymes, antibodies and the like are encompassed by these techniques.

As the PCR method used for the detection, for example, an RT-PCR method is exemplified, but various modified methods used in the art can be applied.

Further, the measuring method of the present invention is applied to the method of measuring ka in a sample.
By using a reagent kit for detecting the is7 gene, it can be easily carried out.

Therefore, the present invention provides a kit for detecting Kais7, which comprises the above-mentioned Kais7 DNA fragment.

The reagent kit contains at least SEQ ID NO: 2
If a DNA fragment that hybridizes to a part or all of the base sequence shown in or a complementary base sequence thereof is contained as an essential component, a labeling agent, P
Indispensable reagents for CR method (for example, Taq DNA polymerase, deoxynucleotide triphosphate, primer, etc.)
May be included.

Examples of the labeling agent include a radioisotope or a chemically modified substance such as a fluorescent substance.
The fragment itself may be conjugated with the labeling agent in advance. Further, the reagent kit may contain a suitable reaction diluent, a standard antibody, a buffer, a detergent, a reaction stop solution, etc., for the benefit of performing the measurement.

Further, the present invention also provides a method for diagnosing cancer using the above-mentioned measuring method, a diagnostic agent used for the method, and a diagnostic kit.

Further, by using the above-described method, the Kais7 sequence obtained from the test sample is directly or indirectly sequenced, so that a new Kais7 which is highly homologous to wild-type Kais7 is obtained. Related genes related to genes can be found.

Accordingly, the present invention also provides a method for screening a related gene related to the human kais7 gene in a test sample by such measurement and sequencing of the kais7 DNA in the test sample.

Also, a polypeptide encoded by the human Kais7 gene represented by SEQ ID NO: 1 of the present invention or an amino acid in which one or several or more amino acids are deleted, substituted or added in SEQ ID NO: 1 By synthesizing a polypeptide from the sequence, or a fragment thereof, or by synthesizing an antibody against the polypeptide;
It becomes possible to measure wild-type and / or mutant kais7.

Accordingly, the present invention provides a method for measuring an antibody and an antigen for wild-type and / or mutant kais7. The degree of ACE activity, the degree of impaired blood pressure regulation, or the severity of hypertension,
It is also possible to detect the degree of hypertensive complications such as cardiac hypertrophy based on changes in wild-type Kais7 polypeptide. Such alterations can also be determined by Kais7 sequence analysis by conventional techniques in the art, but more preferably, antibodies (polyclonal or monoclonal antibodies) are used to detect differences in the Kais7 polypeptide or the presence or absence of the Kais7 polypeptide. be able to. As a specific example of the measurement method of the present invention, Kais
The 7 antibody can immunoprecipitate the kais7 protein from a solution containing a biological material sample collected from a human such as blood or serum, and react with the kais7 polypeptide on a Western blot or immunoblot of a polyacrylamide gel. In addition, the kais7 antibody can be used to detect kai in paraffin or frozen tissue sections using immunohistochemical techniques.
The s7 polypeptide can be detected. Since antibody production technology and purification technology are well known in the art, these technologies can be appropriately selected.

More preferred embodiments related to the method for detecting wild-type kais7 or a mutant thereof include enzyme-linked immunosorbent assay (ELISA), including a sandwich method using a monoclonal antibody and / or a polyclonal antibody, and radioimmunoassay. Assay (RIA), Immunoradiometric Assay (IRMA) and Immunoenzymatic Assay (IEMA)
Is included.

[0199] The present invention can also provide a cell membrane fraction having a kais7 binding activity to a kais7 polypeptide or a kais7 receptor present on the cell surface. The Kais7 receptor is obtained by conjugating a labeled Kais7 protein in a biomaterial sample containing a cell membrane fraction, extracting / isolating and purifying a Kais7-binding reactant, and specifying the amino acid sequence of the isolate. Achieving and obtaining and sequencing the said kais7 receptor polypeptide protein can be readily accomplished by those skilled in the art.

Further, the present invention provides a method of screening a compound (kais7 receptor reactant: a compound comprising a low molecular weight compound, a high molecular weight compound, It can be used for screening proteins (polypeptides), protein (polypeptide) partial fragments, antigens or antibodies. Preferably, k
Utilizes the ais7 receptor. The Kais7 receptor polypeptide or fragment thereof used in such a screening test may be free in solution attached to a solid support or carried to the cell surface.

As an example of drug screening, for example, prokaryotic or eukaryotic host cells stably transformed with a recombinant polypeptide expressing a kais7 polypeptide or a fragment thereof, are preferably used in competitive binding assays. Can be used. Such cells, either in free or fixed form, can also be used in standard binding assays. More specifically, the formation of a complex between the Kais7 receptor polypeptide or fragment thereof and the substance to be tested is measured, and the interaction between the Kais7 receptor polypeptide or fragment thereof and the Kais7 polypeptide or fragment thereof is measured. Compounds can be screened by detecting the extent to which complex formation is inhibited by the agent being tested.

Thus, the present invention provides for contacting such a substance with a Kais7 receptor polypeptide or a fragment thereof by methods known in the art, and then contacting the substance with the Kais7 receptor polypeptide or a fragment thereof. The presence of the complex or the Kais7 receptor
It is possible to provide a drug screening method characterized by measuring the presence of a complex between a polypeptide or a fragment thereof and a ligand. Furthermore, kai
The s7 receptor activity was measured, and
7 receptor, and thus a ka as defined above
whether the activity of is7, such as ACE activity or bradykinin inactivating activity, can be modulated or ACE mRNA
It is determined whether the expression level of can be adjusted or the blood pressure of a model animal can be adjusted. In such a competitive binding assay, more specifically, the Kais7 receptor polypeptide or a fragment thereof is labeled. Free Kais7 receptor polypeptide or fragment thereof is separated from that present in the protein: protein complex, and the amount of free (uncomplexed) label is determined by the binding of the tested agent to the Kais7 receptor or the Kais7 receptor, respectively. Receptor: k
It is a measure of inhibition of ais7 protein binding. A small peptide of the kais7 protein (peptide mimetic) is analyzed in this way, and those having a kais7 receptor inhibitory activity can be measured.

In the present invention, another method for drug screening is a screening method for a compound having an appropriate binding affinity for the kais7 receptor polypeptide, which, in short, can be used to test a number of different peptide tests. Compounds are synthesized on a solid support, such as the surface of a plastic pin or other material, and then the peptide test compound is reacted with the Kais7 receptor polypeptide and washed. Subsequently, a method for detecting the reaction-bound Kais7 receptor polypeptide using a known method can also be exemplified (PCT Patent Publication No. WO84-0356).
No. 4). Purified Kais7 receptor can be coated directly onto plates used in the drug screening techniques described above. However, non-neutralizing antibodies against the polypeptide can be used to supplement the antibody and immobilize the Kais7 receptor polypeptide on a solid phase. The present invention is further directed to the use of a competitive drug screening assay, wherein the binding of a Kais7 receptor polypeptide or fragment thereof to a Kais7 receptor polypeptide is determined.
The test compound is allowed to compete with a neutralizing antibody capable of specifically binding to the receptor polypeptide. The competition by the antibodies makes it possible to detect the presence of any peptide having one or more antigenic determinants of the kais7 receptor polypeptide.

Further, with respect to drug screening, additional methods include the use of host eukaryotic cell lines or cells that contain a non-functional kais7 gene. After growing the host cell line or cells in the presence of the drug compound for a period of time, the rate of growth of the host cell is measured to allow the compound to bind, for example, to a protein that regulates ACE activity or inactivation of bradykinin. Or dissociation regulates the transport of binding proteins in blood and tissues,
Confirm whether the activity itself can be regulated.
As one means of measuring the growth rate, the biological activity of the Kais7 receptor can be measured.

Also according to the present invention, to develop a more active or stable form of a Kais7 polypeptide derivative or, for example, an agent that enhances or interferes with the function of Kais7 polypeptide in vivo, It is possible to make biologically active polypeptides or structural analogs of interest with which they interact, such as a kais7 agonist, a kais7 antagonist, a kais7 inhibitor, and the like. The structural analog may be, for example, X-ray crystallography, computer modeling, or the three-dimensional structure of a complex of Kais7 and another protein.
It can be determined by a combination of these methods. Information on the structure of a structural analog can also be obtained by protein modeling based on the structure of a homologous protein.

The more active or more stable form of k
As a method for obtaining an ais7 polypeptide derivative, analysis can be performed by, for example, alanine scanning. The method involves substituting Ala for an amino acid residue and measuring each of the amino acid residues of the peptide in a manner that measures its effect on the activity of the peptide, thus determining regions important for the activity and stability of the peptide. Is the way. By this method, more active or stable Kais7 polypeptide derivatives can be designed.

It is also possible to isolate a target-specific antibody selected by a functional assay and then analyze its crystal structure. In principle, this approach allows the pharmacoma (pharmac
ore). By generating anti-idiotypic antibodies to functional pharmacologically active antibodies, it is possible to identify and isolate peptides from a bank of chemically or biologically generated peptides. Therefore, the selected peptide is also expected to act as a pharmacore.

Thus, a drug having improved Kais7 activity or stability or an action as an inhibitor, agonist, antagonist or the like of Kais7 activity can be designed and developed.

By utilizing the cloned kais7 gene, a sufficient amount of the kais7 polypeptide is obtained and
Analytical studies such as line crystallography can also be performed. Further, by providing the Kais7 polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1 of the present invention, it can be applied to computer modeling technology instead of or in addition to X-ray crystallography.

Further, according to the present invention, it is possible to determine whether any part of the kais7 gene sequence affects various kais7 activities as described above in vivo by preparing a knockout mouse (mutant mouse) containing the kais7 gene. That is, the Kais7 gene product and the modified Kais7
The function of the gene product in vivo can be confirmed.

The method is a technique for intentionally modifying the genetic information of an organism by utilizing homologous recombination of a gene, and includes a method using mouse embryonic stem cells (ES cells) (Capeccchi, MR, Science, 244 , 1288-1292 (198
9)).

The method for producing the above mutant mouse is already a common technique for those skilled in the art, and this modified technique is used.
(Tetsuo Noda, ed., Experimental Medicine, extra edition, 14 (20) (1996), Youtosha).
Mutated mice can be easily prepared by adapting the s7 gene.
Therefore, a drug having improved Kais7 activity or stability or an action as an inhibitor, agonist, antagonist or the like of Kais7 activity can be designed and developed by adaptation of the above technology.

[0213]

According to the present invention, human testis type ACE, human somatic cell type ACE, mouse testis type ACE, mouse somatic cell type ACE, rat testis type ACE, rat somatic cell type, chicken ACE, rabbit testis type ACE Encoding a novel human protein homolog with homology to rabbit somatic cell type
An E-like gene is provided.

The gene of the present invention has high expression in kidney, testis and small intestine, and is thought to promote ACE activity or bradykinin inactivating activity in these tissues and surrounding tissues. By analyzing the expression level, ACE activity, and the like of the kais7 gene of the present invention, it can be used for research on the relationship between the function of related genes and various diseases. The present invention can be used for application research to pharmaceutical use by antibodies or antisense to expression products.

Further, according to the use of the gene of the present invention, the expression status of the gene in various tissues can be examined, and its function in a living body can be analyzed.

According to the gene, a large amount of the kais7 polypeptide encoded by the gene can be produced by genetic engineering. According to the provision of the polypeptide,
Functions such as the Kais7 polypeptide activity and the binding activity of the Kais7 polypeptide can also be examined.

[0217] The Kais7 polypeptide is also a Kais7 polypeptide.
Diseases involving 7 genes and their products (eg, AC
It is useful for elucidation, diagnosis, treatment and the like of diseases related to E activity or bradykinin inactivating activity or diseases related to blood pressure regulation, particularly hypertension and hypertension complications such as cardiac hypertrophy).

According to the present invention, there is further provided a gene transfer vector containing a kais7 antisense oligonucleotide useful for gene therapy, a cell into which the kais7 antisense oligonucleotide has been introduced, and the vector or cell as an active ingredient. And a gene therapy method utilizing the same.

According to the present invention, A
An antisense oligonucleotide or kais7-binding antibody or an antibody or a fragment thereof, which has an inhibitory effect on CE mRNA expression and is used for treating diseases and conditions such as hypertension and hypertension complications due to the effect. Pharmaceuticals as active ingredients can also be provided.

[0220]

The present invention will be described in more detail with reference to the following examples. The present invention is not limited to this.

[0221]

Example 1 (1-1) Isolation of clone from human normal ileum full-length cDNA library From 2 g of human normal ileum tissue, 2 mg of total RNA was isolated using Isogen (manufactured by Nippon Gene), and Oligotex was used. Poly (A) ⁺ RNA-dT30 was purified using -dT30 super (oligotex-dT30 super: manufactured by Daiichi Pharmaceutical Co., Ltd.). Oligocapping method using 50 μg of poly (A) ⁺ RNA (Szuki Y, and Sugano S, et al., Gene, 200
(1997) 149-156).

That is, 2 mg of total RNA was isolated from 2 g of human normal ileum tissue using Isogen, and poly (A) ⁺ RNA was purified using Oligotex-dT30 super.

Oligo-capping was performed according to the method of Maruyama and K. (Maruyama, K. and Sugano, S., Gene, 138 , 171-174).
(1994)) with some modifications. That is, poly (A) ⁺
50 μg of RNA was mixed with 100 μl of 100 mM Tris-HCl (pH 8.0, 100 units of RNasin (promega), 5 μg).
The mixture was treated at 37 ° C. for 40 minutes with mM 2-mercaptoethanol, 1.2 units of alkaline phosphatase (BAP: manufactured by Takara).

After extraction twice with phenol: chloroform (1: 1), the mixture was precipitated with ethanol. 100 μl of 5
1 mM EDT in 0 mM sodium acetate (pH 5.5)
A, 100 units of RNasin, 5 mM of 2-mercaptoethanol, 20 units of tobacco acid pyrophosphatase (TAP) (Maruyama, K. and Sugano, S., Gene, 138 , 1).
71-174 (1994)) at 37 ° C. for 40 minutes.

After extracting with phenol: chloroform (1: 1) and precipitating with ethanol, 2 to 4 μg of BAP-
100 μl of TAP-treated poly (A) ⁺ RNA
M Tris-HCl (pH 7.5, 5 mM MgCl ₂ , 5 mM
2-mercaptoethanol, 0.5 mM ATP, 100
(Includes units of RNasin and 25% PEG 8000)
Medium, 250 units of RNA ligase (manufactured by Takara), 0.4
2 μg of 5′-oligonucleotide (having the base sequence shown in SEQ ID NO: 4 and synthesized by an automatic synthesizer)
Ligated at 0 ° C. for 3 hours.

Next, after removing the unreacted 5'-oligonucleotide (SEQ ID NO: 4), the cDNA was converted to RNa
It was synthesized with seH-free reverse transcriptase (Superscript II, manufactured by Gibco BRL). Ten picomoles of dT adapter-primer (base sequence shown in SEQ ID NO: 5, synthesized by an automatic synthesizer) were combined with 20 μg of oligo-capped poly (A) ⁺ RN.
Used for A. The reaction conditions were incubation at 42 ° C. for 1 hour.

After the synthesis of single-stranded DNA, RNA was degraded by incubation at 65 ° C. for 1 hour with 15 mM NaOH. CDNA made from 1 μg of oligo-capped poly (A) ⁺ RNA was
6 picomoles of 5'-PCR primer (base sequence shown in SEQ ID NO: 6, synthesized by an automatic synthesizer) and 3'-P
Amplification was performed in a volume of 100 μl using an XLPCR kit (manufactured by Perkin-Elmer) having CR primers (base sequence shown in SEQ ID NO: 7, synthesized by an automatic synthesizer).

For dT adapter / primer / primed cDNA, the amplification cycle was 1 minute at 94 ° C.
Ten cycles were performed at 58 ° C. for 1 minute and at 72 ° C. for 10 minutes.

The PCR product was phenol: chloroform.
(1: 1), extracted by ethanol precipitation, digested with Sftl, Sftl-digested PCR products separated by agarose gel electrophoresis, isolating products longer than 2000 bases,
DraIII-digested pME18-FL prepared above
3 (Genebank accession No. ABoo9864)
(Sced, B. and Aruffo, A., Proc.
Natl. Acad. Sci. USA, 84 , 3365-3369 (1987)).

Next, the plasmid DNA obtained above
Was isolated using a PI-100 robot (Kurabo Co., Ltd.).

[0231] The size of the cDNA library thus obtained was about 20,000 clones / µg of poly (A) ⁺ R relative to the full-length enriched cDNA library.
NA.

From this library, 4000 clones were subjected to a 5 ′ random sequence using an ABI377 automatic sequencer (ABI). (1-2) Selection of clones From the data obtained in (1-1) above, a PSORT program (PROTEINS: Structure, Function, and Genetics 11 ,
95-110 (1991), K. Nakai & M. Kanehisa, Genomics 1
4 , 897-911 (1992), K. Nakai & M. Kanehisa, http: //
Using psort.nibb.ac.jp:8800/), 18 clones that were predicted to have a secreted protein signal were selected. (1-3) Isolation of Kais7 For all 18 clones selected in the above (1-2), A
Full length sequencing of inserts was performed using a BI377 automated sequencer (ABI). As one of them, a clone containing an insert having a secretory protein signal was confirmed, and the clone was named Kais7.

This consists of 2599 nucleotides of the nucleotide sequence shown in SEQ ID NO: 3, and its open reading frame (ORF) consists of 2415 nucleotides of the nucleotide sequence shown in SEQ ID NO: 2, and is coded by the nucleotide sequence. The amino acid sequence consisted of 805 amino acid residues shown in SEQ ID NO: 1. FASTA
Program (Person WR, et al., Proc. Natl. Acad.
Sci., USA, 85 , 2444-2448 (1988)).
Comparison of the DNA sequence with the DNA sequence in the Bank / EMBL database revealed that the gene had no homology to any other known DNA sequence.

From the primary sequence, it was revealed that the product of this gene (ACE-like protein) had a signal peptide-like sequence from the 1st to 17th N-terminal residues and was a secretory protein.

The above-mentioned kais7 gene is known to have a blood pressure regulating action in humans, rats and other mammalian A.
Each had about 42% homology with CE.
Furthermore, 743 to 7 of the nucleotide sequence shown in SEQ ID NO: 1
At position 59, it has a transmembrane site and is a central sequence of ACE activity (zinc protease motif: Zinc Proteasemo
tief) was found at positions 371 to 380 in the nucleotide sequence.

[0236]

Example 2 Expression in Tissues In order to examine the expression profile of Kais7 in tissues, RT-PCR analysis using various human tissues was performed.

For the RT-PCR analysis, human MT cDNA panel I (Human Mu
ltile Tissue cDNA Panel I) and human MT cDNA
The analysis was performed using Panel II (Human Multile Tissue cDNA Panel II) (all manufactured by Clontech).

In the PCR reaction, 0.4 μg of cDNA, 10
μM each primer, 0.8 mM dNTPs and 2.5 U
50 including Taq DNA polymerase (promega)
Performed in μl solution.

The primers P1 and P2 having the nucleotide sequences shown as SEQ ID NO: 8 and SEQ ID NO: 9 were used for 30 cycles of PCR amplification.

The PCR product was dissolved in a ethidium bromite-stained 2.0% agarose gel.

As a result, transcripts homologous to kais7 were found to be present in the kidney (kidney), testis (Testis) and small intestine (Small intesti).
ne) was found to be particularly strongly expressed.

The human tissues used were heart,
Brain (brain), placenta (Placenta), lung (Lung), liver (L
iver), skeletal muscle (S. muscle), kidney (Kidney), pancreas (Pancreas), spleen (Spleen), thymus (Thymus), prostate (Prostate), testis (Testis), ovary (Ovary), small intestine (Small intestine) ), Colon and peripheral blood leukocytes (PBL).

[0243]

Example 3 FISH FISH for chromosome alignment is performed by a known method (Hirai
According to M., et al., Genomics, 34 , pp. 263-265 (1996)), 0.01 μg of the cDNA containing the full length was used as a probe.

FISH was captured with a fluorescence microscope BX (Olympus) using Provia 100 film (Fuji, ISO 100).

As a result, the signal tested on 100 typical R-band metaphase cells showed p2 on the X chromosome.
2.1 was localized. Therefore, the localization site of the chromosome of kais7 could be identified as Xp22.1.

[0246] From the above results, the kais7 gene may function similarly to ACE having a blood pressure regulating action, and it can be expected by those skilled in the art that the gene functions as an increase factor in blood pressure regulation.

[0247]

Example 4 Acquisition of Kais7 Gene Expression Product (1) The full-length clone produced by the oligocapping method was pM
Since it is incorporated into the E18 expression vector, the expression product of the Kais7 gene can be easily obtained by introducing it into cells.

When the pME18 expression vector was integrated into the
The gene containing the full length of s7 was replaced with Lipofectin (Lifetechn.
lipofection of a human-derived cell line such as a HeLa cell, using a K.I.

After lipofection, the cells are disrupted with a glass homogenizer. This cell extract contains K
It is expected that the ais7 gene expression product will be included.

[0250]

Example 5 Acquisition of Kais7 Gene Expression Product (2) 1) Preparation of GST-fused Kais7 Expression Vector Based on the DNA sequence information of Kais7 obtained in Example 1, two primers (Q1: containing BamHI site A sense primer and Q2: an antisense primer containing an EcoRI site) are prepared. Their base sequences are as shown in SEQ ID NOs: 10 and 11.

Using the above two primers, PCR is performed using the clone containing the full-length sequence used in Example 1 as a template. After ethanol-precipitating the amplified cDNA, the cDNA was subjected to restriction enzymes BamHI and Eco.
Cleavage with RI, the cleaved product was phenol extracted, ethanol precipitated again, and inserted into the BamHI-EcoRI site of the prokaryotic gene fusion vector pGEX-2TK vector (manufactured by Amersham Pharmacia Biotech).
Sub-cloning. The fusion vector contains BamHI and E
An expression vector having a coRI cleavage site and thus expressing a fusion protein of the desired gene product and a GST domain having a molecular weight of 26,000 (derived from S. japonicum) can be prepared. 2) Acquisition and purification of expression product of Kais7 gene An overnight culture of Escherichia coli K12 strain containing the above pGEX-2TK vector is diluted to a concentration of 1/10, and cultured in an LB medium containing ampicillin for 2 hours. At this point, the expression inducer IPTG (isopropyl-β-thio.
(Galactopyranoside). Positive clones were selected, and it was confirmed that the insertion position was appropriate and that the sequence was identical to the sequence obtained by cloning. The expression-induced medium is further cultured for 5 hours,
After centrifugation for washing, the centrifuged product is washed with PBS.
Wash with (-), resuspend the washed pellet in buffer and sonicate for 15 minutes on ice. The cell lysate is pelleted by centrifugation, the supernatant is collected, and subjected to a glutathione-Sepharose column (Amersham Pharmacia Biotech) for affinity purification, and the column is subjected to 20-column-volume PBS (-). Wash with. The washing column is treated with thrombin, and gel filtration is applied to a Sephacryl-200 column (manufactured by Amersham Pharmacia Biotech) to collect a product obtained by separating the target protein from the fusion protein, and collect a concentrated fraction. The expression of each recombinant protein can be confirmed using a kit (Amersham Pharmacia Biotech) containing an antibody that recognizes the GST epitope.

The protein thus purified can be used for antibody purification,
It can be used as a reagent for preparing an ACE activity measurement system using Kais7 shown in Example 5 and screening for a ligand, agonist or antagonist for Kais7 shown in Example 6, respectively.

[0253]

Example 5 Measurement of ACE Activity of Kais7 Gene Expression Product (Kais7 Protein) Kais7 Gene Expression Product (Kai
ACE activity (Kais7 activity) of s7 protein)
Using a spectrophotometer, the method of Cushman et al. (Cushman, D.
W. and Cheung, HS, Biochemical Pharmacology, 20 ,,
1637-1648 (1971)).

That is, 10 g of the Kais7 protein obtained in Example 4 was dissolved in 100 ml of 50 mM potassium phosphate buffer (pH 8.3), and centrifuged at 40,000 rpm for 40 minutes. This sample was prepared using a final concentration of 100 mM potassium phosphate buffer, 300 mM sodium chloride, and 5 mM substrate.
It is added to 0.25 ml of a measurement mixture containing hippuryl-L-histidyl-L-leucine (Bakchem) (hereinafter abbreviated as HHL), and incubated at 37 ° C. for about 30 minutes. The enzymatic reaction is terminated by adding 0.25 ml of 1N hydrochloric acid. The hippuric acid produced from HHL is extracted by adding 1.5 ml of ethyl acetate and stirring and mixing for 15 seconds. After centrifugation, 1.0 ml of the ethyl acetate layer is transferred to another tube and dehydrated by heating at 120 ° C. for 30 minutes.

This is redissolved in 1.0 ml of water and determined by its absorbance at a generated amount of hippuric acid of 228 μm.

ACE for measurement of absorbance (Kais7)
The definition of ACE activity and the calculation of ACE activity (Kais7 activity) are based on catalysis of 1 μmol of hippuric acid from HHL at 37 ° C. for 1 minute under standard assay conditions for 1 unit of ACE activity (Kais7 activity). Is defined as

[0257]

Example 6 Method for Screening Substances Affecting ACE Activity (Kais7 Activity) AC Using Kais7 Protein Created in Example 3
The system for measuring E activity (Kais7 activity) is based on ACE activity (Kais7 activity).
The present invention can be used for a screening method for screening a compound (peptide or peptide compound fusion) that affects the is7 activity).

The screening method is as follows. First, a standard enzyme inhibitor having various known mechanisms of action is added to an arbitrary concentration range (0.1 to 1000).
(M: 0.1, 1, 10, 100, 1000) are added without preincubation and tested in the assay system of Example 5. Each specimen is optional
It is prepared by adjusting to the (desired) concentration, adding to the assay system of Example 5 without pre-incubation with the Kais7 protein, and measuring its absorbance at 228 μm.

The incubation was carried out with 150 μg of Ka.
Is7 protein / measurement indicated final concentration of analyte and 60
Let react for minutes. 100% when no test object is added
The% of activity inhibition due to the addition of the test substance is measured. Thus, a test substance showing inhibition at a specific concentration with respect to the control can be specified as an inhibitor of the present invention Kais7. On the other hand, a test substance showing a high activity at a specific concentration with respect to the control in the present measurement system can be specified as an agonist for the present invention Kais7.

[0260]

[Sequence List] SEQUENCE LISTING <110> Otsuka Pharmaceutical Co., Ltd. <120> ACE-like gene (kais7) <130> 1709JP <140> <141> <160> 11 <170> PatentIn Ver. 2.0 <210> 1 <211> 805 <212> PRT <213> Unknown <400> 1 Met Ser Ser Ser Ser Trp Leu Leu Leu Ser Leu Val Ala Val Thr Ala 1 5 10 15 Ala Gln Ser Thr Ile Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe 20 25 30 Asn His Glu Ala Glu Asp Leu Phe Tyr Gln Ser Ser Leu Ala Ser Trp 35 40 45 Asn Tyr Asn Thr Asn Ile Thr Glu Glu Asn Val Gln Asn Met Asn Asn 50 55 60 Ala Gly Asp Lys Trp Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala 65 70 75 80 Gln Met Tyr Pro Leu Gln Glu Ile Gln Asn Leu Thr Val Lys Leu Gln 85 90 95 Leu Gln Ala Leu Gln Gln Asn Gly Ser Ser Val Leu Ser Glu Asp Lys 100 105 110 Ser Lys Arg Leu Asn Thr Ile Leu Asn Thr Met Ser Thr Ile Tyr Ser 115 120 125 Thr Gly Lys Val Cys Asn Pro Asp Asn Pro Gln Glu Cys Leu Leu Leu 130 135 140 Glu Pro Gly Leu Asn Glu Ile Met Ala Asn Ser Leu Asp Tyr Asn Glu 145 150 155 160 Arg Leu Trp Ala Trp Glu Ser Trp Arg Ser Glu Val Gly Lys Gln Leu 165 170 175 Arg Pro Leu Tyr Glu Glu Tyr Val Val Leu Lys Asn Glu Met Ala Arg 180 185 190 Ala Asn His Tyr Glu Asp Tyr Gly Asp Tyr Trp Arg Gly Asp Tyr Glu 195 200 205 Val Asn Gly Val Asp Gly Tyr Asp Tyr Ser Arg Gly Gln Leu Ile Glu 210 215 220 Asp Val Glu His Thr Phe Glu Glu Ile Lys Pro Leu Tyr Glu His Leu 225 230 235 240 His Ala Tyr Val Arg Ala Lys Leu Met Asn Ala Tyr Pro Ser Tyr Ile 245 250 255 Ser Pro Ile Gly Cys Leu Pro Ala His Leu Leu Gly Asp Met Trp Gly 260 265 270 Arg Phe Trp Thr Asn Leu Tyr Ser Leu Thr Val Pro Phe Gly Gln Lys 275 280 285 Pro Asn Ile Asp Val Thr Asp Ala Met Val Asp Gln Ala Trp Asp Ala 290 295 300 300 Gln Arg Ile Phe Lys Glu Ala Glu Lys Phe Phe Val Ser Val Gly Leu 305 310 315 320 Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp Pro 325 330 335 Gly Asn Val Gln Lys Ala Val Cys His Pro Thr Ala Trp Asp Leu Gly 340 345 350 Lys Gly Asp Phe Arg Ile Leu Met Cys Thr Lys Val Thr Met Asp Asp 355 360 365 Phe Leu Thr Ala His His Glu Met Gly His Ile Gln Tyr Asp Met Ala 370 375 380 Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly Phe 385 390 395 400 His Glu Ala Val Gly Glu Ile Met Ser Leu Ser Ala Ala Thr Pro Lys 405 410 415 His Leu Lys Ser Ile Gly Leu Leu Ser Pro Asp Phe Gln Glu Asp Asn 420 425 430 Glu Thr Glu Ile Asn Phe Leu Leu Lys Gln Ala Leu Thr Ile Val Gly 435 440 445 Thr Leu Pro Phe Thr Tyr Met Leu Glu Lys Trp Arg Trp Met Val Phe 450 455 460 Lys Gly Glu Ile Pro Lys Asp Gln Trp Met Lys Lys Trp Trp Glu Met 465 470 475 480 Lys Arg Glu Ile Val Gly Val Val Glu Pro Val Pro His Asp Glu Thr 485 490 495 Tyr Cys Asp Pro Ala Ser Leu Phe His Val Ser Asn Asp Tyr Ser Phe 500 505 510 Ile Arg Tyr Tyr Thr Arg Thr Leu Tyr Gln Phe Gln Phe Gln Glu Ala 515 520 525 Leu Cys Gln Ala Ala Lys His Glu Gly Pro Leu His Lys Cys Asp Ile 530 535 540 Ser Asn Ser Thr Glu Ala Gly Gln Lys Leu Phe Asn Met Leu Arg Leu 545 550 555 560 Gly Lys Ser Glu Pro Trp Thr Leu Ala Leu Glu Asn Val Val Gly Ala 565 570 575 Lys Asn Met Asn Val Arg Pro Leu Leu Asn Tyr Phe Glu Pro Leu Phe 580 585 590 Thr Trp Leu Lys Asp Gln Asn Lys Asn Ser Phe Val Gly Trp Ser Thr 595 600 605 Asp Trp Ser Pro Tyr Ala Asp Gln Ser Ile Lys Val Arg Ile Ser Leu 610 615 620 lys Ser Ala Leu Gly Asp Lys Ala Tyr Glu Trp Asn Asp Asn Glu Met 625 630 635 640 Tyr Leu Phe Arg Ser Ser Val Ala Tyr Ala Met Arg Gln Tyr Phe Leu 645 650 655 Lys Val Lys Asn Gln Met Ile Leu Phe Gly Glu Glu Asp Val Arg Val 660 665 670 Ala Asn Leu Lys Pro Arg Ile Ser Phe Asn Phe Phe Val Thr Ala Pro 675 680 685 Lys Asn Val Ser Asp Ile Ile Pro Arg Thr Glu Val Glu Lys Ala Ile 690 695 700 Arg Met Ser Arg Ser Arg Ile Asn Asp Ala Phe Arg Leu Asn Asp Asn 705 710 715 715 720 Ser Leu Glu Phe Leu Gly Ile Gln Pro Thr Leu Gly Pro Pro Asn Gln 725 730 735 Pro Pro Val Ser Ile Trp Leu Ile Val Phe Gly Val Val Met Gly Val 740 745 750 Ile Val Val Gly Ile Val Ile Leu Ile Phe Thr Gly Ile Arg Asp Arg 755 760 765 Lys Lys Lys Asn Lys Ala Arg Ser Gly Glu Asn Pro Tyr Ala Ser Ile 770 775 780 Asp Ile Ser Lys Gly Glu Asn Asn Pro Gly Phe Gln Asn Thr Asp Asp 785 790 795 800 Val Gln Thr Ser Phe 805 <210> 2 <211> 2415 <212> DNA <213> Unknown <400> 2 aacaccaata ttactgaaga gaatgtccaa 180 aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc cacacttgcc 240 caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct gcaggctctt 300 cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa cacaattcta 360 aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa tccacaagaa 420 tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga ctacaatgag 480 aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag gccattatat 540 gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga ggactatggg 600 gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta cagccgcggc 660 cagttgattg aagatgtgga acataccttt gaagagatta aaccattata tgaacatctt 720 catgcctatg tgagcccctattt gatgccatgatcctccatcc caattgga 780 tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa tctgtactct 840 ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat ggtggaccag 900 gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc tgttggtctt 960 cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg aaatgttcag 1020 aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag gatccttatg 1080 tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg gcatatccag 1140 tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa tgaaggattc 1200 catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca tttaaaatcc 1260 attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa cttcctgctc 1320 aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga gaagtggagg 1380 tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg gtgggagatg 1440 aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata ctgtgacccc 1500 gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac aaggaccctt 1560 taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg ccctctgcac 1 620 aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat gctgaggctt 1680 ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa gaacatgaat 1740 gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga ccagaacaag 1800 aattcttttg tgggatggag taccgactgg agtccatatg cagaccaaag catcaaagtg 1860 aggataagcc taaaatcagc tcttggagat aaagcatatg aatggaacga caatgaaatg 1920 tacctgttcc gatcatctgt tgcatatgct atgaggcagt actttttaaa agtaaaaaat 1980 cagatgattc tttttgggga ggaggatgtg cgagtggcta atttgaaacc aagaatctcc 2040 tttaatttct ttgtcactgc acctaaaaat gtgtctgata tcattcctag aactgaagtt 2100 gaaaaggcca tcaggatgtc ccggagccgt atcaatgatg ctttccgtct gaatgacaac 2160 agcctagagt ttctggggat acagccaaca cttggacctc ctaaccagcc ccctgtttcc 2220 atatggctga ttgtttttgg agttgtgatg ggagtgatag tggttggcat tgtcatcctg 2280 atcttcactg ggatcagaga tcggaagaag aaaaataaag caagaagtgg agaaaatcct 2340 tatgcctcca tcgatattag caaaggagaa aataatccag gattccaaaa cactgatgat 2400 gttcagacct ccttt 2415 <210> 3 < 211> 2599 <212> DNA <213> Unknown <220> <2 21> CDS <222> (55) .. (2469) <400> 3 tttttagtct agggaaagtc attcagtgga tgtgatcttg gctcacaggg gacg atg 57 Met 1 tca agc tct tcc tgg ctc ctt ctc agc ctt gtt gct gta act gct gct 105 Ser Leu Leu Leu Ser Leu Val Ala Val Thr Ala Ala 5 10 15 cag tcc acc att gag gaa cag gcc aag aca ttt ttg gac aag ttt aac 153 Gln Ser Thr Ile Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe Asn 20 25 30 cac gaa gcc gaa gac ctg ttc tat caa agt tca ctt gct tct tgg aat 201 His Glu Ala Glu Asp Leu Phe Tyr Gln Ser Ser Leu Ala Ser Trp Asn 35 40 45 tat aac acc aat att act gaa gag aat gtc caa aac atg aat aat gct 249 Tyr Asn Thr Asn Ile Thr Glu Glu Asn Val Gln Asn Met Asn Asn Ala 50 55 60 65 ggg gac aaa tgg tct gcc ttt tta aag gaa cag tcc aca ctt gcc caa 297 Gly Asp Lys Trp Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala Gln 70 75 80 atg tat cca cta caa gaa att cag aat ctc aca gtc aag ctt cag ctg 345 Met Tyr Pro Leu Gln Glu Ile Gln Asn Leu Thr Val Lys Leu Gln Leu 85 90 95 cag gct ctt cag caa aat ggg tct tca gtg ctc tca gaa gac aag agc 393 Gln Ala Leu Gln Gln Asn Gly Ser Ser Val Leu Ser Glu Asp Lys Ser 100 105 110 aaa cgg ttg aac aca att cta aat aca atg agc acc atc tac agt act 441 Lys Arg Leu Asn Thr Ile Leu Asn Thr Met Ser Thr Ile Tyr Ser Thr 115 120 125 gga aaa gtt tgt aac cca gat aat cca caa gaa tgc tta tta ctt gaa 489 Gly Lys Val Cys Asn Pro Asp Asn Pro Gln Glu Cys Leu Leu Leu Glu 130 135 140 145 cca ggt ttg aat gaa ata atg gca aac agt tta gac tac aat gag agg 537 Pro Gly Leu Asn Glu Ile Met Ala Asn Ser Leu Asp Tyr Asn Glu Arg 150 155 160 ctc tgg gct tgg gaa agc tgg aga tct gag gtc ggc aag 585 Leu Trp Ala Trp Glu Ser Trp Arg Ser Glu Val Gly Lys Gln Leu Arg 165 170 175 cca tta tat gaa gag tat gtg gtc ttg aaa aat gag atg gca aga gca 633 Pro Leu Tyr Glu Glu Tyr Val Val Leu Lys Asn Glu Met Ala Arg Ala 180 185 190 aat cat tat gag gac tat ggg gat tat tgg aga gga gac tat gaa gta 681 Asn His Tyr Glu Asp Tyr Gly Asp Tyr Trp Arg Gly Asp Tyr Glu Val 195 200 205 aat ggg gta gat ggc tat gac tacagc cgc ggc cag ttg att gaa gat 729 Asn Gly Val Asp Gly Tyr Asp Tyr Ser Arg Gly Gln Leu Ile Glu Asp 210 215 220 225 gtg gaa cat acc ttt gaa gag att aaa cca tta tat gaa cat ctt cat 777 Val Glu Phe Glu Glu Ile Lys Pro Leu Tyr Glu His Leu His 230 235 240 gcc tat gtg agg gca aag ttg atg aat gcc tat cct tcc tat atc agt 825 Ala Tyr Val Arg Ala Lys Leu Met Asn Ala Tyr Pro Ser Tyr Ile Ser 245 250 255 cca att gga tgc ctc cct gct cat ttg ctt ggt gat atg tgg ggt aga 873 Pro Ile Gly Cys Leu Pro Ala His Leu Leu Gly Asp Met Trp Gly Arg 260 265 270 ttt tgg aca aat ctg tac tct ttg aca gtt ccc g cag aaa cca 921 Phe Trp Thr Asn Leu Tyr Ser Leu Thr Val Pro Phe Gly Gln Lys Pro 275 280 285 aac ata gat gtt act gat gca atg gtg gac cag gcc tgg gat gca cag 969 Asn Ile Asp Val Thr Asp Ala Met Val Asp Gln Ala Trp Asp Ala Gln 290 295 300 305 aga ata ttc aag gag gcc gag aag ttc ttt gta tct gtt ggt ctt cct 1017 Arg Ile Phe Lys Glu Ala Glu Lys Phe Phe Val Ser Val Gly Leu Pro 310 315 320 aat atg act caa gga ttc tgg gaa aat tcc atg cta acg gac cca gga 1065 Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp Pro Gly 325 330 335 aat gtt cag aaa gca gtc tgc cat ccc aca gct tgg gac ctg ggg aag 1113 Val Gln Lys Ala Val Cys His Pro Thr Ala Trp Asp Leu Gly Lys 340 345 350 ggc gac ttc agg atc ctt atg tgc aca aag gtg aca atg gac gac ttc 1161 Gly Asp Phe Arg Ile Leu Met Cys Thr Lys Val Thr Met Asp Asp Phe 355 360 365 ctg aca gct cat cat gag atg ggg cat atc cag tat gat atg gca tat 1209 Leu Thr Ala His His Glu Met Gly His Ile Gln Tyr Asp Met Ala Tyr 370 375 380 385 gct gca caa cct ttt ctg cta aga aat gga gct aat gaa gga ttc cat 1257 Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly Phe His 390 395 400 gaa gct gtt ggg gaa atc atg tca ctt tct gca gcc aca cct aag cat 1305 Glu Ala Val Gly Glu Met Ser Leu Ser Ala Ala Thr Pro Lys His 405 410 415 tta aaa tcc att ggt ctt ctg tca ccc gat ttt caa gaa gac aat gaa 1353 Leu Lys Ser Ile Gly Leu Leu Ser Pro Asp Phe Gln Glu Asp Asn Glu 420 425 430 aca gaa ata aac ttc ctg ctc aaa caa gca ctc acg att gtt ggg act 1401 Thr Glu Ile Asn Phe Leu Leu Lys Gln Ala Leu Thr Ile Val Gly Thr 435 440 445 ctg cca ttt act tac atg tta gag agg tgg agg tgg gtc ttt aaa 1449 Leu Pro Phe Thr Tyr Met Leu Glu Lys Trp Arg Trp Met Val Phe Lys 450 455 460 465 ggg gaa att ccc aaa gac cag tgg atg aaa aag tgg tgg gag atg aag 1497 Gly Glu Ilu Pro Lys Asp Gln Trp Met Lys Lys Trp Trp Glu Met Lys 470 475 480 cga gag ata gtt ggg gtg gtg gaa cct gtg ccc cat gat gaa aca tac 1545 Arg Glu Ilu Val Gly Val Val Glu Pro Val Pro His Asp Glu Thr Tyr 485 490 495 tgt gac ccc gca tct ctg ttc cat gtt tct aat gat tac tca ttc att 1593 Cys Asp Pro Ala Ser Leu Phe His Val Ser Asn Asp Tyr Ser Phe Ile 500 505 510 cga tat tac aca agg acc ctt tac caa ttc cag ttt caa gaa gca ctt 1641 Arg Tyr Tyr Thr Arg Thr Leu Tyr Gln Phe Gln Phe Gln Glu Ala Leu 515 520 525 tgt caa gca gct aaa cat gaa ggc cct ctg cac aaa tgt gac atc tca 1689 Cys Gln Ala Ala Lys His Glu Gly Pro Leu His Lys Cys A sp Ile Ser 530 535 540 545 aac tct aca gaa gct gga cag aaa ctg ttc aat atg ctg agg ctt gga 1737 Asn Ser Thr Glu Ala Gly Gln Lys Leu Phe Asn Met Leu Arg Leu Gly 550 555 560 560 aaa tca gaa ccc tacc gca ttg gaa aat gtt gta gga gca aag 1785 Lys Ser Glu Pro Trp Thr Leu Ala Leu Glu Asn Val Val Gly Ala Lys 565 570 575 aac atg aat gta agg cca ctg ctc aac tac ttt gag ccc tta ttt acc 1833 Asn Met Asn Val Arg Pro Leu Leu Asn Tyr Phe Glu Pro Leu Phe Thr 580 585 590 tgg ctg aaa gac cag aac aag aat tct ttt gtg gga tgg agt acc gac 1881 Trp Leu Lys Asp Gln Asn Lys Asn Ser Phe Val Gly Trp Ser Thr Asp 595 600 605 tgg agt cca tat gca gac caa agc atc aaa gtg agg ata agc cta aaa 1929 Trp Ser Pro Tyr Ala Asp Gln Ser Ile Lys Val Arg Ile Ser Leu Lys 610 615 620 625 tca gct ctt gga gat aaa gca tat gaa tgg aac aat gaa atg tac 1977 Ser Ala Leu Gly Asp Lys Ala Tyr Glu Trp Asn Asp Asn Glu Met Tyr 630 635 640 ctg ttc cga tca tct gtt gca tat gct atg agg cag tac ttt tta aaa 2025 Leu Phe Arg Ser Ser Val Ala Ty r Ala Met Arg Gln Tyr Phe Leu Lys 645 650 655 gta aaa aat cag atg att ctt ttt ggg gag gag gat gtg cga gtg gct 2073 Val Lys Asn Gln Met Ile Leu Phe Gly Glu Glu Asp Val Arg Val Ala 660 665 670 aattt aaa cca aga atc tcc ttt aat ttc ttt gtc act gca cct aaa 2121 Asn Leu Lys Pro Arg Ile Ser Phe Asn Phe Phe Val Thr Ala Pro Lys 675 680 685 aat gtg tct gat atc att cct aga act gaa gtt gaa aag gcc atc 2169 Asn Val Ser Asp Ile Ile Pro Arg Thr Glu Val Glu Lys Ala Ile Arg 690 695 700 705 atg tcc cgg agc cgt atc aat gat gct ttc cgt ctg aat gac aac agc 2217 Met Ser Arg Ser Arg Ile Asn Asp Ala Phe Arg Leu Asn Asp Asn Ser 710 715 720 cta gag ttt ctg ggg ata cag cca aca ctt gga cct cct aac cag ccc 2265 Leu Glu Phe Leu Gly Ile Gln Pro Thr Leu Gly Pro Pro Asn Gln Pro 725 730 735 cct gtt tcc ata tgg ctg att gtt ttt gga gtt gtg atg gga gtg ata 2313 Pro Val Ser Ile Trp Leu Ile Val Phe Gly Val Val Met Gly Val Ile 740 745 750 gtg gtt ggc att gtc atc ctg atc ttc act ggg atc aga gat cgg aag 2361 Val Val Gly Ile Val Ile Leu Ile Phe Thr Gly Ile Arg Asp Arg Lys 755 760 765 aag aaa aat aaa gca aga agt gga gaa aat cct tat gcc tcc atc gat 2409 Lys Lys Asn Lys Ala Arg Ser Gly Glu Asn Pro Tyr Ala Ser Ile Asp 770 775 780 785 att agc aaa gga gaa aat aat cca gga ttc caa aac act gat gat gtt 2457 Ile Ser Lys Gly Glu Asn Asn Pro Gly Phe Gln Asn Thr Asp Asp Val 790 795 800 cag acc tcc ttt tagaaaaatc tatgtttgtttgttg Ser Phe 805 tatgtaaatg ttaatttcat ggtatagaaa atataagatg ataaaagtat cattaaatgt 2569 caaaactatg actctgttca gaaaaaaaaa 2599 <210> 4 <211> 30 <212> DNA <213> Artificial sequence (5'-oligo primer) <400> 4 agcaucgagu cggccucuugu 30 <211> 42 <212> DNA <213> Artificial sequence (dT adaptor primer) <400> 5 gcggctgaag acggcctatg tggccttttt tttttttttt tt 42 <210> 6 <211> 21 <212> DNA <213> 5'-PCR primer <400 > 6 agcatcgagt cggccttgtt g 21 <210> 7 <211> 21 <212> DNA <213> 3'-PCR Primer <400> 7 gcggctgaag acggcctatg t 21 <210> 8 <211> 20 <212> DNA <213> Prim er P1 <400> 8 ggcttggaaa atcagaaccc 20 <210> 9 <211> 20 <212> DNA <213> Primer P2 <400> 9 gccaaccact atcactccca 20 <210> 10 <211> 32 <212> DNA <213> Primer Q1 <400> 10 caggatccat gtcaagctct tcctggctcc tt 32 <210> 11 <211> 32 <212> DNA <213> Primer Q2 <400> 11 cagaattcct aaaaggaggt ctgaacatca tc 32

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 39/395 A61K 39/395 P 4C086 48/00 4H045 A61P 9/12 48/00 C07K 14/47 A61P 9 / 12 16/08 C07K 14/47 C12N 1/15 16/08 1/19 C12N 1/15 1/21 1/19 C12Q 1/68 A 1/21 G01N 33/53 D 5/10 A61K 37/02 C12Q 1/68 37/64 G01N 33/53 C12N 5/00 A F-term (reference) 4B024 AA01 AA11 BA14 BA41 BA61 BA80 CA04 CA11 DA03 DA06 EA04 FA18 GA13 GA18 GA19 HA15 HA17 4B063 QA01 QA07 QA08 QA18 QA19 QQ79 QQ95 QR57 QR24 QR48 QS05 QX01 4B065 AA26X AA90Y AA93X AB01 AC15 BA05 BD35 CA24 CA44 CA46 4C084 AA02 AA07 AA13 BA44 DA39 ZA422 ZC162 ZC172 ZC202 4C085 AA13 AA14 BB22 DD61 DD88 GG01 GG08 GG10 A03A01 MA01 ZA42 ZC16 ZC17 ZC20 4H045 AA10 AA11 AA30 BA10 BA41 CA40 DA75 EA23 EA50 FA74 GA15 GA22 GA26

Claims (28)

[Claims] 1. A gene comprising the following polynucleotide (a), (b) or (c): (a) a polynucleotide encoding a polypeptide having the amino acid sequence represented by SEQ ID NO: 1, and (b) a sequence number:
A polynucleotide having at least 95% homology to a polynucleotide encoding a polypeptide having the amino acid sequence represented by (1), (c) the above (a) or (b)
A polynucleotide complementary to the polynucleotide of 2. A gene comprising the following polynucleotide (a) or (b): (a) a nucleotide sequence represented by SEQ ID NO: 2; and (b) a polynucleotide comprising the nucleotide sequence of (a) and a string. A polynucleotide that hybridizes under gentle conditions. 3. A gene encoding the following polypeptide (a) or (b): (a) a polypeptide having the amino acid sequence represented by SEQ ID NO: 1, and (b) a polypeptide having the amino acid sequence of (a). Alternatively, a polypeptide comprising an amino acid sequence in which a plurality of amino acids have been deleted, substituted or added and having an ACE activity or a bradykinin inactivating activity. 4. The gene according to claim 2, which is a nucleotide sequence represented by SEQ ID NO: 2. 5. A gene encoding a polypeptide having the amino acid sequence represented by SEQ ID NO: 1. A gene expression product having the amino acid sequence according to claim 1 or 3. 7. A recombinant expression vector having the gene according to any one of claims 1 to 3. 8. A host cell having the recombinant expression vector according to claim 7. 9. An oligonucleotide comprising at least 15 consecutive nucleotide sequences in the nucleotide sequence shown by SEQ ID NO: 2. 10. The oligonucleotide according to claim 9, comprising at least 30 consecutive nucleotide sequences in the nucleotide sequence represented by SEQ ID NO: 2. 11. An antisense oligonucleotide for the nucleotide sequence of SEQ ID NO: 2. 12. The antisense strand oligonucleotide according to claim 11, comprising at least 15 contiguous nucleotide sequences. 13. The antisense strand oligonucleotide according to claim 11, comprising at least 30 contiguous nucleotide sequences. A vector comprising the antisense strand oligonucleotide according to any one of claims 11 to 13. (15) A gene therapy agent comprising, as an active ingredient, a vector comprising the antisense strand oligonucleotide according to any one of (11) to (13) or the antisense strand oligonucleotide according to (14). 16. An ACE inhibitor or a bradykinin activator comprising the antisense strand oligonucleotide according to claim 15 or a vector containing the antisense strand oligonucleotide as an active ingredient. 17. An antihypertensive agent comprising the antisense strand oligonucleotide according to claim 15 or a vector containing the antisense strand oligonucleotide as an active ingredient. 18. A sense strand oligonucleotide for the nucleotide sequence of SEQ ID NO: 2. 19. An oligonucleotide probe comprising at least 15 consecutive nucleotide sequences in the nucleotide sequence represented by SEQ ID NO: 2. 20. The oligonucleotide probe according to claim 19, comprising at least 30 consecutive nucleotide sequences in the nucleotide sequence represented by SEQ ID NO: 2. 21. A protein of the following (a) or (b): (a) a protein having an amino acid sequence represented by SEQ ID NO: 1,
(B) a protein comprising an amino acid sequence in which one or more amino acids have been deleted, substituted or added in the amino acid sequence of (a) and having an ACE activity or a bradykinin inactivating activity. 22. An antihypertensive comprising the protein according to claim 21 as an active ingredient. 23. An antihypertensive comprising the gene according to any one of claims 1 to 3 or the gene expression product according to claim 6 as an active ingredient. 24. A method for diagnosing a gene for hypertension, which comprises measuring the amount of the gene according to claim 1 or the amount of the gene expression product according to claim 6 in a sample. 25. A homologue of the gene according to any one of claims 1 to 3, wherein the homologue is a dog, monkey, horse, pig, sheep,
A mammalian homolog selected from cats, mice, rats and guinea pigs. 26. An antibody having a binding property to the expression product of the gene according to claim 6, and a fragment thereof. 27. A method for diagnosing hypertension using the antibody according to claim 26 or a fragment thereof. 28. An antihypertensive comprising the antibody according to claim 26 or a fragment thereof as an active ingredient.