WO2002038755A1 - Nouveaux elements circulaires d'adn extra-chromosomique - Google Patents

Nouveaux elements circulaires d'adn extra-chromosomique Download PDF

Info

Publication number
WO2002038755A1
WO2002038755A1 PCT/CA2001/000205 CA0100205W WO0238755A1 WO 2002038755 A1 WO2002038755 A1 WO 2002038755A1 CA 0100205 W CA0100205 W CA 0100205W WO 0238755 A1 WO0238755 A1 WO 0238755A1
Authority
WO
WIPO (PCT)
Prior art keywords
ced
dna
isolated
circular
polynucleotide
Prior art date
Application number
PCT/CA2001/000205
Other languages
English (en)
Inventor
Wilfred A. Jefferies
Kyung Bok Choi
Nick Cheng
Kendra Payne
Maki Ujiie
Original Assignee
Jefferies Wilfred A
Kyung Bok Choi
Nick Cheng
Kendra Payne
Maki Ujiie
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jefferies Wilfred A, Kyung Bok Choi, Nick Cheng, Kendra Payne, Maki Ujiie filed Critical Jefferies Wilfred A
Publication of WO2002038755A1 publication Critical patent/WO2002038755A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Definitions

  • the present invention pertains to novel DNA elements.
  • the present invention relates to circular extra-chromosomal DNA elements, a method of isolating the circular extra-chromosomal DNA elements, and their use.
  • Extra-chromosomal forms of DNA were identified as early as 1965 (Hotta, Y. and Bassel, A., (1965) Proc. Natl. Acad. Set U.S.A., 53, 356-362). These DNAs are smaller than chromosomal DNA and are covalently closed circular molecules. In eukaryotes, it appears that covalently closed circular DNAs exist in a manner similar to plasmids which are widely distributed in prokaryotes. These DNAs can arise from many origins; they may be associated with organelles, such as mitochondria, or they may comprise the genomes or intermediates of viral life cycles.
  • eccDNAs extra- chromosomal covalently closed circular DNAs
  • Protozoan parasites contain plastid circular extra-chromosomal DNA (35kb) and appear to contain functional genomes (Kohler et al., (1997) Science, 276, 2039-2042; Wilson and Williamson, (1997) Microbiol Mol Biol Rev. , 61, 1-16). Unlike the circular DNAs found in many cells, these Protozoan circular DNA found in Leishmania, Trypanosome and Plasmodium are of the same size. Heterogenous sizes of extra- chromosomal circular DNA containing amplified genes are commonly found in cancer cells (Schoenlein et al. , (1999) Chromosoma., 108,121-131; Sanchez et al., (1998) Cancer Res., 58, 3845-3854).
  • eccDNA levels have been found to increase in response to carcinogen treatment in human and rodent cells (Cohen, S. and Lavi, S., (1996) Mol. Cell. Biol, 16, 2002-2014; Cohen, S., etal, (1997) Oncogene, 14, 977-985; Sunnerhagen, P., etal, (1989) Somatic Cell Mol. Genet, 15, 61-70) and have consistently been found to be raised in neoplastic patients, possibly in response to chemotherapeutic agents (Wahl, G.M., (1989) Cancer Res., 49, 1333-1340).
  • eccDNAs have been observed in the cells of patients suf ering from genetic diseases characterised by genomic instability and premature aging, for example Fanconi's anemia (Motejlek, K., etal, (1993) Mutation Res., 293, 205-214) and Werner's syndrome (Kunisada, T., etal, (1985) Mech. Ageing Dev. , 29, 89-99).
  • Fanconi's anemia Motejlek, K., etal, (1993) Mutation Res., 293, 205-214
  • Werner's syndrome Koreanisada, T., etal, (1985) Mech. Ageing Dev. , 29, 89-99.
  • Another example of eccDNA with an apparent chromosomal origin is the family of relatively small double stranded DNA circles composed of repetitive sequences, often ribosomal DNA, that have been found in invertebrates and implicated as a cause of aging (
  • eccDNAs Analysis of cloned eccDNAs has lead to the identification of sequences within these structures. Among those identified to date are satellite DNA, short interspersed and long interspersed repeat families, retrovirus-like elements, transposable elements, low-copy, and single-copy chromosomal sequences. In addition, repetitive sequences appear to be overrepresented in eccDNAs in comparison to their frequency in chromosomal DNA (Sunnerhagen, P., et al , (1986) Nucleic Acids Res. , 14, 7823-7838) .
  • eccDNAs are often found to be elevated in individuals suffering from certain cancers and genetic disorders, they may be particularly useful in medicinal genetics. To date the use of eccDNAs in molecular diagnosis and identification techniques has not been examined. Further, eccDNAs have not yet been tested as potential gene therapy vectors although their structure and natural occurrence should make them good candidates.
  • An object of the present invention is to provide novel circular extra-chromosomal DNA (CED) elements isolated from a wide diversity of organisms.
  • CED circular extra-chromosomal DNA
  • an isolated circular extra-chromosomal DNA element having a size of about 40 kb to about 110 kb, wherein the element is resistant to ⁇ exonuclease and contains at least one open reading frame.
  • a method of isolating a circular extra-chromosomal DNA element having a size of about 40 kb to about 110 kb, wherein the element is resistant to ⁇ exonuclease and contains at least one open reading frame comprising: alkaline extraction of circular DNA from animal tissue; and precipitation of the circular DNA.
  • fragments of the isolated circular extra-chromosomal DNA element of the present invention there is provided fragments of the isolated circular extra-chromosomal DNA element of the present invention.
  • compositions comprising the isolated extra-chromosomal circular DNA element of the present invention.
  • a circular extra-chromosomal DNA element as a stable expression element, wherein the element is resistant to ⁇ exonuclease and contains at least one open reading frame.
  • a host cell containing a genetically engineered circular extra-chromosomal DNA element having a size of about 40 kb to about 110 kb, wherein the element is resistant to ⁇ exonuclease and contains at least one open reading frame.
  • Table 1 provides a list of partial sequences of DNA. The asterisk indicates that two identifiable sequences were obtained using either M13 forward or reverse primers. NA denotes that the strain information is not available.
  • Figure 1 provides results from an analysis of CED from murine brain.
  • the CED was prepared by an alkaline extraction procedure (Griffin, B. E., etal, (1981) J. Virol, 40, 11- 19) and analysed by electrophoresis in an agarose gel (0.7% w/v) counter-stained with ethidium bromide.
  • Lane 1 contains Balb/c CED.
  • Lane 2 shows Balb/c CED digested with the Notl restriction enzyme. Note the increase in the molecular weight of the Notl digested material.
  • Figure 2 provides results from an examination of CED from various mouse tissues. CED from various mouse tissues were prepared as described and subsequently analysed by electrophoresis in agarose gel (0.4% w/v).
  • Lanes 1-4 include CED from Balb/c brain (lane 1), spleen (lane 2), thymus (lane 3), and testis (lane 4).
  • Lanes 5 to 7 include CED from C57/B16 brain (lane 5), spleen (lane 6 and whole testis (lane 7).
  • Lanes 8 and 9 show CED from C57/B16 RAG-1 -/- liver (lane 6) and brain (lane 9).
  • B The agarose gel in (A) was blotted unto nylon filters and probed using 32 P NE4 probe derived from Balb/c CED circles. The results from Southern blot shows that the CED found in various tissues react with NE4 probes.
  • Figure 3 presents a schematic of the NE4 probe, used for Southern blot analysis and in situ hybridisation studies, corresponds to the intra-cisternal A particle (IAP) region of the short incubation mouse prion gene.
  • the prion gene consists of three exons (Inoue et al. , (1997) J. Vet. Med. Sci, 59(3), 175-183), the first two are non-coding and the third exon is translated into proteins that are believed to be the etiological agents of transmissible spongiform encephalopathies.
  • the IAP region, as well as the two non-coding exons, may play an important role in regulating the expression of exon 3.
  • Figure 4 presents the sequence (SEQ ID NO.J) of a Notl subclone of CED isolated from Balb/c mouse brain.
  • X represents a, t, g or c.
  • FIG. 5 shows a demonstration of the isolation and characterisation of CED from human tissue.
  • CED was prepared by an alkaline extraction procedure and analysed by electrophoresis in agarose gel (0.4% w/v) and counter-stained with ethidium bromide.
  • Lane 1 and 2 contain DNA extractions of human sperm and leukocytes, respectively. Lane 2 shows a band of CED.
  • B The agarose gel was blotted onto nylon filtered and probed with the NE4 probe derived from Balb/c brain CED.
  • Figure 6 shows evidence that purified CED generally has a clustered appearance when viewed under the transmission electron microscope (A).
  • the individual strands appeared fibril-like (B) and exhibited resemblance to the scrapie-associated fibrils responsible for transmission of spongiform encephalopathies (Merz etal, (1983) Nature, 306, 474-476; Merz etal, (1987) J Virol, 61, 42-49; Prusiner etal, (1983) Cell. 35 (2 Pt 1), 349-358).
  • Figure 7 demonstrates the subcellular localisation of CED using in situ hybridisation.
  • the NE4 probe corresponding to a sequence within CED, was used to determine the subcellular localisation of CED. Signal appeared within the nucleus of many cells in grey and white matter, suggesting that CED is ubiquitously distributed in healthy brain cells.
  • FIG. 8 presents results of a study wherein purified CED was digested with proteases, RNases and DNases.
  • CED was digested with RNase, proteinase K and DNase.
  • the bands corresponding to CED were present after treatment with RNase or proteinase K but absent in DNase treated lanes, strongly suggesting that CED consists of DNA elements.
  • Lane 1 is CED treated with RNase; lane 2 is CED treated with Proteinase K; Lane 3 is CED treated with DNase/Mn buffer; and lane 4 shows CED treated with DNase/Mg buffer.
  • Figure 9 shows an electrophoresis gel of CED isolated from mice defective in immunological rearrangement.
  • the brain (lanes 1 - 4) and liver (lanes 5 - 8) of Balb/c (lanes 1 and 5), RAG1 deficient mice (lanes 2 and 6) and RAG2 deficient mice (lanes 3 and 7) and SCID mice (lanes 4 and 8) were examined for the presence of CED.
  • electrophoresis of the CED produced a band around 65 kb. This finding indicates that the formation of CED is independent of immunoglobulin or TCR recombination.
  • FIG 10 demonstrates that CED is present in various organisms.
  • CED appears to be widely distributed in the animal kingdom and extra-chromosomal circular DNA, the size of CED in mice were found in human (lane 1), rat (lane 2), and shark (lane 4) brains, as well as chick liver (lane 3).
  • Lane 5 contained CED from Balb/c mouse brain as a control.
  • Figure 11 demonstrates homogeneity of CED elements obtained from human peripheral blood leukocytes.
  • the CED from several species was subcloned into sequencing vectors and Cosmid vectors.
  • the analysis of three independent isolates of the human peripheral blood leukocytes have demonstrated no heterogeneity in restriction digests with several enzymes including Notl, SacII, Kpnl and Xhol.
  • Figure 12 shows a comparison of CED from brain and testis.
  • CED isolated from C57/b6 brain and testis was analysed using EcoRI and Hindlll restriction enzymes. This example demonstrates a heterogeneity between the CED elements isolated from the C57/b6 brain and testis.
  • Figure 13 depicts the results of PCR analysis of prion-like gene in CED.
  • Ten forward and reverse primers corresponding to various regions of the short incubation prion gene were used in the PCR analysis using genomic DNA and linearised CED as templates (CED isolated from Balb/c brain was subcloned into the Supercosmid vector and digested with Notl).
  • Primers 1 forward (IF) and 1 reverse (1R) correspond to approximately 4 kb upstream of exon 1.
  • Primers 2 forward (2F) and 2 reverse (2R) correspond to approximately 0.8 kb upstream of exon 1.
  • Primers 3 forward (3F) and 3 reverse (3R) correspond to approximately I kb downstream of exon 3.
  • Primers 4 forward (4F) and 4 reverse (4R) correspond to the coding sequence of the short incubation prion gene.
  • Primers 5 forward (5F) and 5 reverse (5R) extend from exon 2 to exon 3 of the gene.
  • the sequences of the primers IF, 1R, 2F, 2R, 3F and 3R were found in genomic DNA but not in CED.
  • the sequences of primers 4F and 4R was found in both genomic DNA and CED, which indicates that the coding sequence of the prion gene is present in both.
  • the genomic sequence overlapping exons 2 and 3 was not found in genomic DNA, but was present in CED, as evidenced by the act that the sequences of primers 5F and 5R were found in CED but not in genomic DNA.
  • FIG. 14 shows that CED contains a sequence that corresponds to exon 3 coding sequence of the prion gene.
  • PCR was performed on CED from C57 (lane 2) and Balb/c (lane 3) mouse brain, using primers directed toward the coding sequence of exon 3 and generated a product of approximately 770 bp.
  • Lane M contained marker DNA (1 kb extended ladder) and lane 1 contained the product of the control PCR, which contained no target DNA.
  • Figure 15 presents the results of ⁇ exonuclease digestion of plasmid DNA, CED and mouse genomic DNA.
  • Figure 16 shows the PCR products from amplification of cosmid subclones of Balb/c mouse brain CED (WJBB), C57 mouse brain CED (WJCB) and human leukocyte CED (WJHL) using the DF2 primer.
  • WJBB Balb/c mouse brain CED
  • WJCB C57 mouse brain CED
  • WJHL human leukocyte CED
  • Figure 17 shows the PCR products from amplification of cosmid subclones of Balb/c mouse brain CED (WJBB), C57 mouse brain CED (WJCB) and human leukocyte CED (WJHL) and the PCR product from genomic DNA, all using the DF3 primer.
  • WJBB Balb/c mouse brain CED
  • WJCB C57 mouse brain CED
  • WJHL human leukocyte CED
  • Lane 18 presents the results of PCR amplification.
  • Lanes 1 to 8 contain PCR products from CED with (+ ⁇ ) and without (- ⁇ ) ⁇ exonuclease pretreatment from amplification using primers specific for the IAP sequence (IAP), the prion gene sequence (PrP) and the DF2 and DF3 primers.
  • Lanes 9 and 10 contain PCR products from a positive control DNA template (mouse testis genomic DNA) known to produce PCR products using the IAP, PrP primers.
  • Lanes 11 and 12 contain PCR products from a positive control DNA template (WJBB cosmid sublone of CED obtained from Balb/c mouse brain) known to produce PCR products using the DF2 and DF3 primers.
  • Figure 19 presents a direct comparison of PCR products generated using the DF2 and DF3 primers and genomic and CED templates.
  • the CED templates used were isolated CED with (CED + ⁇ ) and without (CED - ⁇ ) ⁇ exonuclease pretreatment or the WJBB cosmid sublone of CED obtained from Balb/c mouse brain (WJBB).
  • Figures 20 to 32 present maps of contigs 1 through 10 and 11 through 14 from CED isolated from Balb/c mouse brain.
  • Figure 33 presents the results from a PCR amplification of WJBB (lane 1), WJCB (lane 2), human native CED (lane 3), WJCT (lane 4), SCID testis CED (lane 5) and Balb/c liver CED (lane 6) using the DF2 primer pair.
  • WJBB, WJCB and WJCT denote cosmid clones made from Balb/c brain, C57 brain and C57 testis CED, respectively.
  • Figure 34 presents the results from a PCR amplification of WJBB (lane 1), WJCB (lane 2), human native CED (lane 3) and WJCT (lane 4) using the DF3 primer pair.
  • WJBB, WJCB and WJCT denote cosmid clones made from Balb/c brain, C57 brain and C57 testis CED, respectively.
  • Figure 35 presents the results from a PCR amplification of ⁇ exonuclease-untreated (lanes 1 to 3) and ⁇ exonuclease-treated (lanes 4 to 6) CED isolated from CHO(+) cells transfected with the WJBB cosmid clone.
  • the PCR was performed using neomycin- resistance gene specific primers (lanes 1 and 4), the DF2 primer pair (lane 2 and 5) and the DF3 primer pair (lanes 3 and 6).
  • Figure 36 presents the nucleotide sequence (SEQ ID NO:2) of the PCR product generated from mouse brain CED using the DF2 primer pair.
  • Figure 37 presents the nucleotide sequence (SEQ ID NO: 3) of the PCR product generated from mouse brain CED using the DF3 primer pair.
  • Figure 38 presents the results of a BLAST comparison of sequences from CED elements derived from Balb/c and C57 mouse brains.
  • Figure 39 presents the results from PCR amplification of CED elements from brain tissue of a PrP knock-out mouse.
  • One set of CED elements was treated with ⁇ exonuclease and compared with the untreated CED elements.
  • PCR was performed using primers specific for IAP, Wrn, PrP exon3 sequences and the DF2 primer pair.
  • CED refers to extra-chromosomal, covalently closed circular DNA.
  • Protein refers to include a whole protein, or fragment thereof, such as a protein domain or a binding site for a second messenger, co-factor, ion, etc. It can be a peptide or an amino acid sequence that functions as a signal or another protein in the system, such as a proteolytic cleavage site.
  • isolated polynucleotide refers a polynucleotide of genomic, cDNA, or synthetic origin or some combination there of, which by virtue of its origin the "isolated polynucleotide” (1) is not associated with the cell in which the "isolated polynucleotide” is found in nature, or (2) is operably linked to a polynucleotide which it is not linked to in nature.
  • Polypeptide as used herein as a generic term to refer to native protein, fragments, or analogs of a polypeptide sequence. Hence, native protein, fragments, and analogs are species of the polypeptide genus.
  • a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally-occurring.
  • Polynucleotide refers to a polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms of DNA.
  • “Corresponds to” refers to a polynucleotide sequence that is homologous to all or a portion of a reference polynucleotide sequence, or to a polypeptide sequence that is homologous to a reference polypeptide sequence.
  • the term “complementary to” is used herein to mean that the complementary sequence is homologous to all or a portion of the complement of a reference polynucleotide sequence.
  • the nucleotide sequence "TAT AC” corresponds to a reference sequence "TAT AC” and is complementary to a reference sequence "GTATA”.
  • Primer-like refers to sequences that are similar or identical to known prion nucleic acid and protein sequences. Prion-like sequences are understood to include expressible nucleic acids, proteins and peptides which may or may not comprise an infectious form.
  • the present invention provides novel DNA elements that have been identified in animal tissues.
  • the novel DNA elements are composed of closed, circular, double-stranded DNA and have been isolated from various tissues. Although these CED elements may contain some sequences that are homologous to mitochondrial DNA sequences, these CED elements are distinct from known mitochondrial DNA.
  • the size of the naturally occurring CED element of the present invention is relatively homogeneous within each tissue, the range of which can vary from tissue to tissue. In one embodiment the size ranges from about 40 kb to about 110 kb. In another embodiment the size of the CED ranges from about 50 kb to about 100 kb. In a related embodiment the size of the CED ranges from 60 to 100 kb.
  • the size of the modified CED element may be greater than or less than the ranges outlined above.
  • the CED element of the present invention is capable of autonomous replication, as demonstrated in Example IX.
  • the CED elements contain at least one open reading frame.
  • each CED circle comprises one prion gene.
  • the partial sequence of one exemplary CED isolated from mouse brain (see Table 1) demonstrates the presence of genes or gene fragments from different chromosomal locations that are known to be involved in animal development and pathogenesis.
  • the present invention provides a discrete extra-chromosomal DNA, which is circular and which has electrophoretic migration characteristics that differ from any known extra- chromosomal DNA.
  • CED elements are discrete in nature and differ from the heterogeneous circles previously reported for TCR in the thymus and BCR rearrangement in the bone marrow and spleen.
  • a survey of the literature reveals that no previous reports have appeared describing DNA circles of this size and homogeneity in normal animal tissues or species.
  • the natural formation of the circular CED of the present invention does not depend on the RAG-1 gene.
  • the alkaline extraction procedure was used to extract circular DNA from liver, spleen, testis and thymus tissues from Balb/c mice. As illustrated in Figure 2, discrete forms of CED exist in various tissues. In one example, the CED isolated from liver migrates with an apparent size of 100 kb while that isolated from testis tissues migrates with an apparent size of 65 kb.
  • the CED of the present invention can be isolated from the tissue of interest, cleaved with restriction enzyme, for example EcoRI, BamHI or Saul, and subcloned into a pBluescript sequencing vector.
  • restriction enzyme for example EcoRI, BamHI or Saul
  • the sizes of the inserts will vary from 200 bp to 9 kb and may span the entire CED.
  • These clones can be expanded and partially sequenced.
  • Table 1 shows a partial list of sequences and of the identities of some of the sequences that were identified using this technique on Balb/c mouse brain CED.
  • circular DNA preps can be prepared from various tissues, including brain, liver, testis and peripheral blood leukocyte (PBL) cells.
  • PBL peripheral blood leukocyte
  • Modified Circular Extra-chromosomal DNA Elements One embodiment of the present invention provides modified CED elements that have been modified by the excision of one or more portions from a naturally occurring CED element.
  • a related embodiment provides CED elements that have been modified by insertion of one or more heterologous polynucleotides into a naturally occurring CED element or a CED element derived from a naturally occurring CED element.
  • the present invention encompasses CED elements that include at least one heterologous polynucleotide that contains a regulatory sequence such as a ribosome binding site, polyadenylation site, splice donor or acceptor site, promoter, transcription terminator or enhancer sequence.
  • a heterologous polynucleotide can also be a marker gene or can be used to a express an mRNA, a protein or a peptide of interest.
  • One embodiment of the present invention provides fragments, analogs and derivatives of CED, wherein the fragments, analogs and derivatives are capable of autonomous replication.
  • Another embodiment of the present invention provides linearised forms of the naturally occurring or modified CED elements.
  • One embodiment of the present invention provides a method of isolating CED from animal tissue. This method is unbiased toward TCR and BCR rearrangement and is a modification of the method used to isolate circular DNA from Epstein Barr virus (episome) (Griffin, B. E., etal, (1981) J. Virol, 40, 11-19). The use of the method to isolate mouse brain CED is summarised in Example I.
  • Example I brain tissues from five healthy adult male Balb/c mice were dissected and circular DNA was extracted using the alkaline extraction method of the present invention.
  • the DNA preparation was examined by agarose gel electrophoresis. As evidenced in Figure 1, lane 1 the isolated DNA migrated as a discrete molecular species of approximately 50 kb. When the DNA was cleaved with the rare cutting endonuclease Notl (lane 2), the resulting digested material migrated as a discrete band with an approximate molecular size of 65 kb. This change in migration is indicative of the relaxation of super- coiled circular DNA into an extended linear form.
  • One embodiment of the present invention provides a method of isolating CED, as described above, that additionally includes a step in which the isolated CED preparation is treated with ⁇ exonuclease to remove any contaminating linear DNA, such as chromosomal DNA.
  • Mitochondrial DNA sequencing is an alternative to genomic DNA genetic testing that has found widespread use in forensic, archaeological and lineage analysis, in cases where the sample is highly degraded and/or contaminated, such that the genomic DNA is often present in such low quantities or in such poor condition and is useless for reliable genetic testing. Since CED is circular and relatively small it would also provide an alternative source of genetic material, in a manner similar to the use of mitochondrial, because CED is polymorphic and exhibits reduced susceptibility to denaturation in comparison to genomic DNA.
  • Example VI demonstrates polymorphism between CED sequences from two different mouse strains. This polymorphism can be used to distinguish between the sequences obtained from the two mouse strains.
  • One embodiment of the present invention provides the use of a CED element, or a fragment thereof, as a means of stably expressing a heterologous polynucleotide.
  • a heterologous polynucleotide encoding a protein, a peptide or mRNA of interest can be inserted into the CED element, or a fragment thereof, using standard molecular biology techniques well known to those skilled in the art.
  • the heterologous polynucleotide can be a marker gene. Following insertion of the heterologous polynucleotide with the appropriate regulatory elements, it can be expressed either following transfection into host cells.
  • Example IX demonstrates the expression of the neomycin resistance gene following its insertion, with appropriate regulatory sequences from the cosmid vector, into a 65 kb fragment of CED.
  • TCR T cell receptor
  • BCR B cell receptor
  • mice were perfused with phosphate-buffered saline (PBS) through a left ventricular incision through the heart.
  • PBS phosphate-buffered saline
  • the organs were harvested and the DNA was immediately extracted by first rinsing the tissue with PBS and placing it in alkaline sodium dodecyl sulphate buffer (50 mM NaCl, 2 mM EDTA, 1 % SDS, pH 12.4). After the tissue was incubated and gently agitated at 37°C for 1 hour, Proteinase K solution (0.05 volumes of 1 M Tris pH 7.0, 0.2 volumes of 5 M NaCl, 0.02 volume of 0.5 % solution of Proteinase K) was added and the tissue mixture was incubated for 1 hour with gentle swirling.
  • PBS phosphate-buffered saline
  • the sample was frozen overnight at -20°C to precipitate the circular DNA.
  • the DNA was collected by centrifuging the sample for 20 minutes at 5200 rpm. Subsequently, the ethanol was removed and the DNA pellet was dried.
  • the DNA was resuspended in Tris-EDTA bu er (TE; pH 7) with RNase (2 ⁇ l/100 ⁇ l Tris), and left overnight at 37 °C.
  • RNase was removed by phenol/choroform extraction (1:1) and the CED elements were precipitated using two volumes of ethanol and 1/10 volume of sodium acetate. The mixture was kept at 20 °C for one hour and the CED elements were collected by centrifugation at 11 000 rpm.
  • the ethanol was decanted and the pellet was air dried and resuspended in Tris buffer (pH 7J).
  • the DNA preparation was examined by agarose gel electrophoresis. As shown in Figure 1, the CED in lane 1 migrated as a discreet molecular species of approximately 50 kb. Following cleavage of the DNA with the rare cutting endonuclease, Notl (lane 2), only one distinct molecular species was observed. The resulting digested material migrated as a single band with an approximate molecular size of 65 kb. The digested DNA migrated more slowly than the intact DNA, which is indicative of the relaxation of super-coiled circular DNA into an extended linear form. This data demonstrates that within the brain there exists a novel discrete extra-chromosomal, circular DNA, which is four to five times larger than the mouse mitochondrial genome (T. A.
  • the Balb/c CED was isolated, cleaved with Notl, EcoRI, BamHI or Saul and subcloned into a pBluescript sequencing vector.
  • the CED was subcloned for sequencing as described herein although alternative methods of subcloning may also be used, as would be understood to a worker skilled in the art.
  • the CED was obtained from the brain of Balb/c mice, as described above.
  • the DNA was digested with EcoRI (NE and KE clones) and BamHI (KB clones) and subcloned into the multiple cloning site in pBluescriptTM (following digestion of pBluescriptTM with EcoRI and BamHI and treatment with calf intestinal alkaline phosphatase).
  • the ligated DNA was transformed into E. coli DH10B electro-competent cells using Gene PulserTM. Ampicillin-resistant E. coli colonies were selected and the plasmid DNA was extracted. Clones of the desired sizes of the DNA inserts were automatically sequenced using an
  • M13 forward (5'-GTAAAACGACGGCCAAGT-3' (SEQ ID NO:4)) or reverse primer (5'- GCGAAACAGCTATGACCATG-3' (SEQ ID NO:5)).
  • the sizes of the cloned inserts varied from 200 bp to 9 kb and these libraries likely span the entire brain CED. These clones were expanded and partially sequenced. Table 1 presents a list of exemplary sequences found in the CED, and the identities of some of the sequences.
  • the fragments from the mouse brain CED include genes involved in DNA replication/recombination (Yan, H, et al, (1988) Nat. Genet, 19, 375-378; Brosh, Jr., R. M., etal, (1999) J. Biol. Chem., 274, 18341-18350; Harmon, F. G, et al, (1999) Mol Cell, 3, 611-620; and Liu, Y., etal, (1999) Cell.
  • the NE4 probe obtained from the subcloned CED ( Figure 3) hybridised with the CED isolated from the mouse brain, liver, spleen and testis.
  • the CED elements isolated from these tissues all contained the NE4 sequence identified in the mouse brain CED element.
  • the CED extracted from the Balb/c and C57/B16 mice migrated with a similar molecular size.
  • a cosmid clone was constructed using 3 ⁇ g of cosmid vector, Super cosmid 1 (Stratagene), which was digested with Xbal for 1 hour at 37 °C and treated with calf intestine phosphatase for 30 minutes. Subsequently, the cosmid vector was cut with Not I and ligated with a Notl fragment excised from Balb/c mouse brain CED (incubation at 16 °C overnight). The resulting DNA was packaged into bacteriophage using the XL1 in vitro packaging system (Stratagene). XL1 E. coli cells were infected with the phages generated above and plated on ampicillin-LB agar plates for screening of ampicillin-resistant colonies. The isolated cosmid clone was used for sequencing of the Notl insert, which contains at least 75 - 80 % of the entire Balb/c mouse brain CED.
  • CED was isolated using the alkaline extraction method outlined above and 5 ⁇ l of the CED solution (1.0 ⁇ g/ ⁇ l) was placed on a formvar-coated copper grid. The sample was then negatively stained with 2 % aqueous uranyl acetate for five minutes. The grid was then air dried and viewed under the transmission electron microscope (Figure 6).
  • CED has an unusual fibril-like structure.
  • the large structures shown in Figure 6A are aggregates of CED and the smaller structures in Figure 6B are single or small aggregates of CED. Surprisingly, these structures are morphologically similar to those described for the prion infectious agent.
  • a digoxigenin-labelled DNA probe derived from the Balb/c brain CED was synthesised for use in in situ hybridisation.
  • the NE4 clone was grown vigorously (300 rpm) in 2 ml of LB media containing ampicillin (100 ⁇ g/ml) overnight.
  • the bacterial cells were mini-preped by alkaline lysis.
  • 2 mg of extracted DNA was digested with EcoRI (10U; Gibco-BRL) for one hour and electrophoresed on an 0.8 % agarose gel.
  • the insert DNA was cut out of the gel and purified by QiaxIITM gel extraction kit (Qiagene).
  • DIG-high prime Boerhinger-Mannheim
  • This probe was used to examine, within mouse brain sections, the localisation of CED within cells of the brain.
  • the probe will identify both genomic and CED prion gene sequences. As shown in Figure 7 all the detected signals were localised within the nucleus of the labelled cells which indicates that CED is also localised to the nucleus of the brain cells.
  • CED elements from various mouse and human tissues were purified as described in Example I. PCR was performed using the isolated CEDs in order to demonstrate that components of the prion gene are present in the CED. Primers were prepared based on the sequence of exon 3 of the prion gene, which encodes the prion protein, and on the sequence of the promoter. Within the chromosomal prion gene these regions are separated by 38 kb.
  • Figure 13 depicts the results of PCR analysis of the prion-like sequence in the CED elements.
  • Ten forward and reverse primers corresponding to various regions of the short incubation prion gene were used in the PCR analysis using genomic DNA and linearised CED as templates (CED isolated from Balb/c brain were subcloned into the Supercosmid vector and digested with Notl).
  • Primers IF and IR correspond to approximately 4 kb upstream of exon 1: forward (IF), GGACACGCATGGATACACAC (SEQ ID NO:6); and reverse (IR), TGACCAGGCAACTCTTGTG (SEQ ID NO:7).
  • Primers 2F and 2R correspond to approximately 0.8 kb upstream of exon 1: forward (2F), GTCAGCCTTGAACTTGAGAG (SEQ ID NO:8); and reverse (2R),
  • Primers 3F and 3R correspond to approximately 1 kb downstream of exon 3: forward (3F), GGTTTTTGTCCTGAATCCAG (SEQ ID NO:10); and reverse (3R), GCAAAATCTGAGCTATGAGG (SEQ ID NO:ll).
  • Primers 4F and 4R correspond to the coding sequence of the short incubation prion gene: forward (4F),
  • TCAGTCATCATGGCGAACCT (SEQ ID NO: 12); and reverse (4R), CACGATCAGGAAGATGAGGA (SEQ ID NO:13).
  • Primers 5F and 5R extend from exon 2 to exon 3 of the gene: forward (5F), ACTGAACCATTTCAACCGAG (SEQ ID NO:14); and reverse (5R), TGGTTGTGTACTGATCCAC (SEQ ID NO:15).
  • the use primers IF, IR, 2F, 2R, 3F and 3R were found to produce PCR products from genomic DNA templates but not from PCR using CED as a template.
  • primers 4F and 4R resulted in the production of PCR products from both genomic DNA and CED templates, which indicates that the coding sequence of the prion gene is present in both.
  • the prion gene sequence overlapping exons 2 and 3 was not found in genomic DNA, but was present in CED, as evidenced by the fact that the use of primers 5F and 5R resulted in the production of PCR products from CED but not from genomic DNA.
  • FIG. 14 shows that CED contains a sequence that corresponds to exon 3 coding sequence of the prion gene.
  • PCR was performed on CED from C57 (lane 2) and Balb/c (lane 3) mouse brain, using primers directed toward the coding sequence of exon 3 and generated a product of approximately 770 bp.
  • Lane M contained marker DNA (1 kb extended ladder) and lane 1 contained the product of the control PCR, which contained no target DNA. Together with the previous observation of the presence of the IAP gene within intron 3, this data indicates at least a portion of the complete prion gene is contained within the mouse brain CED.
  • EXAMPLE VI Demonstration of Polymorphism Between Different Mouse Strains
  • FIGS 16 and 17 demonstrate that the ⁇ DNA population isolated from the brains of two different mouse strains, Balb/c (WJBB) and C57 (WJCB) is homogeneous.
  • the isolated CEDs from each mouse strain were used as templates for PCR amplification with two Balb/c specific primer pairs:
  • DF3 Forward GCTTGCATTATTGGATCTCTGA (SEQ ID NO:18)
  • DF3 Reverse CGATCACCACTTGACTTCTCAA (SEQ ID NO:19)
  • the sequences for the DF2 and DF3 primers were designed from the sequencing data of Balb/c brain cosmid circular DNA (WJBB). The results indicate that at least these two CED elements from mouse brains share common sequences.
  • the CED isolated from human leucocytes (WJHL) also generated products from PCR using the DF2 and DF3 primers, although they are different in size from those generated from the mouse CEDs.
  • WJBB DNA was subjected to sequential digestion with exonuclease III and was sequenced. Initially 14 contigs were generated with some gaps between the contigs. To join them, PCR was exploited based on the sequences obtained from these contigs. The sequence from each contig was directly used for BLAST search in order to identify homologous sequences. Contig 7 and 9 contain part of hemoglobin alpha chain exon 3 and yeast zinc finger protein respectively with several repeats of the sequences. Contig 1 contains sequences with homology to i) the cystic fibrosis transmembrane conductance regulator gene which is associated cystic fibrosis, and ii) Smarcall, chromatin regulator.
  • Contig 3 contains two interesting sequences with homology to retrotransposon and prostate susceptibility gene (HPC2). Retrotransposon is a critical genetic element in evolution.
  • Contig 4 contains a sequence homologous to a transcription factor, an insulator gene, and a replication protein implying this segment has some regulatory functions.
  • Contig 5 has a sequence homologous to a partial sequence of EBNA1, which facilitates autonomous replication of Epstein Barr virus.
  • contig 7 contains a sequence homologous to a topoisomerse gene.
  • many contigs exhibited partial homologies to mitochondrial genes or to nuclear genes encoding mitochodrial proteins and to sequences in reverse transcriptase.
  • CHO Chinese Hamster Ovary Cells
  • 2 x 10 6 CHO cells were seeded one day before transfection; the cells reached approximately 70 % confluence.
  • the cells were transfected with 3 ⁇ g of the WJBB construct using lipofectamine (Gibco-BRL).
  • the cells were subjected to selection with neomycin (G418, 700 ⁇ g/ml).
  • G418-resistant cells went through approximately 40 cell division cycles and were frozen at -130 °C for 6 months. After 6 months the cells were thawed and allowed to go through another 10 cell division cycles.
  • CED was extracted from the cells and used in PCR ( Figure 35).
  • PrP knock-out mice were prepared by insertion of the neomycin resistance gene into exon 3 of the PrP gene.
  • CED elements were isolated from the PrP knock-out mice according to the protocol described above. Following isolation the CED elements were analysed by PCR to demonstrate the presence of the neomycin resistance gene in the prion-like sequence. The results shown in Figure 39 indicate that the CED elements do contain the neomycin resistance gene because the PCR products from the PCR performed using primers directed toward exon 3 of the PrP gene sequence were larger from CED elements isolated from the PrP knock-out mice than from the wild-type mice. The larger products are indicative of the presence of the heterologous neomycin resistance gene in the CED elements of these mice.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne de nouveaux éléments circulaires d'ADN extra-chromosomique (CED) isolés à partir d'une grande variété d'organismes. Ces éléments CED présentent une dimension allant de 40 kb à 110 kb environ, sont résistants à la μ exonucléase et contiennent au moins un cadre de lecture ouvert. On peut modifier ces éléments CED au moyen de techniques de biologie moléculaire conventionnelles, adapter leur utilisation à différentes applications, par exemple par l'incorporation de séquences d'acide nucléique hétérologues. L'invention concerne également un procédé permettant d'isoler ces éléments CED dans un tissu animal. On peut utiliser ces éléments CED dans des tests génétiques et en tant qu'élément d'expression stable.
PCT/CA2001/000205 2000-11-07 2001-02-23 Nouveaux elements circulaires d'adn extra-chromosomique WO2002038755A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CA2,323,194 2000-11-07
CA2323194 2000-11-07

Publications (1)

Publication Number Publication Date
WO2002038755A1 true WO2002038755A1 (fr) 2002-05-16

Family

ID=4167373

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2001/000205 WO2002038755A1 (fr) 2000-11-07 2001-02-23 Nouveaux elements circulaires d'adn extra-chromosomique

Country Status (3)

Country Link
EP (1) EP1364007A1 (fr)
AU (1) AU2001235282A1 (fr)
WO (1) WO2002038755A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1774959A1 (fr) * 2005-09-21 2007-04-18 L'Oréal Oligonucléotide d'ARN double brin inhibant l'expression de la tyrosinase
WO2008118679A1 (fr) * 2007-03-23 2008-10-02 Ge Healthcare Bio-Sciences Corp. Amplification multi-amorcée de séquences d'acides nucléiques circulaires
WO2014057109A1 (fr) * 2012-10-12 2014-04-17 Glycovaxyn Ag Procédés de modification d'une cellule-hôte
CN106244585A (zh) * 2016-10-11 2016-12-21 皖南医学院 一种简易高效钉螺线粒体基因组dna的提取方法
CN114908083A (zh) * 2022-07-18 2022-08-16 中山大学附属第七医院(深圳) 一种双链环状dna体外快速合成的方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997016533A1 (fr) * 1995-10-31 1997-05-09 The Regents Of The University Of California Chromosomes mammaliens artificiels et procedes d'utilisation desdits chromosomes
DE19720839A1 (de) * 1997-05-17 1998-11-19 Dirk Dr Schindelhauer Baukastenprinzip-Technologie zur Herstellung von langen, exakten DNA-Konstrukten in vitro, insbesondere für die Herstellung von Konstrukten zur Erzeugung von künstlichen Chromosomen (MAC, mammalian artificial chromosome) aus zwei stabil klonierten DNA-Komponenten und der ditelomerische Vektor-Prototyp PTAT
EP0919623A2 (fr) * 1997-11-17 1999-06-02 Roche Diagnostics GmbH Procédé et kit pour le clonage de fragments

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997016533A1 (fr) * 1995-10-31 1997-05-09 The Regents Of The University Of California Chromosomes mammaliens artificiels et procedes d'utilisation desdits chromosomes
DE19720839A1 (de) * 1997-05-17 1998-11-19 Dirk Dr Schindelhauer Baukastenprinzip-Technologie zur Herstellung von langen, exakten DNA-Konstrukten in vitro, insbesondere für die Herstellung von Konstrukten zur Erzeugung von künstlichen Chromosomen (MAC, mammalian artificial chromosome) aus zwei stabil klonierten DNA-Komponenten und der ditelomerische Vektor-Prototyp PTAT
EP0919623A2 (fr) * 1997-11-17 1999-06-02 Roche Diagnostics GmbH Procédé et kit pour le clonage de fragments

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BROWN W R A: "MAMMALIAN ARTIFICAL CHROMOSOMES", CURRENT OPINION IN GENETICS & DEVELOPMENT, CURRENT BIOLOGY LTD, XX, vol. 2, 1992, pages 479 - 486, XP000600761, ISSN: 0959-437X *
CALOS M P: "The potential of extrachromosomal replicating vectors for gene therapy", TRENDS IN GENETICS, ELSEVIER SCIENCE PUBLISHERS B.V. AMSTERDAM, NL, vol. 12, no. 11, November 1996 (1996-11-01), pages 463 - 466, XP004181563, ISSN: 0168-9525 *
GAUBATZ J W ET AL: "PURIFICATION OF EUKARYOTIC EXTRACHROMOSOMAL CIRCULAR DNAS USING EXONUCLEASE III", ANALYTICAL BIOCHEMISTRY, vol. 184, no. 2, 1990, pages 305 - 310, XP001024672, ISSN: 0003-2697 *
GRIFFIN B E ET AL: "SEQUENCE COMPLEXITY OF CIRCULAR EPSTEIN BARR VIRUS DNA IN TRANSFORMED CELLS", JOURNAL OF VIROLOGY, vol. 40, no. 1, 1981, pages 11 - 19, XP001024673, ISSN: 0022-538X *
HUXLEY C: "Mammalian artificial chromosomes and chromosome transgenics", TRENDS IN GENETICS, ELSEVIER SCIENCE PUBLISHERS B.V. AMSTERDAM, NL, vol. 13, no. 9, 1 September 1997 (1997-09-01), pages 345 - 347, XP004093527, ISSN: 0168-9525 *
SAITO I ET AL: "CHAROMIDS: COSMID VECTORS FOR EFFICIENT CLONING AND MAPPING OF LARGE OR SMALL RESTRICTION FRAGMENTS", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 83, no. 22, 1 November 1986 (1986-11-01), pages 8664 - 8668, XP002062747, ISSN: 0027-8424 *
SCHOENLEIN P V ET AL: "The degradation profile of extrachromosomal circular DNA during cisplatin-induced apoptosis is consistent with preferential cleavage at matrix attachment regions.", CHROMOSOMA (BERLIN), vol. 108, no. 2, 1999, pages 121 - 131, XP002178922, ISSN: 0009-5915 *
VAN LOON NANETTE ET AL: "Formation of extrachromosomal circular DNA in HeLa cells by nonhomologous recombination.", NUCLEIC ACIDS RESEARCH, vol. 22, no. 13, 1994, pages 2447 - 2452, XP002178923, ISSN: 0305-1048 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1774959A1 (fr) * 2005-09-21 2007-04-18 L'Oréal Oligonucléotide d'ARN double brin inhibant l'expression de la tyrosinase
US8410260B2 (en) 2005-09-21 2013-04-02 L'oreal Double-stranded RNA oligonucleotides which inhibit tyrosinase expression
US8822428B2 (en) 2005-09-21 2014-09-02 L'oreal Double-stranded RNA oligonucleotides which inhibit tyrosinase expression
WO2008118679A1 (fr) * 2007-03-23 2008-10-02 Ge Healthcare Bio-Sciences Corp. Amplification multi-amorcée de séquences d'acides nucléiques circulaires
WO2014057109A1 (fr) * 2012-10-12 2014-04-17 Glycovaxyn Ag Procédés de modification d'une cellule-hôte
CN106244585A (zh) * 2016-10-11 2016-12-21 皖南医学院 一种简易高效钉螺线粒体基因组dna的提取方法
CN114908083A (zh) * 2022-07-18 2022-08-16 中山大学附属第七医院(深圳) 一种双链环状dna体外快速合成的方法

Also Published As

Publication number Publication date
AU2001235282A1 (en) 2002-05-21
EP1364007A1 (fr) 2003-11-26

Similar Documents

Publication Publication Date Title
AU2021200010B2 (en) Novel CRISPR enzymes and systems
JP7083364B2 (ja) 配列操作のための最適化されたＣＲＩＳＰＲ－Ｃａｓ二重ニッカーゼ系、方法および組成物
AU2018289077B2 (en) Nucleic acid-guided nucleases
JP6793699B2 (ja) オフターゲット効果を低下させるｃｒｉｓｐｒ酵素突然変異
RU2766685C2 (ru) Рнк-направляемая инженерия генома человека
CN109890424A (zh) 用于治疗视网膜变性的基于crispr/cas9的组合物和方法
KR20180019655A (ko) 열 안정성 cas9 뉴클레아제
KR20160044457A (ko) 서열 조작을 위한 탠덤 안내 시스템, 방법 및 조성물의 전달, 조작 및 최적화
KR20150105635A (ko) 서열 조작을 위한 crispr-cas 성분 시스템, 방법 및 조성물
KR20150105633A (ko) 서열 조작을 위한 시스템, 방법 및 최적화된 가이드 조성물의 조작
US6395872B1 (en) Secreted neural adhesion proteins
KR20160030187A (ko) 간의 표적화 및 치료를 위한 ＣＲＩＳＰＲ­Ｃａｓ 시스템, 벡터 및 조성물의 전달 및 용도
Klinakis et al. Mobility assays confirm the broad host‐range activity of the Minos transposable element and validate new transformation tools
JP2001514510A (ja) 細胞表現型に影響を与える因子をコードする核酸配列を同定するための方法
CN112513277A (zh) 使用来自螟蛾属的转座酶将核酸构建体转座入真核基因组
AU2022331424A1 (en) Persistent allogeneic modified immune cells and methods of use thereof
Hofhaus et al. Highly divergent amino termini of the homologous human ALR and yeast scERV1 gene products define species specific differences in cellular localization
WO2002038755A1 (fr) Nouveaux elements circulaires d'adn extra-chromosomique
Banga et al. Complementation of V (D) J recombination defect and X-ray sensitivity of scid mouse cells by human chromosome 8
Christophides et al. Two medfly promoters that have originated by recent gene duplication drive distinct sex, tissue and temporal expression patterns
WO1998020031A1 (fr) Technique de production de genes, de proteines et de transcripts marques
Chao et al. Mutations in eukaryotic release factors 1 and 3 act as general nonsense suppressors in Drosophila
Bain et al. Disruption of the gene encoding the p34/31 polypeptides affects growth and development of Dictyostelium discoideum
Templeton Strategies for improving the frequency and assessment of homologous recombination
RU2792654C2 (ru) Новые ферменты и системы crispr

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 2001907280

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2001907280

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2001907280

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP