WO2002020784A1 - Novel polypeptide--- a ribosomal protein s1111.22 and polynucleotide encoding it - Google Patents

Abstract

The invention concerns a ribosomal protein S1111.22 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. disorder of protein metabolism etc. utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes a ribosomal protein S1111.22.

Description

 A New Polypeptide-Riboprotein S1111. 22 and Polynucleotide Technology of This Polypeptide

 The present invention belongs to the field of biotechnology, and specifically, the present invention describes a new polypeptide, a "glycoprotein S1111. 22", and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. technical background

 The ribosome contains more than 70 proteins, which are essentially the same in nature. When separated from ribosomes, they tend to settle down, and some can be lost during ribosomal purification. Although the ribosome structure and function are very complicated, some characteristics of some ribosomal proteins have been clarified. From the human fibroblast cDNA library, a cDNA encoding human ribosomal protein S11 has been screened (Okayama, H. And Berg, P., 1983).

 The human ribosomal protein Sl is located on the small subunit of the ribosome. It contains 15 residues of 5, the leader sequence, the entire protein coding sequence and 51 residues of the 3 'non-coding sequence. 158 residues are similar to murine rpSll (Tanaka, T Kuwano, Y. et al., 1985). However, the nucleotide sequences of the two are found to be different, but some differences do not affect their encoding of the same amino acid residues.

 The mouse ribosomal protein Sl l cDNA has only one reading frame open, and the other two reading frames are interrupted by the stop codon. The first amino acid encoded by it is Met, and the Sl l protein contains a total of 3 Met. Residues (Col latz, E., Ulbrich, N. et al ,, 1983), Met is considered to be the starting factor for this mechanism. In mouse mRNA3, the non-coding region contains only 55 nucleotides in addition to the poly A sequence, and the poly A structure is located 29 nucleotides after the stop codon. The non-coding region of murine mRNA3 is shorter than most other fflRNAs. Shorter3, non-coding region appears to be a common feature of eukaryotic ribosomal protein raRNA (Wiedemann, LM, and Perry, RP, 1984; Amaldi, F., Baccar i, E. et al., 1982).

 At the same time, the eukaryotic and prokaryotic ribosomal proteins were analyzed to find some similar regions in the sequence, which indicates that the ribosomal proteins are more conserved during the evolution of the organism (Tanaka, T., Wool, IG, and Stoff ler, G., 1980).

Gene chip analysis revealed that in the bladder mucosa, PMA + E _CV 304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-forming fc growth factor stimulation, 101 ³ HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer construct cell EJ, bladder cancer side, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer, expression profile of polypeptide of the present invention and ribosomal protein S11 The expression profiles are very similar, so their functions may also be similar. The present invention is named ribosomal protein S1111. 22.

 As the ribosomal protein S1111. 22 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more involved in these processes The ribosomal protein S1111. 22 protein, especially the amino acid sequence of this protein is identified. Isolation of the new ribosomal protein S1111. 22 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Object of the invention

 It is an object of the present invention to provide an isolated novel polypeptide monoribosomal protein S1111. 22 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a ribosomal protein S1111.22.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a ribosomal protein S1111.22.

 Another object of the present invention is to provide a method for producing ribosomal protein S1111.22.

 Another object of the present invention is to provide antibodies against the polypeptide of the present invention-ribosomal protein S1111.22.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-ribosomal protein S1111.22.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of ribosomal protein S1111.22. Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

The present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: Its variant:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 292-600 in SEQ ID NO: 1; and (b) having a sequence of 1-1897 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit ribosomal protein S1111. 22 protein activity, which comprises using the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of ribosomal protein S1111. 22 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of ribosomal protein S1111.22.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of ribosomal protein S1111. 22 and ribosomal protein S11 of the present invention. The upper graph is a graph of the ribosomal protein S1111. 22 expression, and the lower graph is the graph of the ribosomal protein S11 expression. Among them, 1-bladder mucosa, 2- PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6-scar into fc growth factor Stimulation, 1013HT, 7-scar into fc without stimulation with growth factor, 1013HC, 8_ bladder cancer Established cells EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal skin, 1 bucket-spleen, 15-prostate cancer, 16-jejunal adenocarcinoma, 17 cardia cancer .

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated ribosomal protein S1111.22. l lkDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with ribosomal protein S1111.22, can cause the protein to change, thereby regulating the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind to the ribosomal protein S1111.22.

An "antagonist" or "inhibitor" refers to a molecule that, when combined with ribosomal protein S1111. 22, can block or regulate the biological or immunological activity of ribosomal protein S1111. 22. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other ribosomal protein S1111. 22 Molecule.

 "Regulation" refers to a change in the function of ribosomal protein S1111.22, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of ribosomal protein S1111.22.

 "Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify ribosomal protein S1111. 22 using standard protein purification techniques. The essentially pure ribosomal protein S1111. 22 produces a single main band on a non-reducing polyacrylamide gel. The purity of ribosomal protein S1111. 22 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues matching between sequence ^ and sequence S

Number of residues in sequence ^-number of interval residues in sequence ^-interval residues in sequence S ¾ ^X

Can also Clus ter or a method well known in the art such as the Jotun Hein measuring the percentage identity between nucleic acid sequences (He in J., (1990) Methods in enzymology 183: 625-645) 0

"Similarity" refers to the degree of identical or conservative substitutions of the acid residues at the corresponding positions in the alignment between amino acid sequences. Amino acids for conservative substitutions, such as negatively charged amino acids, can include Including aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; amino acids with similarly hydrophilic head groups that have no charge can include leucine and isoleucine Acids and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (& 1),) ₂ and? 7, which can specifically bind to the epitope of ribosomal protein S1111.22.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated ribosomal protein S1111. 22" means the ribosomal protein S1111. 22 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify ribosomal protein S1111.22 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of ribosomal protein S1111. 22 peptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, ribosomal protein S1111. 22, which is basically composed of the amino acid sequence shown in SEQ ID NO: ² . The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated , Or can be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues. The invention also includes fragments, derivatives and analogs of the ribosomal protein S1111.22. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the ribosomal protein S1111. 22 of the present invention. 22 · The same biological function or activity. A fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted The amino acid may or may not be encoded by the genetic code; or (Π) such that a group on one or more amino acid residues is substituted by another group to include a substituent; or (Π Ι) like this A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1897 bases in length and its open reading frame of 292-600 encodes 102 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to ribosomal protein S11, and it can be deduced that the ribosomal protein S1111. 22 has similar functions to ribosomal protein S11.

 The polynucleotide of the present invention may be in the DM form or the RM form. DM forms include cDM, genomic DM, or synthetic DM. DM can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences. '

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be days Naturally occurring allelic or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or ( ² ) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 4 ² ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 .

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding ribosomal protein S1111.22.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the ribosomal protein S1111.22 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.

 Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cMA library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua 1, Cold Spruing Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

These genes can be screened from these cDNA libraries by conventional methods. These methods include (but not Limited to): (l) DNA-DM or DNA-RM hybridization; (2) the presence or absence of a marker gene function; (3) determination of the level of the transcript of ribosomal protein S1111.22; (4) through immunological techniques or The biological activity is measured to detect the protein product expressed by the gene. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 1 G nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELI SA) can be used to detect the protein product of ribosomal protein S1111. 22 gene expression.

 A method (Sa iki, et al. Sc; 1985; 230: 1350-1354) for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-cDM terminal rapid amplification method) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 546 3- 5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a ribosomal protein S1111. 22 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.

In the present invention, a polynucleotide sequence encoding a ribosomal protein S 111 L 22 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. Express An important feature of vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding ribosomal protein S1111. ²² and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding ribosomal protein S1111.22 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, Or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

 Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce a recombinant ribosomal protein S1111. 22 (Sc ience, 1984; 224: 1431). Generally, the following steps are taken:

 (1) using the polynucleotide (or variant) encoding human ribosomal protein S1111.22 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells. ·

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 The human ribosomal protein S11 is located on the small subunit of the ribosome. It contains 15 residues of 5, the leader sequence, the entire protein coding sequence, and 51 residues of the 3 'non-coding sequence. Human ribosomal protein S11 is a component of small ribosomal subunits. Abnormal expression of human ribosomal protein S11 can affect the normal physiological functions of ribosomes, affect protein synthesis, and lead to disorders of protein metabolism disorders. The expression profile of the polypeptide of the present invention is consistent with the expression profile of the human ribosomal protein S11 protein, and both have similar biological functions. The polypeptide of the present invention is a component of the small subunit of the ribosome in vivo, and its abnormal expression can affect the normal physiological function of the ribosome, affect protein synthesis, and then lead to the occurrence of disorders of protein metabolism. These diseases include but are not limited to :

 Disorders of protein metabolism can affect the following major physiological functions of proteins, which can lead to the occurrence of related diseases:

I. Provide body energy to maintain tissue growth, renewal and repair: Muscle atrophy, weak limbs, thin body, severe cases can show "cachexia";

 2. Produce some physiologically active substances, such as hormones, antibodies, amines, etc .:

 1. Protein peptide hormone dysfunction can cause the following diseases:

 1) Insulin and glucagon: diabetes, hypoglycemia, etc .;

 2) Hypothalamus and pituitary hormones: Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (stingle disease, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polycystic ovary syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .;

 3) parathyroid hormone: hyperparathyroidism, hypoparathyroidism, etc .;

4) Gastrointestinal hormones: peptic ulcer, chronic indigestion, chronic gastritis, etc .;

 2. Disorders of amine metabolism can cause the following diseases:

 Arrhythmia, shock, insanity, epilepsy, chorea, hepatic encephalopathy (norepinephrine, Y-aminobutyric acid, serotonin, glutamine), motion sickness, type I allergic disease (net Measles, hay fever, allergic rhinitis, skin allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;

 3. Antibody deficiency is prone to various infections:

 Septicemia, suppurative meningitis, pneumonia, bronchitis, otitis media, pyoderma, etc .;

 3. The special physiological effects of certain proteins:

 Various hemoglobin diseases (anemia, jaundice, tissue-induced organic acidemia due to hypoxia), various factor deficiencies (bleeding), muscle spasms, muscle forcing, muscle paralysis (actin), etc .;

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used for the treatment of various diseases, especially diseases of protein metabolism disorders.

 The invention also provides a method for screening compounds to identify agents that increase (agonist) or suppress (antagonist) ribosomal protein S1111.22. Agonists increase the ribosomal protein S1111. 22 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing ribosomal protein S1111. 22 can be cultured together with labeled ribosomal protein S1111. 22 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.

Antagonists of ribosomal protein S1111. 22 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of ribosomal protein S1111. 22 can bind to ribosomal protein S1111. 22 And eliminate its function, either inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

 When screening compounds that act as antagonists, ribosomal protein S1111.22 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between ribosomal protein S1111.22 and its receptor. . Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to ribosomal protein S1111. 22 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the ribosomal protein S1111. 22 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the ribosomal protein S1111. 22 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

 Polyclonal antibodies can be produced by injecting ribosomal protein S1111. 22 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to ribosomal protein S1111. 22 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PMS, 1985, 81: 6851). The unique technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against ribosomal protein S1111.22.

 Antibodies against ribosomal protein S1111. 22 can be used in immunohistochemistry to detect ribosomal protein S1111. 22 in biopsy specimens.

 Monoclonal antibodies that bind to ribosomal protein S1111. 22 can also be labeled with radioisotopes, and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, ribosomal protein S1111. 22 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill ribosomal protein S1111. 22 positive cells .

The antibodies of the present invention can be used to treat or prevent diseases related to ribosomal protein S1111.22. Administration of an appropriate dose of antibody can stimulate or block the production or activity of ribosomal protein S1111.22.

 The invention also relates to a diagnostic test method for quantitative and localized detection of ribosomal protein S1111. 22 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of ribosomal protein S1111.22 detected in the test can be used to explain the importance of ribosomal protein S1111.22 in various diseases and to diagnose diseases in which ribosomal protein S1111.22 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding the ribosomal protein S1111. 22 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of ribosomal protein S1111.22. Recombinant gene therapy vectors (such as viral vectors) can be designed to express the variant ribosomal protein S1111. 22 to inhibit the endogenous ribosomal protein S1111. 22 activity. For example, a variant ribosomal protein S1111.22 may be a shortened ribosomal protein S1111.22 that lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of ribosomal protein S1111.22. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding ribosomal protein S1111. 22 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a ribosomal protein S1111. 22 can be found in the literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding the ribosomal protein S1111. 22 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit ribosomal protein S1111. 22 mRNA are also within the scope of the present invention. A ribozyme is a specific enzyme-like RNA molecule that can specifically decompose. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target MA for endonucleation. Antisense RNA and DNA and ribozymes can be obtained by any RM or DNA synthesis technology. For example, the technology of solid phase phosphate amide synthesis of oligonucleotides has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds. The polynucleotide encoding ribosomal protein S1111. 22 can be used for the diagnosis of diseases related to ribosomal protein S1111. 22. The polynucleotide encoding the ribosomal protein S1111. 22 can be used to detect the expression of the ribosomal protein S1111. 22 or the abnormal expression of the ribosomal protein S1111. 22 in a disease state. For example, the DM sequence encoding ribosomal protein S1111. 22 can be used to hybridize biopsy specimens to determine the expression status of ribosomal protein S1111. 22. Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DM chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. The ribosome protein S1111. 22 specific primers can also be used to detect the transcription product of ribosomal protein S1111. 22 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.

 Detection of ribosomal protein S1111. 22 mutations can also be used to diagnose ribosome protein S1111. 22-related diseases. The forms of the ribosomal protein S1111. 22 mutation include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type ribosomal protein S1111. 22 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988). Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendel ian Inherance in Man (available online with Johns Hopkins University Welch Medica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Ribosome S1111. 22 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of ribosomal protein S1111.22 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally performed according to the general conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), or according to the conditions Conditions recommended by the manufacturer. Example 1 Cloning of ribosomal protein Sl ll 1.2

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA ^ reverse transcription to form cDNA. A Smart cDM cloning kit (purchased from Clontech) was used to insert the 00 fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5α. The bacteria formed a cDNA library. Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one clone 0617A12 was a new DM. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results showed that the full-length cDNA contained in clone 0617A12 was 1897bp (as shown by Seq ID NO: l), and there was a 308bp open reading frame (0RF) from 292bp to 600bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0617A12 and the encoded protein was named ribosomal protein S1111.22. Example 2 Cloning of a gene encoding ribosomal protein S1111.22 by RT-PCR

 CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

 Pr imerl: 5'- GAGTAGGTAATCACAAAAGGTTGC -3 '(SEQ ID NO: 3)

 Primer2: 5'- GCACGGAGACTCTGGTGTGGGTCT -3 '(SEQ ID NO: 4)

 Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Amplification reaction conditions: 50 μl reaction volume containing 50 ol / L KCl, 10 ramol / L Tri s-HCl pH 8. 5, 1. 5 mmol / L MgCl ₂ , 20 (^ mol / L dNTP, 1 Opmol primer , 1U of Taq DNA polymerase (product of Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-act in was used as a positive control and template blank was used as a negative control. The amplified products were purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA Sequence analysis results showed that the DM sequence of the PCR product was completely identical to the l-1897bp shown in SEQ ID NO: 1. Example 3 Northern ribotyping analysis of ribosomal protein Sllll. 22 gene expression

Total RM extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. ⁴ M guanidine isothiocyanate- ² 5 mM sodium citrate, 0.2 M sodium acetate ( _P H4. 0) The tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _§ RNA, electrophoresis was performed on a ^1.2 % agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (PH7. 0) -5raM sodium acetate-ImM EDTA-2. 2M formaldehyde. It was then transferred to a nitrocellulose membrane. A- ³² P dATP was used to prepare ³² P-labeled DNA probes by random primers. The DNA probe used was the PCR amplified ribosomal protein S1111. 22 coding region sequence (292bp to 600bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 x 10 ^s cpm / ml) and RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM K ₂ PO ₄ (ρ 7. 4) -5 χ SSC-5 Denhardt's solution and 20 (^ g / ml salmon sperm DNA. After hybridization, the filter membrane was lx SSC -0.1% SDS was washed at 55 ° C for 30 min. Then, analysis and quantification were performed using Phosphor Imager. Example 4 In vitro expression, isolation and purification of recombinant ribosomal protein S1111. 22

 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

Pr imer 3: 5'-CCCCATATGATGCATGGTATAACAGCACCCG-3 '(Seq ID No: 5) Pr imer4: 5' -CATGGATCCTTAGGAAAATAGGATAGCCTTAGA-3 '(Seq ID No: 6) The 5' ends of these two primers contain Mel and BamHI digestion respectively Sites, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site. The PCR reaction was performed using the PBS-0617A12 plasmid containing the full-length target gene as a template. The PCR reaction conditions are: 50 pg total volume contains 10 pg of PBS-0617A12 plasmid, primers? ] ^ 1116: 1: -3 and? ] ^ 1116]: -4 are 1 (^ 11101, Advantage polymerase Mix (Clontech)) 1μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, 25 cycles in total. Use Ndel Digestion of the amplified product and plasmid pET-28 (+) with BamHI and recovery of large fragments, respectively, and ligation with T4 ligase. The ligated product was transformed by the calcium chloride method of colibacillus DH5 c. After culturing overnight on a LB plate of lysin (final concentration 30μ _§ / πι1), the positive clones were screened by colony PCR method and sequenced. The positive clones with the correct sequence (pET-0617A12) were selected to transform the recombinant plasmid into E. coli using the calcium chloride method BL21 (DE3) plySs (product of Novagen). In a LB liquid medium containing kanamycin (final concentration 30 μ _§ / ιιι1), the host strain BL (pET-0617A12) was cultured at ³⁷ ° C to logarithmic growth phase. Add IPTG to a final concentration of lrmo l / L, and continue to culture for 5 hours. Centrifuge the bacterial cells, sonicate them, collect the supernatant by centrifugation, and use affinity chromatography that can bind to 6 histidines (6His-Tag). Column His. Bind Quick Car tr idge (product of Novagen) Analysis to obtain purified protein ribosomal proteins S1111. 22. via SDS- PAGE electrophoresis and a single band (FIG. 2) at the l lkDa The transfer strip After moving to the PVDF membrane, the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-ribosomal protein S1111. 22 antibodies

 A peptide specific to ribosomal protein S1111. 22 was synthesized using a peptide synthesizer (product of PE company): NH2-Met-His-Gly-I le-Thr-Gln-His-Pro-Thr-Arg-I le-Ser -Thr-Pro-I le-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immimochemi stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex and complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost immunity once. 15A titer plate coated with 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation showed that the purified antibody could specifically bind to ribosomal protein S1111.22. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; A needle is an oligonucleotide fragment that is partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2. GC content is 30% -70%, non-specific hybridization will increase if it exceeds. 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'-TGCATGGTATAACACAGAGCACCCGACAAGAATAAGTACACCT-3 '(SEQ ID NO: 8) probe (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5'-TGCATGGTATAACACAGAGCACCCGACAAGAATAAGTACACCT-3 '(SEQ ID NO: 9) For other common reagents not listed below and their preparation methods, please refer to the reference: DNA PROBES G. Keller; MM Manak; Stockton Press , 1989 (USA) and more commonly used molecular cloning laboratory manuals, such as the Guide to Molecular Cloning Experiments (Second Edition 1998) [US] Sambruck et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (approximately 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl ₂ ). 4) In; 4. C Use an electric homogenizer to homogenize the tissue suspension at full speed until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) The cell pellet was resuspended (O.lg per tissue sample was originally added 1- ⁵ ml), and then centrifuged at lOOOg for 10 min. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DM phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 10 ^s cells / ml) and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or at 37 ° C. C gently shake overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 180 vols of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, ¹⁰⁶ cells per 1-5 χ extracted plus about lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) The aqueous phase was carefully removed, added 1/10 volume of 2mol / L sodium acetate and ^2.5 volumes of cold ethanol, mix set --20. C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determine A ₂₆ . And A _28Q to check the purity and yield of DM. 15) Store at -20 ° C after dispensing.

Preparation of sample film: 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that they can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) The ³² P-Probe (the second peak is free γ- ³² P-dATP) after the collection of the first peak is combined.

 Pre-hybridization

The sample film was placed in a plastic bag pre-hybridization solution was added 3-10m _g (10xDenhardt's; 6xSSC, 0. lrag / ml CT DNA ( calf thymus DNA)). After sealing the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 ° /. SDS, 40. C Wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

4) 0.1xSSC, 0.1% SDS, 55. Wash for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0. / oSDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene chip or gene microarray (DM Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, see the documents DeRis iJ. L., Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M. ., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

1. Hydration in a humid environment for 4 hours; 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

It was extracted from the body with a one-step mixing with body tissue specific tissue (or cell line after stimulation) total mRNA, and washed with Ol igotex mRNA Midi Ki t (available from QiaGen Inc.) purified mRNA, reverse transcription divided by another ¹ J The fluorescent reagent Cy3dUTP (5-Amino-propargyl-2--deoxyur i dine 5'-tri hate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5 -Amino-propargyl-2,-deoxyuridine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) fflRNA, and purified probes were prepared. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davis, RW (1995 ) Science. 270. (20): 467-480.

 (Three) cross

 The probes from the above two tissues and the chip were respectively hybridized in a UniHyb ™ Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a graph based on these 17 Cy3 / Cy5 ratios (Figure 1). It can be seen from the figure that the expression profile of ribosomal protein S1111. 22 and ribosomal protein S11 according to the present invention are very similar.

Claims

Rights request

An isolated polypeptide-ribosomal protein S 1111. 22, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 292 to 600 in SEQ ID NO: 1 or a sequence of positions 1-1897 in SEQ ID NO: 1 sequence.

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or vector expression vector Recombinant vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having ribosomal protein S1111.22 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing ribosomal protein S1111.22;

 (b) Isolating a polypeptide having ribosomal protein S1111. 22 activity from the culture.

1 0. An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to a ribosomal protein S1111. 22 antibodies that specifically bind.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of ribosomal protein S1111.22.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

 13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of ribosomal protein S1111. 22 in vivo and in vitro.

 14. A method for detecting a disease or disease susceptibility related to the polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression amount of the polypeptide, or detecting the polypeptide Activity, or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of ribosomal protein S1111.22; or for Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormalities of ribosomal protein S1111.22.

 18. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and drugs of various inflammations.