WO2001094533A2 - A novel polypeptide, human protein phosphatase regulation protein 13 and the polynucleotide encoding the polypeptide - Google Patents
A novel polypeptide, human protein phosphatase regulation protein 13 and the polynucleotide encoding the polypeptide Download PDFInfo
- Publication number
- WO2001094533A2 WO2001094533A2 PCT/CN2001/000846 CN0100846W WO0194533A2 WO 2001094533 A2 WO2001094533 A2 WO 2001094533A2 CN 0100846 W CN0100846 W CN 0100846W WO 0194533 A2 WO0194533 A2 WO 0194533A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- protein phosphatase
- human protein
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ A protein phosphatase 1 regulatory protein 13 and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
- Protein phosphatase 1 is a gene family with important functions in the brain. The combination of protein phosphatase 1 with many different regulatory proteins (regulatory subunits) determines that it can function in different subcellular environments and has different enzyme bases. Comp Neurol 1999, Oc t 25; 413 (3): 373-84).
- protein phosphatase 1 in the body are caused by the combination of its catalytic subunits with different regulatory proteins (EMB0 J 1997 Apr 15; 16 (8): 1876-87).
- PP-1 has a disulfide redox site in addition to its phosphorylation active site, so it is speculated that PP-1 also has the function of an oxidoreductase, but this has not been confirmed (FASEB J 1999 Oct; 13 (1 3): 1866-74).
- Phosphoproteins and calmodulin complexes can regulate the fusion of bilayers of cell membranes and play an important role in exocytosis (Sc ience 1999, Aug 13; 285 (5430): 1084-7) 0
- PP-1 can interact with a variety of regulatory proteins, among which PP-1's nuclear binding factor (NIPP1) is a more common binding protein for PP-1.
- NIPP1 nuclear binding factor
- Hepatic glucose-related regulatory protein a protein phosphatase
- Asp905Tyr mutation of PP-1G can cause cells to become very sensitive to cAMP and affect the regulation of PP-1G on insulin-stimulated hepatic glucose synthesis (Mol Endocr ino l 1999 Oct; 13 ( 10): 1773-83); (Endocr inology 1997 Jun; 138 (6): 2398-404).
- NIPP1 has an endonuclease domain and an RM binding domain, and the localization of these domains has been confirmed (Biochem J 1999; Aug 15; 342 (Pt 1): 13-9).
- regulatory proteins regulatory subunits
- Studies on a series of regulatory proteins (regulatory subunits) of protein phosphatase 1 have not fully elucidated their crusts and functions, but it is certain that the regulatory proteins of protein phosphatase 1 are related to protein phosphatase 1 Activity regulation.
- the human protein phosphatase 1 regulatory protein 13 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participants These processes regulate the protein 13 of human protein phosphatase 1 and specifically identify the amino acid sequence of this protein. Isolation of the novel human protein phosphatase 1 regulatory protein 1 3 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human protein phosphatase 1 regulatory protein 13.
- Another object of the present invention is to provide a engineered host cell containing a gene containing a polynucleotide encoding a human protein phosphatase 1 regulatory protein 13.
- Another object of the present invention is to provide a method for producing a human protein phosphatase 1 regulatory protein 13. Another object of the present invention is to provide an antibody against the polypeptide-human protein phosphatase 1 regulating protein 13 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide-human protein phosphatase 1 regulating protein 13 of the present invention.
- Another object of the present invention is to provide diagnosis and treatment of human protein phosphatase 1 regulatory protein 13 abnormalities. Methods for related diseases.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 3257-61 in SEQ ID NO: 1; and (b) having a sequence 1- in SEQ ID NO: 1 1643-bit sequence.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human protein phosphatase 1 regulating protein 13 protein activity, which comprises utilizing the polypeptide of the present invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human protein phosphatase 1 regulatory protein 13 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human protein phosphatase 1 regulatory protein 13.
- Fig. 1 is a comparison diagram of gene chip expression profiles of human protein phosphatase 1 regulatory protein 13 and human protein phosphatase 1 regulatory protein of the present invention.
- the upper graph is a graph of the expression profile of the human protein phosphatase 1 regulatory protein 13 and the lower graph is the graph of the expression profile of the human protein phosphatase 1 regulatory protein.
- 1-bladder mucosa 2-PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6- scar into fc growth factor Stimulation, 1013HT, 7-scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human protein phosphatase 1 regulatory protein 1 3.
- 1 3 kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioly active refers to a protein with the scab, regulatory, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human protein phosphatase 1 regulatory protein 13, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human protein phosphatase 1 regulatory protein 13.
- Antagonist refers to a molecule that can 'block or regulate the biological or immunological activity of human protein phosphatase 1 regulatory protein 13 when combined with human protein phosphatase 1 regulatory protein 13.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human protein phosphatase 1 regulatory protein 13.
- Regular refers to a change in the function of human protein phosphatase 1 regulatory protein 13, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human protein phosphatase 1 regulatory protein 13. Change of nature.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human protein phosphatase 1 regulatory protein 13 using standard protein purification techniques. Essentially pure human protein phosphatase 1 regulatory protein 13 produces a single main band on a non-reducing polyacrylamide gel. The purity of human protein phosphatase 1 regulatory protein 13 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
- sequence A and sequence B The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Match between the sequences and the sequence of residue numbers ⁇ 0 the number of residues of the sequence - sequences spacer residues - residues spacer sequence S x
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RM sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? 7, which can specifically bind to the epitope of human protein phosphatase 1 regulatory protein 13.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human protein phosphatase 1 regulatory protein 13 means that human protein phosphatase 1 regulatory protein 13 is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human protein phosphatase 1 regulatory protein 13 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human protein phosphorus The purity of the acidase 1 regulatory protein 13 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide ⁇ ⁇ protein phosphatase 1 regulatory protein 13, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
- the invention also includes fragments, derivatives and analogs of human protein phosphatase 1 regulatory protein 13.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human protein phosphatase 1 regulatory protein 13 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
- the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such a Species, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (such as Leader sequence or secretory sequence or the sequence or protease sequence used to purify this polypeptide).
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1643 bases, and its open reading frames 257-613 encode 118 amino acids.
- the peptide has a similar expression profile to the human protein phosphatase 1 regulatory protein, and it can be deduced that the human protein phosphatase 1 regulatory protein 13 has similar functions as the human protein phosphatase 1 regulatory protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DM forms include cDM, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- "degenerate variant" in the present invention refers to a coding region that encodes a protein or polypeptide having SEQ ID NO: 2 but is identical to the coding region shown in SEQ ID NO: 1 Sequences with different nucleic acid sequences.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 col l, 42 ° C, etc .; or (3) only the same between the two sequences Crosses occur only when the sex is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” is at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human protein phosphatase 1 regulatory protein 1 3.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human protein phosphatase 1 regulatory protein 13 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences Is the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Labora tory Manua 1, Cold Harbor Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of transcripts of human protein phosphatase 1 regulatory protein 13; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of human protein phosphatase 1 regulating protein 13 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method for amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DM / MA fragment can be separated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a vector or a direct use of the vector of the present invention.
- a host cell produced by genetic engineering using a human protein phosphatase 1 regulatory protein 13 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding a human protein phosphatase 1 regulatory protein 13 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequences encoding human protein phosphatase 1 regulatory protein 13 and appropriate transcription / translation regulatory elements can be used to construct expression vectors containing DM sequences encoding human protein phosphatase 1 regulatory protein 13 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Labora tory Manua 1, Cold Spring Harbor Labora tory. New York, 1989).
- the DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
- Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- the acidic recombinant vector can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human protein phosphatase 1 regulatory protein 13 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- human protein phosphatase 1 regulatory protein 68 The function of the polypeptide (human protein phosphatase 1 regulatory protein 68) of the present invention needs further study, But overall, human protein phosphatase 1 regulatory protein 68 can be used to diagnose and treat many diseases. For example, malignant tumors, endocrine system diseases, nervous system diseases, immune diseases, human acquired immune deficiency syndrome (AIDS), and so on.
- diseases For example, malignant tumors, endocrine system diseases, nervous system diseases, immune diseases, human acquired immune deficiency syndrome (AIDS), and so on.
- AIDS human acquired immune deficiency syndrome
- the polypeptide of the present invention can be used to treat human malignant tumors, including epithelial tissues (such as basal epithelium, squamous epithelium, mucus cells, etc.), (such as fibrous tissue, adipose tissue, cartilage tissue, smooth muscle tissue, blood vessels and lymphatic endothelial cells Tissue, etc.), hematopoietic tissue (such as B cells, T cells, histiocytes, etc.), central nervous tissue, peripheral nerve tissue, endocrine tissue, gonadal tissue, special tissue (such as dental tissue, etc.), such as, Stomach cancer, liver cancer, colorectal cancer, breast cancer, lung cancer, prostate cancer, cervical cancer, pancreatic cancer, esophageal cancer, etc.
- epithelial tissues such as basal epithelium, squamous epithelium, mucus cells, etc.
- fibrous tissue such as fibrous tissue, adipose tissue, cartilage tissue, smooth muscle tissue, blood vessels
- the polypeptide of the present invention is an immunomodulator and has an immune promoting or immunosuppressing effect.
- the polypeptide of the present invention can be used for the treatment of diseases including non-reactivity of immune response, or abnormal immune response, or ineffective host defense.
- the polypeptides and antibodies of the present invention also have effects on damage, defects or disorders of immune tissues, especially for hematopoietic diseases (such as malignant anemia), skin diseases (such as psoriasis), and autoimmune diseases (such as rheumatoid arthritis). ), Radiation diseases and the production and regulation of immune lymphocytes are extremely closely related.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human protein phosphatase 1 regulatory protein 1 3.
- Agonists increase human protein phosphatase 1 regulatory protein 13 and stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human protein phosphatase 1 regulatory protein 13 and labeled human protein phosphatase 1 regulatory protein 13 can be cultured together in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human protein phosphatase 1 regulatory protein 13 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human protein phosphatase 1 regulatory protein 13 can bind to human protein phosphatase 1 regulatory protein 13 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide such that the polypeptide cannot function biological functions.
- human protein phosphatase 1 regulatory protein 13 When screening compounds as antagonists, human protein phosphatase 1 regulatory protein 13 can be added to a bioanalytical assay, and the compound can be identified by measuring the effect of the compound on the interaction between human protein phosphatase 1 regulatory protein 13 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human protein phosphatase 1 regulatory protein 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 13 molecules of human protein phosphatase 1 regulatory protein should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human protein phosphatase 1 regulatory protein 13 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- polyclonal antibodies can be obtained by using human protein phosphatase 1 regulatory protein 13.
- Direct injection into immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
- Techniques for preparing monoclonal antibodies to human protein phosphatase 1 regulatory protein 13 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
- Embedding antibodies that combine human constant regions with non-human-derived variable regions can be produced using proprietary techniques (Morrison et al., PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human protein phosphatase 1 regulatory protein 13.
- Antibodies against human protein phosphatase 1 regulatory protein 13 can be used in immunohistochemical techniques to detect human protein phosphatase 1 regulatory protein 13 in biopsy specimens.
- Monoclonal antibodies that bind to human protein phosphatase 1 regulatory protein 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human protein phosphatase 1 regulatory protein 13 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human protein phosphatase 1 regulatory protein 13 positive Cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human protein phosphatase 1 regulatory protein 13. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human protein phosphatase 1 regulatory protein 13.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human protein phosphatase 1 regulatory protein 13 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human protein phosphatase 1 regulatory protein 13 detected in the test can be used to explain the importance of human protein phosphatase 1 regulatory protein 13 in various diseases and to diagnose the role of human protein phosphatase 1 regulatory protein 13 disease.
- polypeptides of the present invention can also be used for peptide mapping, for example, the polypeptides can be physically, chemically or enzymatically Specific cleavage and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, preferably mass spectrometry.
- Polynucleotides encoding human protein phosphatase 1 regulatory protein 13 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human protein phosphatase 1 regulatory protein 13.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human protein phosphatase 1 regulatory protein 13 to inhibit endogenous human protein phosphatase 1 regulatory protein 13 activity.
- a mutated human protein phosphatase 1 regulatory protein 13 may be a shortened human protein phosphatase 1 regulatory protein 13, lacking a signaling domain, although it can bind to downstream substrates, but lacks signaling activity.
- the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human protein phosphatase 1 regulating protein 13.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a human protein phosphatase 1 regulatory protein 13 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human protein phosphatase 1 regulatory protein 13 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human protein phosphatase 1 regulatory protein 13 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides that inhibit human protein phosphatase 1 regulatory protein 13 mRNA and ribozymes are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense MA and DM and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence is integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human protein phosphatase 1 regulatory protein 13 can be used for the diagnosis of diseases related to human protein phosphatase 1 regulatory protein 13.
- the polynucleotide encoding human protein phosphatase 1 regulatory protein 13 can be used to detect the expression of human protein phosphatase 1 regulatory protein 13 or the abnormal expression of human protein phosphatase 1 regulatory protein 13 in a disease state.
- the DNA sequence encoding human protein phosphatase 1 regulatory protein 13 can be used to hybridize biopsy specimens to determine the expression of human protein phosphatase 1 regulatory protein 13.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue.
- Human protein phosphatase 1 regulatory protein 13 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human protein phosphatase 1 regulatory protein 13 transcription products.
- Human protein phosphatase 1 regulatory protein 13 gene can also be used to diagnose human protein phosphatase 1 regulatory protein 13-related diseases.
- Human protein phosphatase 1 regulatory protein 13 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human protein phosphatase 1 regulatory protein 13 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cMA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries. .
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- containers containing one or more ingredients of the pharmaceutical composition of the invention.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human protein phosphatase 1 regulatory protein 13 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human protein phosphatase 1 regulatory protein 13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRM was isolated from total RNA using Quik raRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed CDNA is formed. Smar t cDNA cloning kit (purchased from C 1 ontech l cDNA fragment was inserted into the multicloning site of pBSK (+) vector (Clontech)) to transform DH5 ⁇ , and bacteria were used to form CDM library.
- Dye terminate cycle reaction The sequencing kit (Perkin-Elmer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the 5 'and 3' ends of all clones. The determined cDNA sequences were compared with the existing public DNA sequence database (Genebank). By comparison, the CDM sequence of one of the clones 0821b07 was found to be new DNA. A series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
- the encoded protein is named human protein phosphatase 1 regulatory protein 13
- Example 2 Using RT-PCR method to clone the gene encoding human protein phosphatase 1 regulatory protein 13 for fetal brain cells RNA as a template, ol igo-dT primer of the cDNA synthesized by reverse transcription reaction, after purification kit using Qiagene amplified by PCR using the following primers:
- Primer 1 5'- ATTTTATAAGGTTAAATGTTGAAA -3 '(SEQ' ID NO: 3)
- Primer2 5'- TTCATAATTCATTTTTATTCCCCT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 ⁇ l reaction volume containing 50 ol / L KCl, 10 mmol / L Tri s-HCl pH 8.5, 1.5 mraol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 C 30sec; 55 ° C 30sec; 72 ° C 2min 0 at RT- During PCR, ⁇ -act in was used as a positive control and template blank was used as a negative control.
- RNA sequence analysis results It is shown that the DNA sequence of the PCR product is identical to the 1-1643bp shown in SEQ ID NO: 1.
- Example 3 Analysis of the expression of human protein phosphatase 1 regulatory protein 13 gene by Northern blotting method Total RNA was extracted in one step [Anal. Biochem 1987 , 162, 156-159] This method involves acid guanidinium thiocyanate phenol-chloroform extraction. The tissue is homogenized with 4M guanidinium isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0).
- RNA precipitate was centrifuged. The resulting precipitate was MA 7 0 ° /. Washed with ethanol, dissolved in water and dry in. Through 20 g of RNA, containing 2 0raM 3- (N- Morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-ImM EDTA-2. 2M formaldehyde on a 1.2 % agarose gel. It was then transferred to a nitrocellulose membrane.
- A- 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers.
- the DNA probe used was the PCR-encoded human protein phosphatase 1 regulatory protein 13 coding region sequence (257bp to 613bp) shown in FIG. 32P-labeled probes (approximately 2 x 10 6 cpm / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% amidamide-25mM KH 2 P0 4 (H7. 4) -5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DM.
- Example 4 In vitro expression, isolation, and purification of recombinant human protein phosphatase 1 regulatory protein 13 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair was designed Specific amplification primers, the sequence is as follows:
- Priraer3 5 '-CCCCATATGATGAGAGCTGCAAACAGGAGGCTT-3' (Seq ID No: 5)
- Primer4 5 '-CCCGAATTCTCAAGTCTGCAGTAGCTGCTGCTG-3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and EcoRI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest were followed, and the Ndel and EcoRI restriction sites correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Sex endonuclease site.
- the PCR reaction was performed using the pBS-0821b07 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0821b07 plasmid was contained in a total volume of 50 ⁇ l, and primers Primer-3 and Primer-4 were lOpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into E. coli DH5c by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were selected by colony PCR method and sequenced. The positive clone (pET-0821b07) with the correct sequence was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following human protein phosphatase 1 regulatory protein 13 specific peptides:
- NH2-Met-Arg-Ala-Ala-Asn-Arg-Arg-Leu-Ala-Pro-Arg-Arg-Thr-Gly-Asn-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Imraunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin doxin complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera.
- the polypeptide bound to cyanogen bromide-activated S e pharose4B column, by affinity chromatography from total IgG isolated anti-polypeptide antibody.
- the immunoprecipitation method proved that the purified antibody could specifically bind to human protein phosphatase 1 regulatory protein 13.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes selected in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Needle-to-sample hybridization has the strongest specificity and is retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) to be prepared.
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially diseases related genes such as tumors; diagnosis of diseases such as heredity disease.
- the specific method steps have been reported in the literature, for example, see the literature DeRis i, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, R. A ,, Schema, M ⁇ , Chai,, Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen).
- Cy3dUTP (5-Amino-propargyl-2--deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy 5dUTP (5-Amino-pr opa rgy 1-2'-deoxyur idi ne 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
- Cy3dUTP (5-Amino-propargyl-2--deoxyuridine 5'-triphate coupled to Cy
- Probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profile of the human protein phosphatase 1 regulatory protein 13 and the human protein phosphatase 1 regulatory protein according to the present invention are very similar.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU89492/01A AU8949201A (en) | 2000-05-24 | 2001-05-21 | A novel polypeptide, human protein phosphatase regulation protein 13 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115850 CN1324949A (en) | 2000-05-24 | 2000-05-24 | New polypeptide human protein phosphatase 1 controlling protein 13 and polynucleotides for encoding same |
CN00115850.3 | 2000-05-24 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001094533A2 true WO2001094533A2 (en) | 2001-12-13 |
WO2001094533A3 WO2001094533A3 (en) | 2002-04-04 |
Family
ID=4585292
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000846 WO2001094533A2 (en) | 2000-05-24 | 2001-05-21 | A novel polypeptide, human protein phosphatase regulation protein 13 and the polynucleotide encoding the polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1324949A (en) |
AU (1) | AU8949201A (en) |
WO (1) | WO2001094533A2 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5512434A (en) * | 1992-12-14 | 1996-04-30 | The United States Of America As Represented By The Department Of Health And Human Services | Expression cloning of a human phosphatase |
US5888794A (en) * | 1990-07-11 | 1999-03-30 | New York University | Receptor-type phosphotyrosine phosphatase-alpha |
-
2000
- 2000-05-24 CN CN 00115850 patent/CN1324949A/en active Pending
-
2001
- 2001-05-21 WO PCT/CN2001/000846 patent/WO2001094533A2/en active Application Filing
- 2001-05-21 AU AU89492/01A patent/AU8949201A/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5888794A (en) * | 1990-07-11 | 1999-03-30 | New York University | Receptor-type phosphotyrosine phosphatase-alpha |
US5512434A (en) * | 1992-12-14 | 1996-04-30 | The United States Of America As Represented By The Department Of Health And Human Services | Expression cloning of a human phosphatase |
Also Published As
Publication number | Publication date |
---|---|
CN1324949A (en) | 2001-12-05 |
WO2001094533A3 (en) | 2002-04-04 |
AU8949201A (en) | 2001-12-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001074879A1 (en) | A novel polypeptide - homo ribosome protein s3-12 and polynucleotide encoding said polypeptide | |
WO2001088084A2 (en) | A novel polypeptide, a superoxide dismutase 11 and the polynucleotide encoding the polypeptide | |
WO2001096560A1 (en) | A novel polypeptide, a human protein stat2 and the polynucleotide encoding the polypeptide | |
WO2001066730A1 (en) | A novel polypeptide, a human rs3 protein 12 and the polynucleotide encoding the polypeptide | |
WO2001094533A2 (en) | A novel polypeptide, human protein phosphatase regulation protein 13 and the polynucleotide encoding the polypeptide | |
WO2001092515A1 (en) | A novel polypeptide, a human transcription factor 29.26 and the polynucleotide encoding the polypeptide | |
WO2001090177A1 (en) | A novel polypeptide, a human natural killer cell enhancing factor b13.64 and the polynucleotide encoding the polypeptide | |
WO2001092518A1 (en) | A novel polypeptide, a human ccr4 relative protein 9.5 and the polynucleotide encoding the polypeptide | |
WO2001090133A1 (en) | A novel peptide - human uracil-dna glycosylase 22 and the polynucleotide coding this novel peptide | |
WO2002006471A1 (en) | A novel polypeptide, a nucleophosmin9.68 and the polynucleotide encoding the polypeptide | |
WO2001092517A1 (en) | A novel polypeptide, a human transformer-2-beta protein 29.15 and the polynucleotide encoding the polypeptide | |
WO2001094401A1 (en) | A new polypeptide-human npat protein 15 and the polynucleotide encoding it | |
WO2002004501A1 (en) | A novel polypeptide - human beta-glucuronidase 11.88 and a polynucleotide encoding the same | |
WO2001087949A1 (en) | A novel polypeptide- human pax protein 9 and the polynucleotide encoding said polypeptide | |
WO2002000824A2 (en) | A NOVEL POLYPEPTIDE, A HUMAN tre ONCOGENE 10.56 AND THE POLYNUCLEOTIDE ENCODING THE POLYPEPTIDE | |
WO2001092329A1 (en) | A NOVEL POLYPEPTIDE - α-SUBUNIT 9.9 OF ATP SYNTHASE AND A POLYNUCLEOTIDE ENCODING THE SAME | |
WO2001094534A2 (en) | A novel polypeptide, a human transcription factor 9.57 and the polynucleotide encoding the polypeptide | |
WO2001090381A1 (en) | Novel polypeptide - a human alpha interferon receptor 115.62 and polynucleotide encoding it | |
WO2001092325A1 (en) | A novel polypeptide human-zinc-finger protein 13 and a polynucleotide encoding the same | |
WO2002020583A1 (en) | A novel polypeptide-homo transcription factorlcr-f19.02 and polynucleotide encoding said polypeptide | |
WO2001090131A1 (en) | A novel peptide - human tre cancerogenic gene protein 10.56 and the polynucleotide coding this novel peptide | |
WO2002000833A2 (en) | A novel polypeptide gamma carboxyl glutamic acid protein 113.31 with abundant proline and the polynucleotide coding this novel peptide | |
WO2001092318A1 (en) | A novel polypeptide, a kringle protein 14 and the polynucleotide encoding the polypeptide | |
WO2001092324A1 (en) | A novel polypeptide -human basonuclin 10.78 and a polynucleotide sequence encoding the same | |
WO2001074894A1 (en) | A new polypeptide - human protein phosphatase 1 regulation protein 12 and the polynucleotide encoding it |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |