WO2002020583A1 - A novel polypeptide-homo transcription factorlcr-f19.02 and polynucleotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of polypeptide-HOMO transcription factorLCR-F19.02 and polynucleotide encoding said polypeptide and a process for producing said polypeptide by DNA recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of diseases, such as erythropathy. Antagonist and the therapeutic use of the polypeptide is also disclosed. In addition, it refers to the use of polynucleotide encoding said HOMO transcription factorLCR-F19.02.

Description

 A new peptide, human transgenic LCR-F19. 02 and a polynucleotide encoding this polypeptide

The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a ~ Λ transcription factor LCR-F19. 02, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. technical background

 Hemoglobin is the main component of red blood cells in spinal animals, and it is responsible for transporting oxygen and carbon dioxide in the body. Each hemoglobin molecule consists of two identical four subunits and four heme, and hemoglobin without heme becomes globin. The genes of all globin subunits have very similar structures. The composition of subunits of hemoglobin varies at different stages of individual development. Transcription and expression of globin subunits in vivo are regulated by related transcription factors. The transcription factor LCR regulates the transcription and expression of globin Υ, ε, and P subunits in the body. It has two important activities in the body. First, it binds to the chromosome containing the globin β subunit gene. Then strengthen the transcription and expression of globin ε, γ and p subunits. It can be seen that this transcription factor plays an important regulatory role in the transcription and expression of globin. Its mutation or abnormal expression will lead to abnormal expression of related globin in the body, and then affect the expression and function of related hemoglobin, which will cause various Related diseases.

 In 1994, John and others cloned a new transcription factor LCR-F1 from humans, and studied the structure and function of the protein. This protein is similar to the known transcription factor LCR, and its protein sequence also contains a conserved CNC domain, which may play an important role in the regulation of protein transcription. This protein also binds to the globin β subunit gene in vivo and regulates the transcription and expression of globin ε, Υ and β subunits. It plays an important regulatory role in the formation of globin in the body. Mutation or abnormal expression of this protein will lead to abnormal expression of related globin in the body, and then affect the activity of related hemoglobin in the body, which will cause various related diseases [John J. Cater ina, David Donze et al., 1994, Nuc leic Acids Research, 22 (12): 2383-2391] From the above, we can see that the transcription factor LCR-F1 plays a very important role in the process of globin formation in the body. Mutations or abnormal expression of this protein will lead to related hemoglobin in the body The abnormal formation of serotonin affects the occurrence of various related metabolic pathways. It is usually closely related to the occurrence of various related respiratory metabolic disorders and related material metabolic disorders in living organisms. It can also be used for diagnosis and treatment Various related diseases mentioned above.

Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv30 cell line thymus, normal fibroblasts 1024NC, Fibrob las t, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer construct cell EJ, bladder cancer In parabens, bladder cancer, liver cancer, liver cancer cell lines, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, and cardia cancer, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human transcription factor LCR-F1, so both The function may be similar. The invention is named human transcription factor LCR-F19. 02.

 As mentioned above, the human transcription factor LCR-F19. 02 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participation in the field These processes of the human transcription factor LCR-F19. 02 protein, in particular, identify the amino acid sequence of this protein. Isolation of the new human transcription factor LCR-F19. 02 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention

 An object of the present invention is to provide an isolated novel polypeptide-human transcription factor LCR-F19. 02 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding the human transcription factor LCR-F19. 02.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding the human transcription factor LCR-F19. 02.

 Another object of the present invention is to provide a method for producing human transcription factor LCR-F19. 02.

 Another object of the present invention is to provide an antibody against the polypeptide-human transcription factor LCR- F19. 02 of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, the human transcription factor LCR-F19. 02.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of human transcription factor LCR-F19. 02. Summary of invention

The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No., or a conservative variant, biologically active fragment, or derivative thereof. Preferably, the The polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70½ identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 994-1242 in SEQ ID NO: 1; and (b) a sequence having 1-1409 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human transcription factor LCR-F19. 02 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of the human transcription factor LCR-F19. 02 protein, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the manufacture of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human transcription factor LCR-F19. 02.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of the human transcription factor LCR-F19. ⁰² and human transcription factor LCR-F1 according to the present invention. The upper graph is a graph of the expression profile of the human transcription factor LCR-F19. ⁰² , and the lower graph is the graph of the expression profile of the human transcription factor LCR-F1. Among them, 1-fetal brain, 2-bladder mucosa, 3-PMA + Ecv304 cell line, 4-LPS + Ecv304 cell line thymus, 5-normal fibroblasts 1024NC; 6-Fibroblas t, growth factor stimulation, 1024NT, 7-scarf into fc growth factor stimulation, 1013HT, 8-scar into fc stimulation without growth factor, 1013HC, 9-bladder cancer cell EJ, 10-bladder cancer, 11-bladder cancer, 12-liver cancer, 13-liver cancer cell line, 14-fetal skin, 15-spleen, 16-prostate cancer, 17-jejunal adenocarcinoma 18 cardia cancer.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human transcription factor LCR-F19. 02. 9kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

 The following terms used in this specification and the claims shall have the following meanings unless specifically stated: "Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with the human transcription factor LCR-F19.02, can cause the protein to change, thereby regulating the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the human transcription factor LCR-F19.02.

"Antagonist" or "inhibitor" refers to a compound that binds to the human transcription factor LCR-F19. Molecules that block or regulate the biological or immunological activity of human transcription factor LCR-F19. 02. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind the human transcription factor LCR-F19. 02.

 "Regulation" refers to a change in the function of the human transcription factor LCR-F19. 02, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties of the human transcription factor LCR-F19. 02 ¾ :, function Or changes in immune properties.

 "Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify the human transcription factor LCR-F19. 02 using standard protein purification techniques. The substantially pure human transcription factor LCR-F19.02 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human transcription factor LCR-F19. 02 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged into clusters. Each cluster is then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues matching between sequence 4 and sequence

Residues sequences - sequences spacer residues - the sequence of residues ^X interval S

The assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzyraology 183: 625-645) 0 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to an intact antibody molecules and fragments thereof, such as _{Fa, F (a b,)} 2 and F _V, which specifically binds to human transcription factor LCR-F19. 02 epitopes.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human transcription factor LCR-F19. ⁰² " refers to human transcription factor LCR-F19. 02 which is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify the human transcription factor LCR-F19. 02 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human transcription factor LCR-F19. 02 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, a human transcription factor LCR-F19. 02, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptide of the present invention may be a naturally purified product or a chemically synthesized product Or from recombinant cells using prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of the human transcription factor LCR-F19. 02. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human transcription factor LCR-F19.02 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1409 bases, and its open reading frame 994-1242 encodes 82 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human transcription factor LCR-F1, and it can be deduced that the human transcription factor LCR-F19. 02 has a similar function to human transcription factor LCR-F1.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" means including a polynucleotide encoding the polypeptide and including additional Coding and / or non-coding polynucleotides.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding the human transcription factor LCR-F19.02.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human transcription factor LCR-F19.02 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of the D sequence is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the CDM of interest is to isolate raR from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cD library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua 1, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determining the level of the transcript of the human transcription factor LCR-F19.02; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is usually a D sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human transcription factor LCR-F19.02 gene expression protein.

 A method (Saiki, et al. Sc; 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human transcription factor LCR- F19. 02 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.

In the present invention, a polynucleotide sequence encoding the human transcription factor LCR-F19. 02 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; A pMSXND expression vector (Lee and Na thans, J Bio Chera. 263: 3521, 1988) expressed in dairy animal cells and a baculovirus-derived vector expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct an expression vector containing a DNA sequence encoding the human transcription factor LCR-F19.02 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, CFold Harbor Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable genes to provide phenotypic traits for the selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and green Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human transcription factor LCR-F19. 02 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. . The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, it can Competent cells that absorb D can be harvested after the exponential growth phase and treated with the CaCl ₂ method, the steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human transcription factor LCR-F19. 02 (Science, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding the human human transcription factor LCR-F19.02 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.

Hemoglobin is the main component of red blood cells and is responsible for transporting oxygen and carbon dioxide in the body. Each hemoglobin molecule consists of two identical four subunits and four heme, and hemoglobin without heme becomes globin. The genes of all globin subunits have very similar structures. The composition of subunits of hemoglobin varies at different stages of individual development. The transcription and expression of globin subunits in vivo are regulated by related transcription factors. The transcription factor LCR regulates the transcription and expression of globin γ, _£ and 0 subunits. It first binds to the chromosome containing globin ρ subunit genes, and then strengthens globin ε,

Transcription and expression of β and β subunits.

The transcription factor LCR-F1 is a gene with a structure and function similar to the known transcription factor LCR. The conserved CNC domain in its protein sequence plays an important regulatory role in the transcription and expression regulation of globin ε, γ, and P subunits, and plays an important regulatory role in the formation of globin. Mutation or abnormal expression of this protein will cause abnormal expression of relevant globin in the body, and then affect the activity of related hemoglobin in the body, that is, cause various related diseases.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of human transcription factor LCR-F1, both of which have similar biological functions. The polypeptide of the present invention is involved in regulating the transcription and expression of globin ε, γ, and P subunits in vivo, which is of great significance for the normal formation of globin. Abnormal expression of globin will cause abnormal formation of red blood cells and related diseases.

 It can be seen that the abnormal expression of the human transcription factor LCR-F19. 02 of the present invention will produce various diseases, especially red blood cell diseases, and these diseases include, but are not limited to:

 Red blood cell disease: various anemias, erythrocytosis, symptomatic erythrocytosis, hereditary ellipsoid

 The polypeptide of the present invention, as well as its antagonists, agonists and inhibitors, can be directly used in the treatment of diseases, for example, it can treat various diseases, especially red blood cell diseases and the like.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the human transcription factor LCR-F19.02. Agonists enhance human transcription factor LCR-F19. 02 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, a mammalian cell or a membrane preparation expressing the human transcription factor LCR-F19. 02 can be cultured with the labeled human transcription factor LCR-F19. 02 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined. "'"

 Antagonists of human transcription factor LCR-F19. 02 include antibodies, compounds, receptor deletions, and the like that have been screened. The antagonist of human transcription factor LCR-F19. 02 can bind to human transcription factor LCR-F19. 02 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.

 When screening compounds as antagonists, the human transcription factor LCR-F19. 02 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between the human transcription factor LCR-F19. 02 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human transcription factor LCR- F19. 02 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human transcription factor LCR-F19. 02 molecule should generally be labeled.

The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides Antibodies against the epitope of human transcription factor LCR- F19. 02 are described. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human transcription factor LCR-F19. 02 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies to human transcription factor LCR-F19. 02 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against the human transcription factor LCR-F19.02.

 Antibodies against human transcription factor LCR-F19. 02 can be used in immunohistochemistry to detect human transcription factor LCR-F19. 02 in biopsy specimens.

 Monoclonal antibodies that bind to human transcription factor LCR-F19. 02 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human transcription factor LCR- F19. 02 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through disulfide exchange. This hybrid antibody can be used to kill the human transcription factor LCR-F19. Cell.

 The antibodies of the present invention can be used to treat or prevent diseases related to the human transcription factor LCR-F19. 02. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human transcription factor LCR-F19. 02.

 The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human transcription factor LCR-F19.02. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human transcription factor LCR-F19. 02 detected in the test can be used to explain the importance of human transcription factor LCR-F19. 02 in various diseases and to play a role in the diagnosis of human transcription factor LCR-F19. 02 disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

The polynucleotide encoding the human transcription factor LCR-F19. 02 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used for treatment of non-expression or abnormal / inactive expression of human transcription factor LCR-F19. 02 Caused by abnormal cell proliferation, development or metabolism. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human transcription factor LCR-F19. 02 to inhibit endogenous human transcription factor LCR-F19. 02 activity. For example, a mutated human transcription factor LCR-F19. 02 may be a shortened human transcription factor LCR-F19. 02, which lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human transcription factor LCR-F19. 02. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding the human transcription factor LCR-F19.02 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding the human transcription factor LCR-F19. 02 can be found in the existing literature (Sambrook, et al.). In addition, the polynucleotide encoding the human transcription factor LCR-F19.02 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human transcription factor LCR-F19. 02 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RM molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation. Antisense RNA and D and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis for the synthesis of oligonucleotides has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human transcription factor LCR-F19. 02 can be used for the diagnosis of diseases related to human transcription factor LCR-F19. 02. The polynucleotide encoding the human transcription factor LCR-F19. 02 can be used to detect the expression of the human transcription factor LCR-F19. 02 or the abnormal expression of the human transcription factor LCR- F19. 02 in a disease state. For example, the DNA sequence encoding human transcription factor LCR-F19. 02 can be used to hybridize biopsy specimens to determine the expression status of human transcription factor LCR-F19. 02. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue. Human transcription factor LCR- F19. 02 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the transcription of human transcription factor LCR- F19. 02 Product.

 Detection of mutations in the human transcription factor LCR- F19. 02 gene can also be used to diagnose human transcription factor LCR- F19. 02 related diseases. Human transcription factor LCR-F19. 02 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human transcription factor LCR-F19. 02 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergaraon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and unaffected individuals usually involves first looking for structural changes in the chromosome, such as defects visible at the chromosomal level or detectable by cDNA sequence-based PCR Missing or transposing. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human transcription factor LCR- F19. 02 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dosage range of the human transcription factor LCR-F19. 02 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally performed according to the general conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), or according to the conditions Conditions recommended by the manufacturer.

Example 1 transcription factor human clone LCR-F1 ^9.02 of

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) raRNA forms cDNA by reverse transcription. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public D sequence database (Genebank), and one of the clones was found. The 0093f03 cDNA sequence is new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the 0093f03 clone contains a full-length cDNA of 1409bp (as shown in Seq ID N0: l), and has an open reading frame (0RF) of 248b _P from 994bp to 1242bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0093f 03 and the encoded protein was named human transcription factor LCR-F19. 02. Example 2 Cloning of a gene encoding human transcription factor LCR-F19. 02 by RT-PCR

 CMA was synthesized by reverse transcription reaction using fetal brain cell total RNA as a template and ol igo-dT as a primer. After purification with Qiagene's kit, PCR was performed using the following primers:

 Priraerl: 5,-GAGATTCACAAAGAAAAAAAGCAA -3 '(SEQ ID NO: 3)

 Primer 2: 5'- AAATATAACTTTATTTTTCAGGTT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

Primer ² is the 3 'terminal reverse sequence of SEQ ID NO: 1.

Amplification reaction conditions: A reaction volume of 50 μl contains 50 mmol / L KCl, 10 crypto ol / L Tri s-HCl pH 8. 5, 1. 5 mraol / L MgCl ₂ , 200 mol / L dNTP, 1 Opmol primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1409bp shown in SEQ ID NO: 1. Example 3 Northern blot analysis of human transcription factor LCR-F19. 02 gene expression Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] This method involves acid guanidine thiocyanate phenol-chloroform extraction The tissue was homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.22¾1 sodium acetate (114.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49 : 1), mixed and centrifuged. Aspirate the aqueous phase layer, add isopropanol '(0.8 volume) and centrifuge the mixture to obtain RNA precipitate. Wash the obtained RNA precipitate with ⁷⁰ % ethanol, dry and dissolve in water. Using 20 μ _δ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 nm sodium acetate-IfflM EDTA-2. 2M formaldehyde. It was then transferred to a nitrocellulose membrane. A ³² P-labeled DNA probe was prepared by random primer method using ct- ³² P dATP. The DNA probe used was the PCR amplified human transcription factor LCR- F19 shown in FIG. 1. 02 coding region sequence (994bp to 1242bp). A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / _ra l) and an RNA-transferred nitrocellulose membrane Hybridize overnight at ⁴² ° C in a solution containing 50% formamide-25ra KH ₂ P0 ₄ (. PH7 4) - 5 x SSC- 5 x Denhardt, s solution and 200μ ε _/ ιη1 salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4 In vitro expression, isolation and purification of recombinant human transcription factor LCR- F19. 02

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer3: 5, -CCCCATATGATGCAGATGGTGCTGCTGCCATAT- 3, (Seq ID No: 5) Pr imer4: 5 '-CCCAAGCTTTCAAAATGTAGACCCACATCTTTC-3' (Seq ID No: 6) The two ends of these two primers contain Ndel and Hindlll digestion sites, respectively. , Followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and Hindll l restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site. The PCR reaction was performed using the PBS-0093f03 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: 10 pg of pBS-0093f03 plasmid in a total volume of 50 μ1, Primer-3 and Primer-4 primers were 1 Opmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and Hindlll were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5 CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR and sequenced. A positive clone (pET-0093f03) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by the calcium chloride method. In a LB liquid medium containing kanamycin (final concentration 30 μ _Ε / ιη1), the host bacteria BL21 (pET-0093f 03) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). The purified human transcription factor LCR-F19. 02 was purified. After SDS-PAGE electrophoresis, a single band was obtained at 9 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edaras hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human transcription factor LCR-F19. 02 antibody

Polypeptide synthesizer (product of PE company) was used to synthesize the following human transcription factor LCR-F19. 02 specific polypeptides: -Pro-Leu-Ser-C00H (SEQ ID NO: 7). The polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Imm painted chemi s try, 1969; 6: 43. Use 4mg of the above hemocyanin polypeptide The complex plus complete Freund's adjuvant was used to immunize rabbits. After 15 days, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as the EL ISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The polypeptide bound to cyanogen bromide activated Se _P har _{0S e} 4B column, by affinity chromatography from total IgG isolated anti-polypeptide antibody. The immunoprecipitation method proved that the purified antibody could specifically bind to the human transcription factor LCR- F19. 02. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30 ° / »-70%, non-specific hybridization increases when it exceeds; 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (robel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'-TGCAGATGGTGCTGCTGCCATATTTTCCTGGCACACCTTTA-3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5'-TGCAGATGGTGCTGCTGCCACATTTTCCTGGCACACCTTTA-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DM PROBES GHKeller; MMManak; Stockton Press, 1989 (USA ) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambruck et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5 ral per 0.1 g of the original tissue sample) and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells (1 × ^{10 8} cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3. Purification of DNA and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, 1- 5xl0 ⁶ cells per extracted plus about lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volume of cold ethanol, mix well and set to -20. C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) A _26Q and A _28D were measured to check the purity and yield of D. 15) Store at -20 ° C after dispensing.

 Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that they can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and put in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

Labeling of probes 1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) After the collection solution of the first peak is combined, the ³² P-Probe (the second peak is free γ- ³² P-dATP) to be prepared.

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (lOxDenhardt's; 6xSSC, 0.1 lrag / ml CT DM (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 4) 0. lxSSC, 0.1 ° /. SDS, 55. Wash for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 4) 0. lxSSC, 0.1 hits, 40. Wash for 15 minutes (twice) and dry at room temperature.

X-ray auto-development:

 -0 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

The hybridization experiment using low-intensity membrane washing conditions, the radioactivity of the hybrid spots of the above two probes is not strong. There are obvious differences; and for the hybridization experiments performed under high-intensity washing conditions, the radioactive intensity of the hybrid spot of probe 1 is significantly stronger than that of the hybrid spot of the other probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Example 7 DNA Microarray

 Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target MA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were dried to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2 SDS was washed for 1 minute;

 3. dd 0 wash twice, 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). Cy3dUTP (5-Araino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amershara Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5 -Amino- propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amershara Phamacia Biotech Company, labeled mRNA of specific tissues (or stimulated cell lines) of the body, and purified the probe to prepare a probe. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Sha Ion, Da ri., Davis, RW (1995) Science. 270 (20): 467-480.

 (Three) cross

 The probes from the two types of tissues and the chip were hybridized in a UniHyb ™ Hybridizat ion Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

The above specific tissues (or stimulated cell lines) are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 10 ²⁴ NT, Scar into fc growth factor stimulation, 1013HT, Scar into fc without growth factor stimulation, 1013HC, bladder cancer plant cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, jejunal gland Cancer, cardia cancer. Based on these 18 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profiles of human transcription factor LCR-F19. 02 and human transcription factor LCR-F1 according to the present invention are very similar.

Claims

Uncle demand

1. An isolated polypeptide-human transcription factor LCR-F19.02, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an active fragment, analog or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 994-1242 in SEQ ID NO: 1 or a sequence of positions 1-1409 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or vector expression vector Recombinant vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human transcription factor LCR-F19. 02 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human transcription factor LCR-F19.02;

 (b) Isolating a polypeptide having human transcription factor LCR-F19. 02 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to a human transcription factor LCR-F19. 02 Specific binding antibody.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of the human transcription factor LCR-F19. 02.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

 13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human transcription factor LCR-F19. 02 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening a mimic, agonist, antagonist or inhibitor of the human transcription factor LCR-F19.02; or For identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of human transcription factor LCR-F19. 02.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.