WO1996009311A1 - Human transcription factor iia - Google Patents

Abstract

The small (η) subunit of human Transcription Factor IIA and DNA (RNA) encoding such polypeptide and a procedure for producing such polypeptide by recombinant techniques. Also disclosed are methods for utilizing such polypeptide for regulating gene-specific and global transcription. Antagonists against such polypeptide and their use to inhibit transcription are also disclosed.

Description

HUMAN TRANSCRIPTION FACTOR IIA

This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is the small (γ) subunit of human transcription factor IIA, sometimes hereinafter referred to as "small subunit". The invention also relates to inhibiting the action of such polypeptides.

In prokaryoteε, simply mixing purified RNA polymerase, a template carrying a promoter, nucleoside triphosphates, and appropriate buffer and salts is sufficient to obtain specific gene transcription in vitro beginning at the correct sites. Purified RNA polymerase from eukaryotes, however, initiates transcription very poorly and essentially at random. Accordingly, accessory factors are required for accurate initiation of transcription in eukaryotes. Some of these transcription factors are general factors required for initiation at all promoters, while others are gene-specific and are required only for certain promoters. Among the general factors is a protein called Transcription Factor IID "TFIID", which binds to a TATA sequence, wherein T represents thymidine and A represents adenosine, in promoters. Other general factors are also involved in the assembly of a multicomponent protein complex at the promoter.

In general, transcription factors are found to contain two functional domains, one for DNA-binding and one for transcriptional activation. These functions often reside within circumscribed structural domains that retain their function when removed from their natural context. The DNA- binding domains of transcription factors fall into several structural families based on their primary amino acid sequence.

In order to identify the specific nucleotides that control gene expression, regions of the gene flanking the coding region can be εequenced. Comparisons of these sequences reveal common patterns near the 5' and 3' ends of different genes. These are predicted to be important for proper transcription by RNA polymerase. The most common motif is the TATA sequence around 30 bp from the transcriptional start site. Other conserved sequences have been found roughly 50 to 100 bp upstream of the transcriptional start site.

Eukaryotic transcriptional activation requires the characterization of several multiprotein complexes, referred as general transcription factors and coactivators¹ . The heteromeric general transcription factor TFIIA binds directly to the TATA binding protein (TBP)^3,4 and has been implicated in the process of transcriptional activation^5*8. The y subunit of TFIIA binds weakly to the TATA binding protein, but strongly stabilized the binding of the large subunit of TFIIA (α β ) to TBP. Recombinant human TFIIA is functional for the transcriptional activation mediated by at leastthree distinct activators. Both the β and subunits are essential for activator dependent stimulation of TFIID by binding to promoter DNA, thus facilitating the first step in pre- initiation complex formation. This demonstrates that TFIIA is an evolutionary conserved general transcription factor important for activator regulated transcription.

The interaction of TFIIA with the general transcription factor IID (TFIID) has been shown to be rate-limiting step in the transcriptional activation process⁵. TFIIA binds directly to TBP^3,4, the DNA binding subunit of the multiprotein TFIID complex¹². TBP associated factors (TAFs)^12"14, which are essential for activated transcription, are also required for an activator-dependent stimulation of the TFIIA-TFIID- promoter complex⁶. While TFIIA has no known function in unregulated basal transcription¹⁵, it has been postulated that TFIIA plays a role in preventing inhibitors of TFIID from repressing transcription¹⁶"¹⁹.

A TFIIA homolog has been identified in yeast⁹"¹⁰, and the genes encoding the two subunits are essential for viability¹¹. Human TFIIA consists of three polypeptides (α, β , y ) , but the two largest subunits are derived from a single gene which shares homology to the large subunit of yeast TFIIA^7,20-²¹. Both the human and yeast protein bind to the evolutionary conserved domain of TBP²² and stimulate transcription reconstituted with TFIID, but not TBP^17,19.

The polypeptide of the present invention has been putatively identified as the subunit of TFIIA. This identification has been made as a result of amino acid sequence homology.

In accordance with one aspect of the present invention, there is provided a novel mature polypeptide which is the small subunit of TFIIA, as well as fragments, analogs and derivatives thereof. The polypeptide of the present invention is of human origin.

In accordance with another aspect of the present invention, there are provided polynucleotides (DNA or RNA) which encode such polypeptide. In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptide by recombinant techniques.

In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptide, or polynucleotide encoding such polypeptide for therapeutic purposes, for example, for regulating gene- specific or global transcription and to counteract repressors of the TFIID complex.

In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.

In accordance with yet another aspect of the present invention, there are provided antagonists to such polypeptides, which may be used to inhibit the action of such polypeptides, for example, to inhibit transcription of undesired cells, e.g., malignancies.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

Figure 1(A) depicts the cDNA sequence and corresponding deduced amino acid sequence of the small subunit of human TFIIA. The small subunit polypeptide shown is the mature form of the polypeptide. Standard one-letter abbreviations for amino acids is used.

Figure 1(B) illustrates a comparison of the amino acid composition of the human TFIIA small subunit and the yeast (T0A2) TFIIA small subunit.

Figure 1(C) is a schematic diagram depicting the human TFIIA subunits. TFIIA is encoded by two genes, aβ and 7. The aβ protein is processed post-translationally into two polypeptides (α and β ) , approximately 35 and 19 kDa, respectively. Recombinant a and β polypeptides were designed with a breakpoint at amino acid residue 251, but this may not exactly correspond to the naturally occurring proteolytic cleavage site.

Figure 2 illustrates the functional activity of recombinant human, yeast and heterologous TFIIA. Figure 2(A) illustrates the formation of a D-A complex (resulting from the addition of TFIIA small subunit to TBP) bound to DNA detected by polyacrylamide gel EMSA (electrophoresis mobility shift assay) . A 29 bp oligonucleotide probe containing the adenovirus E1B TATA element was incubated with various preparations of TFIIA in the absence (-) or presence (+) of 10 ng of yeast TBP as indicated above each lane. Approximately 50 ng of recombinant TFIIA was incubated in each reaction. Partially purified human TFIIA (hllA, lanes 3,4), combinations of recombinant human subunits ( aβ , a , β , y , lanes 6-16), recombinant yeast aβ with yeast y ( aβ/yy ,lanes 19,20) are indicated above each lane.

Figure 2(B) illustrates the requirement of TFIIA activity in reconεtitution of transcriptional activation by the Epstein-Barr virus encoded activator, Zta transcriptional activator. Transcription reactions were reconstituted with immunoaffinity purified TFIID, recombinant TFIIB, partially purified RNA polymerase II, TFIIE, TFIIF, and USA with (+) or without (-) Zta. Various TFIIA preparations were added to reactions as indicated above each lane. Arrow at the left indicates the correctly initiated transcript.

Figure 3(A) illustrates the interaction of TFIIA subunits with TBP. ^3SS-labelled TFIIA (lanes 1-3), aβ (lanes 4-6), aβ+y (lanes 7-9) or T3 luciferase control (lanes 10-12) proteins were incubated with GST (lanes 2, 5, 8, 11,) or GST-TBP (lanes 3, 6, 9, 12) immobilized on glutathione sepharose beads, as indicated above each lane. Lanes marked input (lanes 1, 4, 7, 10) represent approximately 2.5% of the reaction input. Figure 3(B) illustrates that the interaction of TFIIA subunits reveals a strong homotypic binding of TFIIA 7. ³⁵S labelled TFIIA 7 (lanes 1-4), aβ (lanes 5-8), TBP (lanes 9- 12) or T3 luciferase (lanes 13-16) were incubated with GST (lanes 2, 6, 10, 14), GST-α3 (lanes 3, 7, 11, 15), or GST-7 (lanes 4, 8, 12, 16) fixed to gluthathione sepharoεe beads.

Figure 4(A) illustrates that recombinant TFIIA restores the ability of three distinct activation domains to function in TFIIA depleted nuclear extracts. The transcriptional activator proteins Zta (lanes 2, 4, 6, 7, 8, 9), GAL4-AH (lanes 10, 12, 14) or VP16 (lanes 16, 18, 20) were incubated with untreated HeLa cell nuclear extract (laneε 1, 2, 9, 10, 15, 16) or with TFIIA depleted HeLa cell nuclear extracts (lanes 3-9, 11-14, 17-20) in in vitro transcription reactions. 50 ng of recombinant TFIIA αS+7 (laneε 5, 6, 13, 14, 19, 20), TFIIA aβ (lane 7), or TFIIA 7 (lane 8) was supplemented to depleted extracts. Correctly initiated primer extension products for Zta and GAL4 templates are indicated by the arrows at the left and right, respectively.

Figure 4(B) illustrates the requirement for TFIIA in the reconstitution of transcriptional activation by an acidic activator with partially purified general transcription factors. Transcription reactions were essentially the same as those described for Fig. 2(B), except that the GAL-AH activator and the G₅E1BTCAT template were used.

Figure 4(C) shows that recombinant TFIIA promotes an activator and TAF dependent TFIID promoter complex. Mg agarose gel EMSA of DNA binding reactions with immunopurified TFIID (lanes 3-12), Zta (even laneε, and 13), and a 250 bp probe derived from the Z7E4TCAT promoter. Zta (20 ng), recombinant TFIIA (50 ng), and 0.1 footprinting unit of TFIID were incubated with approximately 1 fmole of radiolabelled promoter DNA for 15 minuteε at room temperature.

Sequencing inaccuracies are a common problem when attempting to determine polynucleotide sequences. Accordingly, the sequence of Figure 1A is based on several sequencing runs and the sequencing accuracy is considered to be at least 97%.

In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1A or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Depoεit No. 75809 on June 10, 1994.

The polynucleotide of this invention was discovered in a T-cell library. It is structurally related to the small subunit of yeast (T0A2). It contains an open reading frame encoding a protein of 109 amino acid residues. The protein exhibits the highest degree of homology to yeast TOA2 with 40% identity and 50% similarity over the entire amino acid stretch.

The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1A or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1A or the deposited cDNA.

The polynucleotide which encodeβ for the mature polypeptide of Figure 1A or for the mature polypeptide encoded by the deposited cDNA includes only the coding sequence for the mature polypeptide since the polypeptide is a nuclear protein which is not excreted to the outside of the cell.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1A or the polypeptide encoded by the cDNA of the deposited clone. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1A or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variantε of εuch polynucleotides which variantε encode for a fragment, derivative or analog of the polypeptide of Figure 1A or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variantε include deletion variantε, εubεtitution variants and addition or insertion variants.

As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1A or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which doeε not εubεtantially alter the function of the encoded polypeptide.

The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).

The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the εequenceε. The preεent invention particularly relateε to polynucleotideε which hybridize under εtringent conditionε to the hereinabove-described polynucleotides . As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain subεtantially the εame biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1A or the depoεited cDNA.

The depoεit(ε) referred to herein will be maintained under the ter ε of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admisεion that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequenceε herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

The present invention further relates to the small subunit of TFIIA polypeptide which has the deduced amino acid sequence of Figure 1A or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivativeε of εuch polypeptide.

The termε "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1A or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

The fragment, derivative or analog of the polypeptide of Figure 1A or that encoded by the depoεited cDNA may be (i) one in which one or more of the amino acid reεidues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid reεidueε includeε a εubstituent group, or (iii) one in which the mature polypeptide iε fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, which are employed for purification of the mature polypeptide. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptideε could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

The present invention also relateε to vectorε which include polynucleotides of the present invention, host cells which are genetically engineered with vectorε of the invention and the production of polypeptideε of the invention by recombinant techniqueε.

Host cells are genetically engineered (transduced or transformed or transfected) with the vectorε of thiε invention which may be, for example, a cloning vector or an expreεεion vector. The vector may be, for example, in the form of a plaεmid, a viral particle, a phage, etc. The engineered hoεt cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformantε or amplifying the TFIIA geneε. The culture conditionε, εuch aε temperature, pH and the like, are those previously used with the host cell selected for expresεion, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing polypeptideε by recombinant techniqueε. Thuε, for example, the polynucleotide may be included in any one of a variety of expression vectorε for expreεsing a polypeptide. Such vectorε include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectorε derived from combinations of plasmids and phage DNA, viral DNA such aε vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used aε long as it is replicable and viable in the host.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease εite(ε) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

The DNA sequence in the expresεion vector is operatively linked to an appropriate expression control sequence(ε) (promoter) to direct RNA εyntheεis. As repreεentative exampleε of εuch promoterε, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P_L promoter and other promoterε known to control expreεsion of genes in prokaryotic or eukaryotic cells or their viruεeε. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain one or more εelectable marker geneε to provide a phenotypic trait for selection of transformed host cells such aε dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin reεiεtance in E. coli.

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate hoεt to permit the host to express the protein.

As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli. Streptomyces. Salmonella typhimuriu : fungal cells, such as yeast; insect cells such as Drosophila and Sf9 animal cells such aε CHO, COS or Boweε melanoma; plant cells, etc. The selection of an appropriate hoεt iε deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plas id or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequenceε, including, for example, a promoter, operably linked to the εequence. Large numberε of εuitable vectorε and promoters are known to those of skill in the art, and are commercially available. The following vectorε are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, PSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plaεmid or vector may be used as long as they are replicable and viable in the hoεt.

Promoter regions can be εelected from any deεired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are PKK232-8 and PCM7. Particular named bacterial promoterε include lad, lacZ, T3, T7, gpt, lambda P_R, P_L and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retroviruε, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the hoεt cell can be a prokaryotic cell, such aε a bacterial cell. Introduction of the conεtruct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation. (Davis, L. , Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).

The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide εyntheεizerε.

Mature proteinε can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructε of the preεent invention. Appropriate cloning and expression vectorε for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al.. Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.

Transcription of the DNA encoding the polypeptideε of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancerε.

Generally, recombinant expreεεion vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin reεiεtance gene of E. coli and S. cereviεiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such aε 3-phoεphoglycerate kinase (PGK), σ-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is aεsembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.

Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with εuitable tranεlation initiation and termination εignalε in operable reading phaεe with a functional promoter. The vector will compriεe one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various specieε within the genera Pseudomonas, Streptomyceε, and Staphylococcuε, although others may also be employed as a matter of choice.

As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectorε include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expresεed.

Following transformation of a suitable hoεt strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.

Cells are typically harvested by centrifugation, diεrupted by phyεical or chemical meanε, and the resulting crude extract retained for further purification.

Microbial cells employed in expression of proteins can be diεrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical diεruption, or uεe of cell lysing agentε, εuch methodε are well know to thoεe skilled in the art.

Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblaεtε, deεcribed by Gluzman, Cell, 23:175 (1981), and other cell lineε capable of expreεεing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lineε. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

The TFIIA small subunit polypeptideε can be recovered and purified from recombinant cell cultureε by methodε including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic hoεt (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) . Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue.

While Applicant does not wish to limit the scientific reasoning in the present invention to any particular theory, the following procedures are illustrationε of the functional aεpects of TFIIA aε a whole and the small (7) subunit, in particular.

TFIIA activity was first assayed for the stabilization of TBP binding to a TATA box containing oligonucleotide probe in polyacrylamide gel EMSA (Fig. 2A) . In the absence of TFIIA, yeast TBP does not form a εtable complex with a TATA box containing oligonucleotide (lane 2) . Addition of partially purified human TFIIA (hllA) to TBP reεulted in the formation of a stable complex (D-A) (lane 4). Recombinant aβ+y also produced a stable D-A complex (lane 6) . TBP failed to form the stable D-A complex when the aβ or 7 subunit was added individually (lanes 8 and 10). Since natural TFIIA occurs as three polypeptides, the aβ protein was expressed as two independent subunits (Fig. 1C). The a+y had no effect (lane 12), while β+y had a small effect (lane 14) on TBP binding. In contrast, the combination of α, β and 7 subunits ( aβ+y ) reεulted in strong stimulation of TBP binding, while electrophoretic mobility was very similar to the native human TFIIA protein (lane 16). In addition, the yeast 7 subunit could also form a stable D-A complex when mixed with the human aβ subunit, demonstrating the interaction between the aβ and 7 subunits is evolutionarily conserved (lane 20). The electrophoretic mobility of the D-A complex was influenced by the different 0/87 forms of TFIIA, εuggesting that TFIIA is retained in the bound complexes.

The various TFIIA complexes were analyzed for their ability to support transcriptional activation in reactions reconstituted with partially purified general transcription factors, the coactivator USA²⁵, and the Epstein-Barr virus encoded activator, Zta⁶. The 7 subunit was essential for transcriptional activation, and the a and β subunit could be εupplemented as either a single aβ polypeptide, or as two distinct polypeptides ( a+β ) (Fig. 2B) . In all cases, the formation of the D-A complex in EMSA correlated with the ability of TFIIA to support transcriptional activation by Zta.

Radio labelled aβ , 7 or α|3+7 proteins were tested for their ability to interact with glutathione-S-transferase (GST) or GST-TBP fusion proteinε immobilized on glutathione agaroεe (Fig. 3A) . The 7 εubunit bound weakly, but εpecifically to GST-TBP (lane 3), aε did the aβ subunit (lane 6). Significantly, the combination of the aβ+y subunits markedly increased the binding to GST-TBP (lane 9) . The ability of radiolabelled TBP to bind to GST-7 and GST-α3 was also examined (Fig. 3B). TBP bound to GST-α3 protein, but failed to interact with the GST-7 protein (Fig. 3B, lanes 11 and 12). The discrepancy of the binding of 7 to TBP may be a partial result of the steric hindrance of GST fused to the amino terminus of 7. Although both aβ and 7 are capable of making direct contact with TBP, the heterodimer clearly binds with higher affinity. The interaction of 7 with the aβ polypeptides was also examined by the GST-fusion protein binding assay. Radiolabelled 7, aβ, or T3 control were incubated with GST-7, GST-aβ, or GST alone (Fig. 3B). As expected, the aβ subunit bound to GST-7 and the 7 subunit bound to GST-α/3. The 7 subunit also bound strongly to GST-7, while aβ did not bind GST-α3, suggesting that a homotypic association of the 7 subunit contributes to the oligomerization state of TFIIA. The T3 control protein did not interact with any of the GST proteins tested.

To determine whether TFIIA was required for transcriptional activation by activators distinct from Zta, the need for TFIIA by the acidic activator GAL4-AH²⁶ and the herpes virus derived activator GAL4-VP16²⁷ was examined. Zta is not an acidic activator, like AH and shares no obvious homology to the VP16 activation modules. TFIIA depleted HeLa cell nuclear extracts were prepared by serial passage over nickel agarose, which bindε specifically to the aβ subunit of TFIIA.^7,2° Addition of Zta to the depleted extract failed to produce significant transcription levels (Fig. 3A, lane 4). Addition of TFIIA aβ+y subunits restored activation of the depleted extracts to levels observed in the undepleted extract (compare laneε 2 and 6) . The aβ or 7 subunit alone failed to restore Zta activation in these depleted extracts indicating that both subunits were equally depleted by the nickel agarose. Similarly, GAL4-AH (lanes 9-14) and GAL4- VP16 (lanes 15-20) did not function in the TFIIA depleted extracts. Addition of recombinant aβ+y subunits restored activator dependent transcription for all three distinct activators. GAL4-AH was also shown to require TFIIA in reconstituted transcription assays (Fig. 4B) as did Zta (Fig. 2B). These results indicate that distinct activation domains require TFIIA for activated transcription in both crude nuclear extracts, as well as in more purified reconstitution systemε. Partially purified TFIIA is required for an activation domain stimulation of TFIID binding to promoter DNA.⁶ Using Mg agarose gel EMSA, it was found that recombinant TFIIA substitutes for the partially purified TFIIA in this function (Fig. 4C). In the absence of TFIIA, Zta does not stimulate the formation of a TFIID-DNA complex (Fig. 4C, lane 4). However, the addition of partially purified TFIIA (lane 6) or aβ+y (lane 12), but not aβ or 7 alone (lanes 7-10) allows Zta stimulation of TFIID binding to the promoter DNA. These results demonstrate that TFIIA mediates an interaction between activators and TFIID, which result in the increase affinity of TFIID for promoter DNA.

The isolation of the 7 subunit of human TFIIA has allowed testing for the requirement for highly purified TFIIA in the reconstitution of activated transcription in vitro . Several distinct activation domainε require TFIIA for their ability to function. The recombinant human 7 εubunit, haε alεo been shown to be functionally interchangeable in in vitro transcription and TBP binding assays.

The TFIIA small εubunit polypeptide may be uεed to prevent inhibitors of TFIID from repressing transcription, this iε useful where a particular gene product is desired and is not being produced at the desired levels due to the inhibition of the TFIID complex.

Most importantly, the TFIIA small subunit polypeptide may be used to regulate transcription globally or in a gene- specific manner, to obtain desired concentrations of particular proteins. For example, in the case of a malignancy, the TFIIA small subunit may be repressed to prevent transcription and in the case where a protein is desired, for example growth hormone, the TFIIA small εubunit may enhance transcription and the production of the gene product.

The polypeptide of the present invention is also useful for identifying other molecules which have similar biological activity. An example of a screen for this iβ isolating the coding region of the small subunit of the TFIIA gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotideε having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

This invention provideε a method of εcreening compoundε to identify those which enhance (agonistε) or block (antagoniεtε) interaction of the small subunit of TFIIA with TFIID. An agonist is a compound which increases the natural biological function of the small subunit of TFIIA, while antagonists eliminate such functions. Aε an example, purified RNA polymerase, a template carrying a promoter, nucleoεide triphosphateε and appropriate buffer and εaltε may be mixed with TFIIA and TFIID in the preεence of the compound under conditionε where transcription would normally take place. The ability of the compound to enhance or block the binding of TFIIA to the template DNA could then be determined by measuring the level of transcription product.

Alternatively, the aεεay may be a cell-baεed aεεay wherein a TFIIA-inducible promoter drives the expression of a marker gene. TFIIA and the compound to be screened would then be added to meaεure the level of production of the marker gene. Additionally, thiε cell-based asεay could be uεed in tandem with the binding assay to determine if the effects on transcription are specific to TFIIA agonism or antagonism.

Potential antagonists include an antibody, or in some cases, an oligonucleotide, which binds to the small subunit of TFIIA. Alternatively, a potential antagoniεt may be a closely related protein which binds to the TBP protein of the TFIID complex but do not initiate transcription. An example of such a closely related protein is a negative dominant mutant, wherein one the two subunits of TFIIA are mutated and do not retain function. The negative dominant mutant, however, still recognizes substrate but doeβ—not initiate transcription.

Another potential antagonist is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production of the TFIIA small subunit. The antisenεe RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the TFIIA small εubunit (antiεenεe - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expresεion, CRC Press, Boca Raton, FL (1988)). The oligonucleotides deεcribed above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the small subunit of TFIIA.

Potential antagonists include a small molecule which binds to and occupies the active site of the polypeptide such that TFIIA is unable to activate TFIID and initiate transcription. Examples of small molecules include but are not limited to small peptides or peptide-like molecules.

The antagonists may be employed to inhibit the transcription of undesired polypeptides. For example, where a particular polypeptide leads to an undesired condition the antagonists mentioned above may be used to prevent transcription of that polypeptide. An example of this is the transcription and differentiation of cancerous cells. The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.

The polypeptides of the present invention may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

The invention also provideε a pharmaceutical pack or kit compriεing one or more containerε filled with one or more of the ingredientε of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form preεcribed by a governmental agency regulating the manufacture, uεe or sale of pharmaceuticals or biological productε, which notice reflectε approval by the agency of manufacture, use or sale for human administration. In addition, the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds.

The pharmaceutical compositionε may be administered in a convenient manner such as by the topical, intravenouε, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at leaεt about 10 μg/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage iε from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.

The small subunit polypeptide of TFIIA and agonists and antagonists which are polypeptides may also be employed in accordance with the present invention by expression of such polypeptides in vivo , which is often referred to as "gene therapy. "

Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cellε then being provided to a patient to be treated with the polypeptide. Such methodε are well-known in the art. For example, cellε may be engineered by procedureε known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.

Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the preεent invention may be administered to a patient for engineering cellε in vivo and expresεion of the polypeptide in vivo . These and other methodε for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenoviruε which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.

Fragments of the full length TFIIA small subunit gene may be used aε a hybridization probe for a cDNA library to isolate the full length TFIIA small subunit gene and to isolate other genes which have a high sequence similarity to the gene. Probes of this type can be, for example, 30, 40, 50 75, 90, 100 or 150 bases. Preferably, however, the probes have between 30 and 50 base pairs. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene including regulatory and promotor regions, exonε, and introns. The probe may be labelled, for example, by radioactivity to facilitate identification of hypbridization.

The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular siteε on the chromoεome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAε to chromoεomeε according to the present invention is an important first step in correlating those sequences with genes associated with diseaεe.

Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analyεiε of the cDNA iε used to rapidly εelect primers that do not εpan more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic cloneε in an analogouε manner. Other mapping strategies that can similarly be uεed to map to itε chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.

Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 500 or 600 bases; however, cloneε larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. FISH requires use of the clones from which the EST was derived, and the longer the better. For example, 2,000 bp iε good, 4,000 is better, and more than 4,000 iε probably not necessary to get good results a reasonable percentage of the time. For a review of this technique, see Verma et al., Human Chromosomeε: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once a sequence has been mapped to a precise chromosomal location, the phyεical poεition of the εequence on the chromoεome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library) . The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysiε (coinheritance of physically adjacent geneε).

Next, it iε neceεsary to determine the differences in the cDNA or genomic εequence between affected and unaffected individuals. If a mutation is obεerved in some or all of the affected individuals but not in any normal individualε, then the mutation iε likely to be the causative agent of the disease.

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative geneε. (Thiε assumes 1 megabase mapping resolution and one gene per 20 kb).

The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used aε an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.

Antibodies generated againεt the polypeptideε correεponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodieε (Cole, et al., 1985, in Monoclonal Antibodieε and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. The present invention will be further described with reference to the following examples; however, it iε to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.

In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.

"Plas idε" are designated by a lower case p preceded and/or followed by capital letterε and/or numberε. The εtarting plaεmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.

"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain εequenceε in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were uεed aε would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment iε used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37'C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction iε electrophoresed directly on a polyaerylamide gel (or an agarose gel) to isolate the desired fragment, aε described in Sa brook et al.. Molecular Cloning: A laboratory Manual, Sceond Edition, Cold Spring Harbor, N.Y. (1989).

"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotideε have no 5' phoεphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A εynthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" referε to the process of forming phosphodieεter bondε between two double εtranded nucleic acid fragmentε (Maniatiε, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligaεe") per 0.5 μg of approximately equimolar amountε of the DNA fragmentε to be ligated.

Unleεε otherwiεe εtated, tranεformation waε performed aε described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

Example 1 Bacterial Expresεion and Purification of the εmall TFIIA εubunit

The DNA sequence encoding for the small TFIIA subunit, ATCC # 75809, is initially amplified using PCR oligonucleotide primers corresponding to the 5' and sequences of the processed TFIIA subunit protein and the vector sequences 3' to the small subunit of TFIIA gene. Additional nucleotides corresponding to the small subunit of TFIIA were added to the 5' and 3' sequences respectively. In the case of the 7 εubunit, the 5' oligonucleotide primer has the εequence 5'GCGGCGGATCCATGGCATATCAGGTATAC3' containε a Bam HI restriction enzyme site followed by 18 nucleotides of the small subunit of TFIIA (underlined) coding sequence starting from the presumed terminal amino acid of the processed protein codon . The 3 ' s equence 5'GCGGCAAGCTTATTCTGTAGTATTGG3' contains complementary sequences to HindiII site and is followed by 13 nucleotides of the small subunit of TFIIA (underlined). The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQE-9 encodeε antibiotic reεiεtance (Amp^r), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/0), a riboεome binding site (RBS), a 6-Hiε tag and reεtriction enzyme εiteε. pQE-9 was then digested with Bam HI and Hind III. The amplified sequences were ligated into pQE-9 and were inserted in frame with 6 His reεidueε fused to the amino terminus. The ligation mixture was then used to transform E. coli strain available from Qiagen under the trademark M15/rep 4 by the procedure described in Sa brook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresεeε the lad represεor and alεo confers kanamycin resiεtance (Kan^r). Tranεformantε are identified by their ability to grow on LB plateε and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysiε.

Cloneε containing the desired constructs were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ l). The 0/N culture iε uεed to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D.⁶⁰⁰) of between 0.4 and 0.6. IPTG ( "Isopropyl-B-D- thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expresεion. Cellε were grown an extra 3 to 4 hourε. Cellε were then harvested by centrifugation. The cell pellet waε solubilized in the chaotropic agent 6 Molar Guanidine HCl. After clarification, solubilized TFIIA subunits was purified from this solution by chromatography on a Nickel-Agarose column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)). The small subunit of TFIIA (95% pure) was eluted from the column in 6 molar guanidine HCl pH 5.0 and were allowed to renature by themselves of in stoichiometric combination with the specified protein (see Fig. 2). Gel Mobility Shift aεεays were used to separate the transcription products as they appear in the Figure.

Example 2 Interaction of small subunit of TFIIA with σlutathione-S- transferase or GST-TBP fusion proteinε

Bacterial extracts of GST or GST fusion proteins were incubated with glutathione sepharoεe-4B beads (6-9 μg of GST- fusion protein/20 μl of beads) with shaking at 4°C. After 2 hours the beadε were waεhed with 50 column volumeε of cold buffer A (20 mM NaH₂P0₄ (pH 7.0) 150 mM NaCl, 1 mM DTT, 1 mM PMSF). Waεhed beadε (20 μl) were then incubated with reticulocyte lysateε containing 2x10⁴ cpm of ³⁵S labelled protein in 300 μl of protein binding buffer (PBB) for 1 hour at room temperature. PBB contained 20 mM Hepeε (pH 7.9), 20% glycerol, 0.5 mM EDTA, 60 mM KC1, 5 mM MgC12, 0.1% NP40, and 5 mM /3-mercaptoethanol. The beadε were subsequently washed 4 times in PBB and labeled proteins were eluted with 1M KC1. Samples were analyzed on 15% SDS polyacrylamide gels, enhanced with NaSalycilate, and visualized by autoradiography. Example 3 Transcription reactions utilizing TFIIA

Transcription reactions contained 100 ng of the Z7E4TCAT²⁹ or G5E1BTCAT²⁶ template, approximately 200 ng of activator protein, and 40 μg of nuclear extract in a 50 μl final reaction volume. TFIIA depleted nuclear extracts were prepared by dialyzing HeLa cell nuclear extract in buffer D in 20 mM Hepes (pH 7.9), 20% glycerol, 5 mM β- mercaptoethanol, 1 mM PMSF, containing 500 mM KCl, followed by two sequential incubations with Nickel agarose beadε (150 ul packed beadε/1 mg of nuclear extract) for 20 minuteε at 4°C rotating. Depleted extractε were dialyzed into D buffer containing 100 mM KCl. The reconεtituted tranεcription reactions and the Mg agarose EMSA were described previously⁶.

Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly deεcribed.

SEQUENCE LISTING

(1) GENERAL INFORMATION: (i) APPLICANT: LI, ET AL.

(ii) TITLE OF INVENTION: Human Transcription Factor IIA

(iii) NUMBER OF SEQUENCES: 2

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,

CECCHI, STEWART & OLSTEIN

(B) STREET: 6 BECKER FARM ROAD

(C) CITY: ROSELAND

(D) STATE: NEW JERSEY

(E) COUNTRY: USA

(F) ZIP: 07068

(V) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 3.5 INCH DISKETTE

(B) COMPUTER: IBM PS/2

(C) OPERATING SYSTEM: MS-DOS

(D) SOFTWARE: WORD PERFECT 5.1

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE: Submitted herewith

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA

(A) APPLICATION NUMBER:

(B) FILING DATE: (Viϋ) ATTORNEY/AGENT INFORMATION:

(A) NAME: FERRARO, GREGORY D.

(B) REGISTRATION NUMBER: 36,134

(C) REFERENCE/DOCKET NUMBER: 325800-149

(IX) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 201-994-1700

(B) TELEFAX: 201-994-1744

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 804 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

GGCCCCCTCT AGAACTAGTG GATCCCCCCG GCCTGCAGGA ATTCGGCACG AGCTGGAGAG 60 GTGGTCGGAG AGTAGGAAC CTCCTGCCGG GCTCGTGGCG GCT CTGTCC GCTCCGCGGA 120

GGGAAGCGCC TTCCCCACAG GACATCAATG CAAGCTTGAA TAAGAAAAAC AAATTCT CC 180 TCCTAAGCCA TGGCATATCA GTTATACAGA AATACTACTT TGGGAAACAG TCTTCAGGAG 240 AGCCTAGATG AGCTCATACA GTCTCAACAG ATCACCCCCC AACTTGCCCT TCAAGTTCTA 300 CTTCAGTTTG ATAAGGCTAT AAATGCAGCA CTGGCTCAGA GGGTCAGGAA CAGAGTCAAT 360 TTCAGGGGCT CTCTAAATAC GTACAGATTC TGCGATAATG TGTGGACTTT TGTACTGAAT 420 GATGTTGAAT TCAGAGAGGT GACAGAACTT ATTAAAGTGG ATAAAGTGAA AATTGTAGCC 480 TGTGATGGTA AAAATACTGG CTCCAATACT ACAGAATGAA TAGAAAAAAT ATGACTTTTT 540 TACACCATCT TCTGTTATTC ATTGCTTTTG AAGAGAAGCA TAGAAGAGAC TTTTTATTTA 600 TTCTAGAATT GCAGAAATGA CTACACTGTG CTARACCAGA GAATTCCAGT AGAAAGAAAC 660 TTGTAACTCT GTAGCCTCTT ACATCACCTT TATTATACAG CATGAAAAAC CATAACTTTT 720 TTTTAAGGAC AAAAGTTGTT GCCTTCCTAA GAACCTTCTT TAATAAACTC ATTTTAAAAC 780 TCTGAAAAAA AAAAAAAAAA AAAA 804 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 109 AMINO ACIDS

(B) TYPE: AMINO ACID

(C) STRANDEDNESS:

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: PROTEIN

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Ala Tyr Gin Leu Tyr Arg Asn Thr Thr Leu Gly Asn Ser Leu

5 10 15

Gin Glu Ser Leu Asp Glu Leu lie Gin Ser Gin Gin lie Thr Pro

20 25 30

Gin Leu Ala Leu Gin Val Leu Leu Gin Phe Asp Lyε Ala lie Asn

35 40 45

Ala Ala Leu Ala Gin Arg Val Arg Asn Arg Val Asn Phe Arg Gly

50 55 60

Ser Leu Asn Thr Tyr Arg Phe Cys Aεp Asn Val Trp Thr Phe Val

65 70 75

Leu Aεn Aεp Val Glu Phe Arg Glu Val Thr Glu Leu lie Lyε Val

80 85 90

Aεp Lyε Val Lyε lie Val Ala Cyε Aεp Gly Lyε Aεn Thr Gly Ser

95 100 105 Aεn Thr Thr Glu 109

REFERENCES:

1. Tjian, R. and Maniatis, T. Cell 77, 5-8 (1994).

2. Zawel, L. and Reinberg, D. Prog. Nucl. Acids. Res. Mol. Biol. 44, 67-108 (1993).

3. Buratowski, S. Hahn, S. Guarente, L., and Sharp, P.A. Cell 56, 549-561 (1989).

4. Maldonado, E., Ha, I., Cortes, P., Weiss, L., and Reinberg, D. Mol. Cell. Biol., 12, 6335-6347 (1990).

5. Wang, W., Gralla, J.D., and Carey, M. Genes and Dev.

6. 1716-1727 (1992).

6. Lieberman, P. and Berk, A., Genes and Dev., 8:995- 1006 (1994).

7. Ma, D., Watanabe, H., Memelstein, F., Admon, A., Oguri, K., Xiaoqing, S., Wada, T., Imai, T., Shiroya, T., Reinberg, D., and Handa, H. Geneε Dev. 7, 2246-2257 (1993).

8. Chi, T., and Carey, M. Mol. Cell. Biol., 13, 7045- 7055 (1993).

9. Hahn, S., Buratowski, S., Sharp, P., and Guarente, L., EMBO J., 8, 3379-3382 (1989).

10. Ranish, J.A. and Hahn, S. J. Biol. Chem. 266, 19320- 19327 (1991).

11. Ranish, J.A., Lane, W.S. and Hahn, S. Science 255, 1127-1129 (1992). 12. Hernandez, N. Geneε Dev. 7, 1291-1308 (1993).

13. Dynlacht, B.D., Hoey, T., and Tjian, R. Cel 66, 563-576 (1991).

14. Tanese, N., Pugh, B.F., and Tjian, R. Geneε and Dev. 5, 2212-2224 (1991).

15. Tyree, CM., George, C.P. Lira-De Vito, L., Wampler, S. Dahmus, M.E., Zawel, L., and Kadonaga, J.T. 7, 1254-1265 (1993) .

16. Roeder, R.G. Trends Biochem. Sci. 16, 402-408 (1991).

17. Corteε, P., Floreε, 0., and Reinberg, D. Mol. Cell. Biol. 12, 412-421 (1992).

18. Merino, A., Madden, K., Lane, W.S., Champoux, J. , and Reinberg, D. 1993. Nature 365, 327-332 (1993).

19. Drapkin, R. Merino, A. and Reinberg, D. Cur. Opin. Cell. Biol., 5, 469-476 (1993).

20. DeJong, J. and Roeder, R. Genes and Dev. 7, 2220-2234 (1993).

21. Yokomuri, K., Ad on, A., Goodrich, J.A., Chen, J.L., and Tjian, R. Genes Dev. 7, 2235-2245 (1993).

22. Buratowski, S. and Zhou, H. Science 255:1130-1132 (1992) .

23. Adams, M.D. et al.. Science 252, 1651 (1991).

24. Adams, M.D., et al., Nature 355:632-634 (1992). 25. Meisterernεt, M. , Roy, A.L. , Lieu, H.M., and Roeder, R.G. Cell 66, 981-993 (1991).

26. Lin, Y.S., Carey, M., Ptashne, M., and Green, M. Cell 54, 659-664 (1988).

27. Chasman, D.I., Leather ood, J., Carey, M., Ptashne, M., and Korngerg, R. Mol. Cell. Biol. 9, 4746-4749 (1989).

28. Kao, C.C., Lieber an, P.M., Schmidt, M.C., Zhou, Q., Pei, M.R., and Berk, A. Science 248, 1646-1650 (1990).

29. Carey, M. , Kolman, J., Katx, D.A., Gradoville, L., Barberis, L., and Miller, G.J. Virol. 66, 4803-4813 (1992).

30. Zhou, Q., Lieberman, P.M., Boyer, T.G. and Berk, A.J. Genes Dev. 6, 1964-1974 (1992).

Claims

WHAT IS CLAIMED IS:

1. An isolated polynucleotide selected from the group consisting of:

(a) a polynucleotide encoding a small εubunit polypeptide having the deduced amino acid sequence of Figure 1A or a fragment, analog or derivative of said polypeptide;

(b) a polynucleotide encoding a small subunit polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75809 or a fragment, analog or derivative of said polypeptide.

2. The polynucleotide of Claim 1 wherein the polynucleotide iε DNA.

3. The polynucleotide of Claim 1 wherein the polynucleotide iε RNA.

4. The polynucleotide of Claim 1 wherein the polynucleotide iε genomic DNA.

5. The polynucleotide of Claim 2 wherein said polynucleotide encodes a small subunit having the deduced amino acid sequence of Figure 1A.

6. The polynucleotide of Claim 2 wherein said polynucleotide encodes a small subunit polypeptide encoded by the cDNA of ATCC Deposit No. 75809.

7. The polynucleotide of Claim 1 having the coding sequence of a small subunit as shown in Figure 1A.

8. The polynucleotide of Claim 2 having the coding sequence of a small subunit deposited aε ATCC Deposit No. 75809.

9. A vector containing the DNA of Claim 2.

10. A host cell genetically engineered with the vector of Claim 9.

11. A process for producing a polypeptide comprising: expressing from the host cell of Claim 10 the polypeptide encoded by said DNA.

12. A process for producing cellε capable of expressing a polypeptide comprising genetically engineering cells with the vector of Claim 9.

13. An isolated DNA hybridizable to the DNA of Claim 2 and encoding a polypeptide having a small subunit activity.

14. A polypeptide selected from the group consisting of: (i) a small subunit polypeptide having the deduced amino acid sequence of Figure 1A and fragments, analogs and derivatives thereof and (ii) a small subunit polypeptide encoded by the cDNA of ATCC Deposit No. 75809 and fragmentε, analogs and derivatives of said polypeptide.

15. The polypeptide of Claim 14 wherein the polypeptide is a small subunit having the deduced amino acid sequence of Figure 1A.

16. An antibody against the polypeptide of claim 14.

17. An agoniεt for the polypeptide of claim 14.

18. An antagonist against the polypeptide of claim 14.

19. A method for the treatment of a patient having need of an enhanced level of transcription comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 14.

20. A method for the treatment of a patient having need of an enhanced level of transcription compriεing: administering to the patient a therapeutically effective amount of the agoniεt of claim 17.

21. A method for the treatment of a patient having need to inhibit transcription comprising: administering to the patient a therapeutically effective amount of the antagonist of Claim 18.

22. The method of Claim 19 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

23. A method for identifying antagonists and agonistε specific to the small subunit polypeptide comprising: preparing a cell having a TFIIA-inducible promoter which drives the expresεion of a marker gene; contacting the cell with TFIIA and a compound to be screened; and determining the level of expression of the marker gene.