EP0788540A1

EP0788540A1 - Human abh

Info

Publication number: EP0788540A1
Application number: EP95901018A
Authority: EP
Inventors: Ying-Fei Wei; Granger G. Sutton, Iii
Original assignee: Human Genome Sciences Inc
Current assignee: Human Genome Sciences Inc
Priority date: 1994-10-21
Filing date: 1994-10-21
Publication date: 1997-08-13
Also published as: JPH10507634A; AU1041195A; WO1996012791A1; EP0788540A4

Abstract

A human hABH polypeptide and DNA (RNA) encoding such polypeptide and a procedure for producing such polypeptide by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polypeptide for the treatment of mutations and the treatment of diseases which result from damaged DNA, for example, cancer. Antagonists against such polypeptides and their use as a therapeutic to augment chemotherapy of cancer cells are also disclosed.

Description

HUMAN ABH

This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is human homolog of the bacterial AlkB gene, sometimes hereinafter referred as "hABH". The invention also relates to inhibiting the action of such polypeptides.

Alkylating agents induce DNA damage which may cause either killing of cells or induction of mutation and cancer. Most of such damage is subjected to common cellular DNA repair mechanisms, such as excision repair and postreplication repair (Hanawalt, P.C., et al, Annu. Rev. Biochem., 48:783-836 (1979) and itkem, Bacteriol. Rev., 40:869-907 (1976)). A repair mechanism is that performed by the human DNA mismatch repair protein.

Certain strain of E. Coli mutants have been found to be specifically sensitive to alkylating agents. Two types of such mutants have been isolated, alkA and tagA (Yamamato, Y., et al., J. Bacteriology, 135:144-152 (1978) and Karran, P., et al., J. Mol. Biol., 40:101-127 (1980)). These genes control the formation of enzymes that catalyze the liberation of certain alkylated bases from damaged DNA (Karran, P., Nature (London), 296:770-773 (1982)). In addition, ada and adc mutants have been isolated which are defective in controlling mechanisms to induce the adaptive response to alkylating agents (Jeggo, P., J. Bacteriol., 139:783-791 (1982)) .

The tagA gene has been mapped to an E. Coli chromosome and controls a constitutive enzyme 3-methyladenine-DNA glycosylase I that releases 3-methyladenine from alkylated DNA (Karran, P. et al. , Nature (London), 296:770-773 (1982)). The alkA gene has also been mapped and it too controls an inducible enzyme, 3-methyladenine-DNA glycosylase II, which catalyzes the liberation of 3-methyladenine, 3-methylguanine, and 7-methylguanine from the DNA (Evensen, G. and Seeberg, E., Nature (London), 296:773-775 (1982).

Another gene of E. Coli. AlkB , has also been found to control sensitivity to methyl methane sulfonate (MMS). The AlkB gene was located in a region of the chromosome near ada and adc , but is not considered an allele to these genes (Sedgwick, B., J. Bacteriol., 150:984-988 (1982)).

Thus, AlkB resides in a new gene that is near the nalA gene. The AlkB phenotype is different ._rom that of ada, since the AlkB mutant exhibited a normal adaptive response to n-methyl-n'-nitro-n-nitrosoguanidine (Kataoka, H., et al., J. Bact., 153:1301-1307 (1983)). The AlkB gene of E.coli has been found to be responsible for the repair of alkylated DNA (Kondo, H., et al. , J. Biol. Chem. , 15:1-6, (1986)).

Due to the amino acid sequence between AlkB from E.coli. the present polynucleotide and deduced polypeptide have been putatively identified as a human homolog of the E.coli AlkB protein.

In accordance with one aspect of the present invention, there is provided a novel mature polypeptide which is hABH, as well as fragments, analogs and derivatives thereof. The polypeptide of the present invention is of human origin. In accordance with another aspect of the present invention, there are provided polynucleotides (DNA or RNA) which encode such polypeptides.

In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptide by recombinant techniques.

In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptide, or polynucleotide encoding such polypeptide for therapeutic purposes, for example, for repairing alkylated DNA and accordingly preventing or treating cell death and cancer.

In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.

In accordance with yet another aspect of the present invention, there are provided antagonists to such polypeptides, which may be used to inhibit the action of such polypeptides, for example, to prevent this polypeptide from repairing tumor cell DNA during chemotherapy with alkylating agents.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

Figure 1 is the cDNA sequence and corresponding deduced a ino acid sequence for hABH. The a ino acid sequence shown comprises the putative mature polypeptide. The standard one letter abbreviation for amino acids is used.

Figure 2 is a schematic illustration of the survival rate of cells in the presence of increasing concentrations of MMS (methyl methane sulfonate). Cells which are wild type for AlkB show no decrease in survival rate as there is an increase in MMS. Mutations (MT) show a dramatic decrease in the survival rate as the concentration of MMS increases. Cells which have the hABH present therein show an increased survival rate as compared to mutant cells.

Figure 3 illustrates amino acid homology between hABH (top) and AlkB (bottom) from E.coli.

In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75855 on August 9, 1994.

A polynucleotide encoding a polypeptide of the present invention may be obtained from a human prostate, testis, placenta and heart. The polynucleotide of this invention was discovered in a cDNA library derived from a human synovial sarcoma. It is structurally related to E. Coli AlkB. It contains an open reading frame encoding a protein of 307 amino acid residues. The protein exhibits the highest degree of homology to E.coli AlkB with 23% identity and 52% similarity over a 283 amino acid stretch.

The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 or the deposited cDNA.

The polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as intronε or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.

The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode for a proprotein which is the mature protein plus additional 5 ' amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.

Thus, for example, the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).

The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al.. Cell, 37:767 (1984)).

The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides . As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 or the deposited cDNA.

The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

The present invention further relates to an hABH polypeptide which has the deduced amino acid sequence of Figure 1 or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.

The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

The fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the hABH genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenoviruε, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda P_L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.

As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Strepto yces. Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila and Sf9; animal cells such as CHO, COS or Bowes melanoma; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, pεiX174, pbluescript SK, pbskε, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plaεmid or vector may be uεed aε long as they are replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are PKK232-8 and PCM7. Particular named bacterial promoters include lad, lac2 — 3, T7, gpt, lambda P_R, P and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such aε a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation. (Davis, L., Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986) ) . The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoterε. Cell-free tranεlation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al.. Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.

Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytumegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream εtructural εequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination εequenceε. and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.

Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella typhimuriu and various species within the genera Pεeudomonas, Streptomyces, and Staphylococcus, although others may also be employed aε a matter of choice.

As a repreεentative but nonli iting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, PKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.

Following transformation of a suitable host strain and growth of the hoεt strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period. Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.

Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to thoεe skilled in the art.

Various mammalian cell culture syεtems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblaεts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expreεεing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lineε. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necesεary riboεome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

The hABH polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necesεary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification εtepε.

The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) . Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue.

The hABH polypeptide of the present invention may be employed to protect against cellular DNA damage as a result of exposure to chemical mutagens. More particularly, the hABH may be used to repair cellular DNA, such as by excision repair, substitution, removing alkylated portion of bases or postreplication repair.

In this manner, the hABH polypeptide of the present invention may be used to treat diseases characterized by abnormal cellular differentiation, for example, cancer. Further, mutated DNA leads to a host of other known and unknown disorders which could be treated with the hABH polypeptide of the present invention.

The polypeptide of the present invention is also useful for identifying other molecules which have similar biological activity. An example of a screen for this is isolating the coding region of the hABH gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

The present invention also provides a diagnostic assay for detecting mutated hABH genes, which is indicative of a susceptibility to mutation of DNA by various agents, such as chemical mutation. One example of such an assay is the RT- PCR method. For RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) , the RNA encoding hABH is isolated from the total cellular RNA removed from a cell sample. The coding region of the RT-PCR products are then sequenced and compared to the hABH gene to detect mutations. Alternatively, oligonucleotide probes may be prepared which are highly specific for the mRNA to be detected. Such oligonucleotide probes have between 10 and 40 base pairs and preferebly between 10 and 30 base pairs. The oligonucleotide probes may be labelled, for example by radioactivity. The probe is hybridized, for example in si tu hybridization, to a cDΝA library prepared from total mRΝA in a cell sample derived from a host. If there is hybridization, the probe may be removed and the gene to which it hybridizes is sequenced to detect mutations.

The present invention also relates to an assay which demonstrates the biological activity of the hABH gene to protect against the effects of exposure to chemical mutagens and alkylating agents. An example of this type of assay comprises exposing three different groups of E. Coli cells to varying concentrations of an alkylating agent, for example MMS. One cell type is an HK81 strain of E. Coli which is wild-type for the alkB gene. Another cell type is an KH82 strain of E. Coli which is a mutant strain for the alkB gene. The third group is the HK82 strain which has been transfected with a vector containing the hABH gene. A survival percentage of these groups of E. Coli cells is then computed and the results are shown in Figure 2. It is clear from Figure 2 that the mutant strain (mt) had the lowest survival rate, while the wild-type (wt) strain had the highest survival rate. The results further show that the hABH gene was able to increase the survival rate of the mutant strain and, therefore, effectively protect against alkylating agents by repairing DΝA.

Alternatively, mammalian cells may be employed wherein cells which are wild-type and mutant for the alkB gene may be used. The mutant strain may then be transfected with the hABH gene and percentage of surviving cells calculated. In another embodiment, knock-out mice may be employed wherein the alkB gene has been removed through genetic engineering techniques known to those of skill in the art.

The above-described assay could be used to identify agonist or antagonist compounds. An example of such an assay comprises preparing groups of cells, E. Coli or mammalian, wherein one group is wild-type and the other group is mutant for the alkB gene. The cells are then exposed to the varying amounts of MMS as above. However, in this assay compounds are added to the reaction and the ability of the compound to increase or decrease the survival rate of the mutant strain could then be determined using an assay performed in the absence of any compounds as a control.

Example of potential antagonists to hABH include antibodies, or in some cases an oligonucleotide, which binds to the hABH to eliminate its function. Potential antagonists also include proteins closely related to hABH such that they recognize and bind to the damaged bases of the DNA but do not repair them.

Another potential antagonist includes an antisense construct prepared using antisense technology. Antisense technology can be used to control gene t-xpression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DΝA or RΝA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DΝA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Νucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production of hABH. The antisense RNA oligonucleotide hybridizes to the mRΝA in vivo and blocks translation of the mRNA molecule into the hABH (antisense - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotideε as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of hABH.

Potential antagonists also include small molecules which bind to and occupy the effective site of the hABH polypeptide such that it is inaccessible to damaged DNA. Examples of small molecules include but are not limited to small peptides or peptide like molecules.

The antagonists may be employed to specifically target tumor cells and prevent hABH from repairing the DNA of the tumor cell so that the result of chemotherapy with alkylating agents is not offset. However, it is desirable for normal cells to have the alkylated bases repaired by hABH, therefore, the above antagonists are only effective if specifically targeted to tumor cells, or other cells which are the object of chemotherapy. The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.

The polypeptides and agonists and antagonists may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipien . Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds.

The pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. Pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, the pharmaceutical compositions will be administered in an amount of at least about 10 μg/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 μg/kg to about l mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.

The hABH polypeptides and agonists or antagonists may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."

Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide. Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.

Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.

Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 500 or 600 bases,- however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. FISH requires use of the clones from which the gene was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good results a reasonable percentage of the time. For a review of this technique, see Verma et al . , Human Chromosomes: a Manual of Basic Techniques, Pergamon Presε-, New York (1988) . The hABH gene of the present invention has been mapped to human chromosome 14q 24-31.

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library) . The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes) .

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .

The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al. , 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention.

The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.

In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.

"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used aε would be known to the ordinarily skilled artisan. For analytical purposes, typically l μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37'C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980).

"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatiε, T. , et al., Id., p. 146) . Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units ^o T4 DNA ligaεe ("ligase") per 0.5 μg of approximately equimolar amounts of the DNA fragments to be ligated.

Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A. , Virology, 52:456-457 (1973) .

Example 1 Bacterial Expression and functional complementation of hABH The DNA sequence encoding for hABH, ATCC # 75855, is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the hABH protein. The 5' oligonucleotide primer has the sequence 5' GCGCGTCGACATGTGTCTTCTGTCAGTG contains a Sail restriction enzyme site (underlined) followed by 18 nucleotides of hABH coding sequence starting from the presumed N-terminal amino acid of the protein codon. The 3' primer has the sequence 5' GCGCAAGCTTTCATCCAGATGGCAGAAACC 3' contains complementary sequences to a Hindlll site (underlined) and is followed by 20 nucleotides of hABH. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311) . pQE-9 encodes antibiotic resistance

(Amp^r) , a bacterial origin of replication (ori) , an IPTG- regulatable promoter operator (P/O) , a ribosome binding site

(RBS) , a 6-His tag and restriction enzyme sites. pQE-9 was then digested with Sail and Hindlll. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture was then used to transform E. coli mutant strain HK82 by the procedure described in Sambrook, J. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) . Transformants are identified by their ability to grow on LB plates and ampicillm resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis.

The AlkB mutant strain of HK82 was then examined for its ability to complement an AlkB mutant. Wild-type E. Coli strain HK81 harboring the pQE-9 vector and mutant E. Coli strain HK82 containing the vector pQE-9hABH were grown to 2 x 10" cells per milliliter in LB ampicillin medium at 37 degrees C. The cells were then diluted with M9 salts, and plated on LB ampicillin plates containing 0, 0.001, 0.02, and 0.03% of MMS. The plates were incubated at 37 degree C overnight. The results are depicted in Figure 2.

Example 2 Expression of Recombinant hABH in COS cells The expression of plasmid, hABH HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire hABH precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767) . The infusion of HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

The plasmid construction strategy is described aε follows:

The DNA sequence encoding for hABH, ATCC # 75855, was constructed by PCR on the original EST cloned using two primers: the 5' primer 5' GCGCAAGCTTATGTGTCTTCTGTCAGTG 3' contains a Hindlll site (underlined) followed by 18 nucleotides of hABH coding sequence starting from the initiation codon,- the 3' primer sequence 5'GCGCGAATTCTCAAGCG TAGTCTGGGACGTCGTATGGGTATCCAGATGGCAGAAACC 3' contains an EcoRI site, complementary sequences to a translation stop codon, HA tag and the last 17 nucleotides of the hABH coding sequence (not including the stop codon) . Therefore, the PCR product contains a Hindlll site, hABH coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an EcoRI site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, were digested with Hindlll and EcoRI restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment. For expression of the recombinant hABH, COS cells were transfected with the expression vector by DEAE-DEXTRAN method. (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)) . The expression of the hABH HA protein was detected by radiolabelling and immunoprecipitation method. (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press,

(1988)) . Cells were labelled for 8 hours with ³⁵S-cysteine two days post transfection. Culture media were then collected and cells were lysed with detergent (RIPA buffer

(150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5) . (Wilson, I. et al. , Id. 37:767 (1984)) . Both cell lysate and culture media were precipitated with a HA specific monoclonal antibody. Proteins precipitated were analyzed on 15% SDS-PAGE gels.

Example 3 Expression pattern of hABH in human tissue

Northern blot analysis was carried out to examine the levels of expression of hABH in human tisεueε. Total cellular RNA samples were isolated with RNAzol™ B system (Biotecx Laboratories, Inc. 6023 South Loop East, Houston, TX 77033) . About lOμg of total RNA isolated from each human tissue specified was separated on 1% agarose gel and blotted onto a nylon filter. (Sambrook, Fritsch, and Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)) . The labeling reaction was done according to the Stratagene Prime- It kit with 50ng DNA fragment. The labeled DNA was purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303) . The filter was then hybridized with radioactive labeled full length hABH gene at 1,000,000 cpm/ml in 0.5 M NaP0₄, pH 7.4 and 7% SDS overnight at 65°C. After wash twice at room temperature and twice at 60'C with 0.5 x SSC, 0.1% SDS, the filter was then exposed at -70'C overnight with an intensifying screen. The message RNA for hABH is abundant in thy us, testis, gall bladder, liver, prostate, heart and placenta.

Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: WEI, ET AL.

(ii) TITLE OF INVENTION: hABH

(iii) NUMBER OF SEQUENCES: 2

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,

CECCHI, STEWART & OLSTEIN

(B) STREET: 6 BECKER FARM ROAD

(C) CITY: ROSELAND

(D) STATE: NEW JERSEY

(E) COUNTRY: USA

(F) ZIP: 07068

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 3.5 INCH DISKETTE

(B) COMPUTER: IBM PS/2

(C) OPERATING SYSTEM: MS-DOS

(D) SOFTWARE: WORD PERFECT 5.1

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE: Concurrently

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA

(A) APPLICATION NUMBER:

(B) FILING DATE: (Viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: FERRARO, GREGORY D.

(B) REGISTRATION NUMBER: 36,134

(C) REFERENCE/DOCKET NUMBER: 325800-214

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 201-994-1700

(B) TELEFAX: 201-994-1744

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 1953 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS : SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

GGGAAGATGG CAGCGGCCGT GGGCTCTGTG GCGACTCTGG CGACTGAGCC CGGGGAGGAC 60

GCCTTTCGGA AACTTTTCCG CTTCTACCGT CAGAGCCGGG CCCGGGACCG CAGACCTGGA 120

AGGGGTCATC GACTTCTCGG CGGCCCACGC AGCCCGTGCA AGGGTCCTGG TGCCCAAAAG 180

GTGATCAAAT CTCAGCTAAA TGTGTCTTCT GTCAGTGAGC AGAATGCATA TAGAGCAGGT 240

CTTCAGCCCG TCAGCAAGTG GCAAGCCTAT GGACTCAAAG GCTATCCTGG GTTTATTTTT 300

ATCCCAAACC CCTTCCTCCC AGGTTACCAG TGGACACTGG GTGAAACAGT GCCTTAAGTT 360

ATATTCCCAG AAACCTAATG TATGTAACCT GGACACACAC ATGTCTAAAG AAGAGACCCA 420

AGATCTGTGG GAACAGAGCA AAGAGTTCCT GAGGTATAAA GAAGCGACTA AACGGAGACC 480

CCGAAGTTTA CTGGAGAAAC TGCGTTGGGT GACCGTAGGC TACCATTATA ACTGGGACAG 540

TAAGAAATAC TCAGCAGATC ATTACACACC TTTCCCTTCT GACCTGGGTT TCCTCTCAGA 600

GCAAGTAGCC GCTGCCTGTG GATTTGAGGA TTTCCGAGCT GAAGCAGGGA TCCTGAATTA 660

CTACCGCCTG GACTCCACAC TGGGAATCCA CGTAGACAGA TCTGAGCTAG ATCACTCCAA 720

ACCCTTGCTG TCATTCAGCT TTGGACAGTC CGCCATCTTT CTCCTGGGTG GTCTTCAAAG 780

GGATGAGGCC CCCCCGCCCA TGTTTATGCA CAGTGGTGAC ATCATGATAA TGTCGGGTTT 840

CAGCCGCCTC TTGAACCACG CAGTCCCTCG TGTCCTTCCA AATCCAGAAG GGGAAGGCCT 900

GCCTCACTGC CTAGAGGCAC CTCTCCCTGC TGTCCTCCCG AGAGATTCAA TGGTAGAGCC 960 TTGTTCTATG GAGGACTGGC AGGTGTGTGC CAGCTACTTG AAGACCGCTC GTGTTAACAT 1020

GACTGTCCGA CAGGTCCTGG CCACAGACCA GAATTTCCCT CTAGAACCCA TCGAGGATGA 1080

AAAAAAGAGA CATCAGTACA GAAGGTTTCT GCCATCTGGA TGACCAGAAT AGCGAAGTAA 1140

AACGGGCCAG GATAAACCCT GACAGCTGAG ACTTGGAGAT CCCATCCTTT TTACTCAGGC 1200

ACCTGCTTAC CGTAAATGAT CATGTTATTG TGTATTGCCG TGGACTTCAG CACCCAGACA 1260

AGCCAAAAAC AGAGACAGGG AAGAACTCAT TGTTGATCAC ACTGTTGCCT TGGAACCCAC 1320

GCAGAAGTAA ACTCATCCAC TTTGCTCAGA GAAGTGTTTG ACATGGTCTG TTCCTAGTTA 1380

CATGTTGGCT GTAATGTATG TTGAGAAGTC AGTCCAAGGA GGTATGTTCT TCCACAACAG 1440

CCTTCTCAGC CTCTGCTATT TCCTTTGAGG AAGGTAGAAG TGAGTTTCCA TGTTTGCAGA 1500

GTATTTAAAT ACCTCAGATT TTATTAATGA GAAATACAGT ACCCCTCCCT CCACTCCATC 1560

TGGTAATTTA TGGTAAAATT GTGGTTCTGT GAACCAGCTA TTAGTCTCAT CTTCTTAACT 1620

CCCTCAGGCA TCATCAAATT CTTTGATCTT CTCTTCCACC TCTCTGGCTC TCATGGAAGA 1680

ATCCTTTACA CATGAAAACA ATGGAACTGG AAAATCTTGT CTTTTAGAAA AGAAATTAAT 1740

CACAACTATC TCTCTTGCCT AAAAGATAAA TATAGGTAAA CCCAAGGAAA GGGGAATTTA 1800

GTTTCTCTAC ATGTCATTTC GGTCTCCAAA CTCCCTGTTG GCTTTTTAAT GCAATTTTAA 1860

TTGTTGGAAT AAAAAAGTCC CAAGGGTGTT TTGTTACTGT TTTCTCCATG AATAAACTCA 1920

CTTGATTTTA AAAAAAAAAA AAAAAAAAAA AAA 1953

(2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS

(A) LENGTH: 307 AMINO ACIDS

(B) TYPE: AMINO ACID

(C) STRANDEDNESS:

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: PROTEIN

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Cys Leu Leu Ser Val Ser Arg Met His lie Glu Gin Val Phe

5 10 15

Ser Pro Ser Ala Ser Gly Lys Pro Met Asp Ser Lys Ala lie Leu

20 25 30

Gly Leu Phe Leu Ser Gin Thr Pro Ser Ser Gin Val Thr Ser Gly

35 40 45

His Trp Val Lys Gin Cys Leu Lys Leu Tyr Ser Gin Lyε Pro Aεn

50 55 60 Val Cys Asn Leu Asp Thr His Met Ser Lys Glu Glu Thr Gin Asp

65 70 75

Leu Trp Glu Gin Ser Lys Glu Phe Leu Arg Tyr Lys Glu Ala Thr

80 85 90

Lys Arg Arg Pro Arg Ser Leu Leu Glu Lys Leu Arg Trp Val Thr

95 100 105

Val Gly Tyr His Tyr Asn Trp Asp Ser Lys Lys Tyr Ser Ala Asp

110 115 120

His Tyr Thr Pro Phe Pro Ser Asp Leu Gly Phe Leu Ser Glu Gin

125 130 135

Val Ala Ala Ala Cys Gly Phe Glu Asp Phe Arg Ala Glu Ala Gly

140 145 150 lie Leu Asn Tyr Tyr Arg Leu Asp Ser Thr Leu Gly lie His Val

155 160 165

Asp Arg Ser Glu Leu Asp His Ser Lys Pro Leu Leu Ser Phe Ser

170 175 180

Phe Gly Gin Ser Ala lie Phe Leu Leu Gly Gly Leu Gin Arg Asp

185 190 195

Glue Ala Pro Pro Pro Met Phe Met His Ser Gly Asp lie Met lie

200 205 210

Met Ser Gly Phe Ser Arg Leu Leu Asn Hiε Ala Val Pro Arg Val

215 220 225

Leu Pro Asn Pro Glu Gly Glu Gly Leu Pro His Cys Leu Glu Ala

230 235 240

Pro Leu Pro Ala Val Leu Pro Arg Asp Ser Met Val Glu Pro Cys

245 250 255

Ser Met Glu Asp Trp Gin Val Cys Ala Ser Tyr Leu Lys Thr Ala

260 265 270

Arg Val Asn Met Thr Val Arg Gin Val Leu Ala Thr Asp Gin Asn

275 280 285

Phe Pro Leu Glu Pro lie Glu Asp Glu Lys Lys Arg His Gin Tyr

290 295 300

Arg Arg Phe Leu Pro Ser Gly

305

Claims

WHAT IS CLAIMED IS:

1. An isolated polynucleotide selected from the group consisting of :

(a) a polynucleotide encoding the hABH polypeptide having the deduced amino acid sequence of Figure l or a fragment, analog or derivative of said polypeptide;

(b) a polynucleotide encoding the hABH polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75855 or a fragment, analog or derivative of said polypeptide.

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 1 wherein the polynucleotide is RNA.

4. The polynucleotide of Claim 1 wherein the polynucleotide is genomic DNA.

5. The polynucleotide of Claim 2 wherein said polynucleotide encodes hABH having the deduced amino acid sequence of Figure 1.

6. The polynucleotide of Claim 2 wherein said polynucleotide encodes the hABH polypeptide encoded by the cDNA Of ATCC Deposit No. 75855.

7. The polynucleotide of Claim 1 having the coding sequence of hABH as shown in Figure 1.

8. The polynucleotide of Claim 2 having the coding sequence of hABH deposited as ATCC Deposit No. 75855.

9. A vector containing the DNA of Claim 2.

10. A hoεt cell genetically engineered with the vector of Claim 9.

11. A process for producing a polypeptide comprising: expressing from the host cell of Claim 10 the polypeptide encoded by said DNA.

12. A process for producing cells capable of expressing a polypeptide comprising genetically engineering cells with the vector of Claim 9.

13. An isolated DNA hybridizable to the DNA of Claim 2 and encoding a polypeptide having hABH activity.

14. A polypeptide selected from the group consisting of (i) a hABH polypeptide having the deduced amino acid sequence of Figure 1 and fragments, analogs and derivatives thereof and (ii) a hABH polypeptide encoded by the cDNA of ATCC Deposit No. 75855 and fragments, analogs and derivatives of said polypeptide.

15. The polypeptide of Claim 14 wherein the polypeptide is hABH having the deduced amino acid sequence of Figure 1.

16. An antibody against the polypeptide of claim 14.

17. An antagonist against the polypeptide of claim 14.

18. A method for the treatment of a patient having need of hABH comprising: administering to the patient a therapeutically effective amount of the polypeptide of claim 14.

19. A method for the treatment of a patient having need to inhibit hABH comprising: administering to the patient a therapeutically effective amount of the antagonist of Claim 17.

20. A pharmaceutical composition comprising the polypeptide of Claim 14 and a pharmaceutically acceptable carrier.

21. The method of Claim 18 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expressing said polypeptide in vivo.

22. A process for determining a susceptibility to mutation of DNA in a host comprising: identifying a mutation in the hABH polynucleotide sequence derived from the host.