JP2002020313A - Human dna topoisomerase i-alpha - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a human hTopI-α polypeptide and a DNA (RNA) encoding the human hTopI-α polypeptide. SOLUTION: This human hTopI-α polypeptide and this DNA (RNA) encoding the human hTopI-α polypeptide are obtained. This method for producing the polypeptide by a recombination technique is provided. An antibody and an antagonist/inhibitor against the polypeptide are obtained. This method for using the antibody and the antagonist/inhibitor for inhibiting the action of hTopI-α for treatment with an antitumor agent, etc., detecting an autoimmune disease or a retrovirus infection and treating adenocarcinoma is also provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, and the production of such polynucleotides and polypeptides. More specifically, the polypeptide of the present invention is human DNA topoisomerase I-alpha (hTopI-α). The invention also relates to inhibiting the action of such polypeptides.

[0002] DNA topoisomerases I and II are D
DN in a way that allows the NA chains to pass each other
It catalyzes the cleavage and recombination of the A-strand, altering the topology of the DNA. Type I topoisomerase has 2
It recognizes single-stranded DNA, but only breaks one strand in the process of relaxing the DNA. On the other hand, type II enzymes cut both strands of double-stranded DNA. Both enzymes can perform various similar topological interconversions, including relaxing supercoiled DNA, tying and unwinding double-stranded DNA, and tying and cutting. Topoisomerase I is ATP independent,
On the other hand, topoisomerase II requires energy.

[0003] Topoisomerases I and II are both
Topological interconversions required for transcription and replication can be provided. For example, topoisomerase I can provide the necessary breaking activity for efficient in vitro DNA replication (Minden et al., J. Biol. Ch.
em. 260: 9316 (1985)). However, topoisomerase II can also promote the replication of SV40 DNA by Hela cell lysates (Yang et al., Proceedings
f the National Academy of Sciences, US
A., 84: 950 (1987)). Genetic studies in yeast have shown that both replication and transcription proceed in a single mutant lacking either topoisomerase I or II (Goto et al., Proceeding of the
National Academy of Sciences, USA,
82: 7178 (1985)). Transcription and replication are dramatically reduced in cells lacking both topoisomerases (Uemur
a, et al., EMBO Journal, 5: 1003 (198
6)).

Several lines of evidence suggest that topoisomerase I normally functions during transcription. The preferential localization of the enzyme in places where it is actively transcribed is determined by immunofluorescence (Fleishmann et al., Proceedings of the
National Academy of Sciences, USA, 8
1: 6958 (1984)) and by co-immunoprecipitation with transcribed DNA (Gilmore et al., Cell, 44:40).
1 (1986)). In addition, topoisomerase cleavage sites have been mapped to regions in and around the transcribed DNA (Bonner et al., Cell, 41: 541 (19).
85)). Nevertheless, at least in yeast, topoisomerase II does not
Obviously you can take the place of the feature.

[0005] While all cells use topoisomerase I and II for transcription and replication, cells with large amounts of transcription and replication, such as cancer cells, have much higher topoisomerase I and II concentrations.

[0006] Topoisomerase I has been used to classify autoimmune diseases. Autoimmune diseases are diseases in which the immune system of an animal attacks its own tissues. Often, various types of autoimmune diseases can be characterized based on the specificity of the autoantibodies produced. It is well known that the sera of patients with, for example, a connective tissue autoimmune disease, progressive systemic sclerosis (also known as scleroderma) often contain antibodies to nucleus antigens such as topoisomerase I. Thus, the ability to accurately detect the presence of antibodies reactive with topoisomerase I can greatly help assess or monitor the prognosis and regimen of appropriate treatment for patients with scleroderma.

3645 base pairs of human topoisomerase I
cDNA clone and cDNA encoding a protein with phenylalanine at position 723 instead of tyrosine
Mutants of NA are overexpressed 2-5 fold in stably transfected baby hamster kidney cells. The results of this overexpression indicate that tyrosine 723 is essential for enzymatic activity, consistent with the prediction based on homology comparison with the yeast enzyme that it is the active site tyrosine in human topoisomerase I (Madden, K. .R. And Ch
ampoux, JJ, Cancer Research, 52: 525
532 (1992)).

CD coding for human topoisomerase I
NA clones have also been isolated from expression vector libraries screened with autoimmune anti-topoisomerase I serum. The sequence data shows that the catalytically active 67.7
The KDa fragment is shown to consist of the carboxyl terminus (D'Arpa, P. et al., Proc. Natl. Acad. Sci.
U.S.A., 85: 2543-2547 (1988)).

[0009] cDNA molecules encoding eukaryotic topoisomerase I polypeptides encoding at least one epitope for an autoantibody to eukaryotic topoisomerase I, and cloning vehicles capable of expressing these cDNA molecules, are disclosed in US Pat. 070,19
No. 2.

According to one aspect of the present invention, there is provided a novel mature polypeptide that is hTopI-α, and fragments, analogs and derivatives thereof. The polypeptides of the present invention are of human origin.

According to another aspect of the present invention, there is provided a polynucleotide (DNA or RNA) encoding such a polypeptide.

According to a further aspect of the present invention there is provided a method for producing such a polypeptide by recombinant techniques.

According to a further aspect of the present invention, there are provided antibodies against such polypeptides, which antibodies may be used diagnostically to detect cancer and autoimmune diseases.

According to a further aspect of the present invention there are provided antagonists / inhibitors for such polypeptides, for example inhibiting the action of such polypeptides as antitumor agents, detecting autoimmune diseases, It can be used therapeutically to treat adenocarcinoma of the colon and retroviral infections.

[0015] These and other aspects of the invention will be apparent to those skilled in the art from the teachings herein.

The following figures are illustrative of embodiments of the invention and do not limit the scope of the invention which is encompassed by the claims.

1 to 8 show the cDNA of hTopI-α and the corresponding deduced amino acid sequence. The polypeptide encoded by the amino acid sequence shown is the mature form of the polypeptide. The standard one letter abbreviation for amino acids is used.

FIGS. 9-11 show hTop at the amino acid level.
3 shows a comparison of I-α and human topoisomerase I. The upper line is hTopI-α.

According to one aspect of the present invention, encoded by the cDNA of the mature polypeptide having the deduced amino acid sequence of FIGS. 1-8, or the clone deposited as ATCC Deposit No. 75714 on Mar. 18, 1994. An isolated nucleic acid (polynucleotide) encoding the mature polypeptide to be provided is provided.

[0020] The polynucleotide encoding the polypeptide of the present invention was obtained from a fetal brain cDNA library. It is homologous to human topoisomerase I. It has an open reading frame encoding a protein of about 601 amino acid residues (open reading frame), which is structurally related to human DNA topoisomerase I, has 86% similarity and 70% identity at the amino acid level Is shown. In addition, hTopI-α shows 83% similarity and 67% identity to human topoisomerase I as shown by D'Arpa et al.

The polynucleotide of the present invention may be in the form of RNA or DNA (the DNA may be cDNA, genomic DN).
A and synthetic DNA). The DNA is 2
It may be single-stranded or single-stranded, and if single-stranded may be the coding strand or non-coding (antisense) strand. The coding sequence encoding the mature polypeptide may be identical to the coding sequence shown in FIGS. 1-8 or the sequence of the deposited clone, or the DNA of FIGS. 1-8 as a result of duplication or degeneracy of the genetic code. Alternatively, it may be a different coding sequence encoding the mature polypeptide, the same as the deposited cDNA. .

The polynucleotide encoding the mature polypeptide of FIGS. 1-8 or the mature polypeptide encoded by the deposited cDNA may be only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and the leader or secretory sequence. Or an additional coding sequence such as a protein sequence; the coding sequence of the mature polypeptide (and optionally additional coding sequence) and the non-coding sequence 5 'of the coding sequence of the intron or mature polypeptide.
And / or non-coding sequences such as 3 '.

The term "polynucleotide encoding a polypeptide" encompasses polynucleotides that contain only the coding sequence of the polypeptide, as well as polynucleotides that contain additional coding and / or non-coding sequences.

The present invention encodes a polypeptide having the deduced amino acid sequence of FIGS. 1-8 (SEQ ID NO: 2), or fragments, analogs and derivatives of the polypeptide encoded by the cDNA of the deposited clone.
It further relates to variants of the polynucleotides described above.
A variant of the polynucleotide can be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Accordingly, the present invention relates to cDNAs of the same mature polypeptides or deposited clones as shown in FIGS.
As well as variants of such polynucleotides, wherein the variants comprise the polypeptides of FIGS. 1-8 or the cD of the deposited clone.
A fragment of the polypeptide encoded by NA,
Derivative or analog coding. Such nucleotide variants include deletion variants, substitution variants, and addition or insertion variants.

As indicated above, the polynucleotide may have a coding sequence that is a naturally occurring allelic variant of the coding sequence shown in FIGS. 1-8 or of the deposited clone. . As is known to those of skill in the art, an allelic variant has one or more nucleotide substitutions, deletions or additions, and is an alternative form of a polynucleotide sequence that does not substantially alter the function of the encoded polypeptide. is there.

[0027] The polynucleotide of the present invention may include (i) a marker sequence within a marker sequence which allows for purification of the polypeptide of the present invention.
n frame) can also have fused coding sequences. The marker sequence may be a hexahistidine tag provided by a pQE-9 vector to aid in the purification of the mature polypeptide fused to the marker in the case of a bacterial host, and may be a mammalian host, such as a COS-7 cell. When is used, the marker sequence may be a hemagglutinin (HA) tag. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I et al., C
ell, 37: 767 (1984)).

The present invention further relates to polynucleotides which hybridize to the above sequences if there is at least 50%, preferably 70%, identity between the sequences.
The invention particularly relates to polynucleotides that hybridize to the above-described polynucleotides under stringent conditions. As used herein, “stringent conditions” means that hybridization occurs only when there is at least 95%, preferably at least 97%, identity between the sequences. Polynucleotides that hybridize to the above-described polynucleotides in a preferred embodiment,
Or a polypeptide that retains substantially the same biological function or activity as the mature polypeptide encoded by the deposited cDNA.

The deposit referred to herein will be maintained under the terms of the Putapest Treaty on International Recognition of the Deposit of Microorganisms for Patent Procedure. These deposits are made solely for the convenience of the person skilled in the art;
Not an admission that it is required under U.S.C. §112. The sequence of the polynucleotide contained in the deposited material, and the amino acid sequence encoded thereby, form a part of the present specification and will be referred to in case of conflict with the description of the sequence herein. Making, using, or selling the deposit requires a license, and such license is not granted herein.

The present invention further relates to hTopI-α polypeptides having the deduced amino acid sequence of FIGS. 1-8 or the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptides. The terms “fragment,” “derivative,” and “analog” when referring to the polypeptide of FIGS. 1-8 or the polypeptide encoded by the deposited cDNA refer to substantially the same biology as such polypeptide. Refers to a polypeptide that retains a specific function or activity. Thus, analogs include proproteins that are activated by cleavage of the proprotein portion to produce an active mature polypeptide.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, and is preferably a recombinant polypeptide.

The polypeptide of FIGS. 1 to 8 or the deposited
Fragments, derivatives or analogs of a polypeptide encoded by a cDNA may include (i) one or more amino acid residues that are conserved or non-conserved.
(Preferably the same amino acid residue), and such a substituted amino acid residue may or may not be encoded by the genetic code, (ii ) One or more amino acid residues comprising a substituent, or (iii) a mature polypeptide fused to another compound such as a compound that increases the half-life of the polypeptide (e.g., polyethylene glycol); Or (iv) additional amino acids may be fused to the mature polypeptide, such as a leader or secretory sequence or a sequence used to purify the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are considered to be within the skill of the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the material has been removed from its original environment (eg, the natural environment if it is natural). For example, a natural polynucleotide or polypeptide present in a living animal has not been isolated, but the same polynucleotide or DNA or polypeptide has been separated from some or all of the coexisting materials in the natural system. If so, it has been isolated. In that such a polynucleotide or polypeptide may be part of a vector, and / or such a polynucleotide or polypeptide may be part of a composition, and such vector or composition is not part of its natural environment. It has been isolated.

The present invention also relates to vectors containing the polynucleotides of the present invention, host cells genetically engineered with vectors of the present invention, and the production of polypeptides of the present invention by recombinant techniques.

For example, a host cell can be genetically engineered (transduced, transformed, or transfected) with a vector of the invention, which can be a cloning vector or an expression vector. Vectors can be, for example, plasmids, viral particles, phages, and the like. The engineered host cell activates the promoter, selects for transformants, or provides hTopI-
It can be cultured in a conventional nutrient medium that has been modified to be suitable for amplifying the α gene. Culture conditions, such as temperature, pH, etc., have been used previously for the host cell selected for expression and will be apparent to those skilled in the art.

The polynucleotides of the present invention can be used to produce peptides by recombinant techniques. Thus, for example, the polynucleotide can be included in any of a variety of polypeptide expression vectors. Such vectors contain chromosomal, non-chromosomal and synthetic DNA sequences such as S
V40 derivatives, bacterial plasmids, phage DNA,
Includes baculovirus, yeast plasmid, vectors in which the plasmid is combined with phage DNA, and viral DNA such as vaccinia, adenovirus, fowlpox virus, and pseudorabies. However, any other vector can be used as long as they are replicable and viable in the host.

[0038] The appropriate DNA sequence may be inserted into the vector by a variety of methods. Generally, the DNA sequence is inserted into an appropriate restriction endonuclease site by methods known in the art. Such methods and the like are considered to be within the purview of those skilled in the art. The DNA sequence in the expression vector is operably linked to an appropriate expression control sequence (promoter) and
A synthesis is performed. Representative examples of such promoter, LTR or SV40 promoter, E. coli
include lac or trp, the phage lambda P _L promoter, and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation and transcription termination. The vector may also include appropriate sequences for amplifying expression.

[0039] Further, the expression vector, in the case of eukaryotic cell culture dihydrofolate reductase or neomycin resistance, E. It preferably contains one or more selectable marker genes that provide phenotypic characteristics for selection of transformed host cells, such as tetracycline or ampicillin resistance in E. coli .

Using a vector containing the above-described appropriate DNA sequence and an appropriate promoter or control sequence, an appropriate host is transformed, and the protein is expressed in the host.

[0041] Representative examples of appropriate hosts, E. col
i , Streptomycos , bacterial cells such as Salmonella typhimurium , fungal cells such as yeast, insect cells such as Drosophila and Sf9 , animal cells such as CHO, COS or Bowes melanoma, and plant cells. The selection of an appropriate host is deemed to be within the skill of the art in light of the teachings herein.

More specifically, the present invention also includes a recombinant construct comprising one or more of the sequences broadly described above. The construct comprises a vector, such as a plasmid or viral vector, into which the sequence of the invention has been inserted in the forward or reverse orientation. In this preferred embodiment, the construct further comprises control sequences, including for example, a promoter operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are given as examples. For bacteria: pQE7
0, pQE60, pQE-9 (Qiagen), pbS, pD10,
Phage script, psiX174, pbluescriptSK,
pbsks, pNH8A, pNH16a, pNH18a, pNH4
6A (Stratagene); ptrc99A, pKK223-3, p
KK233-3, pDR540, pRIT5 (Pharmaci
a). For eukaryotes: pWLNEO, pSV2CAT, pOG
44, pXT1, pSG (Stratagene), pSVK3, pB
PV, pMSG, pSVL (Pharmacia). However,
Any other plasmid or vector can be used as long as they are replicable and viable in the host.

The promoter region can be selected from any desired gene using a CAT (chloramphenicol transferase) vector or other vector having a selectable marker. Two suitable vectors are pKK
232-8 and pCM7. Individual named bacterial promoters are lacI, lacZ, T3, T7,
gpt, including the lambda _P R, _{P L} and trp. Eukaryotic promoters include CMV immediate, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

[0044] In a further aspect, the present invention relates to host cells containing the above constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into host cells can be accomplished by calcium phosphate transfection, DEAE-dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Bat.
tey, L., Basic Methods in Molecular Biolo
gy (1986)).

The construct in the host cell can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be produced synthetically on a conventional peptide synthesizer.

The mature protein can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of a suitable promoter. Such a protein can also be produced using a cell-free translation system and RNA derived from the DNA construct of the present invention. Suitable cloning and expression vectors for use in prokaryotic and eukaryotic hosts are
Ambrook et al., Molecular Cloning: A Laboratory
Manual, Part 2 (Cold Spring Harbor, New York, 1989). That disclosure forms a part of this specification.

Transcription of a DNA encoding a polypeptide of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers act on a promoter to increase its transcription, usually about 1
It is a cis-acting factor of 0-300 bp DNA. Examples include the SV40 enhancer (bp
100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancer.

In general, a recombinant expression vector has an origin of replication,
And a selectable marker that allows transformation of the host cell, such as E. coli . ampicillin resistance gene of coli, S. cerevisiae TRP1 gene, and promoters from highly expressed genes that direct transcription of downstream structural genes. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase, or heat shock proteins. The heterologous structural sequence is assembled in a suitable phase with translation initiation and termination sequences, and preferably a leader sequence capable of directing secretion of the translated protein into the periplasmic region or extracellular medium. In some cases, the heterologous sequence may provide N-terminal identity that confers desired characteristics, such as stabilization of the expressed recombinant product or simplified purification.
n) can encode a fusion protein comprising a peptide;

Useful expression vectors for use in bacteria are prepared by combining a structural DNA sequence encoding the desired protein, with appropriate translational initiation and termination signals, in an operable reading phase having a functional promoter.
It is constructed by inserting in e). The vector is 1
It comprises the above phenotype selectable marker and origin of replication, ensuring maintenance of the vector and, if desired, providing amplification inside the host. Suitable prokaryotic hosts for transformation, E. coli , Bacillus subtilis , Salmone
lla typhimurium , and genus Pseudomonas, Streptmyce
s, and various species within the genus Staphylococcus,
Others may be used as a matter of choice.

As a representative, but non-limiting example, useful expression vectors for use in bacteria include those derived from commercially available plasmids containing the genetic elements of the well-known cloning vector pBR322 (ATCC37017). It can include a selectable marker and a bacterial origin of replication. Such commercial vectors are, for example, p
KK223-3 (Pharmacia Fine Chemicals, Upp
sala, Sweden) and GEM1 (Promega Biote)
c, Madison, Wisconsin, USA)
The pBR322 "bone nucleus" portion is ligated with a suitable promoter and the structural sequence to be expressed.

After transformation of the appropriate host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (eg, temperature shift or chemical induction) and the cells are cultured for an additional period. I do. Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.

Microbial cells used for protein expression include:
Disruption can be by any conventional method, including freeze-thaw cycles, sonication, mechanical disruption or the use of cell lysing agents. Such methods are well-known to those skilled in the art.

Various mammalian cell culture systems can be used to express the recombinant protein. Examples of mammalian expression systems include the monkey kidney fibroblast COS-7 line described by Gluzman, Cell, 23: 175 (1981);
And other cell lines capable of expressing compatible vectors, such as C127, 3T3, CHO, Hela and BHK cell lines. The mammalian expression vector contains an origin of replication, an appropriate promoter and enhancer, any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcription termination sequences,
It will also include the non-transcribed sequence adjacent to the 5 '. DNA sequences derived from the SV40 splice and polyadenylation sites can be used to provide the necessary non-transcribed genetic elements.

The polypeptide may be prepared by ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and lectin chromatography. Can be recovered from the recombinant cell culture and purified. Optionally, a protein regeneration step may be used to complete the configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be used for the final purification step.

The polypeptides of the present invention may be natural, purified products, or products of chemical synthesis, or may be prokaryotic or eukaryotic hosts, such as bacteria, yeast,
(Higher plants, insects and mammalian cells). Depending on the host used in the recombinant production method, the polypeptide of the present invention can be glycosylated or not glucosylated. A polypeptide of the invention may include an initial methionine amino acid residue.

The polypeptides of the present invention are useful for identifying other molecules having similar biological activities. An example of this screening is to isolate the coding region of the hTopI-α gene by using a known DNA sequence and synthesize an oligonucleotide probe. Using labeled oligonucleotides having a sequence complementary to the sequence of the gene of the present invention, human cDNA, genomic DNA
Alternatively, a library of mRNA is screened to determine to which member of the library the probe hybridizes.

The present invention also provides a drug screening method for identifying a drug that specifically interacts with and binds to hTopI-α, the method comprising hTopI-α.
Contacting a mammalian cell comprising a DNA molecule encoding I-α with a number of agents to detect an agent that binds to the mammalian cell, thereby specifically interacting with and binding to hTopI-α Identifying the drug. Various detection methods can be used. The agent may be "labeled" by conjugation with a detectable marker substance (e.g., a radioactive label or a non-radioactive label such as biotin). Drug candidates were expressed in transfected cells using well-known radioligand binding methods.
Confirmation by selecting chemicals that bind with high affinity to TopI-α protein.

The sequences of the present invention are also valuable for chromosome identification. The sequence can be specifically targeted and hybridized to specific locations on individual human chromosomes. There is also a current need to identify specific sites on chromosomes. Currently available for marking chromosome locations,
Few chromosome marking reagents are based on actual sequence data (repeat polymorphism). Mapping of DNA to chromosomes according to the present invention is an important first step in relating these sequences to genes associated with disease.

Briefly, sequences are mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the cDNA is used to rapidly select primers that do not span one or more exons of the genomic DNA, complicating the amplification method. These primers are used in the somatic hybrids containing individual human chromosomes.
It is then used for CR screening. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

PCR mapping of somatic cell hybrids is a fast method of assigning specific DNA to specific chromosomes. Using the present invention with the same oligonucleotide primers, sublocalization can be performed in an analogous manner using a panel of fragments from a pool of specific chromosomes or large genomic clones. Other mapping strategies that can also be used to map to chromosomes are in situ hybridization, prescreening using labeled flow sorted chromosomes, and preselection by hybridization to construct a chromosome-specific cDNA library. including.

Fluorescence in situ hybridization (FIS) of cDNA clones to metaphase chromosome spreads
H) can be used to provide the exact chromosomal location in one step.
This technique can be used with cDNAs as short as 500-600 bases, but clones larger than 2000 bp have greater binding potential to unique chromosomal locations with sufficient signal intensity for easy detection. F
ISH requires the use of clones from which ESTs are derived, the longer the better. For example, 2000bp is good,
4000 is better and 4000 or more is good, perhaps not necessary to get a reasonable percentage of time. To review this technology, see Verma et al., Human
Chromosomes: a Manual of Basic Techniqne
s, Pergamon Press, New York (1988).

Once a sequence has been mapped to a precise chromosomal location, the physical location of that sequence on that chromosome can be associated with genetic map data. Such data is described, for example, in V.A. McKusick, Mendelian Inherit
ance in Man (available online via the Welch Medical Library at John Hopkins University)
Found inside. The relationship between the disease and the gene mapped to the same chromosomal region is then confirmed by binding analysis (coinheritance of physically adjacent genes).

According to current analysis of physical and genetic mapping, a cDNA correctly located in a chromosomal region associated with a disease can be one of 50-500 possible causative genes. (This assumes 1 megabase mapping resolution and 1 gene per 20 kb).

The polypeptides, their fragments or other derivatives, or their analogs, or the cells that express them, can be used as an immunogen to produce antibodies against them. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments or the products of a Fab expression library. Various methods known in the art may be used for the production of such antibodies and fragments.

Antibodies raised against a polypeptide corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptide into an animal, or by administering the polypeptide to an animal, preferably a non-human animal. Obtainable. The antibody thus obtained will bind to the polypeptide itself. In this way, even sequences encoding only fragments of the polypeptide can be used to generate antibodies that bind the entire native polypeptide. Such antibodies can then be used to isolate the polypeptide from tissues that express the polypeptide.

For preparing monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technology (Kohler and Milstein, 1975, Nature, 25
6: 495-497), trioma technology, human B cell hybridoma technology (Kozbor et al., 1983, Immunology).
Today 4:72), and EBV-hybridoma technology for producing human monoclonal antibodies (Cole et al., 1985, M.P.
During onoclonal Antibodies and Cancer Therapy,
Alan R. Liss, Inc. 77-96).

Techniques Described for the Production of Single Chain Antibodies
(U.S. Pat. No. 4,946,778) can be adapted to produce single-chain antibodies to the immunogenic polypeptide products of the invention.

The present invention relates to hTopI-α in a sample from a host.
It also relates to a diagnostic assay for measuring the concentration of An example of such an assay is an ELISA assay using an antibody, preferably a monoclonal antibody, specific for the hTopI-α antigen, which is conjugated to an indicator enzyme such as horseradish peroxidase to produce a highly specific antibody. To create a highly sensitive assay system. After binding the peroxidase-conjugated antibody to the antigen, peroxidase can be used to produce a colored product that can be measured and whose concentration is related to the amount of antigen in the sample. Due to the catalytic nature of the enzyme, the system greatly amplifies the signal. High levels of oxalyl-CoA decarboxylase represent cancer because certain human colon cancer cells have increased levels of hTopI-α. They also represent autoimmune diseases such as scleroderma, rheumatoid arthritis and AIDS-related syndrome.

[0069] Other examples of immunoassays that can be used to determine levels of antibodies to the polypeptides of the present invention are competitive and non-competitive immunoassays in a direct or indirect format. Examples are radioimmunoassays,
There are sandwich (immunometric) assays and Western blot assays. HTopI-α of the present invention
Detection of antibodies that bind to can be performed using immunoassays performed in a forward, reverse or simultaneous mode, including immunohistochemical assays on physiological samples. Regardless of the type of immunoassay used, the concentration of hTopI-α used can be readily determined by one skilled in the art using routine experimentation.

The hTopI-α of the present invention can be labeled, bound to a number of different carriers, and used to detect the presence of an antibody that specifically reacts with the polypeptide.
Examples of well-known carriers include glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylase, natural and modified cellulose, polyacrylamide, agarose and magnetite. The nature of the carrier can be either soluble or insoluble.

The present invention also relates to antagonist / inhibitor molecules of the polypeptide of the present invention, which can be used to reduce or eliminate the function of the polypeptide of the present invention.

Examples of antagonists are antibodies or, in some cases, oligonucleotides that bind to the hTopI-α polypeptide. Examples of inhibitors are small molecules that bind to and occupy the catalytic site of the polypeptide, thereby rendering the catalytic site inaccessible to the substrate, thereby inhibiting normal biological activity. Examples of small molecules include, but are not limited to, small peptides, or peptide-like molecules.

Another example of an inhibitor is an antisense construct that inhibits hTopI-α in vivo using antisense technology. Antisense technology can be used to control gene expression by triple helix formation or antisense DNA or RNA. Both methods are based on the binding of a polynucleotide to DNA or RNA. For example, the 5 'coding portion of a polynucleotide sequence encoding a mature polypeptide of the present invention is used to design an antisense RNA oligonucleotide of about 10-40 base pairs in length. DNA oligonucleotides are designed to be complementary to the region of the gene involved in transcription (triple helix, Lee et al., Nucl. Acids Res.,
6: 3073 (1979); Money et al., Science, 24.
1: 456 (1988); and Dervan et al., Science,
251: 1360 (1991)).
Inhibits I-α transcription and production. Antisense RN
The A oligonucleotide hybridizes to mRNA in vivo and blocks translation of the mRNA molecule into hTopI-α (Antisense-Okano, J. Neurochem., 5).
6: 560 (1991); Olgodeoxynucleotides as
Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Florida (198
8).

The specific inhibition of hTopI-α is dependent on the tumor cell DN
Antagonists / inhibitors can be used to treat tumors, as they will inhibit tumor cell growth by preventing A replication. The antagonist / inhibitor is hTopI-α
Can also be used to treat retroviral infections by inhibiting virus initiation and replication thereby. Antagonists / inhibitors may also be used to treat adenocarcinoma of the colon. This is because metastasis is prevented by interfering with the DNA transcription of cancer cells. The present invention provides hTop
It also relates to assays using hTopI-α to identify antagonists / inhibitors of I-α and / or human topoisomerase I. The DNA, hTopI-α and potential antagonist / inhibitor are combined under appropriate conditions for a time sufficient for hTopI-α to act on the single-stranded DNA. The DNA is then analyzed, for example, by gel electrophoresis and h
It can be determined whether TopI-α functions properly and in this way it can be determined whether an effective antagonist / inhibitor is present. Compounds of the invention, such as antagonists /
The inhibitors may be used in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the antagonist / inhibitor and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should suit the mode of administration.

The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical composition of the present invention. Such containers may carry a notice in the form provided by governmental authorities that regulate the manufacture, use, and sale of the pharmaceutical or biological product, which notice may include manufacturing instructions for human administration. Represents the approval of the use or sale by the relevant bureau. Further, the polypeptides of the present invention may be used in combination with other therapeutic compounds.

Pharmaceutical compositions may contain hTopI- if its action leads to undesirable conditions, such as retroviral infection.
An amount effective to effectively prevent α from promoting DNA transcription and replication can be administered.

The present invention will be further described by the following examples. However, it should be understood that the invention is not limited to such an embodiment. All parts or amounts are by weight unless otherwise indicated.

Some frequently used methods and / or terms are described to facilitate understanding of the following examples.

"Plasmids" are designated by a preceding p and / or a capital letter and / or number. Starting plasmids are commercially available and publicly available without limitation, or can be constructed from available plasmids according to published methods. Plasmids equivalent to those further described are known in the art and will be apparent to those skilled in the art.

“Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only on certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to one of skill in the art. For analytical purposes, typically 1 μg of plasmid or DNA
The fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically
g of DNA is digested with 20-250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for the individual restriction enzymes are specified by the manufacturer. An incubation time of about 1 hour at 37 ° C. is typically used, but may be varied according to the supplier's instructions. After digestion, the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment. Separation according to the size of the cleaved fragments is described by Goeddel, D, et al.
s. 8: 4057 (1980).

"Ligation" refers to the step of forming a phosphodiester bond between two double-stranded nucleic acid fragments (Maniatis, T. et al., Ibid., P. 146). Unless otherwise stated, ligation was performed with 10 units of T4 DNA per 0.5 μg of approximately equivalent DNA to be ligated.
This can be done using known buffers and conditions with ligase ("ligase").

Unless otherwise stated, transformations were performed according to Graham, F and Van der Eb, A, Virolo.
gy, 52: 456-457 (1973).

[0083]

EXAMPLES Example 1 Expression of a recombinant hTopI-α expression plasmid, pcDNAtopI HA, in COS cells was examined using 1) SV4
0 origin of replication, 2) ampicillin resistance gene, 3) E.col
4) derived from the vector pcDNAI / Amp (Invitrogen) containing the CMV promoter followed by a polylinker region, the SV40 intron, and a polyadenylation site. A DNA fragment encoding the entire hTopI-α precursor and an HA tag fused in frame to the 3 ′ end were cloned into the polylinker region of the vector. Therefore recombinant protein expression is CMV
Directed by a promoter. The HA tag corresponds to an epitope derived from the previously described influenza hemagglutinin protein (I. Wilson, H. Ni).
man, R.S. Heighten, A.S. Cherenson, M .; Connolly
And R. Lerner, 1984, Cell 37, 76
7). When the HA tag is fused to our target protein,
Facilitates detection of the recombinant protein by an antibody that recognizes the HA epitope.

The plasmid construction strategy is as follows.
Expression plasmid pcDNATop encoding hTopI-α
I-α ATCC # 75714 was constructed by PCR with pBLTopI-α using the following two primers: 5 ′ primer 5′-CGGGATCCATGCCG
CGTGGTGCGG-3 'contains 15 nucleotides of the HhTopI-α coding sequence starting from the bAM hi site and the subsequent initiation codon; 3' sequence 5'-CGCT
CTAGATCAAGCGTAGTCTGGGACGT
CGTATGGGTAGAATTCAAAGTCTTC
TCC-3 'contains a sequence complementary to the XbaI site, a translation stop codon, an HA tag, and the last 18 nucleotides of the hTopI-α coding sequence (not including the stop codon).

The PCR product therefore contains a Bam HI site, an active hTopI-α coding sequence, followed by an HA tag fused in frame, a translation stop codon next to the HA tag, and an XbaI site. DN amplified by PCR
A fragment and vector, pcDNAI / Amp to B
Digested with amHI and XbaI restriction enzymes and ligated. The ligation mixture was added to E. coli. coli strain SURE
(Stratagene Cloning Systems, 11099 No
rth Torrey Pines Road, La Jolla, CA 9
2037). Transformed cultures were plated on ampicillin medium plates and resistant colonies were selected. Plasmid D
NA was isolated from transformants and checked by restriction analysis for the presence of the correct fragment. Recombinant h
For expression of TopI-α, COS cells were transfected with the expression vector by the DEAE-dextran method (J. Sambrook, E. Fritsch, T. Maniatis,
Molecular Cloning: ALaboratory Manual, Col
d Spring Laboratory Press (1989)). hTop
Expression of I-α HA protein was detected by radiolabeling and immunoprecipitation (E. Harlow, D. Lan).
e, Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory Press (198
8)). Cells were labeled with ³⁵ S-cysteine for 8 hours 2 days after transfection. The medium was then collected and the cells were lysed with detergent (R1PA buffer (150 mM NaCl, 1
% NP-40, 0.1% SDS, 1% NP-40,
0.5% DOC, 50 mM Tris, pH 7.5)) (Wilso
n, I, et al., 37: 767 (1984)). Both cell lysates and medium were precipitated with HA-specific monoclonal antibodies. 15% SDS
-Analyzed on PAGE gel.

Example 2 In Vitro Transcription and Translation of hTopI-α In vitro transcription and translation of hTopI-α was performed using TNT C
oupled Reticulocyte Lysate System (Promeg
a, Madison, Wl). The plasmid vector used is pBLSK. encodes hTopI-α
The cDNA was cloned in the direction from EcoRI to XhoI. Eco
The RI site defines the 5 'end of the gene and the XhoI site defines the 3' end of the gene. The gene was inserted in the T3 direction. T3 recognizes a specific promoter, and
Defines a bacteriophage RNA polymerase that transcribes mRNA into mRNA. Add 1 μg of pBLSKhTopIα to 25
μl TNT rabbit reticulocyte lysate, 2 μl TNT
Reaction buffer, 1 μl T3 RNA polymerase, 1 μl amino acid mixture without methionine (1 mM), 4 μl 10 mCi / ml ³⁵ S-methionine (1,000 Ci / m2)
mol), 1 μl of RNasin ribonuclease inhibitor (40
V / μl) and a final volume of 50 μl at 37 ° C. for 1.5 hours. 5 μl of the reaction mixture was mixed with loading buffer, boiled for 5 minutes, and loaded on a 10% SDS polyacrylamide gel to separate proteins. The gel was then fixed with 10% acetic acid, 10% methanol for 30 minutes at room temperature, immersed in Amplify solution (Amersham) for 1.5 hours at room temperature, dried and autoradiographed. The observed molecular weight of hTopI-α in this system is 70 KD, which is consistent with the molecular weight predicted by the sequence.

Example 3 Expression of hTopI-α in Human Tissues
The I-α expression level was examined. Total RNA RNA sample
zol ^™ B System (Biotecx Laboratories, In
c. 6023 South Loop East, Houston, TX
77033). Approximately 10 μg of total RNA isolated from each human tissue was separated on a 1% agarose gel and blotted onto nylon filters (Sambrook,
Fritsch and Maniatis, Molecular Cloning, Co
ld Spring Harbor Press (1989)). The labeling reaction was performed at 50 ng according to the Stratagene Prime-It kit.
Performed on DNA fragments. Label the DNA with
Purified on a tG-50 column (5 Prime-3 Prime,
Inc. 5603 Arapahoe Road, Boulder, CO8
0303). The filters were then combined with the radioactively labeled full-length hTopI-α gene at 1,000,000 cpm /
In ml, 0.5 M NaPO ₄ , pH 7.4 and 7% SDS
And hybridized at 65 ° C overnight. 0.5 × SS
C, After washing twice with 0.1% SDS at room temperature and twice at 60 ° C, the filters were exposed to an intensifying screen at -70 ° C overnight. The message RNA for hTopIα is present in all tissues, including ovaries, testes,
Abundant in lung, spleen and prostate. Various modifications and alterations of the present invention are possible in light of the above teachings, and thus are within the scope of the appended claims, and the invention may be practiced other than as specifically described.

[0088]

[Sequence list]

(1) General information: (i) Patent applicant: Way et al. (Ii) Title of the invention: Human DNA topoisomerase I-alpha (iii) Number of sequences: 2 (iv) Contact: (A) Address: Carrera, Baan, Vane, Gilfiran, Sec, Stuart and Olstein (B) Street: Becker Farm Road 6 (C) City: Roseland (D) State: New Jersey (E) Country: United States (F) ZIP: 07068 (v) Computer reading / reading ceremony: (A) Medium type: 3.5 inch diskette (B) Computer: IBM PS / 2 (C) Operating system: MS-DOS (D) Software: Word Perfect 5.1 (vi) Data of this application: (A) Application number: (B) Filing date: Simultaneous (C) Classification: (vii) Patent attorney / agent information: (A) Name: Ferralo, Gregory di (B) Registration number: 36 , 134 (C) Reference / Reference number No .: 325800-104 (ix) Telephone contact information: (A) Telephone number: 201-994-1700 (B) Fax number: 201-994-1744 (2) Information of sequence number 1: (i) Sequence characteristics (A) Sequence length: 1,917 base pairs (B) Sequence type: nucleic acid (C) Number of strands: single-stranded (D) Topology: linear (ii) Molecular type: cDNA (xi) Sequence Description: SEQ ID NO: 1: (2) Information of SEQ ID NO: 2 (i) Sequence characteristics (A) Sequence length: 601 amino acids (B) Sequence type: amino acids (C) Number of chains: (D) Topology: linear (ii) ) Type of molecule: protein (xi) Sequence description: SEQ ID NO: 2

[Brief description of the drawings]

FIG. 1 shows the cDNA of hTopI-α and the corresponding deduced amino acid sequence.

2 shows the cDNA of hTopI-α and the corresponding deduced amino acid sequence (continuation of the sequence shown in FIG. 1).

FIG. 3 shows the cDNA of hTopI-α and the corresponding deduced amino acid sequence (continuation of the sequence shown in FIG. 2).

FIG. 4 shows the cDNA of hTopI-α and the corresponding deduced amino acid sequence (continuation of the sequence shown in FIG. 3).

FIG. 5 shows the cDNA of hTopI-α and the corresponding deduced amino acid sequence (continuation of the sequence shown in FIG. 4).

FIG. 6 shows the cDNA of hTopI-α and the corresponding deduced amino acid sequence (continuation of the sequence shown in FIG. 5).

FIG. 7 shows the cDNA of hTopI-α and the corresponding deduced amino acid sequence (continuation of the sequence shown in FIG. 6).

FIG. 8 shows the cDNA of hTopI-α and the corresponding deduced amino acid sequence (continuation of the sequence shown in FIG. 7).

FIG. 9 shows a comparison of hTopI-α and human topoisomerase I at the amino acid level. The top line is hTop
I-α.

FIG. 10 shows a comparison of hTopI-α and human topoisomerase I at the amino acid level (continuation of FIG. 9). The upper line is hTopI-α.

FIG. 11 shows a comparison of hTopI-α and human topoisomerase I at the amino acid level (continuation of FIG. 10). The upper line is hTopI-α.

 ────────────────────────────────────────────────── ─── Continued on front page (72) In-Fay Way Straw Vail Lane, No. 13524, Darnestown, Maryland, United States 20878 United States Mark 72. Potomac, Duffy Drive No. 15205 (72) Inventor Robert Di Fleischman USA 20008 Washington, D.C., Northwest No. 134, Woodley Road No. 2800 F-Term (Reference) 4B024 AA01 BA10 CA04 DA02 EA02 EA04 GA11 HA01 HA08 4C084 AA02 BA22 BA23 ZB26

Claims (1)

[Claims] 1. A method of treating a patient having a need to inhibit hTopI-α, wherein the patient has a therapeutically effective amount of: i) an hTopI- having the deduced amino acid sequence of Figures 1-8 (SEQ ID NO: 2). α polypeptides and fragments thereof,
Analogs and derivatives, and (ii) ATCC Deposit No. 7
A method comprising administering an antagonist / inhibitor to a polypeptide selected from the group consisting of a hTopI-α polypeptide encoded by the 5714 cDNA and fragments, analogs and derivatives of the polypeptide.