WO2001048206A1

WO2001048206A1 - A novel polypeptide, a human proteinase suppressor factor 12 and the polynucleotide encoding the polypeptide

Info

Publication number: WO2001048206A1
Application number: PCT/CN2000/000716
Authority: WO
Inventors: Yumin Mao; Yi Xie
Original assignee: Shanghai Biowindow Gene Development Inc.
Priority date: 1999-12-27
Filing date: 2000-12-25
Publication date: 2001-07-05
Also published as: CN1301757A; AU2146701A

Abstract

The present invention discloses a novel polypeptide, a human proteinase suppressor factor 12, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumour, hemopathy, HIV infection, immunological disease, and various inflammation etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel human proteinase suppressor factor 12.

Description

A new polypeptide-human protease inhibitor 12 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human protease inhibitor factor 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. technical background

Cereal seeds contain a large number of serine protease inhibitors and α-amylase inhibitors. These inhibitors can form a family due to structural similarity. This family may form defenses against pathogenic bacteria and invaders by inhibiting foreign proteases and amylases. Members of the family of cereal trypsin inhibitors and alpha-amylase inhibitors are proteins consisting of about 120 amino acid residues, which contain 10 Cys residues to form 5 disulfide bonds.

This family is very limited in sequence similarity, mainly existing in the number and distribution of Cys residues, and the difference in physical and chemical properties (such as solubility) indicates that they may have common ancestors in the evolution process. Its common sequence is C— X (4) — (SAGD) -X (4)-(SPAL)-(LF) -X (2) -C- (RH) -X- (LIVMFY) (2) -X ( 3, 4) -C (three Cys are involved in the formation of disulfide bonds).

Some of the family of cereal trypsin inhibitors and a-amylase inhibitors soluble in NaCl and albumin and globulin bind to IgE in the serum of patients with plant allergies, and some members of this family have been identified as asthma The patient's main allergen.

The polypeptide of the present invention is deduced to be identified as human protease inhibitor 12.

Since the human protease inhibitor 12 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human protease inhibitor 12 proteins involved in these processes. In particular, the amino acid sequence of this protein is identified. The isolation of the novel human protein enzyme inhibitor factor 12 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention

It is an object of the present invention to provide an isolated novel polypeptide, human protease inhibitor 12 and fragments, analogs and derivatives thereof.

Another object of the invention is to provide a polynucleotide encoding the polypeptide. Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human protease inhibitor factor 12.

It is another object of the present invention to provide a genetically engineered host cell comprising a polynucleotide encoding a human protease inhibitor factor 12.

Another object of the present invention is to provide a method for producing human protease inhibitor factor 12.

Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human protease inhibitor 12.

Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human protease inhibitor 12.

Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human protease inhibitor 12. Summary of invention

The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a);

(c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 622-942 in SEQ ID NO: 1; and (b) a sequence having 1-1750 in SEQ ID NO: 1 Sequence of bits.

The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human protease inhibitor factor 12 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human protease inhibitor factor 12 protein in vitro, which comprises detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.

The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human protease inhibitor 12.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

FIG. 1 is a comparison diagram of amino acid sequence homology of a total of 82 amino acids and domain cereal trypsin inhibitors of human protease inhibitor 12 of the present invention at 22-103. The upper sequence is the human protease inhibitor 1 2 and the lower sequence is the cereal trypsin inhibitor domain. Ί "and": "" and "." Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.

Figure 1 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human protease inhibitor 12. 12kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan. "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

"Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

"Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant, or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

An "agonist" refers to a molecule that, when combined with human protease inhibitor 12, causes a change in the protein and thereby regulates the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human protease inhibitor 12.

An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human protease inhibitor 12 when combined with human protease inhibitor 12. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human protease inhibitor 12.

"Regulation" refers to a change in the function of human protease inhibitor factor 12, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human protease inhibitor factor 12.

"Substantially pure" means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify human protease inhibitor 12 using standard protein purification techniques. The substantially pure human protease inhibitor 1 2 can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human protease inhibitor 12 polypeptide can be analyzed by amino acid sequence.

"Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Sou thern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require the binding of two sequences to each other to be specific Or selective interaction.

"Percent identity" refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis. :). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula: Number of residues matching between sequence ^ and sequence ^

The number of residues in sequence ^ -the number of spacer residues in the sequence-the number of spacer residues ^X in the sequence ^ can also be determined by the Cluster method or using a method known in the art such as Jotun He in. Hein J., (1990) Methods in enzymo logy 183: 625-645).

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

"Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. The "antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

"Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? ^ It can specifically bind to the epitope of human protease inhibitor factor 12.

A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not its natural environment The ingredients, they are still separated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

As used herein, "isolated human protease inhibitor Π" means that human protease inhibitor 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human protease inhibitor 12 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human protease inhibitor 12 peptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, human protease inhibitor factor 12, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

The invention also includes fragments, derivatives and analogs of human protease inhibitor 12. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the human protease inhibitor 12 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: U) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) such A type in which a mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 50 bases, and its open reading frame (622-942) encodes 106 amino acids. This The polypeptide has a characteristic sequence of a protease inhibitor, and it can be deduced that the human protease inhibitor 12 has the structure and function represented by the protease inhibitor.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDM, genomic DM or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) Add a denaturant during hybridization, such as 50 ° /. (V / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% or more, more Fortunately, hybridization only occurred at 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human protease inhibitor factor 12.

The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human protease inhibitor 12 of the present invention can be performed in various ways. Get. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of the human proteinase inhibitor 12 transcript; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human protease inhibitor 12 gene.

A method of applying a PCR technique to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid cDNA end rapid amplification method) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Fixed. Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human protease inhibitor 12 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.

In the present invention, a polynucleotide sequence encoding a human protease inhibitor 12 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human protease inhibitor 12 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the _PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters , Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture. And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli. Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding a human protease inhibitor 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; Plague cells such as Fly S 2 or Sf 9; animal cells such as CH0, COS or Bowes s melanoma Cells etc.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DM may be harvested after exponential growth phase, with &(; Treatment 1 _2, used in this step are well known in the art alternative is to use MgC l. _2. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Plastid packaging, etc.

Through the conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human protease inhibitor 12 (Science, 1 984; 224: 14 31). Generally, the following steps are taken:

(1) using the polynucleotide (or variant) encoding human human protease inhibitor 12 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

(2) culturing host cells in a suitable medium;

(3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.

Cereal trypsin inhibitors and α-amylase inhibitors have inhibitory effects on the secreted proteins of pathogenic bacteria. Similar activities of trypsin inhibitors and α-amylase inhibitors mot i f also exist in human peptides, it also inhibits trypsin and x-amylase, affecting the body's digestive and absorption functions.

Trypsin inhibitors and α-amylase inhibitor-specific conserved sequences are required to form their active mot i f. It can be seen that the abnormal expression of the specific trypsin inhibitor and the x-amylase inhibitor mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, which will lead to abnormal digestion and absorption functions of the body, and Produce related diseases such as digestive diseases.

It can be seen that the abnormal expression of the human protease inhibitor 12 of the present invention will cause various diseases, especially digestive diseases, including but not limited to: malnutrition, pancreatitis, gastrointestinal indigestion, irritable bowel syndrome, Chronic diarrhea, chronic gastritis, acute gastritis, peptic ulcer, pancreatic cancer, gastric cancer, CROHN disease, ulcerative colitis, colorectal cancer

The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat various diseases, especially digestive diseases.

The invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human protease inhibitor 12. Agonists enhance human protease inhibitor factor 12 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human protease inhibitor 12 can be cultured together with labeled human protease inhibitor 12 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

Antagonists of human protease inhibitor factor 12 include antibodies, compounds, receptor deletions, and the like that have been screened. The antagonist of human protease inhibitor factor 1 2 can bind to human protease inhibitor factor 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

When screening compounds as antagonists, human protease inhibitor 12 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human protease inhibitor 12 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human protease inhibitor factor 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase Got. In screening, the human protease inhibitor 12 molecule should generally be labeled.

The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human protease inhibitor 12 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

Polyclonal antibodies can be produced by injecting human protease inhibitor 12 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. . Techniques for preparing monoclonal antibodies to human protease inhibitor factor 12 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridization. Tumor technology, etc. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). And existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human protease inhibitor factor 12.

Antibodies against human protease inhibitor 12 can be used in immunohistochemistry to detect human protease inhibitor 12 in biopsy specimens.

Monoclonal antibodies that bind to human protease inhibitor 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human protease inhibitory factor 12 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP, and toxins are bound to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human protease inhibitor 12 positive cells.

The antibodies of the present invention can be used to treat or prevent diseases related to human protease inhibitor 12. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human protease inhibitor 12.

The invention also relates to a diagnostic test method for the quantitative and localized detection of human protease inhibitor 12 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human protease inhibitor 12 detected in the test can be used to explain the importance of human protease inhibitor 12 in various diseases and to diagnose diseases in which human protease inhibitor 12 functions.

The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis. Analysis.

Polynucleotides encoding human protease inhibitor 1 2 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human protease inhibitor 1 2. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant human protease inhibitor 12 to inhibit endogenous human protease inhibitor 12 activity. For example, a mutated human protease inhibitor 12 may be a shortened human protease inhibitor 12 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human protease inhibitor 12. Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding human protease inhibitor 12 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human protease inhibitor 12 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human protease inhibitor 1 2 can be packaged into liposomes and transferred into cells.

Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human protease inhibitor 12 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human protease inhibitor 1 2 can be used for the diagnosis of diseases related to human protease inhibitor 1 2. The polynucleotide encoding human protease inhibitor 1 2 can be used to detect the expression of human protease inhibitor 1 2 or the abnormal expression of human protease inhibitor 1 2 in a disease state. For example, a DNA sequence encoding human protease inhibitor 12 can be used to hybridize biopsy specimens to determine the expression of human protease inhibitor 12. Hybridization techniques include Southen blotting, Nortenhen blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be immobilized on a microarray as probes (Microarray) or DNA chip (also known as "gene chip"), used to analyze differential expression analysis and gene diagnosis of genes in tissues. Human protease inhibitor 12 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human protease inhibitor 12 transcription products.

Detection of mutations in the human protease inhibitor 12 gene can also be used to diagnose human protease inhibitor 12-related diseases. Human protease inhibitor 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human protease inhibitor 12 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FISH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is not observed in any normal individual, The mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human protease inhibitor 12 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human protease inhibitor 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as Sambrook et al., Molecular Cloning: The conditions described in the laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

Example 1 Cloning of human protease inhibitor 12

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 cc. The bacteria formed a cDNA library. Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. CDM The sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0528b01 was new DNA. A series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments contained in this clone. The results show that the 0528b01 clone contains a full-length cDNA of 1750bp (as shown in Seq IDN0: 1), and a 321bp open reading frame (0RF) from 622bp to 942bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0528b01 and named the encoded protein as human protease inhibitor factor 12. Example 2 Domain analysis of cDNA clones

The sequence of the human protease inhibitor 12 of the present invention and the protein sequence encoded by the protein protease inhibitor were subjected to a profile scan program (Basic local alignment search tool) in GCG [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403 -10], perform domain analysis in databases such as prosite. The human protease inhibitor 12 of the present invention is homologous to the domain cereal trypsin inhibitor at 22-103. The homology result is shown in Fig. 1. The homology rate is 14%, and the score is 9.40; the threshold value is 8.96. Example 3 Cloning of a gene encoding human protease inhibitor 12 by RT-PCR

CDNA was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

Primerl: 5'- GGGGAGAGGAAAGACTTATTTTAA -3 '(SEQ ID NO: 3)

Primer2: 5'- AACCATTCATTTTATTTCCTGTAT -3 '(SEQ ID NO: 4)

Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: 50 μl reaction volume containing 50 μl / L KC1, 10 mmol / L Tris-HC1, pH 8.5, 1.5 mmol / L MgCl ₂ , 2 (mol / L dNTP, lOpmol primer, 1U Taq DM polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94. C 30sec; 55 ° C 30sec; 72. C 2min ₀ at RT- During PCR, β-act in was used as a positive control and template blank was used as a negative control. Amplification products were purified using QIAGEN's kit, and TA cloning kit was used to connect to the pCR vector (Invitrogen's product). The results of DNA sequence analysis showed that The DNA sequence of the PCR product is exactly the same as 1-1750bp shown in SEQ ID NO: 1. Example 4 Analysis of human protease inhibitor 12 gene expression by Northern blot

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. Use 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0) Homogenize the tissue, add 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _§ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (PH7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation of ct- ³² P dATP with ³² P- DNA probe labeled by the random primer method. The DNA probe used was the PCR amplified human protease inhibitor 12 coding region sequence (622bp to 942bp) shown in FIG. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 C overnight in a solution containing 50¾ formamide-25mM H ₂ P0 ₄ (pH 7 .4)-5 χ SSC- 5 χ Denhardt's solution and 20 (^ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1> SSC- 0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager Analysis and quantification Example 5 In vitro expression, isolation and purification of recombinant human protease inhibitor 12

According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

Primer 3: 5- CCCCATATGATGACATCCCCCCTCTGCAACCTT -3 '(Seq ID No: 5) Primer4: 5'- CCCGAATTCCTAGATTCCCAAGCCCTTGATTTC -3' (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and EcoRI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The PCR reaction was performed using the pBS-0528b01 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0528b01 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5 CC using the calcium chloride method. After being cultured on an LB plate containing kanamycin (final concentration 30 μ8 / ηι1) overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0528b01) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration of 30μ _§ / ηι1) in LB liquid medium, host strain BL21 _(P ET-0528b01) at 37. C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The chromatography was performed using an affinity column His. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified human protein protease inhibitor 12 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 12 kDa (Figure 2). The section The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams water * method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-human protease inhibitor factor 12 antibodies

The following peptides specific for human protease inhibitor 12 were synthesized using a peptide synthesizer (product of PE): NH ₂ -Met-Thr-Ser-Pro-Leu-Cys-Asn-Leu-Ser-Leu-Trp-Gly-Leu -Tyr-Gln- C00H (SEQ ID NO: 7). The polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avrameas, et al. Immunocherai s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned ii cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human protease inhibitor factor 12. Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe

Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes selected in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes A needle is an oligonucleotide fragment that is partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

3. There should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

After completing the above analysis, select and synthesize the following two probes:

Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)

5'- TGACATCCCCCCTCTCTGCAACCTTTCTCTCTGGGGGCTGTAC -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment or its complementary fragment (41Nt) of SEQ ID NO: 1

5'- TGACATCCCCCCTCTCTGCAACCTGTCTCTCTGGGGGCTGTAC -3 '(SEQ ID NO: 9) For other common reagents and their preparation methods not listed in the following specific experimental procedures, please refer to the literature: DNA PROBES G. Η · Kel ler; MM Manak; Stockton Press , 1989 (USA) and more commonly used molecular cloning experiment manuals such as "Molecular Cloning Experiment Guide" U998 2nd Edition. [US] Sambrook et al., Science Press.

Sample Preparation

1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1000g for 10 minutes. 3) Suspend the pellet (about 10 ml / _g ) with cold homogenization buffer (0.25 mol / L sucrose; 25 ramol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 cryptool / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 C with a motorized homogenizer at full speed until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5ml per 0.1 gram of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the initial tissue sample), and then take the following

2, DNA phenol extraction method

Steps: 1) Wash the cells with] -10ml cold PBS and centrifuge at 1000g for 10 minutes. 2) with cold cell lysate pelleted cells were resuspended (lx 10 ⁸ cells / ml) Minimum application lOOul lysis buffer. 3) Force P SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

3. Purification of DNA and ethanol precipitation

Steps: 1) Add 10 vol. 2mol / L sodium acetate and 2 times cold volume 100% ethanol to the DM solution and mix. Leave at -20 C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper, and gradually increase TE, mix until the DNA is fully dissolved, and add approximately 1 ^{ul for} each 1- 5 χ 10 ^ύ cell extraction.

The following steps 8-13 are only used when contamination must be removed, otherwise step M can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A _26fl and A _28fl to check the purity and yield of DNA. 15) Store at -20 ° (:) after packing. Preparation of sample film

1) Take 4x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe, so that it can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

3) Place on filter paper infiltrated with 0.1 lraol / L NaOH, 1.5mol / L NaCl for 5 minutes (twice), and dry in 0.5mol / L Tris-HCl (pH7.0), 3mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

Labeling of probes

1) 3 μ1 Probe (0.1 IOD / Ιθμΐ), add 2 l Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase, to make up to a final volume of 20 μ1.

2) Incubate at 37 ° C for 1 hour.

3) Add 1/5 volume of bromophenol blue indicator (BPB \

4) Pass through a Sephadex G-50 column.

5) Start to collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

6) 5 drops / tube, collect 10-15 tubes.

7) Monitor the amount of isotope with a liquid scintillator.

8) After the collection of the first peak is combined, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared.

Pre-hybridization

The sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (lOxDenhards; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.

Cross

Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight. Wash film:

High-intensity washing film:

1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

4) 0. lxSSC, 0.1 ° /. Wash in SDS at 55 ° C for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray autoradiography:

-70, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

Experimental results:

釆 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was obvious Stronger in radioactivity than the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 8 DNA Mi croarray

Gene chip or gene micro-matrix (DM Mi croarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific methods and steps have been reported in the literature for various references.

(1997) Science 278, 680-686. Hel Le, R. A., Schema, M., Chai, A., Shalom, D.,

(1997) PNAS 94: 2150-2155.

(A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDMs were used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between the points is 280 μm. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

1. Hydration in a humid environment for 4 hours; 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

5. 95 ° C water for 2 minutes;

6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

8. Dry and store at 25 ° C in the dark for future use.

(Two) probe marking

Total mRNA was extracted from normal liver and liver cancer by one-step method, and mRM was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). Cy3dUTP (5-Amino-propargy l-2'-deoxyur idine) was used as the fluorescent reagent by reverse transcription. 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company) labeled mRNA of normal liver tissue, using a fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2 · -deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent Dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see:

Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davis, RW (1995 ) Science.270 (20): 467-480.

(Three) cross

The probes from the two types of tissues and the chips were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000. Scanner (purchased from General Scanning Company, USA) for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered. Genes with differential expression.

Experimental results show that Cy3 signal = 6674.58 (average of four experiments), Cy5 signal = 1616.11 (average of four experiments), Cy3 / Cy5 = 4.13, the polynucleotide of the present invention is in the above two tissues There are significant differences in the expression, indicating that the polynucleotide of the present invention is associated with glioma.

Claims

Rights request

1. An isolated polypeptide, human protease inhibitor factor 12, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative of a polypeptide thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having an amino acid sequence shown in SEQ ID NO: 2.

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

(b) a polynucleotide complementary to polynucleotide (a); or

(c) a polynucleotide that is at least 70% identical to) or (b).

5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 622-942 in SEQ ID NO: 1 or the sequence of positions 1-1750 in SEQ ID NO: 1. .

7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 with a plasmid, virus or a carrier expression vector Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

(a) a host cell transformed or transduced with the recombinant vector of claim 7; or

(b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human protease inhibitory factor 12 activity, characterized in that the method includes:

(a) culturing the engineered host cell according to claim 8 under the condition that human protease inhibitor 12 is expressed;

(b) A polypeptide having human protease inhibitor 12 activity is isolated from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human protease inhibitor factor 12.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human protease inhibitor factor 12.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human protease inhibitor 12 in vivo and in vitro.

14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. The use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human protease inhibitor 12; or for peptide fingerprinting Atlas identification.

16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human protease inhibitor 12 abnormality.

18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.