WO2002016396A2 - Mammalian rh type b glycoprotein ion transporter - Google Patents

Abstract

The present invention provides nucleic acid sequences encoding novel mammalian nonerythroid Rh glycoprotein homologues, Rhbg including the human homologue RhBG. These RhBG, Rhbg glycoproteins are polytypic transporter-type proteins with 12 transmembrane domains and are predominantly expressed as a single major form in kidney, and as multiple forms in liver, skin and ovaries. Also provided are recombinant vectors and host vector systems containing these nucleic acid sequences, as well as fusion proteins incorporating Rhbg, RhBG or fragments of each. The invention further provides methods of detection of Rhbg and RhBG glycoproteins and also methods of detecting nucleic acids encoding Rhbg and RhBG.

Description

MAMMALIAN RH TYPE B GLYCOPROTEIN ION TRANSPORTER

This work was supported in part by National Institutes of Health Grant HL54459. The United States government may have certain rights to this invention.

FIELD OF THE INVENTION

This invention relates to the field of molecular biology of mammalian genes and their encoded proteins, and more particularly to the Rh gene family.

BACKGROUND

Ammonia transporters (Ami) constitute a superfamily of structurally divergent transmembrane (TM) proteins found in diverse organisms of the three domains of life, Bacteria, Archaea, and Eucarya. These proteins play a key functional role in the uptake and assimilation of ammonium ion (NH ₄) as a source of nitrogen in vast nitrogen-fixing microorganisms and plants (See reference 1). The best-known Amts are those that are only recently characterized in bacteria, yeast, flowering plant (A. thaliana), and soybean nodules (2-10). Whole-genome sequencing also has revealed the presence of Amt-like proteins in archaeons (11,12) and nematode (C. elegans, 13). In a single given species of lower organisms and plants, NH⁺ ₄ transport is often endowed with multiple separate gene and protein forms. Members or subgroups of the Amt superfamily vary greatly in primary structure, in number of transmembrane segments, and in kinetics of NH⁺ ₄ uptake (2-10), thus correlating the function with environmental adaptation. Targeted gene replacements have shown that the absence of Amt results in growth defect of the mutant organism when the culture medium is depleted or lowered in NH⁺ ₄ (2,3,6).

Instead of being a key compound of nitrogen acquisition in microorganisms or plants, NH ₄ is formed as an end product of nitrogen metabolism in ammonotelic animals and serves as an important urinary buffer in mammals. Mammalian species such as rats, dogs, and humans face a net acid load and excrete NH⁺ , via the kidney, to remove excess protons to regulate systemic acid-base balance (14). Hence, the maintenance of NH⁺ ₄ homeostasis bestows a vital mechanism in regulating net acid excretion. In human kidneys, for example, half of the ammonia produced is excreted under normal conditions and three fourth of that is excreted in response to even a mild acidosis (15). Active NH⁺ ₄ transport in mammals has been well documented physiologically, at least in the case of kidneys (16), but its building block remains to be identified. A recent database search (17) has revealed a marginal homology between some Amt and red blood cell (RBC) Rh proteins (particularly RhAG) (18- 20).

Although the RBC Rh proteins may serve to trap ammonia in circulation (21), they are not appreciably expressed in liver, kidney, and skin (22), the three major organs specialized in ammonia genesis, excretion, and secretion. Nevertheless, RhAG homologues are rooted deeply in evolution and occur in primitive life forms: the slime mold D. discoideum (23), marine sponge G. cydonium (24), nematode C. elegans (13), and fruit fly D. melanogaster (23). Cross-reactions with monoclonal anti-Rh antibodies suggest the presence of erythroid Rh-like constituents in tissues of human and other mammals (25). Recently, RhCG and Rhcg were identified as first members of the nonerythroid Rh subfamily and as a candidate ammonium transporter expressed in kidney and testis (26).

Abbreviations: Amt, ammonium transporter(s); RBC, red cell(s); TM, transmembrane; GSP, gene-specific primer(s); RACE, rapid amplification of cDNA ends; PCR, polymerase chain reaction; RT-PCR, reverse transcriptase PCR; GFP, green fluorescence protein; GST, glutathione-S-transferase; BAC, bacterial artificial chromosome; FISH, fluorescence in situ hybridization; PAGE, polyacrylamide gel electrophoresis; UTR, untranslated region.

SUMMARY OF THE INVENTION

The present invention provides the nucleic acids of the human RhBG gene and the mouse Rhbg gene. Also provided are homologues of the natural RhBG and Rhbg genes that exhibit at least 75% sequence identity to the natural gene sequences, and further homologues that hybridize to the natural RhBG and Rhbg gene nucleic acids. Fragments of the above-mentioned homologues are also provided.

In another aspect, the invention provides recombinant vectors comprising RhBg and Rhbg gene and regulatory sequences, and recombinant vectors comprising nucleic acid molecules encoding RhBG and Rhbg glycoproteins. Also provided are host cells transformed with such recombinant vectors comprising nucleic acid molecules encoding RhBG and Rhbg glycoproteins including NH₄ ⁺ ion transporters.

In yet another aspect, the invention provides isolated proteins, glycoproteins and peptides having at least 60% amino acid sequence identity to mammalian RhBG glycoprotein and Rhbg glycoprotein. Also provided are protein, peptide fragments and fusion proteins having epitopes characteristic of RhBG and Rhbg glycoproteins. Further provided are RhBG and Rhbg glycoproteins and fragments exhibiting transporter activity. Such transporter activity includes ion transporter activity, with NH₄ ⁺ ion transporter activity being particularly preferred.

In yet a further aspect, the invention provides antibodies that specifically bind to an epitope of an RhBG glycoprotein and antibodies that specifically bind to an epitope of an Rhbg glycoprotein.

In another further aspect the invention provides gene specific probes including those that specifically bind Rh type B glycoprotein gene sequences.

In yet another aspect the invention provides an isolated nucleic acid molecule comprising a functional RhBG regulatory region.

In a yet further aspect the invention provides a hybrid gene under Rh type B gene regulation, the hybrid gene comprising an upstream nucleic acid regulatory sequence of the RhBG gene and the coding sequence of a gene, including heterologous gene sequences.

Further, the present invention provides a method of detecting an epitope of Rhbg or RhBG glycoprotein in a sample, the steps of the method comprising: contacting the sample with an antibody that specifically binds to an epitope of RhBG glycoprotein or an Rhbg glycoprotein under conditions suitable for binding, assessing the specific binding to the antibody, and thereby detecting the presence of an epitope of Rhbg or RhBG glycoprotein in the sample. Further, in yet another aspect the invention provides a method of detecting an Rhbg or RhBG nucleotide sequence in a sample, said method comprising the steps of: providing a nucleic acid sample, contacting the sample with a nucleic acid probe that hybridizes to sequences homologous to the natural RhBG and Rhbg genes that exhibit at least 75% sequence identity to the natural gene sequences, under conditions suitable for hybridization, detecting the nucleic acid probe hybridized to the sample, and thereby detecting the presence of an Rhbg or RhBG nucleotide sequence in the sample.

BRIEF DESCRIPTION OF THE FIGURES

Fig.l. RhBG and Rhbg: cDNA and regulatory sequences and alignment with erythroid RhAG/Rhag and nonerythroid RhCG/Rhcg. la. RhBG human cDNA sequence (SEQ ID No.: 1); Rhbg mouse cDNA sequence (SEQ ID No.: 2); Deduced amino acid sequence of RhBG human glycoprotein (SEQ ID No.: 3); Deduced amino acid sequence of Rhbg mouse glycoprotein (SEQ ID No.: 4). Sequences are aligned by means of MegAlign and their numbering is indicated at far right. Identical aa (n>4) is shaded in yellow and similar ones (n=4) in gray or red. The insertion of ⁸A- A-G¹⁰ in RhBG is indicated (dots). NX(S/T) motif (bar), D/E conservation (red star)in TM4 or 5, and E/Q change (blue star) in TM1 or 5 are shown. Accession numbers: RhBG, AF193807; Rhbg, AF193808; RhAG, AF031548; Rhag, AF057526; RhCG, AF193809; Rhcg, AF193810. lb. Amino acid sequence alignment: RhAG, Rhag, RhBG, Rhbg, RhCG and Rhcg. lc. Upstream regulatory sequence of human RHBG: nucleotide sequence from -1205 to +108.

Fig.2. Hydropathy profile and secondary structure of RhBG: comparison with RhAG and RhCG. The mouse counterpart of each protein is not shown, as it shows an apparently identical pattern. Analysis was carried out using the Kyte-Doolittle scale and Chou-Fasman algorithm in Protean™ software. The hydrophobic segments as putative TM domains are indicated in Roman numerals. Secondary structure symbols are: A, α-helix, B, β-sheet, and T, turns.

Fig.3. Relatedness of the Rh and Amt families by protein sequence clustering. Left, the dendrogram of the relationships between the Rh and Amt proteins constructed with the ClustalW program. Four major clusters including Rh are recognized: Cluster I is subdivided into class la and lb, whereas the Rh cluster intercepts Amt Clusters I and II. CG6499 is a putative Amt from fruit fly. Note that some branch points within individual clusters remain ambiguous. Right panel shows accession, organism, and structure parameters of each protein. Human RhBG (boxed) is used as a reference (100%) for computation of sequence identity (ID) and overall similarity (SM) using the J. Hein procedure. TM numbering is based on either database search or Kyte- Doolittle hydropathy analysis.

Fig.4. Sequence homology between human RhBG and two Amt members from subfamily II. Sequences are aligned by means of MegAlign with minor manual manipulations; their designations are: Hs.RhBG, human RhBG, (SEQ ID No.: 3); Sp.AmtA, Synechococcus PCC7002 ammonium transporter A (AAF21444, no.49 in Fig.3); Sy.Amtl, Synechocystis sp. ammonium transporter 1 (P72935, no.51 in Fig.3); and Rh.maj, the majority consensus derived from a collective alignment of mammalian Rh glycoprotein homologues. Amino acid number is denoted at far right. Identical residues are colored in blue and similar ones in yellow. A/G or G/A substitutions are denoted in red letters and shaded in gray. Gaps are indicated with dashes. In Rh.maj, nonconserved aa positions are marked with crosses. Note the composite identity and similarity RhBG shares with either Sp.AmtA or Sy.Amtl .

Fig.5. Chromosomal mapping of human RHBG and mouse Rhbg genes. A, Diagram for the location of RHBG at lq21.3. RHBG BAC DNA was used as FISH probes to paint interphase chromosomes. B, Diagram for the linkage map of mouse Rhbg on chromosome 3 (the centromere toward the top). A 3 cM scale bar is shown right. Loci mapping to the same position are listed in alphabetical order. Corresponding human map positions for underlined loci are listed to the left.

Fig.6. MTN (multiple tissue Northern) blot analysis. A, RHBG expression in human adult and fetal tissues. B, Rhbg expression in mouse adult tissues and at embryonic gestational stages. 2μg of poly (A)+ RNA was loaded to each lane. Size markers are indicated at left. Tissues are designated above each panel: s. muscle, skeletal muscle; s. intestine, small intestine, and WBC, white blood cells. Three bands of varying intensity on human MTN blots are arrow-indicated, but only one major band is seen on mouse blots. Actin cDNA hybridization was relatively constant.

Fig.7. Rhbg expression in mouse embryos and adult tissues. A, Rhbg expression in the 16.5 -day mouse embryo: skin (S) and liver (L). Note the kidney is not seen in this section. B and C, low and high magnification of Rhbg expression in skin (H, hair; HF, hair follicle; P, papilla). D, Rhbg signal in adult mouse kidney (C, cortex; M, medulla). E, high magnification of Rhbg expression in the kidney (CT, convoluted tubules, arrow-indicated, and RC, renal capsules). F, image of E. G, Rhbg expression in the liver. H, high magnification of Rhbg expression in liver (HC, hepatocyte, arrow-indicated; CV, central vein). I, image of H. A, D, F, G, and /: dark field. B, C, E, and H: bright field.

Fig.8. Localization of RhBG to the plasma membrane by confocal microscopy. Cultured cells were transfected with RHBG-GFP (in pΕGFP-N3) or GFP-RHBG plasmid (in pEGFP-Cl). Images were collected on a Bio-Rad MRC confocal laser- scanning microscope. A, B, and C: homologous HepG2 cells. D, E, and F: homologous HEK293 cells. G, H, and /: heterologous HeLa cells. A, D, and G: controls (pEGFP-N3 vector). B, E, and H: RHBG-GFP fusion. C, F, and /: GFP- RHBG fusion.

Fig. 9. In vitro protein translation and processing of human RhBG. A: Left, 12% SDS-PAGE of in vitro translated RhBG in the absence of CPMM. Positive (Pos) and negative (Neg) controls: Pos 1, yeast α-mating factor; Pos 2, luciferase; Neg 1, no template; Neg 2, pYES2 alone. RhBG, pYES2/RhBG. RhBG-myc, pcDNA3.1/RhBG-myc. Right, 12% SDS-PAGE of in vitro translated RhBG in the presence of CPMM. Pos 1, yeast α-mating factor; and Neg 1, no template. RhBG and RhBG-myc, as in left.

Fig.10. Western blot analysis of human RhBG from stable HEK293 cells and mouse Rhbg from native tissues. A, Plasma membranes of HEK293 cells stably expressing the tagged human RhBG were separated by 12% SDS-PAGE and blotted. RhBG was visualized with RhBG C tail-specific antisera (left panel) or anti-Myc monoclonal (right panel). Human RBC ghost membranes were used as controls. +, DTT or PNGase F added. -, DTT or PNGase F not added. B, Western blot of mouse Rhbg. Membrane proteins from mouse heart, liver and kidney were fractionated, blotted, and probed with anti-Rhbg polyclonal antibodies raised with synthetic peptides. + and -, PNGase F added and not added. Size markers (in kDa) are shown at the left margin. Dilution of antibodies is shown.

DETAILED DESCRIPTION OF THE INVENTION

DEFINITIONS

"Isolated proteins " When a protein is isolated, this means that it is essentially free of other proteins. Essentially free from other proteins means that it is at least 90%), preferably at least 95%) and, more preferably, at least 98%> free of other proteins. Isolated proteins may be recognized as single bands after electrophoresis in SDS acrylamide gels and staining with coomassie blue or silver stain. See Laemmli, Nature 227:680-685 (1970).

"Essentially Pure" A protein or nucleic acid is essentially pure, when the protein or nucleic acid is free not only of other proteins and nucleic acids, but also of other materials used in its isolation and identification, such as, for example, sodium dodecyl sulfate and other detergents. The protein or nucleic acid is at least 95% free, preferably at least 98% free and, more preferably, at least 99% free of such materials.

An "oligonucleotide" or "oligomer" is a stretch of nucleotide residues which has a sufficient number of bases to be used in a polymerase chain reaction (PCR). These short sequences are based on (or designed from) genomic or cDNA sequences and are used to amplify, confirm, or reveal the presence of an identical, similar or complementary DNA or RNA in a particular cell or tissue. Oligonucleotides or oligomers comprise portions of any nucleic acid, preferably DNA sequence having at least about 10 nucleotides and as many as about 100 nucleotides, preferably about 15 to 50 nucleotides. They may be chemically synthesized and may be used as probes.

"Percent sequence identity" in a comparison of two aligned sequences as used herein means the percent of identical nucleotide bases or amino acid residues in a stretch of contiguous bases or residues. "Percent sequence similarity" in a comparison of two aligned sequences as used herein means the percent of conserved or similar amino acid residues in a stretch of contiguous amino acids.

"Probes" are nucleic acid sequences of variable length, preferably between at least about 10 and as many as about 3,000 nucleotides, depending on use. They are used in the detection of identical, similar, or complementary nucleic acid sequences. Longer length probes are usually obtained from a natural or recombinant source, are highly specific and much slower to hybridize than oligomers. They may be single- or double-stranded and carefully designed to have specificity in PCR, hybridization membrane-based, or ELISA-like technologies.

"Reporter" molecules are chemical moieties used for labelling a nucleic or amino acid sequence. They include, but are not limited to, radionuclides, enzymes, fluorescent, chemi-luminescent, or chromogenic agents. Reporter molecules associate with, establish the presence of, and may allow quantification of a particular nucleic or amino acid sequence.

A "portion" or "fragment" of a polynucleotide or nucleic acid comprises all or any part of the nucleotide sequence having fewer nucleotides than about 3 kb, preferably fewer than about 1 kb which can be used as a probe. Such probes may be labelled with reporter molecules using nick translation, Klenow fill-in reaction, PCR or other methods well known in the art. After pretesting to optimize reaction conditions and to eliminate false positives, nucleic acid probes may be used in Southern, northern or in situ hybridizations to determine whether DNA or RNA encoding the protein is present in a biological sample, cell type, tissue, organ or organism.

"Recombinant nucleotide variants" are polynucleotides which encode a protein. They may be synthesized by making use of the "redundancy" in the genetic code. Various codon substitutions, such as the silent changes which produce specific restriction sites or codon usage-specific mutations, may be introduced to optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic or eukaryotic host system, respectively.

"Control elements" or "regulatory sequences" are those nontranslated regions of the gene or DNA such as enhancers, promoters, introns and 3' untranslated regions which interact with cellular proteins to carry out replication, transcription, and translation. They may occur as boundary sequences or within the coding region of the gene. They function at the molecular level and along with hormones and other biological messenger molecules as well as regulatory genes, the regulatory sequences are important in the control of development, growth, differentiation and aging processes.

"Chimeric" molecules are polynucleotides which are created by combining one or more of nucleotide sequences of this invention (or their parts) with additional nucleic acid sequence(s).. Such combined sequences may be introduced into an appropriate vector and expressed to give rise to a chimeric polypeptide which may be expected to be different from the native molecule in one or more of the following ion transporter characteristics: cellular location, distribution, ligand-binding affinities, interchain affinities, degradation/turnover rate, signalling, etc.

"Active " is that state which is capable of being useful or of carrying out some role. It specifically refers to those forms, fragments, or domains of an amino acid sequence which display the biologic and/or immunogenic activity characteristic of the naturally occurring RhBG or Rhbg.

"Naturally occurring RhBG or Rhbg" refers to a polypeptide produced by cells which have not been genetically engineered or which have been genetically engineered to produce the same sequence as that naturally produced. Specifically contemplated are various polypeptides which arise from post-translational modifications. Such modifications of the polypeptide include but are not limited to acetylation, carboxylation, glycosylation, phosphorylation, lipidation and acylation.

"Derivative" refers to those polypeptides which have been chemically modified by such techniques as acylation, phosphorylation, sulfation, methylation, ubiquitination, labelling with radioactive or other detectable moieties and chemical insertion or substitution of amino acids which do not normally occur in mammalian proteins.

"Recombinant polypeptide variant" refers to any polypeptide which differs from naturally occurring RhBG or Rhbg by amino acid insertions, deletions and/or substitutions, created using recombinant DNA techniques. Guidance in determining which amino acid residues may be replaced, added or deleted without abolishing characteristics of interest may be found by comparing the sequence of RhBG or Rhbg with that of related polypeptides and minimizing the number of amino acid sequence changes made in highly conserved regions.

A "signal or leader sequence" is a short amino acid sequence which or can be used, when desired, to direct the polypeptide through a membrane of a cell. Such a sequence may be naturally present on the polypeptides of the present invention or provided from heterologous sources by recombinant DNA techniques.

An " oligopeptide" is a short stretch of amino acid residues and may be expressed from an oligonucleotide. It may be functionally equivalent to and either the same length as or considerably shorter than a "fragment ", "portion ", or "segment" of a polypeptide. Such functional binding sequences, such as epitopes comprise a stretch of amino acid residues of at least about 5 amino acids and often about 17 or more amino acids, typically at least about 9 to 13 amino acids, and of sufficient length to display biologic and/or immunogenic activity. Functional biologic activity, such as ion transporter activity may reside in a domain of at least about 25 amino acids, more typically about 50-100 amino acids and in some cases may require 100-200 amino acids to preserve function.

An "inhibitor" is a substance which retards or prevents a chemical or physiological reaction or response. Common inhibitors include but are not limited to antisense molecules, antibodies, antagonists and their derivatives. A "mammal" as used herein may be defined to include human, domestic (cats, dogs, etc), agricultural (cows, horses, sheep, goats, chicken, etc) or test species (mice, rats, rabbits, simians, etc).

"Homologues and fragments of RhBG and Rhbg" The invention includes homologues and fragments of RhBG and Rhbg proteins as defined above, and also includes homologues, including recombinant nucleotide variants, and fragments of nucleic acids, whether DNA, including genomic DNA or cDNA, or RNA including spliced or unspliced messenger RNA, that encode RhBG and Rhbg.

In the present specification, an amino acid sequence of a first protein is considered to be homologous to that of a second protein if the amino acid sequence of the first protein shares at least about 60% amino acid sequence identity, preferably at least about 70% identity, and more preferably at least about 80% identity, with the sequence of the second protein. In the case of proteins having high homology, the amino acid sequence of the first protein shares at least about 85%) sequence identity, preferably at least about 90%> identity, more preferably at least about 95% identity, and optimally at least about 98% identical to the amino acid sequence of the second protein.

A first nucleotide sequence is herein considered homologous to a second nucleotide sequence if the first sequence is at least about 70% identical, preferably at least about 75% identical, and more preferably at least about 80% identical to the second nucleotide sequence. In the case of nucleotide sequences having high homology, the first sequence is at least about 85%), preferably at least about 90%>, more preferably at least about 95% and optimally at least about 98% identical to the second nucleotide sequence.

A homologue of the RHBG or Rhbg glycoprotein or of the unglycosylated form of the protein can be,, for example, a substitution, addition, or deletion mutant of the protein. For example, it is preferred to substitute amino acids in a sequence with similar or equivalent amino acids. Groups of amino acids known normally to be equivalent are:

(a) Ala(A), Ser(S), Thr(T), Pro(P), Gly(G); (b) Asn(N), Asp(D), Glu(E), Gln(Q);

(c) His(H), Arg(R), Lys(K);

(d) Met(M), Leu(L), Ile(I), Val(V); and

(e) Phe(F), Tyr(Y), Trp(W).

"Substitutions " are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.

Amino acid "insertions" or "deletions" are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 10 amino acids in length. The variation allowed in a particular amino acid sequence may be experimentally determined by producing the peptide synthetically or by systematically making insertions, deletions, or substitutions of nucleotides in the RhBG or Rhbg sequence using recombinant DNA techniques.

The term "stringent conditions," as used herein, is equivalent to "high stringent conditions" and "high stringency". These terms are used interchangeably in the art.

High stringency conditions are defined in a number of ways. In one definition, stringent conditions are selected to be about 50°C lower than the thermal melting point (T_m) for a specific sequence at a defined ionic strength and pH. The T_m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched sequence. Typical stringent conditions are those in which the salt concentration is at least about 0.02 M at pH 7 and the temperature is at least about 60°C.

High stringent conditions are defined in a number of ways. In one definition, stringent conditions are selected to be about 25°C lower than the thermal melting point (T_m) for DNA or RNA hybrids longer than 70 bases, and 5°C lower than the T,„ for shorter oligonucleotides (11-70 bases long). The T_m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched sequence. Typical stringent conditions are those in which the salt concentration is about 0.02 M at pH 7.0 and the temperature is calculated as described below.

The following equations are used to calculate the T_m of the following hybrids at pH 7.0: For DNA hybrids of more than 70 nucleotides: T_m = 81.5°C + 16.6 logtM^1"] + 41(%G + C) - 0.63(% formamide) - (600/X). For DNA: RNA hybrids of more than 70 nucleotides: T_m = 79.8°C + 18.5 log^] + 58.4(%G + C) + 11.8(%G + C)² - 0.5(% formamide) - 820/X. For DNA or RNA hybrids of 14-70 bases: T_m = 81.5°C + 16.6 logtM ] + 41(%G + C) - 600/X. For DNA or RNA hybrids of 11-27 bases (based on 1 M Na and in the complete absence of organic solvents): T_m = 4(%G + C) + 2(%A + T).

Where

T_m = thermal melting temperature;

%>G+C = percentage of total guanine and cytosine bases in the DNA, usually 30% -75% (50%> is ideal), and expressed as a mole fraction ;

[M ] = log of the monovalent cation concentration, usually sodium, expressed in molarity in the range of 0.01 M to 0.4 M; and

L = length of the hybrid in base pairs;

%A+T = percentage of total adenine and thymine bases in the DNA and expressed as a mole fraction.

"Stringent conditions," in referring to homology or substantial similarity in the hybridization context, can be combined conditions of salt, temperature, organic solvents or other parameters that are typically known to control hybridization reactions. The combination of parameters is more important than the measure of any single parameter. If incompletely complementary sequences recognize each other under high stringency conditions, then these sequences hybridize under conditions of high stringency. See U.S. Pat No. 5,786,210; Wetmur and Davidson J. Mol. Biol. 3J.:349-370 (1968). Control of hybridization conditions, and the relationships between hybridization conditions and degree of homology are understood by those skilled in the art. See, e.g., Sambrook, J. et al. (Eds.), Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989) and Ausubel, F.M. et al. (Eds.), Current Protocols in Molecular Biology, John Wiley & Sons, New York (1999). Further examples of stringent conditions can be found in U.S. Patent No. 5,789,550 of Goeddel et al.(1998) the specification of which is hereby incorporated by reference.

For the purposes of this specification, "percent similarity" is calculated as percent of contiguous sequence with positions occupied by "similar" or equivalent amino acids according to the above description.

"Percent identity" is calculated as the percent contiguous amino acids that are identical in the two sequences compared. Substitutions, additions, and/or deletions in an amino acid sequence can be made. Preferably the protein encoded by the nucleic acid of the invention continues to satisfy the functional criteria described herein. An amino acid sequence that is substantially the same as another sequence, but that differs from the other sequence by means of one or more substitutions, additions, and/or deletions, is considered to be a similar or equivalent sequence. Preferably, less than 50%, more preferably less than 25%, and still more preferably less than 10%, of the total number of amino acid residues in a sequence are substituted for, added to, or deleted from the protein encoded by the nucleic acid of the invention.

The Invention

The present invention provides isolated nucleic acids having a nucleotide sequence with at least 75%) sequence identity to the RhBG cDNA or to the Rhbg cDNA disclosed in Figure la. Preferably the nucleic acid sequences exhibit at least 80% identity, more preferably still at least 85% identity, and optimally 90-100%) identity with the RhBG cDNA or the Rhbg cDNA. Preferably the nucleic acid sequence is of greater than about 15 bases in length, more preferably greater than about 18 bases in length and most preferably greater than about 20 bases in length.

The present invention also provides isolated nucleic acids which hybridize under stringent conditions with RhBG cDNA or with the Rhbg cDNA disclosed in Figure la. The meaning of "stringent conditions" will be readily understood by those of skill in the art. For example the hybridization under stringent conditions may be performed in 6xSSC at 65 degrees C. See for example, Sambrook, J., et al. (Eds.) Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory, CSH Lab. Press, Cold Spring Harbor, NY (1989), and Current Protocols in Molecular Biology, Ausubel, F.M. et al. (Eds.), John Wiley & Sons, Inc., New York , (1999).

A second test for homology of two nucleic acid sequences is whether they hybridize under normal hybridization conditions, preferably under stringent hybridization conditions. Also included in the invention are proteins that are encoded by nucleic acid molecules that hybridize under high stringent conditions to a sequence complementary to SEQ ID NO:2.

The probes of the present invention may be used to detect transporter genes and particularly Rh type B transporter genes including for example NH₄ ⁺ ion transporters.

The present invention further provides isolated nucleic acid molecules encoding a protein having an amino acid sequence at least 60%> identical to the amino acid sequences of RhBG or Rhbg glycoproteins (as disclosed in Figure lb). Preferably the protein sequence is at least 70% identical, and more preferably the protein sequences are at least 80% identical to the RhBG or Rhbg glycoproteins. Yet more preferably the protein sequences are at least 85%, and optimally at least 90% identical to the RhBG or Rhbg glycoproteins.

In another aspect the present invention priovides isolated nucleic acids encoding a protein having RhBG or Rhbg activity. The RhBG or Rhbg activity may be a transporter activity, and in a preferred embodiment the RhBG or Rhbg activity is an ion transporter activity which is NH₄ ⁺ ion transporter activity.

In a further aspect the invention provides fragments of nucleic acid molecules having a nucleotide sequence with at least 75%) sequence identity to the RhBG cDNA or to the Rhbg cDNA, encoding a protein having RhBG or Rhbg activity. The RhBG or Rhbg activity may be a transporter activity, and in a preferred embodiment the RhBG or Rhbg activity is an ion transporter activity which is NH₄ ⁺ ion transporter activity. Preferably the fragments are of greater than about 15 nucleotides in length, more preferably the fragments are of greater than about 18 nucleotides in length, and more preferably still the fragments are of greater than about 20 nucleotides in length.

In a yet a further aspect the invention provides fragments of the nucleic acid molecule having a nucleotide sequence with at least 75%> sequence identity to the RhBG cDNA or to the Rhbg cDNA, encoding a protein having an epitope of RhBG or an epitope of Rhbg. The epitope may be an epitope of the N-terminal extracellular region, an extracellular loop, an intracellular loop or the C-terminal intracellular region. Preferably the fragments are of greater than about 15 nucleotides in length, more preferably the fragments are of greater than about 18 nucleotides in length, and more preferably still the fragments are of greater than about 20 nucleotides in length.

In a particular embodiment the epitope of Rhbg is an epitope of an extracellular loop. One embodiment of such an epitope is the epitope of exoloop 6. In a particularly preferred embodiment the epitope of exoloop 6 is encoded by the peptide acetyl-AKGQRSATSQAVYQLFC-amide (aa377-392) of SEQ ID No.:17.

In another particular embodiment the epitope of Rhbg is an epitope of the C- terminal intracellular region. In one embodiment of such an epitope is the epitope encoded by the peptide acetyl-CTETQRPLRGGESDTRA-OH (aa440-455) of SEQ ID No.: 18.

In a further aspect the invention provides a recombinant vector containing a nucleotide sequence with at least 75% sequence identity to the RhBG cDNA or to the Rhbg cDNA (disclosed in figure la).

In a yet further aspect the invention provides a recombinant vector containing a nucleotide sequence encoding an RhBG (SEQ ID No.3) or homologue as described above, or to the amino acid sequence of Rhbg (SEQ ID No.:4) or homologue as described above. In particular embodiments the recombinant vectors contain nucleic acid sequences encoding a protein having RhBG or Rhbg activity. The RhBG or Rhbg activity may be a transporter activity, and in a preferred embodiment the RhBG or Rhbg activity is an ion transporter activity which is NH₄ ⁺ ion transporter activity. In another aspect the present invention provides a host cell transformed with the recombinant vector as described above, containing a nucleotide sequence encoding a protein having an amino acid sequence at least 60%> identical to the amino acid sequence of RhBG (SEQ ID No.3) or to the amino acid sequence of Rhbg (SEQ ID No.:4). In particular embodiments the recombinant vector of the host cell contains a nucleic acid sequence encoding a protein having RhBG or Rhbg activity. The RhBG or Rhbg activity may be a transporter activity, and in a preferred embodiment the RhBG or Rhbg activity is an ion transporter activity which is NH₄ ion transporter activity.

Further the invention provides isolated proteins and peptides having an amino acid sequence at least 60% identical to the amino acid sequence of RhBG glycoprotein (SEQ ID No.: 3) or Rhbg glycoprotein (SEQ ID No.: 4) as disclosed in Figure lb. The isolated proteins are preferably essentially pure. Preferably the protein sequence is at least 70% identical, and more preferably the protein sequences are at least 80% identical to the RhBG or Rhbg glycoproteins. Yet more preferably the protein sequences are at least 85%, even more preferably at least 90% and optimally 95-98% identical to the RhBG or Rhbg glycoproteins. Peptides of at least 4 amino acids in length are preferred. More preferably the peptides are at least 5 amino acids in length and more preferably still the peptides are at least 6 amino acids in length.

Yet further the invention provides an isolated protein having an epitope that is specifically bound by an antibody which specifically binds the RhBG glycoprotein or by an antibody which specifically binds the Rhbg glycoprotein. The isolated protein may be glycosylated or unglycosylated.

In yet another aspect the invention provides a fusion protein containing a fragment of a protein or peptide sequence of greater than about 4-6 amino acid in length with at least 60% sequence identity to the RhBG cDNA or to the Rhbg proteins or peptides disclosed in figure la. In a particular embodiment the fusion protein contains an epitope of the RhBG glycoprotein (SEQ ID No.:3) or Rhbg glycoprotein (SEQ ID No.:4). In a particularly preferred embodiment the fusion protein has RhBG or Rhbg activity. The RhBG or Rhbg activity includes for example a transporter activity, and in a preferred embodiment the RhBG or Rhbg activity is an ion transporter activity which is NH₄ ⁺ ion transporter activity.

In yet another further aspect the invention provides a fusion protein comprising an amino acid sequence at least 60% identical to the amino acid sequence of RhBG glycoprotein (SEQ ID No.: 3) or Rhbg glycoprotein (SEQ ID No.: 4) as disclosed in Figure lb further comprising a detectable peptide or a capture epitope. Examples of a detectable peptide include flag epitopes for which specifically binding high affinity antibodies are readily available, such as the major epitope of the influenza virus HA antigen. Examples of capture epitopes include GST and polyhistidine residues.

The invention also provides antibodies that specifically binds to an epitope of RhBG glycoprotein or an epitope of Rhbg glycoprotein. These antibodies may be polyclonal or monoclonal. In particular embodiments the antibodies bind an epitope of the N-terminal extracellular region, an extracellular loop, an intracellular loop or the C-terminal intracellular region of the RhBG glycoprotein or the Rhbg glycoprotein. The antibodies may be fragments that retain binding characteristics of the polyclonal or monoclonal antibody, such as Fab fragments or Fv fragments. The antibodies may be humanized r chimeric antibodies.

In a preferred embodiment the antibody binds an epitope of the extracellular loop, and in a particularly preferred embodiment the epitope is an epitope of exoloop 6 that has an amino acid sequence encoded by the peptide acetyl-AKGQRSATSQAVYQLFC-amide (aa377-392) of SEQ ID No.: 17.

In another preferred embodiment the antibody binds an epitope of the C- terminal intracellular region, and in a particularly preferred embodiment the epitope is an epitope encoded by the peptide acetyl-CTETQRPLRGGESDTRA-OH (aa440-455) of SEQ ID No.:18. Further, in yet another aspect the invention provides the following gene specific oligonucleotide probes useful in detecting Rh B type genes in various tissue or cell samples or in situ:

SEQ ID No. :5 (21N) CCAGCTGGGATCTGTAGAGGA

SEQ ID No. :6 (24N) CGTGAGAGGAACAGCCCGAAGTAG

SEQ ID No.:7 (24N) CCAAATGTGTGAATTGTCATGGAC

SEQ ID No.:8 (21N) ATCTCTTTCGGGGCTGTTCTG

SEQ ID No.:9 (20N) TGAGAGATGCTGGAGGGTCC

SEQ ID No. : 10 (24N) TC(T/C)ATGAC(C/T)AT(C/T)CACAC(C/A)TTTGG

SEQ ID No.: 11 (21N) GTT(G/A)TG(G/A)AC(A/T)CC(G/A)CATGTGTC

SEQ ID No.: 12 (20N) AGCCTGCAGAGTGTGTTTCC

SEQ ID No. : 13 (22N) AAACCTGGTCCTCGAAGCATTG

SEQ ID No.: 14 (30N) CCGCTCGAGTTAGGCCTGAGTGTCTGCCTC

SEQ ID No.: 15 (29N) GAAGATCTGAGATCGCAGCCCAACCCATG

SEQ ID No. : 16 (27N) CGGGATCCAAGCTACCCTTTCTGGACT

Further the invention provides an isolated nucleic acid molecule comprising a functional RhBG regulatory region. In a preferred embodiment the functional RhBG regulatory region comprises the nucleotide sequence of SEQ ID No.: 19 (disclosed in Figure lc) or functional fragments thereof. Functional fragments are fragments that provide physiological regulation of RhBG, including but not limited to RNA polymerase regulation, transcription factor regulation, hormonal regulation and other factors that impart normal physiological regulation to RhBG.

Yet further provided is a hybrid gene under Rh type B gene regulation comprising an upstream nucleic acid regulatory sequence of the RhBG gene and a coding sequence of a gene to be regulated. Examples of coding regions of genes which may be usefully regulated include any structural gene, including for example those that encode readily detectable gene products such as β-galactosidase, β- lactamase and green fluorescent protein, GFP. The hybrid gene may comprise an upstream nucleic acid regulatory sequence found within the sequence disclosed in Figure lc. (SEQ ID No.: 19). The upstream regulatory region includes one or more of the following sites: Lyf-1, CdxA, Oct-1, AML-la, GATA-1, GATA-2, GATA-3, MZF1, SRY, HNF-3b, HFH-2, Spl, Nkx-2 and the translational stop codons TAA and TGA.

In a preferred embodiment the hybrid gene comprises a nucleic acid sequence found within the sequence disclosed in Figure lc (SEQ ID No.: 19) up to the ATG at the translational start site at position +1. In a yet another preferred embodiment the hybrid gene comprises an upstream nucleic acid regulatory sequence up to the mRNA start site at position -39.

The upstream RhBG regulatory region may further be incorporated into a hybrid, recombinant or mutant gene useful as a drug target for screening potentially active compounds or compound libraries for modulation, including activation or inhibition of the activity of the hybrid gene. Such hybrids including a reporter gene or detectable moiety are of particular utility in drug screening. The compounds identified are of great utility in modulating the RhBG activity, including transporter activity, particularly ion transporter activity and more particularly NH₄ ⁺ ion transporter activity. Such compounds are useful in the treatment of disorders and diseases involving renal tissues, hepatic tissues, ovary and skin follicle and papillae, particularly end stage renal and hepatic diseases, as well as any other condition related to RhBg activity. The modulator compounds are administered in an effective dose to modulate the activity of an Rh type B transporter in formulations well known in the art.

In yet another further aspect the invention provides a method of detecting an epitope of Rhbg or RhBG glycoprotein in a sample, said method comprising: contacting the sample with an antibody that specifically binds to an epitope of RhBG glycoprotein or an Rhbg glycoprotein under conditions suitable for binding, assessing the specific binding to the antibody, thereby detecting the presence of an epitope of Rhbg or RhBG glycoprotein in the sample.

Also, in a further aspect the invention provides a method of detecting an Rhbg or RhBG nucleotide sequence in a sample, said method comprising: Providing a nucleic acid sample, contacting the sample with a nucleic acid probe that hybridizes under conditions suitable for hybridization to a nucleotide sequence of greater than about 20 bases in length with at least 75% sequence identity to the RhBG cDNA or to the Rhbg cDNA disclosed in Figure la., followed by detecting the nucleic acid probe hybridized to the sample, thereby detecting the presence of an Rhbg or RhBG nucleotide sequence in the sample. In particular embodiments of the method, the sample may be immobilized on a suitable support, and a washing step may be incorporated to remove unhybridized nucleic acid probe.

GENERAL METHODS

Labelling of nucleic acid probes- Methods for labelling oligonucleotide probes have been described. See for example, Leary et al., Proc. Natl. Acad. Sci. USA 80:4045 (1983); Renz and Kurz, Nucl. Acids Res. 12:3435 (1984); Richardson and Gumport, Nucl. Acids Res. 11:6167 (1983); Smith et al., Nucl. Acids Res. 13:2399 (1985); Meinkoth and Wahl, Anal. Biochem. 138:267 (1984); and Ausubel, F.M. et al. (Eds.) Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 1999.

The detectable moiety employed as a label for the nucleic acid probe may be radioactive. Some examples of useful radioactive labels include P, I, I, S, ¹⁴C, and ³H. Use of radioactive labels have been described in U.K. patent 2,034,323, U.S. patents 4,358,535, and 4,302,204. Some examples of non-radioactive moieties useful as labels include enzymes, chromophores, heavy atoms and molecules detectable by electron microscopy, and metals detectable by their magnetic properties.

Some useful enzymatic labels include enzymes that cause a detectable change in a substrate. Some useful enzymes and their substrates include, for example, horseradish peroxidase (pyrogallol and o-phenylenediamine), beta-galactosidase (fluorescent beta-D-galactopyranoside), and alkaline phosphatase (5-bromo-4-chloro- 3-indolyl phosphate/nitro blue tetrazolium). The use of enzymatic labels have been described in U.K. 2,019,404, EP 63,879, in Ausubel, F.M. et al. (Eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York (1999), and by Rotman, Proc. Natl. Acad. Sci. USA 47:1981-1991 (1961). Site directed mutagenesis- Synthetic or naturally occuring DNA may be subjected to mutagenesis at predetermined locations and screened for clones expressing the mutated protein; See, for example, Zoller and Smith, Nucl. Acids Res. 10:6487-6500 (1982); Methods Enzymol. 100:468-500 (1983); DNA 3:479-488 (1984); Kunkel, T.A. et al., Methods Enzymol. 154:367-382, Academic Press, Inc., New York (1987); Uhlmann, E., Gene 71:29-40 (1988); Myers, R.M. et al, Science 229:242-246 (1985); Myers, R.M. et al, Methods Enzymol. ]_55, 501-527, Academic Press, Inc., New York (1987); and Current Protocols in Molecular Biology, Ausubel, F.M. et al. (Eds.), John Wiley & Sons, Inc., New York , (1999).

Sequence comparisons: Alignments of nucleic acid coding sequences and of amino acid sequences of proteins, and assessment of the percent homologies (including identities and similarities) may also be performed to provide further examples of sequences of the present invention. For searches and ^' alignments of sequences the BLAST homology search program is available on the internet at http://www.ncbi.nlm.nih.gov giving %> homology determinations according to the above defined criteria.

MATERIALS AND EXEMPLIFIED METHODS

Cloning of Mouse Rhbg and Human RhBG cDNAs - A Blast search (27) with the mouse Rhag cDNA (22) as a query identified a homologous expressed sequence tag

(clone AA798527) from the mouse skin tissue. Gene-specific primers (GSPs) in either sense (s) or antisense (a) were designed to isolate the mouse Rhbg gene by the method of rapid amplification of cDNA ends (RACE). For 5' RACE, 1 μg of cellular total RNA prepared from mouse liver was reverse-transcribed with the gene specific primer

GSP-E4al, SEQ ID No.:5 (5'CCAGCTGGGATCTGTAGAGGA3'). The resultant partial cDNA product was tailed with dCTP, as described in the RACE kit (Version

2.0, Life Technologies, Inc.), and then amplified twice with supplied adapter primers and GSPs:

E4a2, SEQ ID No.:6 (5'CGTGAGAGGAACAGCCCGAAGTAG3') and

E4a3, SEQ ID No.:7 (5'CCAAATGTGTGAATTGTCATGGAC3'), respectively.

The 3' RACE reaction employed two GSPs: These were E3sl, SEQ ID No.:8 (5ΑTCTCTTTCGGGGCTGTTCTG3') and

E4sl SEQ ID No.: 9 (5'TGAGAGATGCTGGAGGGTCC3').

To clone human RhBG, two degenerate primers,

SEQ ID No.: 10 (5'TC(T/C)ATGAC(C/T)AT(C/T)CACAC(C/A)TTTGG3') and

SEQ ID No.: 11 (5'GTT(G/A)TG(G/A)AC(A/T)CC(G/A)CATGTGTC3') were used in

RT-PCR of liver total RNA. These synthetic oligonucleotides define conserved regions in mouse Rhbg coding for a partial sequence of TM6 and endoloop 5, respectively. The 447-bp band of RT-PCR products was cut out from native 5%

PAGE, eluted, and sequenced. The Rhbg and RhBG full length cDNA forms were assembled using their GSP located in the 5' untranslated region (UTR) and 3' exon 10

(E10), respectively.

Sequence Analysis and Structure Prediction — The nucleotide and amino acid (aa) sequences of RhBG or Rhbg were analyzed with ClustalW program, Kyte-Doolittle hydropathy plot, or Chou-Fasman secondary structure algorithm packed in LaserGene software (DNASTAR). Dendrogram was constructed by multiple sequence alignment using ClustalW, and aa sequence identity/similarity was derived from pairwise comparison using the J. Hein method.

Chromosomal Mapping by in Situ Hybridization and Linkage Analysis - The human RHBG gene was localized by fluorescence in situ hybridization (FISH), as described (28). The genomic probes used for FISH were two human BAG DNA clones (421 Gl 9 and 506J9), each containing an intact RhBG gene, as fingerprinted by exon- specific PCR.² The mouse Rhbg gene was assigned using the Afl II restriction fragment length polymorphism along with the Jackson BSS interspecific backcross panel [(C57BL/6jEi X SPRET/Ei) X SPRET/Ei] (29). The Afl II restriction enzyme made an extra cut in Rhbg intron 8 of the SPRET/Ei strain but not the C57BL/6jEi strain. Genomic DNA of the 94 progeny panel was amplified with GSP: E8s SEQ ID No.: 12 (5ΑGCCTGCAGAGTGTGTTTCC3') and E9a SEQ ID No.: 13 (5ΑAACCTGGTCCTCGAAGCATTG3'). The distribution of the Afl II polymorphism in the 94 progeny was computed to establish the linkage of Rhbg gene with known genetic markers. Northern Blot Analysis of RhBG and Rhbg Gene Expression - Human and mouse Northern blots (CLONTECH) retaining poly(A)⁺ RNA prepared from various tissues were hybridized with the ³²P-labeled RHBG and Rhbg cDNA probes, respectively. The human RHBG probe was 519-bp long and covered codon 1-173, whereas the mouse Rhbg probe was 849-bp long and spanned codon 173-455. The blots were hybridized and washed under highly stringent conditions. The human β-actin cDNA probe was used as a control.

RNA in Situ Hybridization to Mouse Embryos and Adult Tissues - RNA in situ hybridization was carried out as previously described (30). A 405-bp cDNA spanning the 3' portion of the mouse Rhbg gene (nt964-1368, see AF193808) was cloned in pCRScript SK(+) vector (Stratagene). To prepare P-labeled RNA hybridization probes, the above recombinant plasmid was made linear by either Bam HI (antisense direction) or Not I (sense direction) digestion and then transcribed in vitro by T7 and T3 RNA polymerases, respectively.

Construction of Expression Vectors - Full-length RhBG was cloned in pCR2.1 vector using Pfu DNA polymerase and GSP:

E10a( røI) SEQ ID No.: 14 (5'CCGCTCGAGTTAGGCCTGAGTGTCTGCCTC3') and E\s(BgR\) SEQ ID No.: 15 (5'GAAGATCTGAGATCGCAGCCCAACCCATG3'). All expression constructs were based on this plasmid and sequenced to preclude spurious mutations. To tag the green fluorescence protein (GFP) gene, RhBG was amplified with Els(Bgl II) and Ε\0a(Xho I) or Els(Bgl II) and E10a(Sα/ I), and inserted in the pEGFP-Cl or -N3 vector (CLONTECH). To generate RhBG C-tail (aa416-458) expression constructs, the corresponding coding region (ntl248-1377) was amplified by

E9s(BamE[) SEQ ID No.: 16 (5' CGGGATCCAAGCTACCCTTTCTGGACT 3') and Εl0a(Xho I), SEQ ID No.:14 (supra). The cDNA fragment was purified and cloned separately in pGEX-4Tl (Amersham Pharmacia Biotech) and pET30a (+) (Novagen). For translation and expression studies, full-length RhBG was also cloned separately in the pYES2 and pcDNA3.1/MycHisA vector (Invitrogen) using compatible BamH I andJ^zo I sites. Production of Polyclonal Antibodies against Human RhBG and Mouse Rhbg Proteins - The RhBG C-tail was expressed as a GST (glutathione-S-transferase) or a His₆- fusion peptide in E. coli BL21 cells and purified as previously described (26). To raise human RhBG antisera, five injections of GST-RhBG (300μg/each) in rabbits followed the standard method (31). To raise mouse Rhbg antisera, two short peptides, SΕQ ID No.: 17, acetyl-AKGQRSATSQAVYQLFC-amide (aa 377-392, corresponding to part of exoloop 6) and

SΕQ ID No.:18, acetyl-CTΕTQRPLRGGΕSDTRA-OH (aa 440-455, specifying the extreme C-terminus), were synthesized. They were purified, linked to keyhole limpet hemacyanin, and used for immunization in rabbits (31). All the antisera were affinity- purified before use.

Cell Culture, cDNA Transfection, and Confocal Microscopy - HΕK293, HepG2, and HeLa cells (ATCC) were grown in Dulbecco's modified Eagle's medium, as described (26). Trypsinized cells were seeded on a 6-well plate or coverglass (MatTek), cultured for 24 h, and then transfected with lipofectamine (Life Technologies). For confocal imaging, 3x10⁵ cells plated on coverglass were transfected with 1 μg of RHBG-GFP or GFP-RHBG plasmid and cultured for 24h.GFP was excited at 488nm with argon laser and the light emitted between 506-538nm was recorded for the fluorescein isothiocyanate filter. Images were collected from BioRad MRC600 confocal scan head on a Nikon Eclipse 200 microscope and were processed with Adobe Photoshop (V4.0).

In Vitro Transciption-Coupled Translation of Human RhBG — Full-length RhBG plasmids were used as DNA templates for in vitro transcription-coupled translation with a Promega kit and ³⁵S-methionine (15 mCi/ml, Amersham Pharmacia Biotech). RhBG cloned in pYES2 carried no tag, whereas that cloned in pcDNA3.1/MycHisA vector had a 3' in-frame fusion with the c-myc epitope sequence and six His codons. S-labeled RhBG or RhBG-Myc, treated with or without canine pancreatic microsomal membranes (CPMM)(Promega), was analyzed by 12%> SDS-PAGE.

Stable Expression of Human RhBG Protein - To attain stable expression, ~3xl0⁵ HEK293 cells were transfected with the RHBG-myc construct. Stable clones were selected in Dulbecco's modified Eagle's medium containing G418 (800μg/ml) and isolated as described (32).

Membrane Protein Preparation, N-glycanase Digestion, and Western Blotting Analysis - Membrane proteins from HEK293 stable cells, human RBC, or mouse liver, kidney, and heart tissues were prepared as described (33, 34). Protein was resuspended at lmg/ml in ice-cold buffer (10 mM HEPES, pH7.5, 1 mM MgCl₂, 250 mM sucrose), and aliquot was taken for N-glycanase digestion (PNGase F, New England BioLabs ) as specified by the supplier. The glycanase-digested and native proteins were subjected to 12% SDS-PAGE and blot-transferred onto Hybond membrane. Western blots were incubated with various primary antibodies specific for RhBG or Rhbg, which are denoted in figure legends. Protein bands were visualized using a chemiluminescent detection kit (Pierce).

EXAMPLES

Example 1. Primary cDNA and Amino Acid Structures of RHBG and Rhbg - The longest open reading frame is 1378-bp for human RHBG and 1369-bp for mouse Rhbg, which encode a polypeptide of 458 and 455 amino acids, respectively (Fig.l). In both cDNAs, the 5' UTR lacks a Kozak consensus (35), whereas the 3' UTR contains an atypical polyadenylation signal, GATAAA (see AF 193807 and AF193808).

The RhBG or Rhbg full-length cDNA predicted a polypeptide sequence of 458 or 455 amino acids. Like the erythroid (18-20, 22) and nonerythroid homologues (26), the first AUG codon of neither RHBG nor Rhbg mRNA resides in the typical Kozak context (35); nevertheless, several lines of evidence support its assignment as the genuine initiation signal for RhBG or Rhbg translation.

1) There are stop signals but no in-frame ATG triplets upstream of the -38 A major transcription start site in the 5' promoter of RHBG gene (see AF219977).

2) The size of human RhBG and mouse Rhbg proteins appears identical, regardless of whether they were produced in vitro or derived from stable cells or native tissues. 3) Consistent with the mRNA distribution, the specific expression of mouse Rhbg protein was confirmed by Western blots using antibodies raised against the deduced peptide sequences.

4) Most significantly, the assigned translation initiator is the only mefhionine N-terminal to the NHS sequon on exoloop 1 that was evidently glycosylated in RhBG and Rhbg proteins.

RHBG and Rhbg each have a very high G/C content (60% vs.58%), notably different from RHAG or Rhag (43% vs. 42%)(20,22), but similar to RHCG or Rhcg (58% vs. 55%) (26). At the protein level, RhBG and Rhbg are 85% identical and 94%> similar, the highest among all Rh protein pairs known to date. RhBG differs from Rhbg mainly by a 9-bp insertion (GCCGCGGGC for ⁸AAG¹⁰ at the N-terminus), a longer 3' UTR, and 26 nonconserved substitutions scattered on the polypeptide backbone (Fig.l). Whole-protein composition analysis is also highly comparable between RhBG and Rhbg, and both proteins possess a molecular mass of ~ 49.5 kDa and a net negative charge at physiological pH (Table 1). RhBG and Rhbg each have a single NX(S/T) N-glycosylation motif (⁴⁹ΝHS⁵¹ vs. ⁴⁶NHS⁴⁸, Fig.l) and thus are possibly expressed as glycoproteins. The noted structural features and high sequence identity define Rhbg and RhBG as a conserved orthologous group and suggest that the two proteins perform the same function in mice and humans.

Example 2. Comparison of RhBG and Rhbg with Erythroid and Nonerythroid Rh Members - Sequence comparison showed that RhBG/Rhbg is homologous to both erythroid RhAG/Rhag and nonerythroid RhCG/Rhcg pairs (Fig.l). This is largely due to a conservation of hydrophobic regions that may define the TM domains and adjacent residues. Notably, four blocks of sequences, the extreme N and C-termini, the portion around the N (S/T) motif, and the predicted exoloop 6, are very divergent among the three pairs. Like RhCG (26), RhBG is much less similar to the Rh polypeptides (18,19).

Secondary structure analysis predicted RhBG to be a polytopic protein with 12 putative TM domains (Fig.2). This topology is a conserved fold, because no gap occurs in the sequence spanning TM2-11 of all six proteins (Fig.l). Notably the D and E negative charges predicted to reside in TM4 or 5 are conserved, whereas the E- to-Q change in TM1 or 5 alternates among the three Rh protein pairs (Fig.l). RhBG may be similar to RhAG with N and C-termini facing the cytoplasm (36), but its TM profile and secondary structure are more akin to RhCG than RhAG (Fig.2). The secondary structural homology arises mainly from an increased exoloop size and higher sequence identity between RhBG and RhCG, although the two proteins differ entirely in their extreme C-terminal sequences (Fig. 1). Together, the results indicate that RhBG and Rhbg are new members of the Rh protein family possibly having functional properties distinct from other mammalian Rh homologues.

Example 3. Relationships between the Rh Family and the Amt. Superfamily - A connection of some Amt to erythroid Rh proteins was noted previously (17). However, due to the limited number of known sequences, the evolution and structural relationship between the Rh and Amt families was not clear. A similarity search using RhBG and Rhbg as queries showed that they were directly related to certain bacterial and archaeal Amt proteins (see below). This study provides a thorough analysis of available Rh and Amt protein sequences resulting in a better definition of their relationship.

As shown in Fig.3, members of the Amt superfamily are distributed in three major clusters. Cluster I consists of two subclasses, one from bacteria and archaeons (no.1-24) and the other from fungi including yeast (no.27-32). Two Amt from A. thaliana (no.25, 26) are also grouped here and may, in analogy to archaeal Amt (no.8- 11), result from horizontal genetic transfers (11,12). Cluster II (no.48-59) is, intriguingly, composed of Amt members from diverse organisms of the three domains of life including invertebrates. This cluster, with its branch point predating both the Rh family and Cluster I, might have served as a provider of ancestors for the evolution of the latter two clusters. Cluster III (no.62-70) is comprised of highly homologous Amt members that are present in plants only and occur as high-affinity NH⁺ ₄ transporters. Notably, the vast majority of Amt proteins are polytopic membrane proteins with 10-12 TM spanning segments.

With regard to members of the Rh family (no.33-47), they form a single distinct cluster that intercepts Cluster I and II of the Amt superfamily (Fig.3). This clustering placed all Rh members as a late divergent group possibly originating from one or more primitive Amt genes that had preexisted in Cluster II. All but the slime mold (a protozoan) homologue, Dd.RhgA, are of metazoan origins, including the most primitive living metazoan (sponge), invertebrates, fish, and mammals. These observations reinforce a structural as well as a likely functional relationship between the Rh and Amt proteins. In the case of human RhBG, it most resembles the Amt members from Cluster II that are present in cyanobacteria and archaeons, respectively (Fig.3). It is noted that 1) despite an extensive search, no Rh homologue other than Amt is found in bacteria, archaeons, fungi or plants; and 2) Rh and Amt coexist in the slime mold, nematode, and possibly fruit fly (13,23,26 and this study).

Example 4. Structural Homology and Divergence between RhBG and Amt Proteins — Detailed sequence analysis further revealed the features and structural homology between the RhBG and Amt proteins. One such example is shown in Fig.4. RhBG bears a similar degree of overall homology to AmtA and Amtl from two different cyanobacteria species. A comparable extent of sequence identity was noted between some divergent members within the Amt superfamily itself (3). Although the three proteins only share 57 identical aa residues, RhBG is characterized by a composite nature in many other sites, having sequence identities with either AmtA or Amtl (Fig.4). This feature leads to a much higher overall sequence similarity and is also evident when RhBG is aligned with other Amt from archaeons or bacteria (see Fig.3, no.8, 12, and 56 for examples). Moreover, many substitutions are conservative in nature or similar to the consensus of Rh glycoprotein homologues, including some 20 G-to-A or A-to-G changes (Fig.4). Of further significance is that the secondary structure or 12-TM topology is conserved between RhBG and the two Amt, particularly with regard to their internal portions.

Nevertheless, as revealed by sequence alignment (Fig.4), a number of structural differences between RhBG and the two Amt are worth mentioning. 1) Several major gaps are evident, although they are likely involved in variable surface loops. 2) The E/D negative charges conserved in the TM domains of various Rh glycoprotein homologues from mammals (Fig.l and data not shown) are not seen in the two Amt proteins. 3) The amino acid identity is dispersed largely in a patched manner, although the sequence similarity runs in longer stretches. 4) The Rh family members posses unique signatures (26) that are absent from the Amt family. Together, the observed structure homology and divergence may reflect a buildup of evolutionary events that transformed an ammonia assimilator in unicellular organisms into an ammonia eliminator in the animal kingdom.

Example 5. Chromosomal Assignment of Human RHBG and Mouse Rhbg Genes — To define the location of human RHBG gene, the genomic DNA isolated from BAC clones was labeled and used as FISH probes to paint interphase chromosomes. The FISH result showed that RHBG resides at lq21.3 of human chromosome 1 (Fig.5 A). This recognized a cis but unlinked relationship of RHBG with RHCED, the locus at lp34-36 encoding Rh blood groups (37), and a trans relationship with RHCG at 15q25 (26). Notably RHBG lies within the candidate region for autosomal dominant medullary cystic kidney disease (OMIM174000) (38). By linkage analysis, Rhbg showed no recombination with the Bglapl marker (lod score, 28.3). This placed Rhbg distal to Mab21/2 but proximal to Nprl on mouse chromosome 3, where many markers are syntenic to human lq21 containing RHBG (Fig.5B).

Example 6. Northern Blot Analysis of RHBG/Rhbg Expression — Northern blot analysis confirmed RHBG or Rhbg expression only in nonerythorid tissues (Fig.6). In human adult, RHBG was expressed as one major form in kidney but multiple forms in liver and ovary (at a moderate level) (Fig.6A). These mRNA species arose from alternative splicing events involving two distinct Alu repeats present in intron 1 of the RhBG gene. In human fetus, RHBG was expressed relatively strongly in kidney but only weakly in liver (Fig.6A). With regard to mouse Rhbg, it was comparably expressed in kidney and liver (Fig.6B, left). However, unlike the human counterpart, mouse Rhbg expression produced a single mRNA form and was not subjected to alternative splicing, suggesting a differential regulation. Although the ovary and skin tissues were not examined, they had identical expressed sequence tags of Rhbg as detected by Blast search (AI406901, AIO 11329, and AA798527). Rhbg transcripts were also evident in mouse embryos at 15 and 17-day gestation (Fig.6B, right). Thus, in a temporal order, Rhbg expression is later than erythroid Rhag or Rhced (22) but earlier than nonerythroid Rhcg (26).

Example 7. RNA in Situ Hybridization — RNA in situ hybridization provided further data on the sites of Rhbg expression in mouse embryos and adult tissues. Consistent with the pattern of gestational expression (Fig.6B), Rhbg showed a strong signal in the kidney and skin but a moderate signal in liver of 16.5-day embryos (Fig.7A). In adult skin, Rhbg was highly expressed in dermal hair follicles and papillae (Fig.7B, C). In adult kidney, Rhbg was widely and abundantly distributed in the cortex and the medulla (Fig.7D). Higher magnification suggested that Rhbg is mainly present in the epithelial linings of the renal convoluted tubules and Henle's loops (Fig.7E, F). In adult liver, the Rhbg signal was dispersed in a dotted fashion (Fig.7G) and was evidently confined to hepatocytes (Fig.7H, I). Although electron microscopy is ultimately revealing, these data show that the pattern of Rhbg expression does not overlap with that of Rhcg (26) in complex nonerythroid tissues.

Example 8. Localization of RhBG Protein at Subcellular Level - The subcellular location of RhBG was defined by confocal imaging of transiently expressed RhBG- GFP fusion proteins (Fig.8). Control cells (panel A, D, G) showed an even distribution of green fluorescence in the cytoplasm. However, the cells transfected with RhBG-GFP (panel B, E, H) or GFP-RhBG (panel C, F, I) displayed green fluorescence that was condensed mainly in the plasma membrane and in some intracellular granules. Time-lapse recording revealed a dynamic movement of those granules, likely indicating transport of RhBG from intracellular vesicles to the plasma membrane. Notably the same imaging pattern was observed in both homologous cells (panel B, C, E, F) and heterologous cells (panel H, I). Thus, similar to RhCG (26), the membrane biogenesis of RhBG is not cell-type specific. These results suggest that contrary to the RBC Rh polypeptides (39), nonerythroid Rh proteins possess intrinsic topogenic signals necessary for their transport and insertion into the plasma membrane.

Example 9. RhBG in vitro Translation and Processing in Microsomal Membranes - Since RhBG has only one NHS⁵¹ sequon (Fig.l) predicted to reside in the exoloop 1 (Fig.2), its glycosylation status was assessed by in vitro translation with CPMM incubation. In the absence of CPMM, in vitro translated RhBG, whether or not carrying the C-terminal Myc epitope and His₆ tags, migrated as a single band (Fig.9A). By SDS-PAGE analysis, the untagged and tagged RhBG species were estimated to have an apparent molecular mass of 38-40 and 42-44 kDa, respectively. The untagged RhBG was smaller than the predicted RhBG in size; this anomaly probably resulted from the high hydrophobicity of the protein (Table 1). Nevertheless, with added CPMM, the in vitro translated RhBG, in both untagged and tagged forms, increased in size and migrated as a broader band (Fig.9B). The difference between CPMM-treated and untreated RhBG appeared to match the size of a single N-linked glycan. These results indicate that the RhBG polypeptide underwent appropriate targeting, translocation, and processing (e.g. N-glycosylation) in microsomal membrane compartments.

Example 10. RhBG/Rhbg Protein Expression in Human Stable Cell Lines and in Mouse Native Tissues- To establish if RhBG is expressed as a glycoprotein in vivo, membrane proteins were isolated from stable HEK293 cells harboring the transfected RHBG-myc gene. Digestion with PNGase F followed by Western blot analysis confirmed RhBG to be an N-glycosylated membrane protein. As shown in Fig.lOA, the two blots probed with anti-RhBG C-tail antisera (left panel) and anti-Myc monoclonal antibody (right panel), respectively, displayed a seemingly identical banding pattern. Moreover, the deglycosylated RhBG-Myc from HEK293 cells (Fig.lOA, lanes 5,6) appeared in same size as in vitro translated RhBG-Myc (Fig.9A, lane 6), suggesting that the same translation initiator functions in vivo and in vitro. Nevertheless, the size of the N-glycosylated product from stable expression was larger than that of the glycosylated species induced by CPMM incubation (Fig.9B). This observation implies that RhBG may be more efficiently glycosylated under in vivo conditions. ^λ

To analyze the expression and biochemical properties of Rh type B glycoprotein homologues in native tissues, polyclonal antibodies specific for mouse Rhbg were developed and tested on Western blots. As shown in Fig.l OB, Rhbg is specifically expressed in liver and kidney but not heart, consistent with the results of RΝA analysis (Figs.6B and 7). The native Rhbg protein was estimated to have an apparent molecular mass of 50-55 kDa. It was of similar size in both the liver and kidney forms (Fig.l OB, lane 3, 5), but was, as expected, slightly smaller than the stably expressed RhBG having C-terminal tags (Fig.lOA, lane 3, 4). PNGase F treatment deglycosylated Rhbg (Fig.l OB, lane 4, 6), resulting in a product that had a size similar to the in vitro translated unglycosylated RhBG (Fig.9A, lane 6). Taken together, these results provide evidence for ⁴⁹NHS⁵¹ and ⁴⁶NHS⁴⁸ to be the most probable attachment site of N-linked glycan on the exoloop 1 of RhBG and Rhbg, respectively.

Comparison of RhBG/Rhbg with other known homologues provides insights into the protein structure and molecular evolutionary genetics of the entire family. The Rh protein homologues from diverse organisms have been subdivided into three interrelated groups (23), which may or may not carry N-linked glycans. The primitive group consists of homologues from unicellular slime molds, multicellular protozoans, and metazoans (nematode and arthropods) that lack RBC or such formed organs as liver and kidneys. The biological function(s) of these Rh homologues is still unknown. The erythroid group includes only members homologous to human RhAG and RhCE/D that coexist in RBC of all mammals (40,41). Here, we show that RhBG/Rhbg is more similar to RhCG/Rhcg (26) than to the RBC Rh proteins (18-20) at the level of primary and secondary structures. This similarity, with the observed tissue distribution, clearly delineates RhBG and Rhbg as novel members of the expanding nonerythroid group. Despite its separate chromosomal location and unique C-terminal segment, RhBG/Rhbg resembles other members of the family by having a highly conserved 12-TM fold. The shared TM fold is a signature characterized by an invariant packing of internal TM2-11 segments, including the conserved positioning of membrane-embedded D/E negative charges. This topologic structure defines a conserved domain similar to a large repertoire of transporters that act as either antiporters or symporters that lack an ATP-binding cassette (42).

RhAG and RhCE/D homologues are coexpressed in and largely restricted to erythroid cell lineages in both mice and humans (18-20,22). This coordinate has been hypothesized to stipulate assembly of the Rh multisubunit complex required for specific functional adaptation in the RBC membrane (43, 44). In contrast, the nonerythroid homologues often have a much broader spectrum of tissue distribution. Although both are expressed in the kidney, Rhbg and Rhcg are clearly localized to discrete regions of the organ and are not overlapping in other complex tissues. In brief, Rhbg is likely expressed in the convoluted tubules and Henle's loops, while Rhcg is mainly concentrated in the collecting tubules (26). Further, RhBG/Rhbg is expressed in liver, skin, and ovary, but RhCG/Rhcg is expressed highly in the testis seminiferous tubules and moderately in several other tissues, namely, brain, pancreas, and prostate (26).

Amt proteins have not yet been described in vertebrates including mammals, despite their presence in such low-order animals as nematodes (13). The Rh proteins may act as membrane transporters participating in homeostatic preservation in many organisms, given their structural and topological conservation and wide distribution in slime molds to humans (23). Similarity searching has linked Amt to human RBC Rh proteins (17). We define the entire Rh family including Rhbg/RhBG as a single phylogenetic group that occurs in Eucarya only but falls into the Amt superfamily.

Concerning the evolution relationship, our finding that the Rh cluster joins two Amt clusters provides evidence that the Rh family is derived from NH₄ ⁺ transporter ancestors. Indeed, extensive search shows that no expressed sequence tags from the human genome other than those of Rh are more homologous to Amt members. It is worth noting that Amt members of Cluster II are distributed in diverse organisms from three life domains, while Clusters I and III are relatively homogeneous in organismal classification. The current rooting indicates a late origin and duplication of Rh precursor genes from Cluster II ancestors. This might explain the gap in the evolution from unicellular to multicellular organisms since Rh is absent in bacteria and yeast but present in D. discoideum (23), a unicellular slime mold with a multicellular developmental program (46). Structurally, members of the Rh family share sequence homology with that of the Amt superfamily in a composite fashion and with some degrees of variation. For example, RhBG/Rhbg is most similar to the cyanobacterial and (to a lesser extent) archaeal Amt proteins that are members present in the Cluster II subfamily.

The Rh homologue occurs as a single-copy gene in the slime mold and fruit fly but in form of multiple copies in mammalian species (23). With the identification of Rhbg and RHBG, four and five gene paralogues are now known to reside on four and three different chromosomes in the mouse and human genomes, respectively. This type of expansion of the Rh family during mammalian evolution implies two possible outcomes with regard to functional specification. 1) If they serve to transport the same or similar ligand(s) (e.g. NH⁺ ₄ or its derivatives), the Rh paralogues may differ in kinetics and regulatory modes to meet the physiological requirements of the target cells or organs. A noted example as such is the duplication and expression of various homologues for urea transport in ureotelic animals (47). 2) Conversely the multiple Rh homologues may each perform a completely different function, say, each transporting a structurally unrelated ligand. An example of this is the yeast MEP2 protein, which not only acts as an NH⁺ ₄ permease, but also regulates pseudohyphal differentiation (48).

It should be understood that the invention is not to be limited only to the particular sequences, variants, formulations or methods described. The sequences, variants, formulations and methodologies may vary, and the terminology used herein is for the purpose of describing particular embodiments. Those of skill in the art will readily recognize the full scope of the invention described herein.

The nucleotide sequences reported in this paper have been submitted to the GenBank™ / EBI Data Bank with accession numbers AF193807, AF193808, and AF219977.

REFERENCES

1. Kleiner, D. (1981) Biochim. Biophy. Acta 639, 41-52

2. Soupene, E., He, L., Yan, D., and Kustu, S. (1998) Proc. Natl. Acad. Sci.

U.S.A. 95, 7030-7034.

3. Van Dommelen, A., Keijers, V., Vanderleyden, J., and de Zamaroczy, M. (1998)

J. Bacteriol. 180, 2652-2659

4. Montesinos, ML, Muro-Pastor, A.M., Herrero, A., and Flores, E. (1998) J. Biol.

Chem. 273, 31463-31470

5. Marini, A.M., Vissers, S., Urrestarazu, A.,and Andre, B. (1994) EMBO J. 13,

3456-3463

6. Marini A.M.,Soussi-Boudekou,S., Vissers, S., Andre, B. (1997) Mol.CellBiol. 17,

4282-4293

7. Ninnemann, O., Jauniaux, J.C., and Frommer, W.B. (1994) EMBO J. 13, 3464-

3471

8. von When, N., Gazzarrini, S., Ninnemann, O., & Fromer W.B. (1999) Plant Cell.

11, 937-948 9. Tyerman, S.D., Whitehead, L.F., and Day, D.A. (1995) Nature 378, 629-632

10. Kaiser, B.N., Finnegan, P.M., Tyerman, S.D., Whitehead, L.F., Bergersen, F.J.,

Day, D.A., and Udvardi, M.K. (1998) Science 281,1202-1206

11. Bult, C.J., White, O., Olsen, G.J., Zhou, L., Fleischmann, R.D., Sutton, G.G.,

Black, J.A., Fitzgerald, L.M., Clayton, R.A., Gocayne, J.D., et al. (1996) Science 273, 1058-1073

12. Klenk, H.P., Clayton, R.A., Tomb, J.F., White, O., Nelson, K.E., Ketchum, K.A.,

Dodson, R.J., Gwin, M., Hickey, E.K., Peterson, J.D., et al. (1997) Nature 390, 364-370.

13. Wilson, R, Ainscough, R, Anderson, K., Baynes, C, Berks, M., Bonfield, J.,

Burton, J., Connell, M., Copsey, T., Cooper, J., et al. (1994) Nature 368, 32- 38

14. Good, D.W., and Knepper, M.A. (1985) Am. J. Physiol. 248, F459-F471

15. Tizianello, A., Deferrari, G., Garibotto, G., Robaudo, C, Acquarone, N., and

Ghiggeri, G.M. (1982) J. Clin. Invest. 69, 240-250

16. Knepper, M.A. (1991) Kidney Int. (Suppl). 40, 95-102

17. Marini, A., Urrestarazu, A., Beauwens, R., Andre, B. (1997)Trends Biochem.Sci.22, 460-461

18. Cherif-Zahar, B., Bloy, C, Le Van Kim, C, Blanchard, D., Bailly, P., Hermand,

P., Salmon, C, Cartron, J.-P., and Colin, Y. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 6243-6247

19. Avent, N.D., Ridgwell, K., Tanner, M.J.A., and Anstee, D.J. (1990)Biochem.J.

271, 821-825

20. Ridgwell, K., Spurr, N.K., Laguda, B., MacGeoch, C, Avent, N.D., Tanner,

M.J.A. (1992) Biochem. J. 287, 223-228

21. Askari, A. (1966) J. Gen. Physiol. 49, 1147-1160

22. Liu, Z., and Huang, C.-H. (1999) Biochem. Genet. 37, 119-138

23. Huang, C.-H., Liu, Z., and Cheng, G.J. (2000) Semin. Hematol. 34, 150-165

24. Seack,J., Pancer,Z., Muller,I.M., and Muller,W.E. (1997) Immunogenet. 46,493-

498

25. Thorpe, S.J. (1997) Biotest 5, 523-528

26. Liu, Z., Chen, Y., Mo, R, Hui, C.-c, Cheng, J.-F., Mohandas, N., and Huang, C-

H. (2000) J. Biol. Chem. 275, 25641-25651 27. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. (1997) Nucleic Acids Res. 25, 3389-3402

28. Heng, H.H.Q., Squire, J., and Tsui, L.C. (1992) P.N.A.S.U.S.A. 89, 9509-9513

29. Rowe, L.B., Nadeau, J.H., Turner, R, Frankel, W.N., Letts, V.A., Eppig, J.T.,

Ko, M.S.H., Thurston, S.J., and Birkenmeier, E.H. (1994)Mammal Genome 5,253-274

30. Hui, C.-c, and Joyner, AL. (1993) Nature Genet. 3, 241-246

31. Harlow, E., and Lane, D. (1988) Antibodies: A Laboratory Manual 1st Ed., Cold

Spring Harbor Laboratory, Cold Spring Harbor, NY

32. Sambrook, J., Fristch, E.F., and Maniatis, T. (1989)Molecular Cloning: A

Laboratory Manual 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

33. Fong, A.D., Handlogten, M.E., and Kilberg, M.S. (1990) Biochim. Biophy. Acta

1022, 325-332

34. Russo, D., Wu, X., Redman, CM., and Lee, S. (2000) Blood 96, 340-346

35. Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8148

36. Eyers,S.A.,Ridgwell,K.,Mawby,W.J.,Tanner,M.J.(1994) J.Biol.Chem.269,6410-

6417

37. Cherif-Zahar, B., Mattei, M.-G., Le Van Kim, C, Bailly, P., Cartron, J.-P., and

Colin, Y. (1991) Hum. Genet. 86, 398-400

38. Christodoulou, K., Tsingis, M., Starvrou, C, Eleftheriou, A., Papapavlou, P.,

Patsalis, P.C., Ioannou, P., Pierides, A., and Constantinou, D.C. (1998) Hum. Mol. Genet. 7, 905-911

39. Hermand, P., Mouro, I., Huet, M., Bloy, C, Suyama, K, Goldstein, J., Cartron,

J.-P., and Bailly, P. (1993) Blood 82, 669-676

40. Matassi, G, Cherif-Zahar, B., Persole, G. Raynal, V., and Cartron, J.-P. (1999) J.

Mol. Evol. 48, 151-159

41. Huang, C.-H., Liu, Z., Apoil, A.-P., and Blancher, A. (2000) J. Mol. Evol.51, 76-

87

42. Henderson, P.J. (1993) Curr. Opin. Cell Biol. 5, 708-721

43. Huang, C.-H. (1998) J. Biol. Chem. 273, 2207-2213

44. Matassi, G., Cherif-Zahar, B., Raynal, V., Rouger, P., and Cartron, J.-P. (1998)

Genomics 47, 286-293 45. McKusik, V.A. (1997) Online Mendelian Inheritance in Man (OMIMTM), Johns

Hopkins University and the National Center for Bio/Technology information, National Library of Medicine, Baltimore and Bethesda, MD

46. Thomason, P., Traynor, D., and Kay, R. (1999) Trends Genet. 15, 15-19

47. Bankir, L.T., and Trinh-Trang Tan, M.M. (2000) Exp. Physiol. 85, 243S-252S

48. Lorenz, M.C., and Heitman, J. (1998) EMBO J. 17, 1236-1247

Claims

CLAIMS:

1. An isolated nucleic acid comprising a nucleotide sequence having at least 75% sequence identity with SEQ ID No.: 1 or SEQ ID No.: 2.

2. An isolated nucleic acid which hybridizes under stringent conditions with a nucleic acid having the nucleotide sequence of SEQ ID No.:l, or SEQ ID No.: 2, or a sequence complementary to SEQ ID No.:l, or SEQ ID No.: 2.

3. The isolated nucleic acid according to claim 1 encoding a protein consisting of an amino acid sequence at least 60%> identical to SEQ ID No.:3 or SEQ ID No.. -4.

4. The isolated nucleic acid according to claim 1 encoding a protein having RhBG or Rhbg activity.

5. The isolated nucleic acid according to claim 4 wherein the RhBG or Rhbg activity is transporter activity.

6. The isolated nucleic acid according to claim 5 wherein the transporter activity is ion transporter activity.

7. The isolated nucleic acid according to claim 6 wherein the ion transporter activity is NH₄ ⁺ ion transporter activity.

8. A fragment of the nucleic acid molecule according to claim 1 encoding a protein having RhBG or Rhbg activity.

9. The fragment of a nucleic acid molecule according to claim 8 wherein the RhBG or Rhbg activity is transporter activity.

10. The fragment of a nucleic acid molecule according to claim 9 wherein the transporter activity is ion transporter activity.

11. The fragment of a nucleic acid molecule according to claim 10 wherein the ion transporter activity is NH₄ ⁺ ion transporter activity.

12. A fragment of the nucleic acid molecule according to claim 1 encoding a protein having an epitope of RhBG or an epitope of Rhbg.

13. The fragment of the nucleic acid molecule according to claim 12 wherein the epitope is an epitope of Rhbg.

14. The fragment of the nucleic acid molecule according to claim 13 wherein the epitope of Rhbg is an epitope of exoloop 6.

15. The fragment of the nucleic acid molecule according to claim 14 wherein the epitope of exoloop 6 is within the amino acid sequence of SEQ ID No. : 17.

16. The fragment of the nucleic acid molecule according to claim 13 wherein the epitope of Rhbg is an epitope of the C-terminal intracellular region.

17. The fragment of the nucleic acid molecule according to claim 16 wherein the epitope of the C-terminal intracellular region is within the amino acid sequence of SEQ ID No.: 18.

18. A recombinant vector comprising the nucleic acid molecule of claim 1.

19. The recombinant vector of claim 18 encoding a protein having an amino acid sequence at least 60% identical to SEQ ID No.:3 or SEQ ID No.:4.

20. The recombinant vector of claim 19, wherein the protein has transporter activity.

21. The recombinant vector of claim 20, wherein transporter activity is ion transporter activity.

22. The recombinant vector of claim 21, wherein the ion transporter activity is NH₄ ⁺ ion transporter activity.

23. A host cell transformed with the recombinant vector of claim 18.

24. The host cell of claim 23 encoding a protein having an amino acid sequence at least 60% identical to SEQ ID No.:3 or SEQ ID No.:4.

25. The host cell of claim 24 wherein the protein has transporter activity.

26. The host cell of claim 25 wherein transporter activity is ion transporter activity.

27. The host cell of claim 26 wherein the transporter, activity is NH ⁺ ion transporter activity.

28. An isolated protein or peptide comprising an amino acid sequence at least 60% identical to SEQ ID No. : 3 or SEQ ID No. : 4.

29. The isolated protein or peptide according to claim 28 comprising an amino acid sequence encoded by the nucleic acid molecule of claim 1.

30. The isolated protein or peptide according to claim 28 comprising an epitope that is specifically bound by an antibody which specifically binds the RhBG glycoprotein or by an antibody which specifically binds the Rhbg glycoprotein.

31. The isolated protein or peptide according to claim 28 consisting of the amino acid sequence of SEQ ID No.:3, or SEQ ID No.:4.

32. The isolated protein or peptide according to claim 28 which is unglycosylated.

33. The isolated protein or peptide according to claim 28 which is glycosylated.

34. A fusion protein comprising a fragment of the protein or peptide of claim 28.

35. The fusion protein according to claim 34 comprising an epitope of Rhbg glycoprotein or RhBG glycoprotein.

36. The fusion protein according to claim 34 having transporter activity.

37. The fusion protein according to claim 36 having ion transporter activity.

38. The fusion protein according to claim 37 having NH₄ ⁺ ion transporter activity.

39. The fusion protein according to claim 38 comprising a detectable peptide.

40. The fusion protein according to claim 34 comprising a capture epitope.

41. An antibody that specifically binds to an epitope of RhBG glycoprotein or an epitope of Rhbg glycoprotein.

42. The antibody of claim 41 wherein the antibody is a monoclonal antibody.

43. The antibody of claim 41 which is a polyclonal antibody.

44. The polyclonal antibody of claim 43 which specifically binds an epitope of Rhbg glycoprotein.

45. The polyclonal antibody of claim 44 wherein the epitope of Rhbg is an epitope of the N-terminal extracellular region, an extracellular loop, an intracellular loop or the C-terminal intracellular region.

46. The polyclonal antibody of claim 45 wherein the epitope is an epitope of an extracellular loop.

47. The polyclonal antibody of claim 46 wherein the epitope of the extracellular loop is an epitope of exoloop 6.

48. The polyclonal antibody of claim 47 wherein the epitope of exoloop 6 has an amino acid sequence within SEQ ID No.: 17.

49. The polyclonal antibody of claim 45 wherein the epitope is an epitope of the C-terminal intracellular region.

50. The polyclonal antibody of claim 49 wherein the epitope of the C-terminal intracellular region has an amino acid sequence within SEQ ID No.: 18

51. A gene specific probe selected from the group consisting of SEQ ID No.:5, SEQ ID No.:6, SEQ ID No.:7, SEQ ID No.:8, SEQ ID No.:9, SEQ ID No.:10, SEQ ID No.:l l, SEQ ID No.:12, SEQ ID No.:13, SEQ ID No.:14, SEQ ID No.:15 and SEQ ID No.:16.

52. An isolated nucleic acid molecule comprising a functional RhBG regulatory region.

53. The isolated nucleic acid according to claim 52 wherein the functional RhBG regulatory region comprises the nucleotide sequence of SEQ ID No.: 19.

54. The isolated nucleic acid according to claim 52 wherein the functional RhBG regulatory region comprises a fragment of the nucleotide sequence of SEQ ID No.:19.

55. A hybrid gene under Rh type B gene regulation comprising an upstream nucleic acid regulatory sequence of the RhBG gene and a coding sequence of the gene to be regulated.

56. The hybrid gene according to claim 55 wherein the upstream nucleic acid regulatory sequence comprises a nucleic acid sequence within SEQ ID No.: 19.

57. The hybrid gene according to claim 56 wherein the upstream nucleic acid regulatory sequence comprises a nucleic acid sequence from SEQ ID No.: 19 up to ATG at position +1.

58. The hybrid gene according to claim 56 wherein the upstream nucleic acid regulatory sequence comprises a nucleic acid sequence from SEQ ID No.: 19 up to position -39.

59. A method of detecting an Rhbg or an RhBG glycoprotein in a sample, said method comprising:

(i) contacting the sample with an antibody that specifically binds to an epitope of RhBG glycoprotein or an Rhbg glycoprotein under conditions suitable for binding,

(ii) assessing the specific binding to the antibody,

(iii) thereby detecting the presence of an epitope of Rhbg or RhBG glycoprotein in the sample.

60. A method of detecting an Rhbg or RhBG nucleotide sequence in a sample, said method comprising:

(i) Providing a nucleic acid sample,

(ii) contacting the sample with a nucleic acid probe that hybridizes to a nucleotide sequence having at least 75% sequence identity with SEQ ID No.: 1 or SEQ ID No.: 2, under conditions suitable for hybridization,

(iii) detecting the nucleic acid probe hybridized to the sample, thereby detecting the presence of an Rhbg or RhBG nucleotide sequence in the sample.