WO2001096371A2

WO2001096371A2 - Adipose-related gene

Info

Publication number: WO2001096371A2
Application number: PCT/EP2001/006713
Authority: WO
Inventors: Günter BRÖNNER; Thomas Ciossek; Cord Dohrmann; Thomas HÄDER; Mike Rothe; Roland Wehr; Dorothea Rudolph; Bettina Rudolph
Original assignee: Develogen Ag
Priority date: 2000-06-16
Filing date: 2001-06-13
Publication date: 2001-12-20
Also published as: AU2001285743A1; WO2001096371A3

Abstract

The present invention relates to a nucleic acid molecule encoding a (poly)peptide regulating, causing or contributing to obesity in an animal or a human wherein said nucleic acid molecule (a) hybridizes under herein defined conditions to the complementary strand of a nucleic acid molecule encoding the amino acid sequence disclosed ehrein; (b) hybridizes under herein defined conditions to the complementary strand of a nucleic acid molecule comprising the nucleic acid sequence disclosed herein; (c) is degenerate with respect to the nucleic acid molecule of (a); (d) encodes a (poly) peptide which is at least 35 % and up to 99,8 % identical to a herein disclosed amino acid sequence representing a (poly)peptide regulating, causing or contributing to obesity; (e) encodes a (poly)peptide which is at least 35 % identical to amino acid sequences as disclosed herein; (f) comprises a portion that is amplified in a polymerase chain reaction carried out on a Drosophila, mouse or human cDNA library or on genomic Drosophila, mouse or human DNA with set(s) of primers herein defined under conditions as disclosed herein, or (g) encodes a (poly)peptide which comprises at least one WD40 motif and at least one TPR-motif.

Description

Adipose-related gene

The present invention relates to a nucleic acid molecule encoding a (poly)peptide regulating, causing or contributing to obesity in an animal or a human wherein said nucleic acid molecule (a) hybridizes under herein defined conditions to the complementary strand of a nucleic acid molecule encoding the amino acid sequence disclosed herein; (b) hybridizes under herein defined conditions to the complementary strand of a nucleic acid molecule comprising the nucleic acid sequence disclosed herein; (c) is degenerate with respect to the nucleic acid molecule of (a); (d) encodes a (poly)peptide which is at least 35% and up to 99,8% identical to a herein disclosed amino acid sequence representing a (poly)peptide regulating, causing or contributing to obesity; (e) encodes a (poly)peptide which is at least 35% identical to amino acid sequences as disclosed herein; (f) comprises a portion that is amplified in a polymerase chain reaction carried out on a Drosophila, mouse or human cDNA library or on genomic Drosophila, mouse or human DNA with set(s) of primers herein defined under conditions as disclosed herein, or (g) encodes a (poly)peptide which comprises at least one WD40 motif and at least one TPR-motif.

The present invention furthermore relates to nucleic acid molecules encoding a mammalian (poly)peptide involved in the regulation of body weight in a mammal. In addition, the present invention relates to vectors comprising said nucleic acid molecule, methods of producing (poly)peptides encoded by said nucleic acid molecule, to antibodies specifically recognizing a (poly)peptide encoded by said nucleic acid molecule.

Furthermore, the present invention provides for methods of identifying (poly)peptides and/or genes involved in the regulation of body weight or of compounds influencing the expression of the nucleic acid molecules as described herein. Additionally, the present invention relates to methods of producing compositions comprising the compounds of the invention. The present invention also relates to methods for identifying (a) compound(s) which specifically bind(s) the (poly)peptide(s) of the invention and/or for identifying (a) compound(s) which function as binding target(s) for the (poly)peptides and/or nucleic acid molecules of the invention. In addition, methods are disclosed which relate to the identification of (an) agent(s) which are capable of modulating the interaction of a (poly)peptide of the invention with a binding target/agent. Finally, pharmaceutical and diagnostic compositions as well as kits are disclosed which comprise the compounds of the invention.

Several documents are cited throughout the text of this specification. The disclosure content of each of the documents cited herein (including any manufacturer's specifications, instructions, etc.) are hereby incorporated by reference.

Obesity is a complex disorder of appetite regulation and/or energy metabolism controlled by specific biological factors. Besides severe risks of illness such as diabetes, hypertension and heart disease, individuals suffering from obesity are often isolated socially.

Human obesity is strongly influenced by environmental and genetic factors, whereby the environmental influence is often a hurdle for the identification of (human) obesity genes.

Nevertheless, major advances have recently been made in identifying components of the homeostatic system(s) that regulate body weight/mass. Several candidate genes have been associated with mammalian/human obesity or its metabolic complications (Kopelman, Nature 404 (2000), 634-643). For example, one key element of the homeostatic system regulating body weight/mass is the hormone leptin (Friedman, Nature 395 (1998), 763-770; Friedman, Nature 404 (2000), 632- 634; Chicurel, Nature 404 (2000), 538-540). Leptin is produced by fat tissue and reports nutritional information to key regulatory centers in the hypothalamus. A decrease in body fat leads to a decreased level of leptin, which in turn stimulates food intake. Furthermore, decreased leptin levels activate a hormonal response that is characteristic of a starvation state (Ahima, Nature 382 (1996), 250-252). Leptin acts on nerve cells in the brain and modulates this function. Several neuropeptides are implicated in the control of energy homeostasis, inter alia, neuropeptide Y (NPY) and agouti-related protein (AGRP), _α-melanocyte- stimulating hormone (_α-MSH) and cocaine - and amphetamine - regulated transcript (CART); see Friedman (2000), loc. cit.; Schwartz, Nature 404 (2000), 661-671 ; Erickson, Science 274 (1996), 1704-1707; Fan, Nature 385 (1997), 165- 168.

The neuronal circuits furthermore regulate further effector molecules which have recently been identified (for review see Lowell, Nature 404 (2000), 652-660). These effector molecules comprise uncoupling proteins (UCP1 , UCP2 and/or UCP3; Lowell (2000), loc. cit.) and peroxisome proliferator-activated receptor-γ (PPAR-γ) co-activator (PGC-I), a key regulator of the genes that regulate thermogenesis (Puigserver, Cell 92 (1998), 829-839).

Furthermore, energy balance and thereby body weight/mass is modulated by the above mentioned neuropeptides and further (neurogenic) factors, like pro- opiomelanocortin (POMC), the precursor of _α-MSH (Elias, Neuron 23 (1999), 775- 786). Mutations in POMC are implicated in obesity (Krude, Nature Genetics 19 (1998), 155).

Additional mutations are described which cause modified and/or altered leptin responses. For example, in 3-5% of extreme obese individuals, mutations in the MSH receptor (MC4R), leading to leptin resistance, have been described (Friedman (2000), loc. cit; Vaisse, Nature Gen. 20 (1998), 113-114). Mutations in the leptin receptor itself are also associated with extreme obesity (Clement, Nature 392 (1998), 398-401 ).

Obesity is not to be considered as a single disorder but a heterogeneous group of conditions with (potential) multiple causes. Therefore, obesity is also characterized by elevated fasting plasma insulin and an exaggerated insulin response to oral glucose intake (Kolterman, J. Clin. Invest 65 (1980), 1272-1284) and a clear involvement of obesity in type 2 diabetes mellitus can be confirmed (Kopelman (2000), loc. cit.; Colditz, Arch. Int. Med. 122 (1995), 481-486).

As with other complex diseases, rare obesity mutations have been described which have been identified by mendelian pattern of inheritance and position mapping (see Barsh, Nature 404 (2000), 644-650). With one or two notable exceptions, the map positions of obesity loci identified by quantative studies do not correspond to defined (mouse) obesity mutations such as ob (leptin), fat (carboxypeptidase E) or tubby (tubby protein). Map positions have been determined for some clinical syndromes, like Prader-Willi, Cohen, Alstrom, Bardet- Biedl or Borjeson-Forssman-Lehman, but the causative genes have not yet been isolated (see Barsh (2000), loc. cit.; Ohta, Am. J. Hum. Gen. 64 (1999), 397-413; Kolehmainen, Eur. J. Hum. Gen. 5 (1997), 206-213; Russell-Eggitt, Ophtalmology 105 (1998), 1274-1280; Mathews, Am. J. Med. Gen. 34 (1989), 470-474; Bruford, Genomics 41 (1997), 93-99). The "human obesity gene map" contains entries for more than 40 genes and 15 chromosomal regions in which published studies indicate a possible relationship to adiposity or a related phenotpye (Barsh (2000), loc. cit, Perusse, Obes. Res. 7 (1999), 111-129). Said "obesity gene map" comprises, however, mainly large chromosomal areas and does not provide for distinct genes involved in obesity.

Many drugs tested as an appetite suppressant interfere with monoamine- neurotransmitters (serotonin, noradrenalin, dopamine, histamine). 5-HT (5- hydroxytryptamine) is released in various sites of the hypothalamus, a brain region believed to be involved in the regulation of food intake. D-fenfluramine is a 5-HT releaser and reuptake inhibitor mostly used in combination with Phentermine (Fen- Phen) to treat obesity. Fen-Phen was withdrawn from the market due to potential heart valve defects (Wadden, Obes. Res. 7 (1999), 309-310). Recently sibutramine, a novel 5-HT and noradreanlin reuptake inhibitor (Knoll Pharma; Bray, Obes. Res 7 (1999), 189-198) was shown to support weight loss when used to support a low calorie diet. Other drugs interfering with monoamine- neurotransmitter effects (e.g. drugs so far used as anti-depressants) are also discussed for their efficacy in the treatment of obesity (Sayler, Int. J. Obes. Realt. Metab. Disord. 18 (1994), 742-751 ; Wadden, Obes. Res. 3 (1995), 549-557).

Even if several candidate genes have been associated with human obesity or its metabolic complications, the identification of additional molecules that influence obesity and/or adiposity will provide insights into the molecular basis of these diseases and may lead to potential strategies to treat and/or prevent pathological body-weight/body mass regulations. Therefore, the technical problem underlying this invention was to provide for means and methods for modulating (pathological) metabolic conditions, influencing thermogenesis, body-weight regulation and/or energy homeostatic circuits. The solution to said technical problem is achieved by providing the embodiments characterized in the claims.

Accordingly, the present invention relates to a nucleic acid molecule encoding a (poly)peptide regulating, causing or contributing to obesity in an animal or a human wherein said nucleic acid molecule

(a) hybridizes at 65°C in a solution containing 0.2 x SSC and 0.1% SDS to the complementary strand of a nucleic acid molecule encoding the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 52 and/or SEQ ID NO: 54;

(b) hybridizes at 65°C in a solution containing 0.2 x SSC and 0.1% SDS to the complementary strand of a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 51 and/or SEQ ID NO: 53;

(c) is degenerate with respect to the nucleic acid molecule of (a);

(d) encodes a (poly)peptide which is at least 35%, preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 75%, more preferably at least 85%, most preferably at least 95% and up to 99,8% identical to SEQ ID NO: 4;

(e) encodes a (poly)peptide which is at least 35%, preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 75%, more preferably at least 85%, more preferably at least 95% and most preferably at least 99% identical to the amino acid sequence as depicted in SEQ ID NO: 2, 6, 8, 52 or 54;

(f) comprises a portion that is amplified in a polymerase chain reaction carried out

(fa) on an Drosophila cDNA library or an genomic Drosophila DNA with the following set(s) of primers:

(i) forward primer as depicted in SEQ ID NO: 9; backward primer as depicted in SEQ ID NO: 10; (ii) forward primer as depicted in SEQ ID NO: 11 ; backward primer as depicted in SEQ ID NO: 12; (iii) forward primer as depcited in SEQ ID NO: 36; backward primer as depicted in SEQ ID NO: 37; (iv) forward primer as depicted in SEQ ID NO: 38; backward primer as depicted in SEQ ID NO: 39; (v) forward primer as depicted in SEQ ID NO: 47; backward primer as depicted in SEQ ID NO: 48; or (vi) forward primer as depicted in SEQ ID NO: 49; backward primer as depicted in SEQ ID NO: 50;

(fb) on genomic Drosophila DNA with the following set(s) of primers:

(vii) forward primer as depicted in SEQ ID NO: 13; backward primer as depicted in SEQ ID NO: 14; or (viii) forward primer as depicted in SEQ ID NO: 15; backward primer as depicted in SEQ ID NO: 16;

(fc) on a mouse cDNA library or on genomic mouse DNA with the following set of primers:

(ix) forward primer as depicted in SEQ ID NO: 17; backward primer as depicted in SEQ ID NO: 18; (x) forward primer as depicted in SEQ ID NO: 19; backward primer as depicted in SEQ ID NO: 20; (xi) forward primer as depicted in SEQ ID NO: 40; backward primer as depicted in SEQ ID NO: 41 ; (xii) forward primer as depicted in SEQ ID NO: 42; backward primer as depicted in SEQ ID NO: 43; (xiii) forward primer as depicted in SEQ ID NO: 47; backward primer as depicted in SEQ ID NO: 48; or (xiv) forward primer as depicted in SEQ ID NO: 49; backward primer as depicted in SEQ ID NO: 50; or (xv) forward primer as depicted in SEQ ID NO: 76; backward primer as depicted in SEQ ID NO: 77;

(fd) on a human cDNA library or on genomic human DNA with the following set of primers: (xv) forward primer as depicted in SEQ ID NO: 21 ; backward primer as depicted in SEQ ID NO: 22; (xvi) forward primer as depicted in SEQ ID NO: 23; backward primer as depicted in SEQ ID NO: 24; or (xvii) forward primer as depicted in SEQ ID NO: 25; backward primer as depicted in SEQ ID NO: 26; (xviii) forward primer as depicted in SEQ ID NO: 40; backward primer as depicted in SEQ ID NO: 44; (xix) forward primer as depicted in SEQ ID NO: 45; backward primer as depicted in SEQ ID NO: 46; (xx) forward primer as depicted in SEQ ID NO: 47; backward primer as depicted in SEQ ID NO: 48; or (xxi) forward primer as depicted in SEQ ID NO: 49; backward primer as depicted in SEQ ID NO: 50; or (xxii) forward primer as depicted in SEQ ID NO: 62; backward primer as depicted in SEQ ID NO: 63; or (xxiii) forward primer as depicted in SEQ ID NO: 65; backward primer as depicted in SEQ ID NO: 66; under the following conditions: 1 min denaturing at 94°C, 1 min annealing at 55°C, 2 min extension at 72°C for 35 cycles; or (g) encodes a (poly)peptide which comprises at least one WD40-motif and at least one TPR-motif.

The term "regulating, causing or contributing to obesity" relates to the functional properties of a (poly)peptide to modify, either directly or indirectly the physiological status of energy metabolism. Said metabolism may be anabolic or catabolic. In this context, obesity is to be understood as a complex disorder of appetite regulation and/or energy metabolism, influencing body weight/body mass of an individual. Said obesity comprises disorders involving an excess storage of fat. Said obesity may be simple obesity or a certain condition wherein obesity is an associated feature (e.g. genetic syndroms associated with hypogonadism, e.g. Prader-Willi syndrome, hypothroidism, Crushing's syndrome, Stein-Leventhal syndrome, corticosteroid intake, hypothalamic damage, etc.). Further disorders/diseases related to obesity, modified status of energy metabolism and/or body weight/body mass of an individual are disclosed herein below.

Obesity is thereby defined as a significant increase above ideal weight and may be measured by body mass index, an indicator of adiposity or fatness. Further parameters for defining obesity are waist circumferences, skinfold thickness and bioimpedance (see, inter alia, Kopelman (1999), loc. cit.). However, the term "obesity" as used herein is not limited to obesity in mammals, specifically humans, but also comprises obesity in fish, preferably zebrafish or in frogs, preferably Xenopus laevis or in lower animals, like arthropods, preferably flies, more preferably fruit flies or like nematodes, preferably C. elegans.

The terms "hybridizes" and "hybridizing" as employed in context of the present invention preferably relate to stringent conditions as, inter alia, defined herein above, e.g. 0.2 x SSC, 0.1 % SDS at 65°. Said conditions comprise hybridization as well as washing conditions. However, it is preferred that washing conditions are more stringent than hybridization conditions. By setting the conditions for hybridization, the person skilled in the art can determine if strictly complementary sequences or sequences with a higher or lower degree of homology are to be detected. The setting of conditions is well within the skill of the artisan and to be determined according to protocols described, for example, in Sambrook, Molecular Cloning, A Laboratory Manual, 2^nd edition (1989), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY or Hames and Higgins, "Nucleic acid hybridization, a practical approach", IRL Press, Oxford (1985). Non-stringent hybridization conditions for the detection of homologous and not exactly complementary sequences may be set at 6 x SSC, 1 % SDS at 65°C.

The molecules hybridizing to the nucleic acid molecules of the invention also comprise fragments, derivatives and allelic variants of the above-described nucleic acid molecules which encode (poly)peptides regulating, causing or contributing to obesity described in the present invention. In this regard, fragments are defined as parts of the nucleic acid molecules, which are long enough in order to encode said (poly)peptides. The term derivatives means that the sequences of these hybridizing molecules differ from the sequences of the above-mentioned nucleic acid molecules at one or more positions and that they exhibit a high degree of homology to these sequences. Hereby, homology means a sequence identity of at least 35 %, in particular an identity of at least 45 %, preferably of more than 50 %, more preferably more than 60%, more preferably more than 70%, more preferably more than 80% and still more preferably a sequence identity of more than 90 %. The person skilled in the art may employ computer programs and packages in order to determine homology values. Generally, nucleotide or amino acid sequence identities/homologies can be determined conventionally by using known computer programs such as BLASTIN, BLASTP, NALIGN, PALIGN or bl2seq using particular algorithms to find the best segment of homology between two segments. As shown in the appended examples, in the context of the present invention the comparative analysis of the percentage of identities at the amino acid level are preferably obtained using the "bl2seq" program from NCBI using the following parameters: Open Gap Cost: 11 and Gap Extension Cost: 1. However, the program allows any positive integer for said value(s).

Furthermore, in the context of the present invention comparative analysis of the percentage of identities at the nucleotide level of the different nucleic acid sequences, on the other hand, are preferably obtained using the "matcher" program of the EMBOSS package using the following parameters: Gap penalty value: 16 and Gap length value: 4 alternatively, the program accepts any positive integer. It was found that these parameters are the best suited to calculate the percentage of identity over the reference nucleotide or amino acid sequences, especially considering the different levels of homology among the different sequences analyzed. Any deviations occurring when comparing with the above- described nucleic acid molecules may be caused by deletion, substitution, insertion or recombination.

Moreover, homology means that functional and/or structural equivalence exists between the respective nucleic acid molecules or the proteins they encode. The nucleic acid molecules, which are homologous to the above-described molecules and represent derivatives of these molecules, are generally variations of these molecules that constitute modifications which exert the same biological function. These variations may be naturally occurring variations, for example sequences derived from other organisms, or mutations, whereby these mutations may have occurred naturally or they may have been introduced by means of a specific mutagenesis. Moreover, the variations may be synthetically produced sequences. The allelic variants may be naturally occurring as well as synthetically produced variants or variants produced by recombinant DNA techniques. The proteins encoded by the various variants of the nucleic acid molecules according to the invention exhibit certain common characteristics. Biological activity, molecular weight, immunological reactivity, conformation etc. may belong to these characteristics as well as physical properties such as the mobility in gel electrophoresis, chromatographic characteristics, sedimentation coefficients, solubility, spectroscopic properties, stability, pH-optimum, temperature-optimum etc.

Preferably, the above described nucleic acid molecule encodes a polypeptide regulating, causing or contributing to obesity in an animal, wherein said (poly)peptide is at least 35% and up to 99,8% identical to the amino acid sequence as depicted in SEQ ID NO: 4. Said amino acid sequence depicts a (poly)peptide encoded, inter alia, by the nucleic acid sequence as depicted in SEQ ID NO: 3 and represents the wild-type protein "adipose" (adp) of Drosophila, which has surprisingly been shown to be involved in the regulation of body weight/body mass and more specifically, in the regulation of obesity. As demonstrated in the appended examples, it has furthermore surprisingly been found that the wild-type gene can rescue the obesity phenotype of adp mutant flies. Therefore, it is believed that the here described product provides for means of regulation of obesity (and/or body weight/mass as shown herein below).

Furthermore, the nucleic acid molecule of the invention may encode a (poly)peptide regulating, causing or contributing to obesity which is at least 35% identical to the Drosophila mutant ADP protein as depicted in SEQ ID NO: 2. Said protein is encoded, e.g. by the nucleic acid sequence as depicted in SEQ ID NO: 1.

The mutant adp-gene as described in this invention has been isolated as described herein from the "adp" mutant. Said mutant was first described in Doane, J. Exp. Zool. 145 (1960) 1-21. Even if this adp Drosophila mutant was first phenotypically described 41 years ago, common cloning strategies had been unsuccessful in elucidating the genetic basis for this mutant fly phenotype and said phenotype could not be linked to a specific genotype (see, inter alia, Doane, DIS 77 (1996), 78-79). As documented in the appended examples, it has surprisingly been found that a frameshift causing deletion leading to a premature termination of the predicted wild-type ADP-protein as described herein above is responsible for the development of an obesity/adipose phenotype in the adp mutant Drosophila.

The present invention also relates to (a) nucleic acid molecule(s) which encode a (poly)peptide regulating, causing or contributing to obesity which is at least 35% identical to the amino acid sequences as depicted in SEQ ID NOs: 6, 8, 52 or 54. Said SEQ ID NOs: 6, 8, 52 or 54 depict the wild-type ADP "adipose" gene product/protein/(poly)peptide and splice variants from mouse and human, respectively.

Said sequences show a homology of 37% to the above described Drosophila ADP wild-type sequence and comprise, like the Drosophila sequence the unique and novel structural arrangement of so called WD40 and tetratricopeptide repeat (TPR) domains/regions, as defined below.

In addition, the here disclosed (poly)peptides regulating, causing or contributing to obesity (or being involved in the regulation of body weight in a mammal, see infra) comprise a novel, previously undefined region which is highly homologous in the Drosophila, mouse and human ADP protein (see SEQ ID NOs: 30, 31 and 32). Intercalated between the N-terminal WD40-like sequences and the TPR-like sequences is a region, in which software tools as mentioned herein below (procite profile , pfam, hmmr) do neither detect WD40 or TPR like motifs nor other known specific protein domains. These sequences are conserved between Drosophila, mouse and human and are considered to have functional relevance. Therefore, this region was called ADP-domain and is depicted in SEQ ID NOs: 30, 31 and 32. Between Drosophila and mouse or human 58% of the amino acids are identical and 72% are similar in said ADP-domain. Between mouse and human 100% of the amino acids are identical. It is envisaged that mutations in the above discussed wild-type sequences of ADP- protein from mouse and human lead to phenotypic and/or physiological changes which regulate, lead to, cause or contribute to obesity. Said mutations may comprise deletions, substitutions, additions, recombinations, inversions and the like.

Additionally, the present invention relates to a nucleic acid molecule encoding a (poly)peptide regulating, causing or contributing to obesity in an animal which comprises a portion that is amplified in a PCR reaction carried out on a Drosophila cDNA library or on a genomic Drosophila DNA employing the sets of primers as depicted in SEQ ID NOs: 9, 10; 11 , 12; 36, 37; 38, 39; 47, 48; or 49 and 50. Primers as depicted in SEQ ID NO:s 9, 10, 11 and 12 comprise, in addition to specific nucleotides of the nucleic acid molecules of the invention, further nucleotides which may be employed in cloning strategies of PCR fragments. Said nucleotides comprise nucleotides 1 to 10 in SEQ ID NO: 9, nucleotides 1 to 11 in SEQ ID NO: 10, nucleotides 1 to 9 in SEQ ID NO: 11 and nucleotides 1 to 10 in SEQ ID NO: 12. Preferably, said Drosophila cDNA library is an adult Drosophila cDNA library. In addition, the present invention relates to nucleic acid molecules as defined herein above which comprise a portion that is amplifiable in a PCR reaction carried out on a mouse cDNA library or an genomic mouse DNA with sets of primers as depicted in SEQ ID NOs: 17, 18; 19, 20; 40, 41 ; 42, 43; 47, 48; 49, 50 or 76 and 77. Preferably, said mouse cDNA is an embryonic cDNA, more preferably said mouse cDNA is an adipocyte and/or a brain cDNA library. Similarly, the present invention relates to a nucleic acid molecule encoding a (poly)peptide as defined herein and which comprises a portion that is amplified in a PCR carried out on a human cDNA library or on genomic human DNA with a set of primers as shown in SEQ ID NOs: 21 , 22; 23, 24; 25, 26; 40, 44; 45, 46; 47, 48 ; 49, 50; 62, 63; or 65 and 66. Preferably, said human cDNA library is an adipocyte and/or a brain cDNA library. It is also envisaged that the above recited primer pairs may be employed in further combination and that thereby nucleic acid molecules of the invention are amplified. For example, the use of forward primer as depicted in SEQ ID NO: 17 and backward primer as depicted in SEQ ID NO: 20 generates amplification products for two ADP splice variants. The smaller amplification product is 948 bp whereas the larger amplification product is 1131 bp in size (see also appended examples). Furthermore, the invention relates to nucleic acid molecules encoding (poly)peptides as defined herein above and which comprise a portion that is amplifiable in a PCR reaction carried out on genomic Drosophila DNA with primer set(s) as shown in SEQ ID NOs: 13 and 14 or 15 and 16. Said PCR reactions are preferably carried out under the following conditions: 1 min denaturing at 94°C, 1 min annealing at 55°C, 2 min extension at 72°C for 35 cycles. Additional sets of primers capable of amplifying the nucleic acid molecules of the invention may be easily deduced by the person skilled in the art from the sequences disclosed herein. Further sets of primers are, inter alia, exemplified in the appended examples.

However, it is also envisaged that different (but similar) PCR conditions as disclosed herein may be employed. For example, the person skilled in the art may modify denaturing, annealing- and or extension-times and temperatures. Said modifications may be, inter alia, in the range of 0.2 to 0.5 min in the extension time.

Modifications in the temperature may involve +/- 3°C in the denaturing step, +/-

5°C in the annealing step and +/- 3°C in the extension step.

The person skilled in the art is aware of the fact that said modifications depend on a variety of factors which comprise, inter alia, buffer constitution, buffer concentration, DNA and/or enzyme concentrations, purities, PCR-equipement, etc.

Furthermore, the present invention relates to a nucleic acid molecule encoding a (poly)peptide as described herein above (or involved in the regulation of body weight as described infra) which comprises at least one WD40- and at least one TPR-motif.

The WD40 motif was first described in the β-subunit of heterotrimeric G-proteins that transduce signals across the plasma membrane (Fong, Proc. Natl. Acad. Sci. USA 83 (1986), 2162-2166). The X-ray structure of the human Gβ subunit revealed that WD40 repeats contribute to blade-like sheets composed of antiparallel β-strands which form a propeller structure representing the contact surface for protein-protein interactions (Sondek, Nature 379 (1996), 369-374). Like TPRs (tetratricopeptide repeat), WD40 domains serve as a recognition module connecting partner proteins involved in intracellular protein signalling and sorting networks (Smith, Trends Biochem. Sci. 24 (1999), 181-185). Recently, a splice variant of the human Gβ3 subunit was found to be associated with obesity in humans (Siffert, J. Am. Soc, Nephrol. 10 (1999), 1921-1930).

TPR (tetratricopeptide repeat) protein-protein interaction motifs are present in a number of functionally different proteins that are involved in mitochondrial import, cell cycle control, gene regulation, and other functions (Blatch, Bioessays 21 (1999), 932-939). It was suggested that the conformation of the TPR motifs could be affected by ligands thereby regulating the activity of TPR proteins (Goebl, Trends Biochem. Sci. 16 (1991 ), 173-177). Interestingly many of the TPR proteins have been found to interact with functionally related proteins containing WD40 domains (Blatch (1999), loc. cit).

Here, it was surprisingly found that the described adipose protein from fruit fly, mouse and human comprises both described structural domains. Without being bound by theory, it can be speculated that the here described (poly)peptides which regulate, cause or contribute to obesity or are involved in the regulation of body weight/body mass may represent signalling pathway intermediates that serve as recognition components connecting partner proteins in intracellular signalling complexes and/or networks. However, it is also envisaged and should not be excluded that the (poly)peptides of the present invention comprise enzymatic activities or other functions.

Specific regions comprising WD40 and TPR domains are deducible by methods known to the person skilled in the art, like Procite profile (Hofmann, Nucleic Acids Res. 27 (1999), 215-219), pfam (Schultz, Nucleic Acids Res. 28 (2000), 231-234), or hmmr (Profile Hidden Markov Models Bioinformatics 14 (1998), 755-763) searches. SEQ ID NOs: 33, 34 and 35 depict the WD40/ADP/TPR/WD40 domains of wildtype ADP-protein/(poly)peptide from Drosophila, mouse and human. From these sequences it can readily be deduced that the Drosophila ADP-protein comprises at least 6 WD40-domains and 3 TPR-domains. Similarly, the herein described mouse and/or human ADP-protein comprises several WD40 and TPR domains; see appended examples and figures.

WD40/TPR specific domains may, inter alia, be detected employing specific primers and/or primer sets. It is in particular preferred that primers disclosed in SEQ ID NOs: 36 to 50 are employed for this purposes. For example, primer pairs as depicted in SEQ ID NOs: 36 and 37 or 38 and 39 are preferred to amplify WD40/TPR regions in Drosophila. Primer pairs as depicted in SEQ ID NOs: 40 and 41 or 42 and 43 may be employed in order to detect WD40/TPR-specific domains in mouse. Human WD40/TPR-domains may be detected employing primer pairs as depicted in SEQ ID NOs: 45 and 46 or 40 and 44. However, the present invention also provides for example of degenerate primers/set of primers capable of hybridizing to DNA isolated from different species and usable to detect and/or amplify the above described WD40/TPR domain(s) in said species, see, inter alia, primers/set of primers as depicted in SEQ ID NOs: 47 and 48 or 49 and 50. Other primers/sets of primers capable of specifically hybridizing to and/or amplifying WD40/TPR related domains may be deduced by conventional methods as described herein.

In a preferred embodiment the above described nucleic acid molecule of the invention is DNA. In this context, it is understood that the term "nucleic acid molecule" comprises coding and, wherever applicable, non-coding sequences, like, inter alia, 5' and 3' non-coding sequences. Said 5' and/or 3' non-coding regions may comprise (specific) regulatory sequences ensuring initiation of transcription and optionally poIy-A signals ensuring termination of transcription and/or stabilization of the transcript. Additional 5' and 3' non-coding regions may comprise promoters and/or transcriptional as well as translational enhancers. Furthermore, the term "nucleic acid molecule" may comprise intron(s) and splice variants, where applicable.

The term DNA as used herein comprises, inter alia, cDNA as well as genomic DNA. Furthermore, the nucleic acid molecule of the invention may also be a RNA molecule such as mRNA. In accordance with the present invention, the term "nucleic acid molecule" comprises also any feasible derivative of a nucleic acid to which a nucleic acid probe may hybridize. Said nucleic acid probe itself may be a derivative of a nucleic acid molecule capable of hybridizing to said nucleic acid molecule or said derivative thereof. The term "nucleic acid molecule" further comprises peptide nucleic acids (PNAs) containing DNA analogs with amide backbone linkages (Nielson, Science 254 (1991 ), 1497-1500).

In this context it has to be stressed that nucleic acid molecules of the invention may also be chemically synthesized, using, inter alia, synthesizers which are known in the art and commercially available, like, e.g. the ABI 394 DNA-RAN- synthesizers.

As mentioned herein above, the present invention relates to a nucleic acid molecule which comprises a portion that is amplified in a polymerase chain reaction carried out on a cDNA or genomic library with the above described set of primers. It is hereby particularly preferred that said library is a Drosophila melanogaster, mouse or human library. Such DNA libraries are known in the art and may be obtained from commercial distributors, like Stratagene (see Cat. No. 937249; human adipocyte library) or Clontech (see Cat. No. HL50187; human brain library). Even more preferred are mouse embryonic or human adipocyte cDNA libraries or brain libraries. These mammalian libraries are also well known in the art and, inter alia, obtainable from commercial sources like, Stratagene, Clontech etc. The preparation of cDNA libraries is well known in the art and described, inter alia, in Sambrook, loc. cit.

Similarly, the nucleic acid molecule of the invention may comprise a portion that is amplified in a PCR reaction carried out on a genomic library or isolated genomic DNA with primers/primer set(s) as disclosed herein above. Said library, as mentioned herein above, may be a Drosophila melanogaster library, preferably an adult cDNA or genomic library. Said genomic DNA may be directly isolated from Drosophila. Particularly preferred PCR-primers for amplifying said portions from a Drosophila melanogaster library, for example the commercially available Stratagene library (Cat. No. 946601), or from (directly) isolated genomic DNA as described herein above comprise the primers as shown in SEQ ID NOs: 13, 14, 15 and 16. Other primers which may be employed comprise those as shown in SEQ ID NOs: 9, 10; 11 , 12; 36, 37; 38, 39; 47, 48; 49, 50; 62, 63; 65, 66; or 76 and 77.

Furthermore, the present invention also relates to nucleic acid molecules which comprise portions which may specifically be amplified in PCR reactions on Drosophila, mouse and/or human genomic DNA (or cDNA libraries) with, inter alia, specific primer sets. Said primer sets may comprise degenerate primers as depicted in SEQ ID NOs: 47, 48, 49 and 50. It is hereby preferred that primer pairs like SEQ ID NOs: 47 and 48 and SEQ ID NOs: 49 and 50 are employed. As shown in the appended examples, primer pairs generating nucleic acid molecules encoding for the inventive polypeptides (or fragments thereof) and comprising specific "tags" may be preferably employed when practizing this invention. Such primer pairs comprise, inter alia, the primers as shown in SEQ ID NOS: 62, 63; 65, 66; or 76 and 77, as well as further primers/primer pairs employed in the appended examples. As pointed out herein above, said primer/primer pairs are capable of specifically amplifying domains which are characterized by a WD40/TPR motif as described herein above.

In a yet more preferred embodiment the present invention relates to a nucleic acid molecule, wherein said nucleic acid molecule encodes the amino acid sequence of SEQ ID NO: 2 or wherein said nucleic acid molecule comprises the nucleic acid sequence of SEQ ID NO: 1.

The amino acid sequence as depicted in SEQ ID NO: 2 comprises a (poly)peptide of 385 amino acids which functions as a mutated form of the above described Drosophila ADP-protein (Adipose-Protein). Wherein the wild-type protein in Drosophila (see SEQ ID NO: 4) comprises 628 amino acids, the here described mutated version comprises a truncated protein, which lacks parts of the above described WD40-ADP-TPR-WD40 motif of the Adipose protein. In particular, this mutated version of the ADP protein is identical to the wild type protein up to and including amino acid No. 383, as depicted in SEQ ID NO: 4. Then, two new amino acids are generated due to the frameshift in the nucleotide sequence. This is an I instead of a T in position 384 and a W instead of an A in position 385 (see SEQ ID NO: 2). A stop codon terminates the mutated protein, the rest of the C-terminus is missing.

The above described truncated version of the Drosophila ADP protein is due to a frame shift, caused by a 23 bp deletion of the wildtype Drosophila adp gene (see

SEQ ID NO: 3) as exemplified in the appended examples. This mutant version of the adp Drosophila DNA (see SEQ ID NO: 1 ) results in a premature termination of the ADP protein, leading to the above described truncated version of ADP.

Without being bound by theory, it is envisaged that the truncated version of the here described ADP (poly)peptide may be a neomorph/gain of function allele. It has, for example, been shown that a splice variant of the WD40- comprising human G-beta3 subunit leads to higher activity of said truncated protein than the wildtype (see, Siffert, loc. cit.). Nevertheless, within the scope of this invention are also mutant ADP-forms and/or splice variants which lead to lower activity and/or to a "loss of function".

In a more preferred embodiment, the nucleic acid molecule of the present invention relates to a nucleic acid molecule which differs from the nucleic acid molecule encoding the amino acid sequence of SEQ ID NO: 4, 6, 8, 52 or 54 or which comprises the nucleic acid sequence of SEQ ID NO: 3, 5, 7, 51 or 53 by mutation and wherein said mutation causes an alteration, deletion, duplication or premature stop in the encoded (poly)peptide.

As mentioned herein above, SEQ ID NOs: 6 and 8 comprise the amino acid sequences of the mouse and the human ADP protein, respectively, whereas SEQ ID NOs: 52 and 54 correspond to mouse and human splice variants of said ADP proteins. Said wt (wildtype) ADP proteins are encoded by the nucleic acid sequences as shown in SEQ ID NOs: 5, 7, 51 and 53, respectively. The above mentioned mutation, which may cause an alteration, deletion, duplication or premature stop in the encoded (poly)peptide may either lead to an enhancement or to a down regulation of the function of the ADP protein. As shown herein above and in the appended examples a deletion of 23 nucleotides in the Drosophila adp gene leads to a premature stop in the encoded ADP protein and results in an obese Drosophila phenotype. Correspondingly, it is envisaged that similar mutations in the mouse and/or human adp gene lead to similar phenotypic and physiological (pathophysiological) changes in mice and/or humans. As explained herein above in context of the mutated Drosophila ADP (poly)peptide/protein, such a deletion may lead to a "gain of function" phenotype. The same applies, mutatis mutantis, for the here described mouse and/or human ADP (poly)peptide.

However, the present invention also envisages "loss of function" mutations and/or silent mutation. Furthermore, the present invention also provides for corresponding splice variants. Yet, it is also envisaged that the above mentioned mutations may not lead to any phenotypic or physiological modifications and/or disorders in mice and/or human. Such a silent mutation may, inter alia, be due to mutations in irrelevant parts of the ADP protein, to a mutation which leads only to less severe effect or to mutations which merely comprise conservative amino acid replacements. The here described nucleic acid molecules which differ from the nucleic acid molecules encoding the amino acid sequences as depicted in SEQ ID

NOs: 6, 8, 52 or 54 or which comprise nucleic acid sequences as shown in SEQ

ID NOs: 5, 7, 51 or 53 by the above described mutations may encode variants of the (poly)peptide regulating, causing or contributing to obesity in an animal, preferably in a mammal. Such "variants" refer to polynucleotides or (poly)peptides differing from the polynucleotides and/or (poly)peptides described herein, but retaining essential properties thereof, as, inter alia, regulating, causing or contributing to obesity or, as described herein below, regulating the body weight of an individual, preferably of a mammal, most preferably of a human. It is preferred that said variants are overall (closely) similar, and, preferably, in some regions, identical to the polynucleotides and (poly)peptides described herein. As mentioned herein above, it is particularly preferred that a (poly)peptide variant is at least 35% identical to the (poly)peptide/amino acid sequence as depicted in SEQ ID NO: 2,

4, 6, 8, 52 or 54.

The term "variant" means in this context that the nucleotide and their encoded amino acid sequence, respectively, of these polynucleotides differs from the sequences of the above-described nucleic acid molecules and (poly)peptides contributing to, regulating or causing obesity in one or more nucleotide positions and are highly homologous to said nucleic acid molecules. Homology is understood to refer to a sequence identity of at least 35%, preferably 50%, more preferably 60%, still more preferably 70%, particularly an identity of at least 80%, preferably more than 90% and still more preferably more than 95%. The deviations from the sequences of the nucleic acid molecules described above can, for example, be the result of nucleotide substitution(s), deletion(s), addition(s), insertion(s) and/or recombination(s). Homology can further imply that the respective nucleic acid molecules or encoded proteins are functionally and/or structurally equivalent. The nucleic acid molecules that are homologous to the nucleic acid molecules described above and that are derivatives of said nucleic acid molecules are, for example, variations of said nucleic acid molecules which represent modifications having the same biological function, in particular encoding proteins with the same or substantially the same biological function. They may be naturally occurring variations, such as sequences from other mammals or mutations. The term "variants" in this context furthermore comprises, inter alia, allelic variations or splice variants as described herein above. Naturally occurring ADP protein or adp gene variants are called "allelic variants", and refer to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985) and updated versions). These allelic variants can vary at either the polynucleotide and/or (poly)peptide level. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis. Using known methods of protein engineering and recombinant DNA technology, variants may be generated to improve or alter the characteristics of the herein described ADP proteins/adp genes. Therefore, the term "allelic variant" also comprises synthetically produced or genetically engineered variants.

The nucleic acid molecule of the invention may be of natural origin, synthetic or semisynthetic or it may be a derivative.

The nucleic acid molecules of the invention encoding the above described (poly)peptides, e.g. wildtype and mutated forms of the ADP (poly)peptide and/or fragments thereof find a wide variety of applications including use as translatable transcripts, hybridization probes, PCR primers or the use in expression profiling of nucleic acids, for example on appropriately coated chips or in diagnostic and/or pharmaceutical settings. In particular they may be used in detecting the presence of adp genes and gene transcripts and in detecting and/or amplifying nucleic acids encoding further adp homologues or structural analogues. Given the probes, materials and methods disclosed herein, inter alia, for probing cDNA and genomic libraries, the person skilled in the art is in a position to recover corresponding homologues. As described herein below, the nucleic acid molecules of the invention may be part of specific expression vectors and may be incorporated into recombinant cells for expression and screening and in transgenic animals for functional studies (e.g. the efficacy of candidate drugs for disease associated with expression of adp) as described herein below. Furthermore, it is envisaged that specific probes and/or primers derived from the nucleic acid molecules of the present invention may be employed as developmental and/or differentiation markers. In a preferred embodiment these probes and/or primers are employed as differentiation markers in adipocyte differentiation.

Furthermore, in diagnosis, specific hybridization probes related to the adp gene(s) as described herein and single nucleotide polymorphisms present in adp alleles find use in identifying wild-type and mutant adp alleles in clinical and laboratory samples. Mutant alleles are, inter alia, used to generate allele-specific oligonucleotide (ASO) probes for, e.g., high-throughput clinical diagnosis. For therapeutic approaches nucleic acid molecules of the invention as described herein above and herein below may be employed to modulate cellular expression or intracellular concentration or availability of active (poly)peptides of the invention. These nucleic acid molecules may comprise antisense molecules, i.e. single- stranded sequences comprising the complements of the disclosed nucleic acids of the invention.

The nucleic acid molecule(s) of the invention may be a recombinantly produced chimeric nucleic acid molecule comprising any of the aforementioned nucleic acid molecules either alone or in combination. Preferably, said nucleic acid molecule is part of a vector. The present invention therefore also relates to a vector comprising the nucleic acid molecule of the present invention.

The vector of the present invention may be, e.g., a plasmid, cosmid, virus, bacteriophage or another vector used e.g. conventionally in genetic engineering, and may comprise further genes such as marker genes which allow for the selection of said vector in a suitable host cell and under suitable conditions. Furthermore, the vector of the present invention may, in addition to the nucleic acid sequences of the invention, comprise expression control elements, allowing proper expression of the coding regions in suitable hosts. Such control elements are known to the artisan and may include a promoter, a splice cassette, translation initiation codon, translation and insertion site for introducing an insert into the vector. Preferably, the nucleic acid molecule of the invention is operatively linked to said expression control sequences allowing expression in eukaryotic or prokaryotic cells.

Furthermore, inventive nucleic acids can be employed in recombinants or vectors or viruses, inventive (poly)peptides can be expressed by or in recombinants or vectors or viruses and recombinants or vectors or viruses of the invention can be generated and employed as in or in a manner analogous to the methods for making and/or using and/or administering a vector, either j_n vivo or in vitro, see e.g., U.S. Patent Nos. 4,603,112, 4,769,330, 5,174,993, 5,505,941 , 5,338,683, 5,494,807, 4,722,848, 5,942,335, 5,364,773, 5,762,938, 5,770,212, 5,942,235, 5,756,103, 5,766,599, 6,004,777, 5,990,091 , 6,033,904, 5,869,312, 5,382,425, WO 94/16716 or WO 96/39491.

Control elements ensuring expression in eukaryotic and prokaryotic cells are well known to those skilled in the art. As mentioned herein above, they usually comprise regulatory sequences ensuring initiation of transcription and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers, and/or naturally-associated or heterologous promoter regions. Possible regulatory elements permitting expression in for example mammalian host cells comprise the CMV- HSV thymikine kinase promoter, SV40, RSV-promoter (Rous sarcome virus), human elongation factor 1_α-promoter, aPM-l promoter (Schaffer, Biochem. Biophys. Res. Commun. 260 (1999), 416-425), or inducible promoter(s), like, metallothionein or tetracyclin, or enhancers, like CMV enhancer or SV40-enhancer. For the expression in prokaryotic cells, a multitude of promoters including, for example, the tac-lac-promoter or the trp promoter, has been described. Besides elements which are responsible for the initiation of transcription such regulatory elements may also comprise transcription termination signals, such as SV40-poly-A site or the tk-poly-A site, downstream of the polynucleotide. In this context, suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pRc/CMV, pcDNAI , pcDNA3 (In-vitrogene), pSPORTI (GIBCO BRL), Casper, Casper-HS43, pUAST, or prokaryotic expression vectors, such as lambda gt11. Beside the nucleic acid molecules of the present invention, the vector may further comprise nucleic acid sequences encoding for secretion signals. Such sequences are well known to the person skilled in the art. Furthermore, depending on the expression system used leader sequences capable of directing the (poly)peptide to a cellular compartment may be added to the coding sequence of the nucleic acid molecules of the invention and are well known in the art. The leader sequence(s) is (are) assembled in appropriate phase with translation, initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein, or a protein thereof, into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusionprotein including an C- or N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product. Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequences, and, as desired, the collection and purification of the (poly)peptide(s) or fragments thereof of the invention may follow.

Furthermore, the vector of the present invention may also be a gene transfer or gene targeting vector. Gene therapy, which is based on introducing therapeutic genes into cells by ex-vivo or in-vivo techniques is one of the most important applications of gene transfer. Suitable vectors, methods or gene-delivering systems for in-vitro or in-vivo gene therapy are described in the literature and are known to the person skilled in the art; see, e.g., Giordano, Nature Medicine 2 (1996), 534-539; Schaper, Circ. Res. 79 (1996), 911-919; Anderson, Science 256 (1992), 808-813, Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Res. 77 (1995), 1077-1086; Onodua, Blood 91 (1998), 30-36; Verzeletti, Hum. Gene Ther. 9 (1998), 2243-2251 ; Verma, Nature 389 (1997), 239-242; Anderson, Nature 392 (Supp. 1998), 25-30; Wang, Gene Therapy 4 (1997), 393-400; Wang, Nature Medicine 2 (1996), 714-716; WO 94/29469; WO 97/00957; US 5,580,859; US 5,589,466; US 4,394,448 or Schaper, Current Opinion in Biotechnology 7 (1996), 635-640, and references cited therein. In particular, said vectors and/or gene delivery systems are also described in gene therapy approaches in adipocyte (see, inter alia, US 5,869,037 or Zhou, PNAS USA96 (1999), 2391-2395) or in the hypothalamus (see, inter alia, Geddes, Front Neuroendocrinol. 20 (1999), 296-316 or Geddes, Nat. Med. 3 (1997), 1402-1404). The nucleic acid molecules and vectors of the invention may be designed for direct introduction or for introduction via liposomes, viral vectors (e.g. adenoviral, retroviral, lentiviral), electroporation, ballistic (e.g. gene gun) or other delivery systems into the cell. Additionally, a baculoviral system can be used as eukaryotic expression system for the nucleic acid molecules of the invention.

As will be discussed herein below, the nucleic acid molecule of the present invention and/or the above described vectors/hosts of the present invention may be particularly useful as pharmaceutical compositions. Said pharmaceutical compositions may be employed in gene therapy approaches. In this context, it is envisaged that the nucleic acid molecules and/or vectors of the present invention may be employed to modulate, alter and/or modify the cellular expression and/or intracellular concentration of the (poly)peptide(s) of the invention or of (a) fragment thereof. Said modulation, alteration and/or modification may lead to up- or downregulation of the ADP (poly)peptide and/or the gene product of the herein described adp gene. Furthermore, said therapeutic approache(s) may lead to an alteration and/or modulation of the availability of active ADP (poly)peptide/protein/gene product. In this context, the term "active" refers to the ability to perform its (normal) cellular function in an organism.

For gene therapy applications, nucleic acids encoding the (poly)peptide of the invention or fragments thereof may be cloned into a gene delivering system, such as a virus and the virus used for infection and conferring disease ameliorating or curing effects in the infected cells or organism.

As mentioned herein above, the nucleic acid molecule(s) and/or vector(s) may be employed in order to modulate/alter the gene expression or intracellular concentration of ADP protein/(poly)peptide. Said modulation/alteration may also be achieved by antisense-approaches.

Antisense modulation of adp expression may employ antisense nucleic acids operably linked to gene regulatory sequences. For example, cells are transfected with a vector comprising an adp sequence with a promoter sequence oriented such that transcription of the gene yields an antisense transcript capable of binding to endogenous adp encoding mRNA. Transcription of the antisense nucleic acid may be constitutive or inducible and the vector may provide for stable extrachromosomal maintenance and integration. Alternatively, single-stranded antisense nucleic acids that bind to genomic DNA or mRNA encoding a (poly)peptide of the invention or a fragment thereof may be administered to the target cell, in or temporarily isolated from a host, at a concentration that results in a substantial reduction in expression of said (poly)peptide. Furthermore, it is envisaged that expression of the (poly)peptide of the invention may be influenced, suppressed by other means than antisense approaches. Therefore, reduced expression of the (poly)peptide of the invention may also be achieved by RNA- mediated gene interference, which applies double-stranded RNA instead of antisense nucleic acids (see, Sharp, Genes Dev. 13 (1999), 139-141 ). Gene suppression by double stranded RNA or RNAi-approach is also described in Hunter, Curr. Biol. 10 (2000), R137-R140.

The nucleic acid molecule of the invention may therefore be used for the construction of appropriate anti-sense oligonucleotides which are able to inhibit the function of the nucleic acid molecules which either encode wildtype or mutant versions of the ADP (poly)peptide of this invention. Said anti-sense nucleotide comprises preferably at least 15 nucleotides, more preferably at least 20 nucleotides, even more preferably 30 nucleotides and most preferably at least 40 nucleotides. In addition, ribozyme approaches are also envisaged in this invention. Ribozymes may specifically cleave the nucleic acid molecule of the invention.

In the context of the present invention ribozymes comprise, inter alia, hammerhead ribozymes, hammerhead ribozymes with altered core sequences or deoxyribozymes (see, e.g., Santoro, Proc. Natl. Acad. Sci. USA 94 (1997), 4262) and may comprise natural and in vitro selected and/or synthesized ribozymes. Nucleic acid molecules according to the present invention which are complementary to nucleic acid molecules coding for proteins/(poly)peptides regulating, causing or contributing to obesity and/or encoding a mammalian (poly)peptide involved in the regulation of body weight (see herein below) may be used for the construction of appropriate ribozymes (see, e.g., EP-B1 0 291 533, EP-A1 0 321 201 , EP-A2 0 360 257) which specifically cleave nucleic acid molecules of the invention. Selection of the appropriate target sites and corresponding ribozymes can be done as described for example in Steinecke, Ribozymes, Methods in Cell Biology 50, Galbraith, eds. Academic Press, Inc. (1995), 449-460.

The present invention also relates to a host cell transfected or transformed with the vector of the invention or a non-human host carrying the vector of the present invention, i.e. to a host cell or host which is genetically modified with a nucleic acid molecule according to the invention or with a vector comprising such a nucleic acid molecule. The term "genetically modified" means that the host cell or host comprises in addition to its natural genome a nucleic acid molecule or vector according to the invention which was introduced into the cell or host or into one of its predecessors/parents. The nucleic acid molecule or vector may be present in the genetically modified host cell or host either as an independent molecule outside the genome, preferably as a molecule which is capable of replication, or it may be stably integrated into the genome of the host cell or host.

The host cell of the present invention may be any prokaryotic or eukaryotic cell. Suitable prokaryotic cells are those generally used for cloning like E. coli or Bacillus subtilis. Furthermore, eukaryotic cells comprise, for example, fungal or animal cells. Examples for suitable fungal cells are yeast cells, preferably those of the genus Saccharomyces and most preferably those of the species Saccharomyces cerevisiae. Suitable animal cells are, for instance, insect cells, vertebrate cells, preferably mammalian cells, such as e.g. CHO, Hela, NIH3T3, MOLT-4, Jurkat, K562, HepG2, 3T3-L1 (and derivatives thereof), HIB-1 B (see Villena, Biochem J. 331 (1998), 121-127), HEK 293, PAZ6 (see, Strobel, Diabetologia 42 (1999), 527-533). Further suitable cell lines known in the art are obtainable from cell line depositories, like the American Type Culture Collection (ATCC).

In a more preferred embodiment the host cell which is transformed with the vector of the invention is an adipose cell, a brain cell, a hepatic cell, an epithelial cell, a blood cell or a cell (line) derived therefrom.

Hosts may be non-human mammals, most preferably mice, rats, sheep, calves, dogs, monkeys or apes and may comprise Psammomis obesus. Said mammals may be indispensable for developing a cure, preferably a cure for obesity, adipositas, eating disorders and/or disorders leading to a pathological body mass/body weight. Furthermore, the hosts of the present invention may be partially useful in producing the (poly)peptides (or fragments thereof) of the invention. It is envisaged that said (poly)peptide (or fragments thereof) be isolated from said host.

The host of the present invention may also be a non-human transgenic animal as described herein below. The present invention also envisages non-human transgenic animals comprising a mutated form of the nucleic acid molecules of the invention or non-human transgenic animals wherein the nucleic acid molecule of the present invention has been deleted and/or inactivated. Said deletion may be a partial deletion.

Furthermore, the present invention relates to a method of producing a (poly)peptide encoded by the nucleic acid molecule of the invention comprising culturing the host cell of the present invention under suitable conditions that allow the synthesis of said (poly)peptide and recovering and/or isolating the (poly)peptide produced from the culture.

The transformed hosts can be grown in fermentors and cultured according to techniques known in the art to achieve optimal cell growth. The (poly)peptide of the invention can then be isolated from the growth medium, cellular lysates, cellular membrane fractions or inclusion bodies. Once expressed, the protein of the present invention can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoressis and the like; see, Scopes, "Protein Purification", Springer-Verlag, N.Y. (1982). Substantially pure proteins of at least about 60%, at least about 70%, at least about 80% or at least about 90 to 97% homogeneity are preferred, and 98 to 99% or more homogeneity are most preferred, for pharmaceutical uses. Once purified, partially or to homogeneity as desired, the proteins may then be used therapeutically (including extracorporeally) or in developing and performing assay procedures.

Additionally, the present invention relates to a (poly)peptide encoded by the nucleic acid molecule of the invention or produced by or obtainable by the above- described method. The term "(poly)peptide" as employed herein denotes either a peptide, a full-length protein or (a) fragment(s) thereof. A peptide is preferably a fragment of the (poly)peptide of the invention. The term "(poly)peptide comprises (a) peptide(s) or (a) (poly)peptide(s) which encompass amino acid chains of any length, wherein the amino acid residues are linked by covalent peptide bonds. Preferably, said amino acid chains of a "peptide" comprise at least 10 amino acids, more preferably at least 20, more preferably at least 30, more preferably at least 40, even more preferably at least 50 and, most preferably at least 60 amino acids. It is even more preferred that the (poly)peptides of the invention comprise at least 100, more preferred at least 200, more preferred at least 300, more preferred at least 400, more preferred at least 500, even more preferred at least 600 amino acids.

The term "or (a) fragment(s) thereof as employed in the present invention and in context with (poly)peptides of the invention, comprises specific peptides, amino acid stretches of the (poly)peptides as disclosed herein. It is preferred that said "fragment(s) thereof is/are functional fragment(s). The term "functional fragment" denotes a part of the above identified (poly)peptide of the invention which fulfils, at least in part, physiological and/or structural activities of the (poly)peptide of the invention. It is, however, also envisaged that said fragment functions as intervening and/or inhibiting molecule for the (poly)peptide of the invention. For example, it is envisaged that fragments of the (poly)peptide of the invention may structurally and/or physiologically interact with the (poly)peptide of the invention and thereby inhibit the function of said (poly)peptide.

The (poly)peptides of the present invention may be recombinant (poly)peptides expressed in host cells like bacteria, yeasts, or other eukaryotic cells, like mammalian or insect cells. Alternatively, they may be isolated from viral preparations. In another embodiment of the present invention, synthetic (poly)peptides may be used. Therefore, such a (poly)peptide may be a (poly)peptide as encoded by the nucleic acid molecule of the invention which only comprises naturally occurring amino acid residues, but it may also be a (poly)peptide containing modifications. These include covalent derivatives, such as aliphatic esters or amides of a carboxyl group, O-acetyl derivatives of hydroxyl containing residues and N-acyl derivatives of amino group containing residues. Such derivatives can be prepared by linkage to reactable groups which are present in the side chains of amino acid residues and at the N- and C-terminus of the protein. Furthermore, the (poly)peptide can be radiolabeled or labeled with a detectable group, such as a covalently bound rare earth chelate, or conjugated to a fluorescent moiety. The (poly)peptide of the present invention can be, for example, the product of expression of a nucleotide sequence encoding such a (poly)peptide, a product of chemical modification or can be purified from natural sources, for example, viral preparations. Furthermore, it can be the product of covalent linkage of (poly)peptide domains.

The peptides/(poly)peptides may also be produced by biochemical or synthetic techniques. Those methods are known to those of ordinary skill in the art (see, e.g. Merrifield, J. Am. Chem. Soc. 85 (1963), 2149-2146; Stewart, "Solid Phase Peptide Synthesis", WH Freeman Co, San Francisco (1969); Scopes, "Protein Purification", Springer Verlag, New York, Heidelberg, Berlin (1987); Janson, "Protein Purification, Principles, High Resolution Methods and Applications", VCH Publishers, New York, Weinheim, Cambridge (1989); Wrede, "Concepts in Protein Engineering and Design", Walter de Gruyter, Berlin, New York (1994)).

Additionally, within the scope of the invention are peptides/(poly)peptides wherein the above mentioned amino acid(s) and/or peptide bonds have been replaced by functional analogs, inter alia by peptidomimetics. Peptidomimetics is well known in the art and corresponding art describing this method are mentioned below. Therefore, the present invention also encompasses functional derivatives and/or analogues of said peptides comprising a specific ADP-derived peptide. Further methods for the preparation of peptides/(poly)peptides are described in Sambrook et al., loc. cit., or in Oxender and Fox (1987) "Protein Engineering", Alan Liss Inc. New York. Protein preparation of chemical derivates and/or analogues are described in, for example, Beilstein "Handbook of Organic Chemistry", Springer Edition New York, or in "Organic Synthesis", Wiley, New York.

The present invention also relates to a fusion protein comprising the (poly)peptide of the invention or (a) fragment thereof.

Therefore, in addition to the (poly)peptides of the present invention, said fusion protein can comprise at least one further domain, said domain being linked by covalent or non-covalent bonds. The linkage can be based on genetic fusion according to the methods known in the art (Sambrook et al., loc. cit, Ausubel, "Current Protocols in Molecular Biology", Green Publishing Associates and Wiley Interscience, N.Y. (1989)) or can be performed by, e.g., chemical cross-linking as described in, e.g., WO 94/04686. The additional domain present in the fusion protein comprising the (poly)peptide of the invention may preferably be linked by a flexible linker, advantageously a (poly)peptide linker, wherein said (poly)peptide linker preferably comprises plural, hydrophilic, peptide-bonded amino acids of a length sufficient to span the distance between the C-terminal end of said further domain and the N-terminal end of the peptide, (poly)peptide or antibody or vice versa. The above described fusion protein may further comprise a cleavable linker or cleavage site, which, for example, is specifically recognized and cleaved by proteinases or chemical agents. Additionally, said at least one further domain may be of a predefined specificity or function. In this context, it is understood that the (poly)peptides of the invention may be further modified by conventional methods known in the art. This allows for the construction of fusion proteins comprising the (poly)peptide of the invention and other functional amino acid sequences, e.g., nuclear localization signals, transactivating domains, DNA-binding domains, hormone-binding domains, protein tags (e.g. GST, GFP, h-myc peptide, FLAG, HA peptide, Strep), transmembrane domains or fatty acid attachment motifs (e.g. CAAX-box) which may be derived from heterologous proteins. Further fusion proteins are exemplified in the appended examples.

In a preferred embodiment the fusion protein of the invention comprises at least one WD40- and at least one TPR-motif/domain as described herein above.

The fusion protein of the invention may also be a mosaic (poly)peptide comprising at least two epitopes of the (poly)peptide of the invention wherein said mosaic (poly)peptide lacks amino acids normally intervening between the epitopes in the native ADP protein.

Inter alia, such mosaic (poly)peptides are useful in the applications and methods described herein, since they may comprise within a single peptide or (poly)peptide a number of relevant epitopes possibly presented linearly or as multi-antigen peptide system in a case of lysines. Relevant epitopes can be separated by spacer regions.

The nucleic acid molecule, the (poly)peptide, the antibody or fragment or derivative thereof, the aptamer or other receptor, the fusion protein, the mosaic (poly)peptide or the anti-sense oligonucleotide of the invention may be detectably labeled. A variety of techniques are available for labeling biomolecules, are well known to the person skilled in the art and are considered to be within the scope of the present invention. Such techniques are, e.g., described in Tijssen, "Practice and theory of enzyme immuno assays", Burden, RH and von Knippenburg (Eds), Volume 15 (1985), "Basic methods in molecular biology"; Davis LG, Dibmer MD; Battey Elsevier (1990), Mayer et al., (Eds) "Immunochemical methods in cell and molecular biology" Academic Press, London (1987), or in the series "Methods in Enzymology", Academic Press, Inc.

There are many different labels and methods of labeling known to those of ordinary skill in the art. Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes (like ³²P or ¹²⁵l), colloidal metals, fluorescent compounds/fluorochromes (like fluorescein, rhodamine, Texas Red, etc.), chemiluminescent compounds, and chemi- or bioluminescent compounds (like dioxetanes, luminol or acridiniums).

Commonly used labels furthermore comprise, inter alia, enzymes (like horse radish peroxidase, β-galactosidase, alkaline phosphatase), biotin or digoxygenin. Labeling procedures, like covalent coupling of enzymes or biotinyl groups, iodinations, phosphorylations, biotinylations, random priming, nick-translations, tailing (using terminal transferases) are well known in the art. Detection methods comprise, but are not limited to, autoradiography, fluorescence microscopy, direct and indirect enzymatic reactions, etc.

The present invention furthermore additionally relates to an antibody or a fragment or derivative thereof or an antiserum or an aptamer or another receptor specifically recognizing an epitope on the nucleic acid, or the (poly)peptide of the invention. The general methodology for producing antibodies is well-known and has, for monoclonal antibodies, been described in, for example, Kόhler and Milstein, Nature 256 (1975), 494 and reviewed in J.G.R. Hurrel, ed., "Monoclonal Hybridoma Antibodies: Techniques and Applications", CRC Press Inc., Boco Raron, FL (1982). In accordance with the present invention the term "antibody" relates to monoclonal or polyclonal antibodies. Polyclonal antibodies (antiserum) can be obtained according to conventional protocols. Antibody fragments or derivatives comprise F(ab')₂, Fab, Fv or scFv fragments; see, for example, Harlow and Lane, "Antibodies, A Laboratory Manual", CSH Press 1988, Cold Spring Harbor, NY. Preferably the antibody of the invention is a monoclonal antibody. Furthermore, in accordance with the present invention, the derivatives of the invention can be produced by peptidomimetics. In the context of the present invention, the term "aptamer" comprises nucleic acids such as RNA, ssDNA (ss = single stranded), modified RNA, modified ssDNA or PNAs which bind a plurality of target sequences having a high specificity and affinity. Aptamers are well known in the art and, inter alia, described in Famulok, Curr. Op. Chem. Biol. 2 (1998), 320- 327. The preparation of aptamers is well known in the art and may involve, inter alia, the use of combinatorial RNA libraries to identify binding sites (Gold, Ann. Rev. Biochem. 64 (1995), 763-797). Said other receptors may, for example, be derived from said antibody etc. by peptidomimetics. The specificity of the recognition implies that other known proteins, molecules are not bound. A suitable host for assessing the specificity would imply contacting the above recited compound comprising an epitope of the nucleic acid molecule or the (poly)peptide of the invention as well as corresponding compounds e.g. from protein or nucleic acid molecules known in the art, for example in an ELISA format and identifying those antibodies etc. that only bind to the compound of the invention but do not or to no significant extent cross-react with said corresponding compounds.

In addition, the present invention relates to a nucleic acid molecule encoding a mammalian (poly)peptide involved in the regulation of body weight in a mammal which

(a) hybridizes at 65°C in a solution containing 0.2 x SSC and 0.1 % SDS to the complementary strand of a nucleic acid molecule encoding the amino acid sequence of SEQ ID NO: 6, 8, 52 or 54;

(b) hybridizes at 65°C in a solution containing 0.2 x SSC and 0.1% SDS to the complementary strand of a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 5, 7, 51 or 53; or

(c) is degenerate with respect to the nucleic acid molecule of (a),

(d) encodes a (poly)peptide which is at least 60%, preferably at least 75%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95% most preferably at least 99% identical to the amino acid sequence as depicted in SEQ ID NO: 6, 8, 52 or 54;

(e) comprises a portion that is amplified in a polymerase chain reaction carried out on a mouse or human cDNA library or on genomic mouse or human DNA with the following sets of primers:

(i) forward primer as depicted in SEQ ID NO: 17; backward primer as depicted in SEQ ID NO: 18; (ii) forward primer as depicted in SEQ ID NO: 19; backward primer as depicted in SEQ ID NO: 20; (iii) forward primer as depicted in SEQ ID NO: 21 ; backward primer as depicted in SEQ ID NO: 22; (iv) forward primer as depicted in SEQ ID NO: 23; backward primer as depicted in SEQ ID NO: 24; (v) forward primer as depicted in SEQ ID NO: 25; backward primer as depicted in SEQ ID NO: 26 (vi) forward primer as depicted in SEQ ID NO: 40; backward primer as depicted in SEQ ID NO: 41 ; (vii) forward primer as depicted in SEQ ID NO: 42; backward primer as depicted in SEQ ID NO: 43; (viii) forward primer as depicted in SEQ ID NO: 40; backward primer as depicted in SEQ ID NO: 44; (ix) forward primer as depicted in SEQ ID NO: 45; backward primer as depicted in SEQ ID NO: 46; (x) forward primer as depicted in SEQ ID NO: 47; backward primer as depicted in SEQ ID NO: 48; or (xi) forward primer as depicted in SEQ ID NO: 49; backward primer as depicted in SEQ ID NO: 50; or (xii) forward primer as depicted in SEQ ID NO: 62; backward primer as depicted in SEQ ID NO: 63; or (xiii) forward primer as depicted in SEQ ID NO: 65; backward primer as depicted in SEQ ID NO: 66; or (xiv) forward primer as depicted in SEQ ID NO: 76; backward primer as depicted in SEQ ID NO: 76; under the following conditions: 1 min denaturing at 94°C, 1 min annealing at 55°C, 2 min extension at 72°C for 35 cycles; or (f) encodes a (poly)peptide which comprises at least one WD40 and at least one TPR motif.

The term "involved in the regulation in body weight" comprises the regulation of body weight and/or body mass. Said regulation comprises maintenance of the actual/current body weight/body mass as well as up- and downregulation of body weight/body mass.

For example, it is envisaged that the wild-type ADP-protein (as, inter alia, depicted in SEQ ID NOs: 6, 8, 52 or 54, for mouse and human ADP protein, respectively) is involved in this maintenance of body weight, whereas mutations in said protein may lead to an obese and/or adipose phenotype (as documented in the appended examples for the adp mutation of Drosophila). Without being bound by theory, it may in particular, be envisaged that mutations in the above described WD40 and/or TPR-domains (or in the newly identified ADP-domain, as inter alia depicted in SEQ ID NOs: 30, 31 or 32) may lead to an altered interaction with other proteins and thereby lead to a malfunctioning signalling pathway.

Embodiments as described herein above with respect to the nucleic acid molecule(s) encoding (poly)peptide(s) regulating, causing or contributing to obesity and their corresponding (poly)peptides are, mutatis mutantis, applicable for the nucleic acid molecules described herein above encoding a protein involved in a regulation of body weight in a mammal.

The above mentioned mouse and human cDNA library is preferably derived from adipocytes or brain. It is also preferred that the mouse cDNA library is an embryonic library.

In a particular preferred embodiment, the present invention relates to a nucleic acid molecule encoding a mammalian (poly)peptide involved in the regulation of body weight in a mammal, wherein said mammal is a mouse or a human.

Furthermore, the present invention relates in a preferred embodiment to a nucleic acid molecule encoding a mammalian (poly)peptide involved in the regulation of body weight, wherein said nucleic acid molecule encodes the amino acid sequence of SEQ ID NOs: 6, 8, 52 or 54 or wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 5, 7, 51 or 53. As described herein above, the amino acid sequence as depicted in SEQ ID NOs: 6, 8, 52 or 54 comprise the wildtype ADP protein sequence of mouse and human, respectively. Said ADP protein sequences may be encoded by the nucleotide/nucleic acid sequences as depicted in SEQ ID NOs: 5, 7, 51 or 53, corresponding to the coding sequences (ORFs) of the mouse and human adp gene.

The above described nucleic acid molecule encoding a mammalian (poly)peptide involved in the regulation of body weight in a mammal is preferably comprised in a vector as described herein above. Said vector is, as a preferred embodiment a gene targeting or a gene expression vector as discussed herein above in the context of the nucleic acid molecule(s) encoding a (poly)peptide regulating, causing or contributing to obesity in an animal.

In addition, said vector may be employed to transfect/transform a host as described, inter alia, herein above. Therefore, the present invention relates, in another embodiment to cells transformed with the nucleic acid molecule of the invention or to (a) non-human mammal(s) transfected with a vector comprising said nucleic acid molecule encoding a mammalian (poly)peptide involved in the regulation of body weight of the invention. However, the present invention also envisages non-human mammals wherein said nucleic acid molecule has been mutagenized and/or deleted (knock-out non-human mammals) or wherein (a) genetically modified nucleic acid molecule(s) of the invention have been introduced which is/are mutated. Said mutation may comprise an alteration, recombination, deletion, duplication, substitution, addition or premature stop in the encoded (poly)peptide. Preferably said non-human mammal is selected from the group consisting of mouse, rat, hamster, pig, calf, horse or sheep. Methods for the preparation of said non-human mammals are well known in the art and, inter alia, described in Joyer (1993), "Gene Targeting", IRL Oxford University Press or in Rajewsky (1996), J. Clin. Invest 98, 600-603.

The present invention also envisages a method for the production of a transgenic non-human animal, preferably a mouse, rat, sheep, hamster, pig, dog, monkey, rabbit, calf, horse, C. elegans, Drosophila, fish comprising introduction of a nucleic acid molecule or a vector of the invention into a germ cell, an embryonic cell, a stem cell or an egg or a cell derived thereof. Such transgenic animals are well suited for, e.g., pharmacological studies of drugs in connection with mutant forms of the above described ADP protein (leading to, inter alia, obesity, adipositas, eating disorders and/or disorders/diseases relating to body weight/body mass).

The invention also relates to transgenic non-human animals such as transgenic mice, rats, hamsters, dogs, monkeys, rabbits, pigs, C. elegans, Drosophila, fish (like zebrafish or torpedofish) comprising a nucleic acid molecule or vector of the invention. Said animal may have one or several copies of the same or different nucleic acid molecules encoding one or several forms of the (poly)peptide of the invention, regulating, causing or contributing to obesity or involved in the regulation of body weight. These animals are partially useful as research models for obesity, adipositas, eating disorders, wasting and/or other disorders of body weight/body mass as described herein.

The present invention also relates to a method for producing the (poly)peptide of the invention by cultu ring/nursing the hosts as described herein above under suitable conditions and isolating the produced (poly)peptide. These methods are known in the art and/or have been described herein above.

In yet another embodiment, the present invention relates to a (poly)peptide encoded by the nucleic acid molecule encoding a mammalian (poly)peptide involved in the regulation of body weight in a mammal or to a (poly)peptide produced by the method as described herein above. The (poly)peptide of the invention (or (a) fragment(s) thereof) may be, inter alia, produced as fusionproteins or as proteins comprising target or fusionsequences which allow the directed expression in, inter alia, mammals. Said expression may lead to secretion of said (poly)peptide (or (a) fragment(s) thereof) in body fluids, like inter alia, milk. The embodiments for fusionproteins as described herein above are also applicable here.

As described herein above, the present invention also relates to antibodies, fragments or derivatives thereof, antisera, aptamers or other receptors specifically recognizing nucleic acid molecules or the (poly)peptides of the invention, e.g. nucleic acid molecules encoding (poly)peptides involved in body weight regulation in mammals or specifically recognizing said (poly)peptides. The embodiments described herein above for antibodies, etc. specifically recognizing nucleic acid molecules encoding (poly)peptides regulating, causing or contributing to obesity or specifically recognizing said (poly)peptide are also applicable here.

In addition, the present invention provides for anti-sense oligonucleotides of the nucleic acid molecules of the invention, i.e. of nucleic acid molecules encoding (poly)peptides regulating, causing or contributing to obesity and/or (poly)peptides involved in the regulation of body weight. As mentioned herein above, said anti- sense oligonucleotides are particularly useful in pharmaceutic and/or diagnostic settings. Said anti-sense oligonucleotides may also be employed as hybridization probes.

As demonstrated herein and the appended examples, the present invention provides evidence that loss of adp activity causes obesity in Drosophila and other species. The target organ in Drosophila, the fat body, is the mesodermally derived major energy storage organ of insects (T. M. Ritzki, In: The genetics and biology of Drosophila (ed. M. Ashbumer and T.R:F. Wright) vol. 2b, 561-601 Academic Press, London (1978)) which shares distinct morphological, physiological and developmental similarities with mammalian adipose tissue (Q. Tong, _et al., Science 290, 134-138 (2000)). The novel arrangement of protein-protein interaction domains in Adp described herein suggests that Adp might constitute an adapter component of an intracellular signalling pathway or network involved in defining susceptibility to developing obesity in Drosophila- Therefore, the newly identified obesity gene in the fly and its conservation in mammals suggest an entrypoint into the identification of additional key determinants for the control of fat storage, energy homeostasis and/or body weight regulation in both Drosophila and mammals, in particular in humans.

The present invention also relates to a method of identifying a (poly)peptide involved in the regulation of body weight in a mammal comprising the steps of (a) testing a collection of (poly)peptides for interaction with the (poly)peptide of the invention using a readout system; and (b) identifying (poly)peptides that test positive for interaction in step (a). The term "regulation of body weight" may comprise upregulation of bodyweight/mass, down regulation of body weight/mass as well as maintainence of the actual body weight/mass.

Said "test for interaction" in step (a) may be carried out by specific immunological and/or biochemical assays which are well known in the art and which comprise, e.g., homogenous and heterogenous assays as described herein below.

Said interaction assays employing read-out systems are well known in the art and comprise, inter alia, two hybrid screenings (as, described, inter alia, in EP-0 963 376, WO 98/25947, WO 00/02911 ; and as exemplified in the appended examples), GST-pull-down columns, co-precipitation assays from cell extracts as described, inter alia, in Kasus-Jacobi, Oncogene 19 (2000), 2052-2059, "interaction-trap" systems (as described, inter alia, in US 6,004,746) expression cloning (e.g. lamda gtll), phage display (as described, inter alia, in US 5,541 ,109), in vitro binding assays and the like. Further interaction assay methods and corresponding read out systems are, inter alia, described in US 5,525,490, WO 99/51741 , WO 00/17221 , WO 00/14271 or WO 00/05410.

As will be discussed herein below, said interaction assays also comprise assays for dimerization, oligomerization and/or multimerization, like FRET-assays, TR- FRETs (in „A homogenius time resolved fluorescence method for drug discovery" in: High throughput screening: the discovery of bioactive substances. Kolb, (1997) J.Devlin. NY, Marcel Dekker 345-360) or commercially available assays, like ..Amplified Luminescent Proximity Homogenous Assay", BioSignal Packard. Furthermore, and as illustrated in the appended examples, the yeast-2-hybrid (Y2H) system may be employed to elucidate particular and specific interaction and/or association partners of the (poly)peptides of the invention or of fragments thereof, like, e.g. TPR or WD40 domains.

Similarly, interacting molecuIes/(poly)peptides may be deduced by cell-based techniques well known in the art. These assays comprise, inter alia, the expression of reporter gene constructs or "knock-in" assays, as described, for, e.g., the identification of drugs/small compounds influencing the gene expression. Said "knock-in" assays may comprise "knock-in" in tissue culture cells, as well as in (transgenic) animals. Examples for successful "knock-ins" are known in the art (see, inter alia, Tanaka, J. Neurobiol. 41 (1999), 524-539 or Monroe, Immunity 11 (1999), 201-212). Furthermore, biochemical assays may be employed which comprise, but are not limited to, binding of the (poly)peptides of the invention (or (a) fragment(s) thereof) to other molecules/(poly)peptides, peptides or binding of the (poly)peptides of the invention (or (a) fragment(s) thereof) to itself (themselves) (dimerizations, oligomerizations, multimerizations) and assaying said interactions by, inter alia, scintillation proximity assay (SPA) or homogenous time-resolved fluorescence assay (HTRFA).

Further method(s) which may be employed comprises FRET (fluorescence resonance energy transfer; as described, inter alia, in Ng, Science 283 (1999), 2085-2089 or Ubarretxena-Belandia, Biochem. 38 (1999), 7398-7405), or fluorescence polarization assays. These methods are well known in the art and inter alia described in Fernandez, Curr. Opin. Chem. Biol. 2 (1998), 547-603.

Said "testing of interaction" may also comprise the measurement of a complex formation. The measurement of a complex formation is well known in the art and comprises, inter alia, heterogeneous and homogeneous assays. Such assays are furthermore exemplified in the appended examples. Homogeneous assays comprise assays wherein the binding partners remain in solution and comprise assays, like agglutination assays. Heterogeneous assays comprise assays like, inter alia, immuno assays, for example, ELISAs, RIAs, IRMAs, FIAs, CLIAs or ECLs.

Further methods and assays for identifying interaction and/or binding partners of the (poly)peptides of the invention or for the identification of agents/compounds which are capable of interfering with the binding of the (poly)peptides of the invention with this (specific) intracellular binding partners/targets are disclosed herein below. Thereby, it is also envisaged and demonstrated herein, that a (specific) intracellular binding partner is the (poly)peptide of the invention itself and that the interfering molecule might interfere with dimerization, oligomerization and/or multimerization of the inventive molecules. Said additional and/or further method(s) and assay(s) described herein may also be employed in the above described method for identifying a (poly)peptide involved in the regulation of body weight and/or capable of interacting with the ADP (poly)peptide of the invention.

Any measuring or detection step of the method(s) of the present invention may be assisted by computer technology. For example, in accordance with the present invention, said detection and/or measuring step can be automated by various means, including image analysis, spectroscopy or flow cytometry. Therefore, the detection/measuring step(s) of the method(s) of the invention can be easily performed according to methods known in the art such as described herein. In particular, the detection/measuring step(s) of the method(s) of the invention can be carried out by employing antibodies directed against the (poly)peptides of the invention. Said antibodies may comprise conformation-dependent antibodies. The use of antibodies is particularly preferred in detection methods like ELISA.

The compounds identified and/or obtained according to the method(s) of the invention, in particular inhibitors or stimulators interacting with the (poly)peptides of the invention or (a) fragment(s) thereof, are expected to be very beneficial as agents which are capable of influencing body weight/body mass and/or energy homeostasis.

The term "readout system" in context with the present invention means any substrate that can be monitored, for example due to enzymatically induced changes. Said "readout system" may also comprise the use of specifically labeled (poly)peptides of the invention. These labels comprise, but are not limited to, radioactive labels, biotin, β-Gal, dioxygenin, fluorescence labels, chemi- or bioluminescent labels or protein labels, like GFP and the like.

The above described method of identifying (poly)peptides involved in the regulation of body weight in a mammal may, mutatis mutandis, be employed in drug screening assays. In this context it should be mentioned that methods as described herein may also comprise (high)-throughput screening methods and analysis known in the art. Such high throughput screening methods are maturing rapidly and are reviewed, e.g., in Oldenburg, Annu. Rev. Med. Chem. 33 (1998), 301-311 or in Mason, Pharmainformatics, Trends Supplement (1999), 34-36.

Furthermore, the present invention provides for a method of identifying a (poly)peptide involved in the regulation of body weight in a mammal comprising the steps of

(a) testing a collection of (poly)peptides for interaction with the (poly)peptide identified by the method described herein above; and

(b) identifying (poly)peptides that test positive for interaction in step (a); and optionally

(c) repeating steps (a) and (b) with the (poly)peptides identified one or more times wherein the newly identified (poly)peptide replaces the previously identified (poly)peptide as a bait for the identification of a further interacting (poly)peptide.

Said (poly)peptide involved in the regulation of body weight may be, inter alia, a (poly)peptide interacting directly or indirectly (e.g. via linker proteins) with the (poly)peptide of the invention, i.e. with ADP protein(s) and/or (a) fragment(s) thereof. Said interaction may lead to a functional activation (stimulation) or a functional inhibition of the (poly)peptide of the invention.

Said testing for interaction of step (a) as described herein above may be carried out by methods known to the skilled artisan and were described herein above.

In yet another embodiment, the present invention relates to the method(s) described herein above, which further comprises the step of identifying the nucleic acid molecule(s) encoding the one or more interacting (poly)peptides.

The identification of such nucleic acid molecule(s) is well known in the art and comprises, inter alia, the use of specific and/or degenerate primers. Furthermore, recombinant technologies as described in Sambrook, loc. cit. or in Glick (1994), "Molecular Biotechnology", ASM Press, Washington may be employed. Additionally, the present invention relates to a method of identifying a (poly)peptide involved in the regulation of body weight in a mammal comprising the steps of

(a) contacting a collection of (poly)peptides with the (poly)peptide (or (a) fragment(s) thereof) of the invention or with the fusionprotein (or (a) fragment(s) thereof) of the invention under conditions that allow binding of said (poly)peptides;

(b) removing (poly)peptides from said collection of (poly)peptides that did not bind to said (poly)peptide of the invention in step (a); and

(c) identifying (poly)peptides that bind to said (poly)peptide or said fusionprotein of the invention.

The method as described herein above may be carried out by the person skilled in the art without further ado. Said "contacting" of step (a) may, inter alia, be carried out in solution employing (magnetic) beads coupled with the (poly)peptide of the invention and/or fragments thereof. Non-bound (poly)peptides may be easily removed by methods known in the art, comprising, for example, magnetic separation, gravity, affinity column systems and corresponding washes and the like.

Methods for identifying bound (poly)peptides are well known in the art and comprise, inter alia, SDS PAGE analysis and Western blotting. Furthermore, techniques like 2D-gel electrophoresis, in-gel digests, microsequencing, N- terminal sequencing, MALDI-MS, analysis of peptides in mass spectroscopy, peptide mass fingerprinting, PSD-MALDI-MS and/or (micro-) HPLC. Separated polypeptdies to be identified may be further analyzed by, inter alia, Edman- degradation, MALDI-MS methods, ladder sequencing (Thiede, FEBS 357 (1995), 65).

By use of the above described and mentioned methods (and others known in the art) amino acid sequences of the (poly)peptides to be identified can be deduced and sequenced. From these sequenced amino acid fragments, degenerative oligonucleotides may be deduced and synthesized that may be used to screen, for example, genomic or cDNA libraries to identify and clone the corresponding gene/cDNA. Furthermore, phage display approaches may be employed in the method(s) of this invention. Phage display allows the identification of proteins that interact with a molecule of interest. Libraries of phage, each displaying a different peptide epitope are tested for binding to the molecule of interest. Bound phages can be purified and the insert encoding the peptide epitope may be sequenced. Phage display kit(s) are known in the art and commercially available, e.g., Display Systems Biotech Cat.No. 300-110.

The present invention relates, in yet another embodiment to the method(s) described herein, wherein said (poly)peptide of the invention is fixed to a solid support.

Solid supports are well known in the art and comprise, inter alia, commercially available column materials, polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulase strips, membranes, sheets, duracytes, wells and walls of reaction trays, plastic tubes etc. Suitable methods for fixing/immobilizing said (poly)peptide(s) of the invention are well known and include, but are not limited to ionic, hydrophobic, covalent interactions and the like.

In a particular preferred embodiment, said solid support is a gel filtration or an affinity chromatography material.

In a yet more preferred embodiment of the method of the invention as described herein above, said binding (poly)peptides are released prior to said identification in step (c).

Said release may be effected by elution. Such elution methods are well known in the art and comprise, inter alia, elution with solutions of different ionic strength or different pH, or with intercalating or competing agents/molecuies/peptides.

Furthermore, in a yet more preferred embodiment, the present invention relates to the above described method of the invention, wherein said method further comprises the step of identifying the nucleic acid molecule(s) encoding the one or more binding (poly)peptides.

As pointed out herein above, said nucleic acid molecule(s) may be deduced, inter alia, by employing degenerate primers/oligonucleotides in order to detect the corresponding gene(s) and/or cDNA(s) or by expression cloning.

Additionally, the present invention relates to a method of identifying a compound influencing the expression of the nucleic acid molecule of the invention comprising the steps of

(a) contacting a host carrying an expression vector comprising the nucleic acid molecule of the invention or the nucleic acid molecule identified by the method of the invention operatively linked to a readout system with a compound or a collection of compounds;

(b) assaying whether said contacting results in a change of signal intensity provided by said readout system; and, optionally,

(c) identifying a compound within said collection of compounds that induces a change of signal in step (b); wherein said change in signal intensity correlates with a change of expression of said nucleic acid molecule.

Similarly, the present invention relates to a method of identifying a compound influencing the activity of (a) (poly)peptide(s) of the invention comprising the steps of

(a) contacting a host carrying an expression vector comprising a nucleic acid molecule of the invention operatively linked to a readout system and/or carrying a (poly)peptide of the invention linked to a readout system with a compound or a collection of compounds;

(c) identifying a compound within said collection of compounds that induces a change of signal in step (b); wherein said change in signal correlates with a change in activity of said (poly)peptide. The term "activity" as used herein above in context of the method of the invention also comprises the "function" of (a) (poly)peptide(s) of the invention. Said function may comprise, as mentioned herein above, enzymatic activities or other functions, like, inter alia, involvement in signalling pathways. Such activities and modulators of such activities may be determined and/or identified by convenient in vitro or in vivo assays as described herein or by variations thereof. The underlying technology is widely and commonly known to the person skilled in the art.

Readout systems operatively linked to the nucleic acid molecules of the invention or linked to the (poly)peptides of the invention are disclosed herein and comprise, but are not limited to, assays based on radioactive lables, luminescence, fluorescence, etc. Inter alia, said readout system may comprise fluorescence resonance energy transfer (FRET). The above described methods are particularly useful in (automated) high-throughput screenings. In context of this invention, the above mentioned "readout system opertatively linked to the nucleic acid molecules of the invention" also comprises readout systems which are located on different molecules, e.g. nucleic acid molecules, like, inter alia, other plasmids, vectors etc.

Said host of step (a) of the methods described herein above may be a eukaryotic host cell. Said host cell may be a yeast cell. It is particularly preferred that said eukaroytic host cell is a mammalian host cell. Said host cell may, inter alia, comprise adipocytes, pre-adipocytes, brain cells, etc. However, said host cell may also be a prokaryotic cell, e.g. a bacterium. Particularly preferred are prokaryotic (host) cells as described herein above.

The term "compound" in the method(s) of the invention includes a single substance or a plurality of substances which may or may not be identical. Said compound(s) may be comprised in, for example, samples, e.g., cell extracts from, e.g., plants, animals or microorganisms. Furthermore, said compound(s) may be known in the art but hitherto not known to be capable of influencing the activity of (a) (poly)peptide(s) of the invention or not known to be capable of influencing the expression of the nucleic acid molecule of the invention, respectively. The plurality of compounds may be, e.g., added to a sample in vitro, to the culture medium or injected into the cell.

If a sample (collection of compounds) containing (a) compound(s) is identified in the method(s) of the invention, then it is either possible to isolate the compound from the original sample identified as containing the compound in question or one can further subdivide the original sample, for example, if it consists of a plurality of different compounds, so as to reduce the number of different substances per sample and repeat the method with the subdivisions of the original sample. It can then be determined whether said sample or compound displays the desired properties by methods known in the art such as described herein. Depending on the complexity of the samples, the steps described above can be performed several times, preferably until the sample identified according to the method of the invention only comprises a limited number of or only one substance(s). Preferably said sample comprises substances of similar chemical and/or physical properties, and most preferably said substances are identical. The methods of the present invention can be easily performed and designed by the person skilled in the art, for example in accordance with other cell based assays described in the prior art (see, e.g., EP-A-0 403 506). Furthermore, the person skilled in the art will readily recognize which further compounds and/or cells may be used in order to perform the methods of the invention, for example, host cells as described herein above or enzymes, if necessary, that, e.g., convert a precursor compound into the active compound which in turn influences the expression of the nucleic acid molecule of the invention and/or influences the activity of (a) (poly)peptide of the invention. Such adaptation of the method of the invention is well within the skill of the person skilled in the art and can be performed without undue experimentation.

Compounds which can be used in accordance with the method of the present invention include, inter alia, peptides, proteins, nucleic acids including cDNA expression libraries, antibodies, small organic compounds, ligands, PNAs and the like. Said compounds can also be functional derivatives or analogues of known activators or inhibitors. Methods for the preparation of chemical derivatives and analogues are well known to those skilled in the art and are described in, for example, Beilstein, loc. cit. Furthermore, said derivatives and analogues can be tested for their effects according to methods known in the art and/or as described herein. Furthermore, peptidomimetics and/or computer aided design of appropriate activators or inhibitors of the expression of the nucleic acid molecules of the invention or of the activity of (a) (poly)peptide of the invention can be used, for example, according to the methods described herein. Appropriate computer systems for the computer aided design of, e.g., proteins and peptides are described in the prior art, for example, in Berry, Biochem. Soc. Trans. 22 (1994), 1033-1036; Wodak, Ann. N. Y. Acad. Sci. 501 (1987), 1-13; Pabo, Biochemistry 25 (1986), 5987-5991. The results obtained from the above-described computer analysis can be used in combination with the method of the invention for, e.g., optimizing known compounds, substances or molecules. Appropriate compounds can also be identified by the synthesis of peptidomimetic combinatorial libraries through successive chemical modification and testing the resulting compounds, e.g., according to the methods described herein. Methods for the generation and use of peptidomimetic combinatorial libraries are described in the prior art, for example in Ostresh, Methods in Enzymology 267 (1996), 220-234 and Dorner, Bioorg. Med. Chem. 4 (1996), 709-715. Furthermore, the three-dimensional and/or crystallographic structure of inhibitors or activators of ADP protein or the adp nucleic acid molecule can be used for the design of peptidomimetic inhibitors or activators of the (poly)peptide of the invention to be tested in the method of the invention (Rose, Biochemistry 35 (1996), 12933-12944; Rutenber, Bioorg. Med. Chem. 4 (1996), 1545-1558).

In a particularly preferred embodiment, the above described methods of the invention are method(s) wherein said change in signal intensity is an increase in signal intensity or a decrease in signal intensity. The above described method(s) of the invention for identifying compounds influencing the expression of the nucleic acid molecule of the invention and/or the activity of the (poly)peptide of the invention may also be employed for screening of said compound(s).

Furthermore, the present invention provides for a method of assessing the impact of the expression of one or more (poly)peptides or of one or more fusionproteins of the invention in an animal comprising the steps of

(a) overexpressing the nucleic acid molecule of the invention in said animal; and (b) determining whether the weight of said animal has increased or decreased, whether metabolic changes are induced and/or whether the eating behaviour is modified.

Similarly, the present invention also relates to a method of assessing the impact of the expression of one or more (poly)peptides or of one or more fusionproteins of the invention in an animal comprising the steps of

(a) underexpressing the nucleic acid molecule of the invention in said animal; and

(b) determining whether the weight of said animal has increased or decreased, whether metabolic changes are induced and/or whether the eating behaviour is modified.

Transgenic animals as described herein above may be particularly useful for the above described methods of assessing the impact of the expression of one or more (poly)peptide of the invention. The above mentioned "underexpression" of the nucleic acid molecule of the invention comprises, inter alia, full deletions of both alleles, or the deletion of any one allele. Furthermore, said term comprises the generation of a mutation which leads to the expression of a less functional protein/(poly)peptide in the test animal.

In addition, the present invention relates to a method of identifying a gene involved in the regulation of body weight comprising the steps of

(a) mutagenizing an animal of the adipose phenotype;

(b) assessing the impact of the mutagenesis event on the body weight of said animal; and

(c) identifying (a) mutated gene(s) if the body weight of said animal is increased or decreased, if metabolic changes are induced and/or if the eating behaviour is modified after said mutagenesis event.

Furthermore, it is envisaged that in step (c) of the above described (a) mutated gene(s) is (are) identified when the eating behaviour of said animal changes and/or when metabolic changes are induced in said animal. In a preferred embodiment, the animal employed in the above described method is a fruit fly. Particularly preferred is a Drosophila. Most preferred is Drosophila melanogaster. Said mutagenization may be effected by using P elements or by employing other transposons. Furthermore, it is envisaged that chemical mutagenesis (e.g. EMS, ENV, TEM, formaldehyde) or (ionizing) radiation may be employed. Methods for mutagenization are well known in the art and, inter alia, described in Grigliatti, "Drosophila, A practical approach", Oxford University Press (1998).

Furthermore, the present invention provides for a method of screening for and/or identifying an agent which modulates the interaction of a (poly)peptide of the invention with a binding target/agent, comprising the steps of

(a) incubating a mixture comprising

(aa) a (poly)peptide regulating, causing or contributing to obesity and/or involved in the regulation of body weight, or a fragment thereof or a fusion protein of the invention or a fragment thereof;

(ab) a binding target/agent of said (poly)peptide or fusion protein or fragment thereof; and

(ac) a candidate agent under conditions whereby said (poly)peptide, fusion protein or fragment thereof specifically binds to said binding target/agent at a reference affinity;

(b) detecting the binding affinity of said (poly)peptide, fusion protein or fragment thereof to said binding target to determine an (candidate) agent-biased affinity; and

(c) determining a difference between (candidate) agent-biased affinity and the reference affinity.

As pointed out herein above, a specific binding target/agent of the (poly)peptide(s) of the present invention may comprise molecules involved in signalling pathways and/or specific receptors contacting of the (poly)peptide of the invention. However, it is also envisaged that said binding target/agent of the (poly)peptide of the invention is said (poly)peptide itself, leading, inter alia, to dimerizations, oligomerizations, multimerizations and/or complex formation. Further (natural and artificial) binding targets/agents may be identified by methods known in the art and disclosed herein.

The "reference affinity" of the interaction of the (poly)peptides of the invention and its binding targets/agents may be established and/or deduced by methods known in the art. Said methods comprise, but are not limited to, in vitro and in vivo methods and may involve binding assays as described herein. In particular, said binding assays encompass any assay where the molecular interaction of the (poly)peptides of the invention with binding targets/agents be evaluated. Said binding target/agent may comprise natural (e.g. intracellular) binding targets/agents, such as, e.g., ADP-substrate, ADP (poly)peptide itself, ADP (poly)peptide regulators and/or molecules of signalling cascades. Within the scope of this invention are, however also non-natural binding partners of the (poly)peptide of the invention, which may comprise, e.g., antibodies or derivatives and/or fragments thereof, aptamers, as well as non-natural receptor molecules. Said binding targets/agents also comprise antagonists as well as agonists of the (poly)peptides of the present invention.

Furthermore, the present invention provides for a method of screening and/or identifying an agent which modulates the dimerization, oligomerization and/or multimerization of an inventive (poly)peptide as defined herein comprising the steps of

(a) incubating a mixture comprising

(aa) an inventive (poly)peptide as defined herein above or a fragment thereof or an inventive fusion protein as defined herein or a fragment thereof; and

(ab) a candidate agent under conditions, whereby said (poly)peptide, fusion protein or fragment thereof is capable of forming dimers, oligomers and/or multimers; and

(b) detecting the presence, absence, acceleration or delay of dimerization, oligomerization and/or multimerization.

As documented in the appended examples, the (poly)peptides of the present invention are capable of forming higher ordered structures, by (self) dimerization or oligomerization and are capable of forming complexes/complex structures with other molecules, preferably with other proteins/(poly)peptides. The term "modulating the dimerization, oligomerization and/or multimerization" comprises the inhibition of formation of these higher ordered structures (which can be measured by an absence of dimers, oligomers and/or multimers) as well as the faster formation of such structures (inter alia to be measured by an accelerated formation of dimers, oligomers or multimers as compared to a reference value, obtainable by assays omitting the agent/target candidate to be tested). Therefore, the above-mentioned presence, absence, acceleration or delay of dimerization, oligomerization and/or multimerization may be detected in comparison to a reference dimerziation, oligomerization and/or multimerization whereby the candidate agent had been omitted. Furthermore, the term "modulation" in this context also comprises the (time) delay of formation of higher ordered structures/complexes. Therefore, the present invention provides in a further embodiment for the above-identified method for identifying and/or screening for agents/molecules capable of modulating said dimerization, oligomerization or multimerization. It is understood that the person skilled in the art may modify the methods disclosed herein, e.g. by the addition of further proteinous structures or binding partners in order to measure, in particular, mulitimerizations, i.e. complex formations. Therefore, it is envisaged that step (a) of the method described above also comprises the incubation of the polypeptides/fusion proteins and/or fragments thereof of the invention and the candidate agent with a further compound which may be a (proteinous) bindig partner of ADP or a fragment thereof.

Screening assays to be employed in the method disclosed herein may comprise FRET-assays, TR-FRETs and the like as disclosed herein. Furthermore, commercial assays like "Amplified Luminescent Proximity Homogenous Assay™" (BioSignal Packard) may be employed.

Specific affinities, activities and/or function of the (poly)peptide(s) of the invention may be determined by convenient in vitro, cell-based or in vivo assays, e.g. in vitro binding assays, cell culture assays, in animals (e. g. gene therapy, transgenics), etc. Binding assays encompass any assay where the molecular interaction of a (poly)peptide of the invention with a binding target or with itself is evaluated. The binding target may be a natural intracellular binding target such as oligomerization (dimerization, multimerization) of said (poly)peptide of the invention itself, a substrate or a regulating protein of said (poly)peptide of the invention or another regulator that directly modulates the activity or the (cellular) localization of the (poly)peptides of the invention. Further binding targets/agents comprise non- natural binding targets like (a) specific immune protein(s) such as an antibody, or an ADP (poly)peptide specific agent such as those identified in screening assays as described below.

Specific screening assays are, inter alia, disclosed in US 5,854,003 or in US 5,639,858. Specific binding agents of the (poly)peptides of the invention may include ADP-specific receptors, such as those of the family of heptahelical receptors. Other natural ADP binding targets are readily identified by screening cells, membranes and cellular extracts and fractions with the disclosed materials and methods and by other methods known in the art. For example, natural intracellular binding targets of the (poly)peptide of the invention may be identified with assays such as one-, two-, and three-hybrid screens. In addition, biochemical purification procedures, co-precipitation assays from cell extracts, „interaction-trap" systems, expression cloning (e. g. in bacteria using lambda gt11 or in eukaryotic cell systems using plasmid expression vectors), phage display, and the like, may be utilised for identification of natural adp binding agents. Non-natural intracellular binding agents may be obtained in screens of chemical libraries such as described below, etc.

The invention provides efficient methods of identifying pharmacological agents, compounds or lead compounds for agents active at the level of Adp modulatable cellular function. Generally, these screening methods involve assaying for compounds, which modulate interaction of the (poly)peptides of the invention with a natural Adp binding target. A wide variety of assays for binding agents are provided including labeled in vitro protein-protein binding assays, immunoassays, cell based assays, etc. The methods are amenable to automated, cost-effective high-throughput screening of chemical libraries for lead compounds and have immediate application in a broad range of domestic and international pharmaceutical and biotechnology drug development programs. Identified reagents find use in the pharmaceutical industries for animal and human trials; for example, the reagents may be derivatised and rescreened in vitro and in vivo assays to optimise activity and minimise toxicity for pharmaceutical development.

In vitro binding assays employ a mixture of components including a (poly)peptide of the invention, which may be part of a fusion product with another peptide or (poly)peptide(s), e. g. a tag for detection or anchoring, etc. The (poly)peptides of the invention or fragment(s) thereof used in the methods are usually added in an isolated, partially pure or pure form and are typically recombinantly produced. The assay mixture also comprises a candidate pharmacological agent at different concentrations. Candidate agents encompass numerous chemical classes, though typically they are organic compounds; preferably small organic compounds. Small organic compounds have a molecular weight of more than 50 Da yet less than about 2,500 Da, preferably less than about 1 ,000 Da, more preferably, less than about 500 Da. Candidate agents comprise functional chemical groups necessary for structural interactions with proteins and/or DNA, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups, more preferably at least three. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one ore more of the aforementioned functional groups. Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purine, pyrimidies, derivatives, structural analogues or combinations thereof, and the like. Where the agent is or is encoded by a transfected nucleic acid, said nucleic acid is typically DNA or RNA. Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are available or readily produced. Additionally, natural and synthetically produced libraries and compounds are readily modified through conventional chemical, physical, and biochemical means. In addition, known pharmacological agents may be subject to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc., to produce structural analogues. A variety of other reagents may also be included in the mixture. These include reagents required as biochemical energy sources, e. g. ATP or ATP analogues, nucleic acids, e. g. in nucleic acids binding assays, salts, buffers, neutral proteins, e. g. albumin, detergents, etc., which may be used to facilitate optimal protein- protein and/or protein-nucleic acid binding and/or reduce non-specific or background interactions, etc. Also, reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, antimicrobial agents, etc. may be used.

The resultant mixture is incubated under conditions whereby, but for the presence of the candidate pharmacological agent, the Adp polypeptide specifically binds the cellular binding target, portion or analogue with a reference binding affinity. The mixture components can be added in any order that provides for the requisite binding and incubations may be performed at any temperature, which facilitates optimal binding. Incubation periods are likewise selected for optimal binding but also minimised to facilitate rapid, high-throughput screening. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i. e. at zero concentration or below the limits of assay detection.

After incubation, the agent-biased binding and/or affinity between the (poly)peptide of the invention and one or more binding targets is detected by any convenient way. For cell-free binding type assays, a separation step is often used to separate bound from unbound components. The separation step may be accomplished in a variety of ways. Conveniently, at least one of the components is immobilised on a solid substrate, which may be any solid from which the unbound components may be conveniently separated. The solid substrate may be made of a wide variety of materials and in a wide variety of shapes, e.g. microtiter plate, microbead, dipstick, resin particle, etc. The substrate is chosen to maximise the signal to noise ratios, primarily to minimise background binding, for ease of washing and cost. Separation may be effected for example, by removing a bead or a dipstick from a reservoir, emptying or diluting a reservoir such as a microtiter plate well, rinsing a bead (e. g. beads with iron cores may be readily isolated and washed using magnets), particle, chromatographic column or filter with a wash solution or solvent. Typically, the separation step will include an extended rinse or wash or a plurality of rinses and washes. For example, where the solid substrate is a microtiter plate, the wells may be washed several times with a washing solution, which typically includes those components of the incubation mixture that do not participate in specific binding such as salts, buffer, detergent, non-specific protein, etc.

Alternatively, cell-free binding type assays may be performed in homogeneous formats that do not require a separation step, e.g. scintillation proximity assay (SPA), homogenous time-resolved fluorescence assay (HTRFA). Further methods which may be employed comprise fluorescence polarisation (FP) and fluorescence resonance energy transfer (FRET).

Detection may be effected in any convenient way. For cell based assays such as one, two, and three hybrid screens, the transcript resulting from ADP-target binding usually encodes a directly or indirectly detectable product (e.g. galactosidase activity, luciferase activity, etc.). For cell-free binding assays, one of the components usually comprises or is coupled to a label. A wide variety of labels may be employed-essentially any label that provides for detection of bound protein. The label may provide for direct detection as radioactivity, luminescence, polarisation of light, optical or electron density, etc. or indirect detection such as an epitope tag, an enzyme, etc. The label may be appended to the protein e. g. a phosphate group comprising a radioactive isotope of phosphorous, or incorporated into the protein structure, e. g. a methionine residue comprising a radioactive isotope of sulfur.

A variety of methods may be used to detect a specific label depending on the nature of the label and other assay components. For example, the label may be detected bound to a solid substrate or a portion of the bound complex containing the label may be separated from the solid substrate, and thereafter the label detected. Labels may be directly detected through optical or electron density, radiative emission, nonradiative energy transfer, emission of polarised light, etc., or indirectly detected with antibody conjugates, etc. For example, in the case of radioactive labels, emissions may be detected directly, e.g. with particle counters or indirectly, e.g. with scintillation cocktails and counters.

A difference in the binding affinity of the (poly)peptide of the invention to the target in the absence of the agent as compared with the binding affinity in the presence of the agent indicates that the agent modulates the binding of the Adp polypeptide to the Adp binding target The difference, as used herein, is statistically significant and preferably represents at least a 50%, more preferably at least a 90% difference.

Analogously, in cell-based assays, a difference in Adp-dependent activity in the presence and absence of an agent indicates the agent modulates Adp mediated cellular function or Adp expression. Such cell-based approaches may involve transient or stable expression assays. In this method, cells are transfected with one or more constructs encoding in sum, a polypeptide comprising a portion of the (poly)peptide of the invention and a reporter under the transcriptional control of an adp responsive promotor. The cell may advantageously also be cotransfected with a construct encoding an Adp activator, e. g. a receptor capable of stimulating Adp activity, etc. Alternatively, the adipose promotor itself may be linked to a suitable reporter gene, e. g. luciferase, and used in cell-based assays to screen for compounds capable of modulating, via up- or down-regulation, adipose expression.

The methods described herein are particularly suited for automated high- throughput drug screening using robotic liquid dispensing workstations. Similar robotic automation is available for high-throughput cell plating and detection of various assay read-outs.

Candidate agents shown to modulate the expression of the nucleic acid molecules of the invention or association of (poly)peptides of the invention with a binding partner provide valuable reagents to the pharmaceutical industries for animal and human trials. Target therapeutic indications are limited only in that the target adp cellular function (e. g. gene expression or association with a binding partner) be subject to modulation. In particular, candidate agents obtained from drug screening assays and the subject compositions, e.g. as adp-derived nucleic acids or therapeutic polypeptides, provide therapeutic applications in diseases associated with body-weight regulation and energy homeostatis, including treatment of obesity, disorders associated with wasting, such as cancer, infectious diseases and HIV infection, or bulimia. As will be discussed herein below, for therapeutic use, the compositions and agents may be administered by any convenient way, preferably parenterally, conveniently in a physiologically acceptable carrier, e.g. phosphate buffered saline, saline, deionized water, or the like. Other additives may be included, such as stabilisers, bactericides, etc. Typically, the compositions are added to a retained physiological fluid such a blood or synovial fluid. Generally, the amount administered will be empirically determined, depending, for example, upon the therapeutic objectives, the route of administration, and the condition of the patient. Typically, the clinician will administer a molecule of the present invention until a dosage is reached that provides the required biological effect. The progress of this therapy is easily monitored by conventional assays.

Additionally, the present invention relates to a method of refining the compound or the agent identified by the method(s) of identifying a compound influencing the expression of nucleic acid molecule of the invention, the method(s) of identifying a (poly)peptide involved in the regulation of body weight in a mammal, or the method of screening for an agent which modulates the interaction of a (poly)peptide of the invention with a binding target/agent comprising

(a) modeling said compound by peptidomimetics; and

(b) chemically synthesizing the modeled compound.

Peptidomimetics is well known in the art and disclosed, inter alia, in Beeley, Trends Biotech 12 (1994), 213-216, Wiley, Med. Res. Rev. 13 (1993), 327-384, Hruby, Biopolymers 43 (1997), 219-266, or references cited therein or references cited herein above.

Methods of the generation and use of peptidomimetic combinatorial libraries are described in the prior art, for example in Ostresh, Methods in Enzymology 267 (1996), 220-234 and Dorner, Bioorg. Med. Chem. 4 (1996), 709-715. Methods for the chemical synthesis and/or the preparation of chemical derivatives and analogues are well known to those skilled in the art and are described in, for example, Beilstein, loc. cit. and "Organic Synthesis", Wiley, New York, U.S.A., see supra.

It is envisaged in the present invention that the above mentioned peptidomimetics methods and/or methods for chemical synthesis, modification or for refining may also directly be employed on the compounds of the invention, e.g. on the (poly)peptides or on the fusionproteins of the invention. The present invention relates to a method of producing a composition comprising formulating the compound of the invention, the compound or agents identified by the method(s) described herein or the compound refined by the method(s) described herein above with a pharmaceutically acceptable carrier and/or diluent.

Examples of suitable pharmaceutical carriers, excipients and/or diluents are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc. Compositions comprising such carriers can be formulated by well known conventional methods. These pharmaceutical compositions can be administered to the subject at a suitable dose. Administration of the suitable compositions may be effected by different ways, e.g., by intravenous, intraperitoneal, subcutaneous, intramuscular, topical, intradermal, intranasal or intrabronchial administration. The dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. Proteinaceous pharmaceutically active matter may be present in amounts between 1 ng and 10 mg per dose; however, doses below or above this exemplary range are envisioned, especially considering the aforementioned factors. If the regimen is a continuous infusion, it should also be in the range of 1 μg to 10 mg units per kilogram of body weight per minute, respectively. Progress can be monitored by periodic assessment. The compositions of the invention may be administered locally or systemically. The compositions of the invention may also be administered directly to the target site, e.g., by biolistic delivery to an internal or external target site or by catheter to a site in an artery. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Furthermore, the pharmaceutical composition of the invention may comprise further agents depending on the intended use of the pharmaceutical composition.

Additionally, the present invention provides for a method of producing a composition comprising the compound(s) of the invention or the compound(s) or agent(s) identified by the method(s) of the invention comprising the steps of (a) modifying a compound of the invention, or a compound or agent identified by the method of the invention as a head compound to achieve (i) modified site of action, spectrum of activity, organ specificity, and/or (ii) improved potency, and/or

(iii) decreased toxicity (improved therapeutic index), and/or (iv) decreased side effects, and/or

(v) modified onset of therapeutic action, duration of effect, and/or (vi) modified pharmakinetic parameters (resorption, distribution, metabolism and excretion), and/or (vii) modified physico-chemical parameters (solubility, hygroscopicity, color, taste, odor, stability, state), and/or (viii) improved general specificity, organ/tissue specificity, and/or (ix) optimized application form and route by

(i) esterification of carboxyl groups, or (ii) esterification of hydroxyl groups with carbon acids, or (iii) esterification of hydroxyl groups to, e.g. phosphates, pyrophosphates or sulfates or hemi succinates, or (iv) formation of pharmaceutically acceptable salts, or (v) formation of pharmaceutically acceptable complexes, or (vi) synthesis of pharmacologically active polymers, or (vii) introduction of hydrophilic moieties, or (viii) introduction/exchange of substituents on aromates or side chains, change of substituent pattern, or (ix) modification by introduction of isosteric or bioisosteric moieties, or (x) synthesis of homologous compounds, or (xi) introduction of branched side chains, or (xii) conversion of alkyl substituents to cyclic analogues, or (xiii) derivatisation of hydroxyl group to ketales, acetales, or (xiv) N-acetylation to amides, phenylcarbamates, or (xv) synthesis of Mannich bases, imines, or (xvi) transformation of ketones or aldehydes to Schiffs bases, oximes, acetales, ketales, enolesters, oxazolidines, thiozolidines or combinations thereof; and (b) formulating the product of said modification with a pharmaceutically acceptable carrier.

Pharmaceutical acceptable carriers are well known in the art, as described herein above. It is envisaged that also the compounds of the invention, i.e. the (poly)peptides or fusionproteins of the invention, the nucleic acid molecules of the invention be employed in the above described method for producing a composition. Preferably, said composition(s) is/are a pharmaceutical composition(s) as described herein.

Therefore, in a more preferred embodiment, the present invention relates to a method of producing a composition comprising the compound(s) of the invention or the compound(s) or agent(s) identified by the method(s) of the invention, wherein said composition is a pharmaceutical composition for preventing or treating obesity, adipositas, eating disorders, bulimia, wasting and/or disorders leading to increased or decreased body weight/body mass as, inter alia, described herein below.

In addition, the present invention relates to a composition comprising (a) an inhibitor of the (poly)peptide of the invention or of the (poly)peptide identified or refined by the method(s) of the invention; (b) an inhibitor of the expression of the nucleic acid molecule of the invention or of the gene identified by the method(s) of the invention;

(c) a compound identified by the method of the invention; and/or

(d) the vector of the invention.

Said inhibitor of the (poly)peptide of the invention may be a compound which functions as inhibitor of the wildtype (poly)peptide of the invention, the ADP protein. Said inhibitor may lead to an increase in body weight/body mass. Said inhibitor may also be an inhibitor specifically interacting with (a) mutated form(s) of the (poly)peptide of the invention and thereby lead to a decrease in body weight/body mass or to an maintainance of the current body weight/body mass. It is to be understood that the term "inhibitor" of the (poly)peptide identified by the methods of the invention also relates to (an) inhibitor(s) which influence the activity and/or function of interacting (poly)peptides as identified by the method of the present invention. Said interaction may be direct or indirect. Said "inhibitor" may also interfere with and/or modify the interaction of the (poly)peptide of the invention with its binding targets/agents as defined herein. The above described applies mutatis mutandis for the term "inhibitor of the expression of the nucleic acid molecule of the invention or of the gene identified by the method(s) of the invention". Said inhibitor may interfere with transcriptional and/or translational processes.

Similarly, the present invention relates to a composition comprising

(a) a stimulator of the (poly)peptide of the invention or of the (poly)peptide identified or refined by the method(s) described herein above;

(b) a stimulator of the expression of the nucleic acid molecule of the invention or of the gene identified by the method(s) of the invention;

(c) a compound identified by the method(s) of the invention; and/or

(d) the vector of the invention.

The term "stimulation of the (poly)peptide" of the invention relates to a compound which functions as a stimulator (activator) of the (poly)peptides of the invention. Said stimulator/activator may lead to a decrease in body weight/body mass or may lead to a maintenance of the current body weigh/body mass. The here described "stimulators" may, inter alia, lead to an increased interaction of the (poly)peptide of the invention with its binding target. The term also relates to a stimulator/activator of the mutated form(s) of the (poly)peptides of the present invention. Said stimulator(s) of the mutated form(s) may lead to an increase in body weight/body mass or to an maintenance of the current body weight/body mass.

"Inhibitors" as well as "stimulators of the (poly)peptide of the invention" may be deduced and/or evaluated by methods known in the art and disclosed herein.

The term "stimulator of a (poly)peptide identified or refined by the method(s) of the present invention" relates also to a stimulator which influences the activity/function of (interacting) (poly)peptides as identified by the method of the present invention they may interact with said (poly)peptides in either direct or indirect fashion. As already mentioned for the term "inhibitor" as defined herein above, the above said applies, mutatis mutantis, for the term "stimulator of the expression of the nucleic acid molecule of the invention or of the gene identified by the method(s) of the invention".

The above mentioned "inhibitors" and "stimulators" not only relate to (poly)peptides, but may also comprise small molecules which bind to, interfere with and/or interact with the (poly)peptides and/or nucleic acid molecules of the invention or with (poly)peptides and/or genes identified by the method(s) of the invention. Examples of such small molecules comprise, but are not limited to small peptides, anorganic and/or organic substances or peptide-like molecules, like peptide-analogs comprising D-amino acids. Said "inhibitors" and "stimulators" may further comprise antibodies, derivatives and/or fragments thereof, aptamers or specific (oligo)nucleotides. The "inhibitors" and "stimulators" may also be part of the pharmaceutical and/or diagnostic compositions as disclosed herein.

As pointed out herein above, said "inhibitors" or "stimulators" may also comprise small organic compounds as defined herein above.

In addition, the present invention relates to a composition comprising a nucleic acid molecule of the invention, a (poly)peptide of the invention, a fusionprotein of the invention, an antibody or (a) fragment(s) or derivative(s) thereof or an aptamer of the invention or an anti-sense oligonucleotide of the invention. Furthermore, said composition may comprise (poly)peptides, nucleic acid molecules, genes and/or compounds or agents as identified by the methods of the present invention. In a preferred embodiment of the invention, said composition is a pharmaceutical composition.

Pharmaceutical composition comprising, optionally, pharmaceutically acceptable carriers have been described herein above. The pharmaceutical composition of the present invention are particularly useful for the treatment and/or the prevention of complex disorders of appetite regulation and/or energy metabolism. It is particularly preferred that said pharmaceutical composition is employed in treating and/or preventing obesity, adipositas, eating disorders, bulimia, disorders of body weight/body mass. It is, however, also envisaged that said pharmaceutical compositions be used in disorders like, inter alia, wasting (cachexia), weight loss due to cancer or infectious diseases or weight loss in immuno-compromised patients, like, HIV-patients. The pharmaceutical composition of the present invention may also be employed in genetic disorders associated with hypogonadism, e.g. Prader-Willi syndrome, Laurence-Moon-Biedl syndrome and the like. Furthermore, it may be used in the treatment of hypothyroidism, diabetes, Cushing's syndrome, Stein-Leventhal syndrome, obese-disorders due to drug use (e.g. corticosteroids), or hypothalamic damage (e.g. due to tumours, trauma, etc.)

In addition, said pharmaceutical composition may be particularly useful in treating and/or preventing endocrine diseases/disorders (like, e.g., hyperthyrodism) or gastrointestinal diseases (like, e.g., dumping syndrome, inflammatory bowel disease, including Crohn's disease and ulcerative colitis, disorders of absorption and maldigestion including sprue).

It is furthermore envisaged that the composition of the invention, in particular the pharmaceutical composition be employed in neurological and/or psychiatric disorders, like e.g. anorexia nervose or bulimia. The above mentioned endocrine, gastrointestinal and neurological/psychiatric diseases/disorders may be associated with substantial loss of body weight/body mass and may therefore be considered as disorders of body weight/body mass. However, disorders of body weight/body mass may also lead, as disclosed herein, to weight gains. Such disorders comprise, but are not limited to, glycogen storage diseases, lipid storage diseases (like, e.g., Gaucher, Niemann Pieck), endocrine disorders (like, e.g., Cushings, hypothyroidism, insulinomas, lack of growth hormone, diabetes, adrenogenital syndrome, diseases of the adrenal cortex), tumors and metastases (such as craniophryngeomas), encephalitis, chronically elevated intracranial pressure (like Pseudotumor cerebri), weight gain due to drugs (inter alia, insulin, insulin sensitizer, corticoids, sulfonyl urea, antidepressants, antipsychotic medication) and genetic diseases and syndromes mentioned herein above or to be identified (like, e.g., hyperiipoproteinemias, hypothalmic disorders, Frδhlich syndrome or empty sella syndrome).

Said pharmaceutical compositions may also be employed for treating and/or preventing disorders like lipomas and/or liposarcomas.

It is furthermore envisaged that the pharmaceutical composition of the invention may be used in combination with other agents employed in the treatment of body weight/mass disorders. Said agents may comprise, but are not limited to, agents reducing/enhancing food intake, agents blocking/activating nutrient absorption, agents increasing/decreasing thermogenesis, agents modulating fat and/or protein metabolism or storage, agents modulating the central contoller regulating body weight. Said agents may, inter alia, comprise, agents like sibutramine, orlistat, ephedrine or caffeine, diethylpropione, phentermine, fluoxetine, sertraline, or phenylpropanolamine.

Furthermore, the present invention relates to a composition comprising a nucleic acid molecule of the invention, a (poly)peptide of the invention, a fusionprotein of the invention, an antibody, a derivative or fragment thereof, an aptamer of the invention at least a primer or a set of primers as defined herein above or an anti- sense oligonucleotide of the invention.

In a particular preferred embodiment said composition is a diagnostic composition.

Said diagnostic composition may comprise the components as defined herein above wherein said components are bound to/attached to and/or linked to a solid support as defined herein above. It is furthermore envisaged, that said diagnostic composition comprises a compound(s) of this invention on (micro-)chips. Therefore, said diagnostic composition may, inter alia, comprise the nucleic acid molecules of the invention on so-called "gene chips" or the (poly)peptides of the invention on so-called "protein-chips". Diagnostic gene chips may^" comprise a collection of the nucleic acid molecules of the invention that, e.g., specifically detect mutations in the ADP-gene of animals, in particular of humans. Therefore, said diagnostic composition may, inter alia, comprise the nucleic acid molecules of the invention on so-called "gene chips" or the (poly)peptides of the invention on so-called "protein-chips" (see U.S. Patent Nos. 6,066,454, 6,045,996, 6,043,080, 6,040,193, 6,040,138, 6,033,860, 6,033,850, 6,025,601 , 6,022,963, 6,013,440, 5,968,740, 5,925,525, 5,922,591 , 5,919,523, 5,889,165, 5,885,837, 5,874,219, 5,858,659, 5,856,174, 5,856,101 , 5,843,655, 5,837,832, 5,834,758, 5,831 ,070, 5,770,722, 5,770,456, 5,753,788, 5,744,305, 5,733,729, 5,710,000, 5,631 ,734, 5,599,695, 5,593,839, 5,578,832, 5,556,752). Diagnostic gene chips may comprise a collection of the nucleic acid molecules of the invention that, e.g., specifically detect mutations in the ADP-gene of animals, in particular of humans. Said diagnostic compositions and in particular the diagnostic gene chip as described herein above may be particularly useful for screening patients for (genetic) defects underlying, e.g. obesity, adipositase, disorders of body weight/body mass, or eating disorders.

Particular useful primers to be employed as diagnostic compositions are primers/set of primers as depicted in SEQ ID NOs: 17 and 18, 19 and 20, 21 and 22, 23 and 24, 25 and 26, 40 and 41 , 42 and 43, 40 and 44, 45 and 46, 47 and 48 and/or 49 and 50. As mentioned herein above, anti-sense oligonucleotides of the invention may also be useful as hybridization probes and may, therefore, also serve as diagnostic tools. Said tools, like protein(s) and/or anti-sense oligonucleotides may, inter alia, be useful in ADP hybridization screens for adp transcripts and/or for screening methods detecting disease-associated mutations as defined herein above. Said mutation(s) may also comprise(s) polymorphisms, like single nucleotide polymorphisms (SNPs) or other modifications/variations of the nucleic acid molecule of the invention, e.g. the nucleic acid molecules encoding ADP. It is preferred that said compounds of the present invention to be employed in a diagnostic composition are detectably labeled. A variety of techniques are available for labeling biomolecules, are well known to the person skilled in the art and are considered to be within the scope of the present invention. Such techniques are, e.g., described in Tijssen, "Practice and theory of enzyme immuno assays", Burden, RH and von Knippenburg (Eds), Volume 15 (1985), "Basic methods in molecular biology"; Davis LG, Dibmer MD; Battey Elsevier (1990), Mayer et al., (Eds) "Immunochemical methods in cell and molecular biology" Academic Press, London (1987), or in the series "Methods in Enzymology", Academic Press, Inc.

There are many different labels and methods of labeling known to those of ordinary skill in the art. Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes, colloidal metals, fluorescent compounds, chemiluminescent compounds, and bioluminescent compounds.

Commonly used labels comprise, inter alia, fluorochromes (like fluorescein, rhodamine, Texas Red, etc.), enzymes (like horse radish peroxidase, β- galactosidase, alkaline phosphatase), radioactive isotopes (like ³²P or ¹²⁵l), biotin, digoxygenin, colloidal metals, chemi- or bioluminescent compounds (like dioxetanes, luminol or acridiniums). Labeling procedures, like covalent coupling of enzymes or biotinyl groups, iodinations, phosphorylations, biotinylations, random priming, nick-translations, tailing (using terminal transferases) are well known in the art.

Detection methods comprise, but are not limited to, autoradiography, fluorescence microscopy, direct and indirect enzymatic reactions, etc.

Commonly used detection assays comprise radioisotopic or non-radioisotopic methods. These comprise, inter alia, RIA (Radioimmuno Assay) and IRMA (Immune Radioimmunometric Assay), EIA (Enzyme Immuno Assay), ELISA (Enzyme Linked Immuno Sorbent Assay), FIA (Fluorescent Immuno Assay), and CLIA (Chemioluminescent Immune Assay). Other detection methods that are used in the art are those that do not utilize tracer molecules. One prototype of these methods is the agglutination assay, based on the property of a given molecule to bridge at least two particles.

For diagnosis and quantification of nucleic acid molecules and/or (poly)peptides of the invention, etc. in clinical and/or scientific specimens, a variety of immunological methods, as described above as well as molecular biological methods, like nucleic acid hybridization assays, PCR assays or DNA Enzyme Immunoassays (Mantero et al., Clinical Chemistry 37 (1991), 422-429) have been developed and are well known in the art. In this context, it should be noted that the nucleic acid molecules of the invention may also comprise PNAs, modified DNA analogs containing amide backbone linkages. Such PNAs are useful, inter alia, as probes for DNA/RNA hybridization.

The diagnostic composition optionally comprises suitable means for detection. The (poly)peptides and antibodies or fragments or derivatives thereof or aptamers etc. described above are, for example, suitable for use in immunoassays in which they can be utilized in liquid phase or bound to a solid phase carrier. Examples of immunoassays which can utilize said (poly)peptide are competitive and non- competitive immunoassays in either a direct or indirect format. Examples of such immunoassays as already described above, are the radioimmunoassay (RIA), the sandwich (immunometric assay) and the Western blot assay. The (poly)peptides, antibodies and/or fusionproteins etc. can be bound to many different carriers. Examples of well-known carriers include glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amyloses, natural and modified celluloses, polyacrylamides, agaroses, and magnetite. The nature of the carrier can be either soluble or insoluble for the purposes of the invention. Appropriate labels and methods for labeling have been identified above.

Said diagnostic compositions may be used in methods for detecting expression of a nucleic acid molecule of the invention by detecting the presence of mRNA coding for a (poly)peptide or viral protein of the invention which comprises, for example, obtaining mRNA from viral preparations and contacting the mRNA so obtained with a probe/primer comprising a nucleic acid molecule capable of specifically hybridizing with a polynucleotide of the invention under suitable conditions (see also supra), and detecting the presence of mRNA hybridized to the probe/primer. Further diagnostic methods leading to the detection of nucleic acid molecules in a sample comprise, e.g., polymerase chain reaction (PCR), ligase chain reaction (LCR), Southern blotting in combination with nucleic acid hybridization, comparative genome hybridization (CGH) or representative difference analysis (RDA). These methods for assaying for the presence of nucleic acid molecules are known in the art and can be carried out without any undue experimentation.

In yet another embodiment, the present invention relates to a method of treating obesity in a mammal comprising administering the composition as described herein above or an inhibitor, stimulator, compound or vector comprised therein to a mammal in need thereof. It is particularly preferred that said mammal is a human.

Furthermore, the present invention relates to the use of

(a) an inhibitor of the (poly)peptide identified or refined by the method(s) of the invention;

(b) an inhibitor of the expression of the gene identified by the method of the invention;

(c) a compound identified by the method of the invention; and/or

(d) the vector of the invention for the preparation of a pharmaceutical composition for the treatment of obesity, adipositas, bulimia, wasting, eating disorders and/or body weight/body mass disorders.

Similarly, the present invention also relates to the use of

(a) a stimulator of the (poly)peptide identified or refined by the method of the invention;

(b) a stimulator of the expression of the gene identified by the method of the invention; and/or

(c) a compound identified by the method of the invention for the preparation of a pharmaceutical composition for the treatment of obesity, adipositas, bulimia, wasting, eating disorders and/or disorders of body weight/body mass. In addition, the present invention relates to the use of an agent which modulates the interaction for a (poly)peptide of the invention with a binding target/agent as identified by the method disclosed herein above for the preparation of a pharmaceutical composition for the treatment and/or prevention of obesity, adipositas, bulimia, wasting, eating disorders, disorders of body weight/body mass.

Body weight/body mass disorders have been described herein above and may comprise disorders wherein body weight/body mass is increased (like, e.g., glycogen storage diseases) as well as disorders wherein body mass/body weight is decreased (like, e.g. cachexia).

The invention can also address other maladies associated with abnormal weight regulation (e.g. being under or over weight) including but not limited to diabetes, heart disease, hypertension, infertility, and neuroendocrinological and psychological problems associated with being under or over weight. Accordingly, the inventive nucleic acid, (poly)peptide or agent may also be administered for treatment of conditions associated with being under weight e.g. enhancing or controlling fertility, controlling weight loss in AIDS or cancer patients.

The present invention also provides for a kit comprising at least one of

(a) a nucleic acid molecule of the invention;

(b) a vector of the invention;

(c) a host of the invention;

(d) a (poly)peptide of the invention;

(e) a fusionprotein of the invention;

(f) an antibody or a fragment or derivative thereof or an antiserum, an aptamer or another receptor of the invention;

(g) a primer or a set of primer(s) as defined herein above; and/or (h) a anti-sense oligonucleotide as defined herein above.

It is furthermore envisaged that said kit may comprise a specific ribozyme or an RNAi as described herein above. Advantageously, the kit of the present invention further comprises, optionally (a) reaction buffer(s), storage solutions and/or remaining reagents or materials required for the conduct of scientific or diagnostic assays or the like. Furthermore, parts of the kit of the invention can be packaged individually in vials or bottles or in combination in containers or multicontainer units.

The kit of the present invention may be advantageously used, inter alia, for carrying out the method of producing a (poly)peptide of the invention and could be employed in a variety of applications referred herein, e.g., as diagnostic kits, as research tools or vaccination tools. Additionally, the kit of the invention may contain means for detection suitable for scientific medical and/or diagnostic purposes. The manufacture of the kits follows preferably standard procedures which are known to the person skilled in the art.

The figures show:

Fig. 1 : Phenotypes of adp mutant flies.

A (a, c, d) Ventral abdomen of flies. Fat body as viewed through the body wall, (b, d, f) Hematoxilin stained sections of the fat body.

(a) Abdomen of an adp⁶⁰ mutant fly. The increased lipid content causes a glassy appearance of the fat body cells (arrow).

(b) Abdomen of an adp⁶⁰ mutant fly. Note the enlarged lipid droplets (arrow).

(c) Wild type fly with normally looking fat body.

(d) Wild type fly with normally sized lipid droplets.

(e) adp⁶⁰ mutant containing a transgene with a wild type copy of the adp gene (..rescue fly").

(f) Rescue fly with normally sized lipid droplets.

B

(a) Triglyceride content of adp⁶⁰ mutant flies was approximately double that of wild type levels (OreR). In rescue flies the triglyceride content was reduced to wild type levels. (b) Starvation resistance of well fed flies 6 days after hatching, adp⁶⁰ mutant flies are able to survive starvation significantly longer than wild type flies or rescue flies.

Fig. 2: Genomic organization of the adp locus

The adp candidate region lies between the pABP gene on the left side (towards the centromere) and the distal breakpoint of a deficiency associated with ln(2R)Pcl¹¹ (towards the telomere). In this candidate region a mutated transcript was detected in adp mutant flies (adp^mut). A rescue fragment containing a wild type copy of the adp gene (adp) was able to rescue all aspects of the observed adp mutant phenotype, establishing the identity of the adp gene. The sequence of other potential transcripts within the rescue fragment (ORF, as predicted by computational analysis) does not differ between wild type and adp mutant flies, again establishing the identity of the adp gene.

Fig. 3: Expression of adp during the development of Drosophila melanogaster. A radioactively labeled riboprobe of the adp cDNA was used to hybridize a northern blot with RNA from different developmental stages. E = embryo, L1-3 = larvae stage 1-3, P = pupae, A1/6 = adults 1/6 days old. A major transcript of 2.7 kb and a minor transcript of 1 ,2 kb were detected. Ribosomal protein L9 (rP L9) served as a loading control.

Fig. 4: Cloning and expression of the Drosophila adp gene

(A) Schematic representation of the adp genomic region. See text for details. Two potential transcription units lie within the 8.1 kb rescue fragment (as predicted by computational analysis). One of these (pred.ORF) does not differ between wild type and adp mutant flies and is not contained within the 3.6 kb rescue fragment. The other transcription unit, however, is present in the 8.1 and 3.6 kb rescue fragments, both of which transformed the adp⁶⁰ host strain, thus confirming its identity as the transcription unit of the adp candidate gene. (B) Sequence of the adp gene. In the mutated adp gene (adp60) 23 bp are deleted, resulting in two changed amino acids followed by a stop codon in the predicted protein (Adp60). (C) Northern blot analysis of the expression of Drosophila adp transcripts in different developmental stages (E = embryos, L1-L3 = larval stages 1-3, P = pupae, A = adults). A major 2.7 kb band is present in all stages (upper blot). A very weak band of 1.2 kb can be detected after prolonged exposure (not shown). A probe for ribosomal gene L9 served as a loading control for equal RNA amounts (lower blot).

Fig. 5: Overexpression of adp in fat body and nervous system

(A) Triglyceride levels in 3^rd instar larvae. Animals overexpressing adp in the fat body (FB-Gal4,UAS-_a ⁺) show a strong reduction of lipid levels compared to control animals (FB-Gal4). Expression of adp in the nervous system (eIav-Gal4,UAS-_aφ⁺) does not reduce lipid levels. (B) Fat specific Oil Red O staining shows a significant reduction of fat body tissue in the adp overexpression larva (bottom) compared to control animal (top, asterisk marks intense red stained fat containing tissue).

Fig. 6: Alignment of the human (Hs_Adp), mouse (Mm_Adp), and Drosophila (Dm_Adp) adipose aminoacid sequence.

Sequence regions containing WD40-like motifs, TPR-like motifs, and the ADP-domain are indicated by bars above the sequence.

Fig. 7: Expression of adp in human and mouse tissues.

A radioactively labeled riboprobe of the human adp cDNA (a) and the mouse adp cDNA (b) was used to hybridize a northern blot with RNA from different tissues of human (a) and mouse (b).

(a) β-actin served as loading control.

(b) GAPDH and β-actin served as loading control.

Fig. 8: Modeled structure of the human Adp protein

Model building suggests that the Adp protein can form a seven-bladed β-propeller. The six _α-helices of the TPR-domains are shown on the right; "linker" regions between the β-propeller and the TPR-motifs are represented as dashed lines.

Fig. 9: "Adipose" transcription is increased during adipocyte differentiation.

Measurement of adp-mRNA expression in an in vitro adipocyte differentiation model.

Up-regulation of adp-RNA during adipocyte differentiation demonstrates that the correct gene dose of adp could be essential for the differentiation process. This notion is confirmed by the antisense experiments presented in Figure 17. In addition adp expression can be used as a marker for the differentiation state e.g. to be used as a readout that allows to screen for compounds affecting the differentiation process.

Fig. 10: Multimerization of Adipose as revealed by Co-lmmunoprecipitation. Size marker in kD.

Fig. 11 : Adipose is part of a large protein complex. Size marker in kD.

Fig. 12: Association of an endogenous 120 kD protein with human adipose. Size markers in kD.

Fig. 13: Association of different Y2H clones with human adipose. Size marker in kD.

Fig. 14: Fluorescence microscopy analysis of human ADP localization in NIH3T3 cells.

Fig. 15: Adipose expression in d15 mouse embryos.

In situ hybridization of a mouse embryo sagittal section (day 15) using a digoxygenin-labeled Adipose antisense RNA probe. (A) Expression is detected in the pancreas and at very low levels in most other tissues. pa = pancreas, nt = neural tube, Ii = liver (B) Adipose expression in the pancreas is concentrated in the pancreatic epithelium (pe).

Fig. 16: Adipose expression in adult mouse tissues.

Fig. 17: Adipose antisense experiments

Treatment of 3T3-L1 cells with adipose morpholino antisense oligos results in a more efficient differentiation process as judged by the expression levels of adipogenic marker genes (AP2). Similar results were obtained with other markers (CEPB _α, PPARγ).

Fig. 18: Characterization of a polyclonal antiserum directed against the TPR- region of human Adipose.

Arrows indicate the position of ADP as detailed in Example XVI. Size marker in kD.

The following Examples illustrate the invention.

Example I: The Drosophila adipose (adp) mutation

The adipose (adp) mutation of Drosophila had been isolated in a natural fly population from Nigeria (Doane, J. Exp. Zool. 145 (1960), 1-21). Homozygous adp flies are viable and can be propagated like wild type fly stocks. To examine the phenotype of adp⁶⁰ mutants, newly emerged flies were kept in uncrowded conditions for 0 to 10 days on fresh fly food ad libitum containing a spot of yeast on the top. After different feeding periods, the phenotypes were analysed by the following assays: The fat body phenotype was examined through the body wall by submerging the flies in ethanol. To show the increased size of lipid droplets, 8 μm paraffin sections of paraformaldehyde-fixed 6 day fed flies were rehydrated, stained with Harris hematoxylin for 10 min. and, after thorough washing with water, mounted on Aquamount Determination of lipid content was performed using the Triglyceride (INT) kit (Sigma) according to the manufacturers protocol. Flies were starved at 25°C in food-free vials with unlimited water supply. The amount of dead and moribund flies was counted at different timepoints between 0 and 96 hours. However, unlike wild type flies (Fig. 1A(a)) adp flies develop obesity during adult life if environmental factors, i.e. food supply, allow. After one week of ad libitum feeding, they display a visible obese phenotype (Fig. 1A(b)). Their fat cells contain abnormally enlarged lipid vesicles, reflecting an accumulation of triglycerides to levels twice as high as in wildtype flies (see Fig. 1A(c)) (Teague, J. exp. Zool. 240 (1986), 95-104). Consistently, when the adp flies are starved after developing the full obese phenotype, they make use of their energy storage and outlive wild type control flies significantly (Fig. 1A(d)). A further detailed analysis is provided in appended Figure 1B. In particular, after one week of ad libitum feeding, the fat cells of adp mutant flies contain greatly enlarged lipid droplets (Fig. 1 B(A), (B)) as compared to wild type flies (Fig. 1 B(C), (D)). This cellular phenotype correlates well with the mutants twofold higher accumulation of triglycerides, which serve as lipid storage in the fly (A. B. Keith, Comp. Biochem. Physiol. 17, 1127-1136 (1966)) (Fig. 1 B(E); see also B. D. Teague, A. G. Clark; W. W. Doane, j. _exp, Zool. 240, 95-104 (1986)). The conditional dependence of the obese phenotype on food supply reflects distinct physiological features of mammalian obesity (P. G. Kopelman, Nature 404, 635-643 (2000)).

When well-fed adp⁶⁰ flies encounter starvation, they significantly outlive wild-type flies (Fig. 1 B (F)) by making use of their accumulated fat resources. Although adp flies are generally of good viability most individuals fall short behind wild type flies in flight endurance tests (Doane, Evolution 34 (1980), 868-874). Results presented here show that the loss in physical fitness is counterbalanced by the ability of adp mutants to survive food deprivation better than wild type, providing an argument for maintaining the adp mutation in a natural fly population. Example II: Localization of the adp gene by genetic mapping/positional cloning

Flies mutant for the _aφ allele adp⁶⁰ recombined into the Ore-R genetic background were used for all experiments and are already described elsewhere (Clark and Doane, Hereditas 99 (1983), 165-175). The same Ore-R fly stock used for the recombination served as a wild-type stock for phenotypic comparisons. P- element-mediated transformation was performed on white mutant flies (Lindsley and Zimm (1992), loc. cit.) using PΛ2-3 as a source of transposase (Rubin, Science 218 (1982), 348-353).

To examine the phenotypes of adp mutant flies newly-emerged adp and Ore-R flies were well-fed under uncrowded conditions for 0 to 10 days on fresh fly food containing a spot of yeast on the top. After different feeding periods the phenotypes were analysed with the following assays:

The fat body phenotype was examined through the body wall by submerging the flies in ethanol. Determination of glycogen- and lipid-content was done as describe in the manuals of the TC Starch-Kit (Roche) and Triclycerid (INT)-Kit (Sigma), respectively. Flies were starved at 25°C in food-free vials under continuos water- supply. The amount of dead and moribund flies was counted at different timepoints between 0 and 96 hours.

The adp locus was mapped to position 55B on the right arm of chromosome 2 (The FlyBase Consortium, Nucleic Acids Res. 27 (1999), 85-88). Therefore, in order to isolate the adp gene by positional cloning, complementation tests with deficiency chromosomes that uncover the mutation and recombination analysis using the nearby loci and Polycomb and pABP (The FlyBase Consortium, loc. cit.) were performed.

Table I

complements

Deficiencies references adp

For a better localization of the adp gene (i.g. to determine if the gene lies within or outside a given deficiency) crosses between male flies (alternatively virgin flies) which are homozygous for the adp mutation iadpladp) and virgins (alternatively males) from fly lines carrying a deficiency over a balancer chromosome (def/bal) have been performed (Tab. I).

The offspring of this crosses has been checked for the obese phenotype. The adp gene is uncovered by the deficiency (i.g. lies within the genomic region that is deleted by the deficiency) if the offspring, which is heterozygous for the adp mutation over a deficiency (aφ/def), shows the obese phenotype, known as a marker for homozygous adp mutant flies.

The defiencies Df(2R)Pcl7B (Duncan, 1982, Genetics 102, 49-70.), Df(2R)Pcl ^M82 (Flybase), Df(2R)Pcl11 B (Duncan, 1982, Genetics 102, 49-70; Sato et al., 1983, Genetics 105, 357-370.), Df(2R)Pci-W5 (Sato et al., 1983, Genetics 105, 357- 370.), Df(2R)PC4 (Nϋsslein-Volhard et al., 1984, Wilhelm Roux^{^}s Arch. Dev. Biol. 193, 267-282; Schϋpbach and Wieschaus, 1986, Wilhelm Roux s Arch. Dev. Biol. 195, 302-317.) and the deficiency included in the inversion ln(2R)Pcl¹¹ (Sato et al., 1983, Genetics 105, 357-370.) did not complement for the adp mutation localizing the _aφ gene within the genomic region that is deleted in the deficiencies. The deficiencies Df(2R)PC29 (Lindsley and Zimm, 1992, The Genome of Drosophila melanogaster- Academic Press, Inc. San Diego), Df(2R)PC66 (Lindsley and Zimm, 1992, The Genome of Drosophila melanogaster- Academic Press, Inc. San Diego) and Df(2R)P34 (FlyBase) complement for the _aφ mutation meaning that the adp gene lies outside of the deletion carried in these deficiencies.

The smallest deficiency that uncovered adp ^was found in ln(2R)Pcl¹¹. This line initially was characterized as an inversion, but it carries in addition to the inversion a deficiency that is associated with the proximal inversion breakpoint. Recombination experiments have shown that _aφ is localized distal to the known genes stau, Pel, and pABP- Since all three genes reside within the deficiency present in line ln(2R)Pcl¹¹ adp is localized distal to pABP and proximal to the distal deficiency breakpoint.

The distal breakpoint of the deletion in ln(2R)Pcl¹¹ was determined by southern blot analysis using a series of molecular probes. A PCR probe generated with the primers (AGTCGGAGAAGCTGCATCATGAGGC; SEQ ID NO: 57) and (TGCTATGCCTTATTTGTCGCTGCGG; SEQ ID NO: 58) on genomic wildtype DNA as a template detected the distal deficiency breakpoint of ln(2R)Pcl¹¹ (when labeled and hybridized against a southern blot of ln(2R)Pcl¹¹ DNA in comparison with OreR DNA cut with restriction enzymes and separated on an agarose gel). Probes further proximal turned out to be inside the deficiency, probes further distal are outside.

The DNA sequence of the genes stau, Pel, and pABP was already known (public database). Combining these data it was shown that the _a gene is localized in a region of approx. 70 kb in size flanked by pABP on the proximal side and the distal deficiency breakpoint on the distal side (see Fig. 2).

Initially adp mutants have been described not only as obese but also as female sterile. Due to the difficulties of accessing the flies obesity phenotype the much easier detectable female sterilty phenotype was used to score genetical experiment to localize the adp gene. Later it turned out that the female sterility is caused by a different gene on the same chromosome. This female sterility gene is very close to the obesity causing adp gene by genetical means but distant by molecular means. This resulted in misleading localization data for adp (Doane,

DIS77 (1996), 78-79).

The difficulties to observe the obese phenotype were a significant hurdle to link phenotype with genotype. The dependence of the phenotype on environmental factors (i.e. rearing conditions) increased the problem.

Only the combination of optimized rearing conditions, special microscopy to detect the obese phenotype quickly and easily and modern molecular biology techniques allowed to speed up the discovery process in a way that resulted in the successful identification and cloning of the adp gene.

Potential transcription units within the 70 kb DNA interval of the _aφ mutant chromosome were determined using software tools, e.g., Genie (Reese, J. Comput Biol. 4 (1997), 311-323) and sequenced and compared with corresponding wildtype DNA (sequences were obtained from the BDGP (Berkely Drosophila Genome Project) and own sequencing data). One transcription unit carried a frameshift-causing 23 bp deletion which results in a premature termination of the predicted protein in _aφ mutant flies (Fig. 2).

In detail, the 70 kb region was searched for open reading frames encoding potential genes using BLAST and Genie software. DNA fragments with a good coding probability have been amplified by PCR using DNA from adp mutant flies as a template. The amplified fragment was sequenced and the sequence compared to the wildtype sequence from public databases and rechecked against the sequence of PCR products generated on own wildtype DNA (using the same primers that have been used to amplify the mutant DNA). A PCR fragment generated with the primers (CCGCCGTCGCCTGCTGTTTG; see SEQ ID NO: 13) and (GCGCGTATCTTGCCCGTGTCTCC; see SEQ ID NO: 14), detected the above mentioned 23 bp deletion in adp DNA resulting in a frameshift and therefore premature stop of the predicted protein.

To establish that this transcription unit does code for adp activity, P-element- mediated rescue experiments were performed by introducing a 8.1 kb DNA fragment which carries the transcript-coding wildtype DNA and which extends from a Kspl restriction site to a Notl restriction site into the genome of _aφ mutants. Therefore, in order to show that the gene with the 23 bp deletion is underlying the adp mutation a Kspl-Notl-fragment (containing a wildtype copy of the presumed adp gene) from Cosmid 15B10 (Drosophila Genome Project) was subcloned in the pBSt-vector using the same restriction sites as insertion points and transferred as Kspl-Xhoi-fragment into the same cloning sites of the pCaSper4-vector, which was than used for germline transformation. Transformed flies were crossed to _aφ mutant flies and the offspring mated to obtain homozygous _aφ mutant flies carrying a copy of the rescue construct (Kspl-Xhol-fragment in the pCaSper4- vector). In these flies the _aφ mutant obese phenotype was rescued demonstrating that the gene carrying the 23 bp deletion is underlying the adp mutation.

In summary, the transgene-bearing adp mutants had lost the visible obese phenotype, and their fat cells were indistinguishable from wildtype. Consistently, their lipid content was reduced to wildtype levels and they had lost their starvation resistance. These results indicate that the transgene provides sufficient adp wild type activity to rescue all aspects of the obesity phenotype in _aφ mutant flies, demonstrating that the transcript codes for _aφ.

Northern blot analysis and j_{n s}itu hybridisation show that the 2.7 kb adp transcript is maternally deposited into Drosophila embryos and is cygotically expressed in larvae, pupae and adults (Fig. 3). Furthermore, j_n situ hybridisation on sections indicates that the _aφ transcript is ubiquitously present in adult tissue, with elevated expression levels detectable in certain areas of the brain. The above described results are furthermore summarized in Figure 4A. The 23 bp deletion, mentioned herein above, causes a frameshift resulting in premature termination of the predicted protein in adp mutants (Fig. 4B).

Example III: Germ line transformation with adp

In order to demonstrate that the candidate transcription unit codes for _aφ⁺ activity, P element-mediated germ line transformation experiments (G. M. Rubin, A. C. Spradling, Science 218, 348-353 (1982)) were performed. An 8.1 kb genomic wild type DNA fragment, which contained the candidate transcription unit (Fig. 4A) was introduced, into the _aφ⁶⁰ host genome. Upon transformation, flies derived from the host stock failed to develop a visible obese phenotype (Fig. 1B (G)), and their fat cells were indistinguishable from those of wild type flies. (Fig. 1B (H)). Furthermore, the lipid content of transformants was reduced to wild type levels (Fig. 1 B (E)) and these transgene-bearing flies were no longer resistant to starvation (Fig. 1B (F)). A shorter 3.6 kb fragment (Fig. 4A), which contains only the 1.8 kb open reading frame of the adp candidate gene and less than 700 bp of sequences upstream of its translation start, rescued the obese phenotype as well. These results indicate that the transgene, which contains only a single transcription unit rescues the observed obesity phenotype of adp⁶⁰ mutant flies and therefore establish unambiguously that this candidate transcription unit carries the _aφ wild type function. Developmental northern blot analysis revealed a 2.7 kb transcript found in wild type embryos, larvae, pupae, and adults (Fig. 4C). In addition, jn situ hybridizations of the cDNA to sections prepared from adult flies indicate that adp transcripts are not only expressed during all stages of the Drosophila life cycle (see Fig. 4C) but also at a low level in all tissues (data not shown).

Next, the effect of ectopic _aφ activity in flies was examined by generating transgenic animals bearing wild type adp cDNA under the control of the Gal4/UAS system (A. H. Brand, N. Perrimon, Development 118, 401-415 (1993)). Overexpression of adp in the fat body was achieved by an enhancer-trap line (FB) that directs Gal4 expression in larval and adult fat body cells (Gift of Marcos Gonzales-Gaitan, MPI of Molecular Cell Biology and Genetics, Dresden). Animals receiving transgenic _aφ activity under these conditions developed into larvae with strongly reduced levels of triglycerides as compared to wild type control larvae (Fig. 5A). Thus, the _adp gain-of-function phenotype, i.e. decreased fat content, is consistent with its loss-of-function phenotype in _aφ⁶⁰ mutants, i.e. increased fat content. In addition, Oil Red O staining, which specifically marks lipid in fat containing cells (R. D. Lillie, Stain. Technol. 19_> 55-58 (1944)), indicates that fat body tissue in which _adp was overexpressed was significantly reduced in the third instar larval stage (Fig. 5B). Such individuals continued development until pupation but died in their pupal cases. In contrast, _aφ overexpression in cells of the nervous system under the control of the panneural _e/_av-promoter (Nucleic Acids Res 27, 85-88 (1999), A. R. Campos, D. R. Rosen, S. N. Robinow, K. White, EMBO J 6, 425-431 (1987)) did not significantly alter total triglyceride content (Fig. 5A). These individuals developed into normal looking, healthy and fertile adults. Similarly, larvae receiving ectopic expression of adp in response to the panmuscular /raw-promoter (Fyrberg et al., Gene 197, 315-323 (1997)) display normal triglyceride levels. These results demonstrate that adp acts in fat body cells and has no general effect on cell viability.

Example IV: Predicted protein structure of ADP

Sequencing of the full-length _adp cDNA and comparison with genomic DNA sequences revealed two exons separated by a 66 bp intron which interrupts a single open reading frame of 1 ,887 nucleotides. It predicts a (poly)peptide of 628 amino acids in length and a calculated molecular weight of 71 ,8 kDa.

The predicted protein encoded by _adp was searched for known protein domains using a Prosite Profile and a Pfam computer search (see above). The predicted protein comprising WD40 repeat containing regions at the amino-terminal and the carboxy-terminal part and a TPR motif containing region in the centre separating both WD40 regions.

As shown in Fig. 6, the adp protein (Adp) is composed of a novel structural arrangement combining WD40 and tetratricopeptide repeat (TPR) domains. The N-terminal region of the adp protein (Adp) contains three complete WD40 motifs followed by a fourth, truncated version of it. Two additional WD40 motifs are located in the C-terminal portion of Adp. The WD40 motif was first described in the β-subunit of heterotrimeric G-proteins that transduce signals across the plasma membrane (Fong, Proc. Natl. Acad. Sci. USA 83 (1986), 2162-2166). The X-ray structure of the human Gβ subunit revealed that WD40 repeats contribute to blade-like sheets composed of antiparallel β-strands which form a propeller structure representing the contact surface for protein-protein interactions (Sondek, Nature 379 (1996), 369-374). The C-terminal WD40 domain of adipose is preceded by three TPR motifs, which constitute WD40-unrelated protein-protein interaction modules present in a number of functionally diverse intracellular proteins (Blatch, Bioessays 21 (1999), 932-939). Secondary structure analysis has shown that TPR motifs are composed of two antiparallel _α-helices (Das, EMBO J. 17 (1998), 1192-1199; Scheufler, Cell 101 (2000), 199-210). It has been speculated that the conformation of TPR motifs may be affected by ligand contact thereby regulating protein activity (Goebl, Trends Biochem. Sci. 16 (1991 ), 173- 177). Interestingly, TPR domain proteins have been found to interact with proteins containing WD40 domains (Blatch, loc. cit.). Interspersed between the TPR- and the N-terminal WD40 domains of Adp is a previously undefined protein region (see SEQ ID NO: 30) which, however, is conserved in the mouse and human homologues of Adp (see below, and SEQ ID NOs: 31 and 32). This Adp-specific region is referred to as "Adp-domain". In summary, Adp can be characterised as WD40/ADP/TPR/WD40-domain protein; see Figure 6. Such a structural arrangement was so far not described for any known protein.

Based on the conserved secondary structure and by using known 3D structures of comparable proteins as a template, a model for the presumed 3D structure of the human Adp protein was constructed. The proposed molecule contains a seven- bladed β-propeller linked to antiparallel alpha helices (Fig. 8). The model of Adp was build to further investigate the feasibility of a β-propeller fold. A search of WD40 repeats using the WD40 domain family alignment from the SMART server ( J. Schultz, F. Milpetz, P. Bork, C. P. Ponting, ρ_r0c Natl Acad Sci U S A 95, 5857- 5864 (1998)) with the HMMER program suite (S. R. Eddy, Bioinformatics 14, 755- 763 (1998)) revealed 6 unambiguous repeats with expectation values ranging between 1.7E-04 and 2.3E-13. A seventh repeat is suggested using the WD40- repeat profile created by Smith et al. (T. F. Smith, C. Gaitatzes, K. Saxena, E. J. Neer, Trends Biochem Sci 24, 181-185 (1999)). The corresponding HMMER- search with the tetratricopeptide family alignment (J. Schultz, F. Milpetz, P. Bork, C. P. Ponting, p_rθc Natl Acad Sci U S A $5, 5857-5864 (1998)) yielded three TPR repeats with E-values between 1.3E-03 and 3.4E-05. This result strongly suggests that Adp is related to the seven-bladed WD40 repeat proteins. Since the β- propeller folds are considered a suitable fold for reliable prediction due to their highly conserved features, G_p (PDB code 1gp2, Ref. (M. A. Wall, et al., Cell 83, 1047-1058 (1995))) was used as a template to attempt the model building of Adp. For the model of Adp the seven repeats of G_p were used to build a seven-bladed propeller with the software "MODELLER" (A. Sali, T. L. Blundell, j Mol Biol 234, 779-815 (1993)). The final model has a packing quality score of -1.7 (G. Vriend, j Mol Graph 8, 52-56 (1990)), thus indicating a potentially correct fold. The TPR repeats were modelled using protein phosphatase 5 (PDB code 1a17, residue numbers 36 to 149) as a template and are positioned next to the point of insertion between WD40 repeats 5 and 6 of the Adp model in Fig. 8.

Example V: Evolutionary conservation of the adp gene

It was next asked whether the _aφ gene or _aφ-like genes are conserved in evolution. cDNAs coding for homologous WD40/Adp/TPR WD40-domain proteins from both mouse and human tissue were identified.

In detail, the Drosophila adp sequence was used for a BLAST search in public databases. The BLAST search reported fragments of similar sequences in database entries for human, mouse, and zebrafish DNA of unknown function. The mouse and human sequence were used to design PCR primers to amplify fragments of the human and mouse genes. These fragments were used to screen cDNA libraries made from mouse and human tissues and the hybridizing clones have been isolated and sequenced. As mentioned herein above, the Drosophila adp cloning was carried out as follows: The Kspl-Notl-fragment from the Cosmid 15B10 (The FlyBase Consortium, loc. cit.) was subcloned in the pBSt-vector using the same restriction sites as insertion points and transferred as Kspl-Xhol- fragment to the same cloning sites of the pCaSper4-vector, which was than used for germline integrations. Sequencing of the EST-clone GH10933 (BDGP) covering the full-length _aφ-cDNA revealed the genomic organisation of _aφ (see also Fig. 2). The clone of the human homologue of adp was cloned from an adipocyte cDNA library (Stratagene) using a PCR probe amplified from the same library by the primers (GCCGACTCTAAGGTGCATGT; SEQ ID NO: 23) and (GCAGGACAGTCCCTGAAGAC; SEQ ID NO: 24). The clone of the mouse homologue of _aφ was cloned from an embryonic cDNA library by the primers of SEQ ID NO: 17 and SEQ ID NO: 18. Resulting sequences are depicted in SEQ ID NO: 3, 5 and 7, respectively, for Drosophila, mouse and human _aφ and represent nucleotide sequences of the corresponding ORFs. cDNA-sequences as obtained by this approach are depicted in SEQ ID NOs: 27, 28 and 29, respectively.

The amino acid identity (similarity) amounts to 37 % (50 %) between the Drosophila and human/mouse genes including linear conservation of the characteristic WD40/ADP/TPRΛ/VD40-domain structure (Fig. 4). Mouse and human adp are 96 % identical (Fig. 4). A main transcript of approximately 4.4 kb in size is expressed, like in Drosophila, in a non-restricted fashion in both human and mouse but appears to be enriched in a number of tissues such as testis, spleen and muscle (see Figure 5).

In order to detect adp-sequences in other species, the Drosophila adp sequence was used for a sequence homology (BLAST) search in public databases. The BLAST search reported fragments of similar sequences in database entries for human, mouse, and zebrafish DNA. The zebrafish fragment carries the Database accession-No. A1722749. Under this Accession-No. a DNA fragment of 490 nucleotides (see SEQ ID NO: 55; corresponding amino acid sequence SEQ ID NO: 56) in length is listed that is 69.3% similar to the corresponding human adp fragment.

Example VI: Detection of splice variants

PCR generated radioactively labeled probes were used to screen cDNA libraries. The PCR reaction to generate the human probe was performed using the forward primer of SEQ ID NO: 21 and the backward primer of SEQ ID NO: 22. The PCR reaction to generate the mouse probe was performed using the forward primer of SEQ ID NO: 17 and the backward primer of SEQ ID NO: 18. During the screen for human and mouse cDNA clones splice-variants of both human and mouse adp were detected.

The alternatively spliced human variant is 100% identical from base 1-1468 of the open reading frame (see SEQ ID NO: 53). Base 1469-1728 is again 100% identical to base 1644-1903 of the open reading frame of the normally spliced human gene. This results in an overall similarity of 90,8%. In the encoded protein (see SEQ ID NO: 54) the aminoacids 1-489 are identical, the remaining 87 aminoacids (490-576) of the splice-variant are completely different since the splicing event resulted in a frame shift in the encoding DNA.

Similarly, a differently spliced mouse cDNA was discovered (see SEQ ID NO: 51 ). Said splice-variant is shorter, bases 480-662 of the open reading frame of the normal mouse gene are missing making the coding regions 91% similar. In the encoded protein, aminoacids 161-221 are missing, the protein of the splice- variant is therefore 61 aminoacids shorter (see SEQ ID NO: 52).

Example VII: Homology, identity and/or similarity of ADP-sequences

Sequences were compared pairwise to establish sequence identity and similarity values.

Nucleotide sequences were compared by making gapped local alignments using the program 'matcher' from the sequence analysis package EMBOSS (reference: <http://www.sanger.ac.uk/Software/EMBOSS/>), version downloaded May 17th 2000). 'matcher' is based on the program Malign' from Bill Pearson, which in turn uses code developed by X. Huang and W. Miller (Adv. Appl. Math. (1991 ) 12:337-357) for the 'sim' program, 'matcher' was used with default settings. For nucleotide sequences, these are the following: The comparison matrix was 'DNAMAT'; alternatively, the program allows the use of 'DNAFULU, 'NUC.4.2', or 'NUC.4.4'. All these matrices are part of the EMBOSS distribution. The gap penalty value was 16; the program allows any positive integer for this value. The gap length value was 4; the program allows any positive integer for this value.

Protein sequences were compared by making gapped local alignments using the program 'bl2seq' version 2.0.12 (Apr-21-2000) from NCBI (reference: <ftp://ftp.ncbi.nlm.nih.gov/blast/executables>). 'bl2seq' was used with default settings except for filtering (see below). For protein sequences, these are the following: the subprogram used was 'blastp', which is the only meaningful one for protein sequences, 'gapped' alignments were selected; alternatively, the program allows the generation of 'ungapped' alignments. The 'gap opening cost' was 11 ; alternatively, the program accepts any positive integer. The 'gap extension cost' was 1 ; alternatively, the program accepts any positive integer. The comparison matrix used was 'BLOSUM62'; alternatively, the program accepts, for example, 'PAM30', 'PAM70', 'PAM250', 'BLOSUM90' or 'BLOSUM50'. 'Word size' was set to 3; alternatively, the program accepts integer values between 1 and 4 in our setup. Low complexity sequences were not filtered out, that is, the 'SEG' filter was not applied.

In both cases, the software was used on an Intel Pentium PC running Linux (Suse6.2).

The employed sequences comprise SEQ ID NOs: 4, 6, 8, 52 and 54, wherein SEQ ID NO: 4 depicts the Drosophila wt amino acid sequence, SEQ ID NO: 6 the mouse wt ADP amino acid sequence and SEQ ID NO: 8 the human wt ADP amino acid sequence. SEQ ID NOs: 52 and 54 correspond to splice variants (spl) of mouse and human ADP amino acid sequences. For nucleotide identity alignments the corresponding SEQ ID NOs: 3, 5, 7, 51 and 53 were employed. Homologies of nucleotide sequences are related to the coding regions of adp. The following results were obtained:

nucleotide identity matcher

drosophila vs zebrafish 64.2% identity in 109 drosophila vs mouse 54.8% identity in 1735 drosophila vs mouse spl 55.5% identity in 1613 drosophila vs human 54.0% identity in 1878 drosophila vs human spl 58.7% identity in 581

zebrafish vs mouse 69.3% identity in 514 zebrafish vs mouse spl 69.3% identity in 514 zebrafish vs human 69.3% identity in 514 zebrafish vs human spl 69.3% identity in 514 mouse vs mouse spl 91.0% identity in 2031 mouse vs human 90.1 % identity in 2034 mouse vs human spl 82.0% identity in 1906 mouse spl vs human 81.8% identity in 2034 mouse spl vs human spl 73.1 % identity in 1906

human vs human spl 90.8% identity in 1903

protein identity bl2seq

drosophila vs zebrafish

Identities = 59/157 (37%), Positives = 78/157 (49%), Gaps = 19/157 (12%)

drosophila vs mouse

Identities = 234/624 (37%), Positives = 323/624 (51%), Gaps = 58/624 (9%)

drosophila vs mouse spl

Identities = 217/605 (35%), Positives = 298/605 (48%), Gaps = 81/605 (13%)

drosophila vs human

Identities = 238/630 (37%), Positives = 326/630 (50%), Gaps = 60/630 (9%)

drosophila vs human spl

Identities = 170/461 (36%), Positives = 232/461 (49%), Gaps = 52/461 (11 %)

zebrafish vs mouse

Identities = 123/171 (71 %), Positives = 141/171 (81%), Gaps = 9/171 (5%)

zebrafish vs mouse spl

Identities = 123/171 (71 %), Positives = 141/171 (81%), Gaps = 9/171 (5%)

zebrafish vs human

Identities = 124/171 (72%), Positives = 141/171 (81%), Gaps = 8/171 (4%) zebrafish vs human spl

Identities = 124/171 (72%), Positives = 141/171 (81 %), Gaps = 8/171 (4%)

mouse vs human

Identities = 657/678 (96%), Positives = 669/678 (97%), Gaps = 2/678 (0%)

mouse vs human spl

Identities = 476/489 (97%), Positives = 485/489 (98%), Gaps = 1/489 (0%).

Example VIII: Adipose transcription is increased during adipocyte differentiation

3T3-F442A cells (Green, H. and O. Kehinde , Cell 7:105, 1976) were purchased from the Harvard Medical School, Department of Cell Biology (Boston, MA). 3T3- F442A cells were maintained as fibroblasts and differentiated into adipocytes as described previously (Djian, P. et al., J. Cell. Physiol., 124:554-556, 1985). At various time points of the differentiation procedure, beginning with day 0 (first day of confluence) and day 2 (hormone addition), up to 10 days of differentiation, aliquots of cells were taken every two days. Total RNA was subsequently isolated, reverse transcribed and subjected to Taqman analysis using the following primer/probe pair:

Mouse adipose forward primer: GTGCCTGGATGACTTCAAAGG (SEQ ID NO:

59)

Mouse adipose reverse primer: CGGCCTAATGCGTCACATG (SEQ ID NO: 60)

Taqman probe (FAM): AAGTTCCCAGAGCAGGCCCACAGC (SEQ ID

NO: 61)

Taqman analysis revealed that adipose transcript levels are accumulated during 3T3-F442A adipocyte differentiation up to 8.9-fold (day 8) compared to adipose transcript levels in preadipocytes maintained as fibroblasts (see Figure 9). Example IX: Adipose oligomerization

HEK293 cells transiently transfected with the indicated constructs were lysed and the tagged proteins immunoprecipitated (IP) with either _α-FLAG or _α-Strep. Immunoprecipitated proteins were resolved by SDS-PAGE, transferred to nitrocellulose and immunoblotted with either _α-FLAG or _α-Strep antibodies (ID).

As shown in Figure 10, an oligomerization of Adipose is revealed by the presence of a single band in the _α-Strep probed IP _α-FLAG (and vice versa) in the double transfected HEK293 cells only.

In particular this experiment was carried out as follows:

Tagged fusion proteins of human adipose were constructed by polymerase chain reaction. Human adipose was amplified by polymerase chain reaction using cloned fu DNA polymerase (Stratagene) with the forward primer 5'- CGCGGATCCAAGATGGCGAAAGTCAAC-3' (SEQ ID NO: 62) and the reverse primer 5'-CCGGAATTCCTACTTGTCATCGTCGTCCTTGTAGTCAGCGCTGG GCCGGCACTGCACCTG-3' (SEQ ID NO: 63) introducing the FLAG-TAG sequence 'DYKDDDDK' (SEQ ID NO: 64) in frame at the c-terminus of adipose in order to generate ADP-FLAG. Similarly, using the same forward primer and the reverse primer 5'-

CGGGAATTCCTATTTTTCGAACTGCGGGTGGCTCCAAGCGCTGGGCCGGCA CTGCACCTG-3' (SEQ ID NO: 65) with the Strep-TAG sequence 'SAWSHPQFEK' (SEQ ID NO. 66). Human ADP-Strep was generated. Both fragments were digested with BamHI and EcoRI and subcloned into the mammalian expression vector pcDNA3.1 (Invitrogen).

HEK293 cells were transiently transfected as described by Chen and Okayama (Mol. Cell Biol. 7, (1987), 2745-2752). Treatment and lysis of the cells were performed as described by Lammers et al- J- Biol. Chem. 268 (1993), 22456- 22462. Immunoprecipitations were done with protein-G sepharose according to Ciossek et al., Oncogene 14 (1997), 35-43 using either 4_μg of _α-FLAG M2 antibody (Sigma, IP _α-FLAG) or 2μl _α-Strep antiserum (IBA; Strep-tag II). The immunoprecipitates were resolved by SDS-PAGE on 7.5% polyacrylamide gels, transferred to nitrocellulose membranes by semi-dry blotting according to the manufacturer's instructions (Sigma) and immunoblotted with either the _α -FLAG antibody (1 μg/ml) or the α-Strep antiserum (1 :1000). For visualisation of immunolabelled bands, the ECL system was used according to the manufacturer's instructions (Amersham Pharmacia). The oligomerization of Adipose is revealed by the presence of a single band as explained and detailed in Figure 10.

Example X: Adipose is part of a protein complex.

As shown in Fig. 11 , adipose forms part of a (multimeric) complex.

HEK293 cells were transiently transfected with FLAG-tagged human Adipose (+, hADP-FLAG) or control vector (-, pcDNA3.1). The cell lysates were treated with the bi-functional chemical crosslinkers DFDNB or DSS at the indicated concentrations. Cell lysates were separated by SDS-PAGE, transferred to nitrocellulose and immunoblotted with an _α-FLAG antibody. More detailed, human FLAG-tagged Adipose was generated as described in Example IX. HEK293 cells were transiently transfected as described by Chen and Okayama (1987) loc. cit. Treatment and lysis of the cells were performed as described by Lammers et al- (1993), loc. cit. 1 ,5 Difluoro-2,4-dinitrobenzene (DFDNB, Pierce) or disuccinimidyl suberate (DSS, Pierce) were added to the cell lysates at the indicated concentrations and incubated for 2 hours on ice. The reaction was terminated by the addition of an equal volume of 250mM Tris/HCI pH 6.8. Samples were resolved by SDS-PAGE on 7.5% polyacrylamide gels, transferred to nitrocellulose membranes by semi-dry blotting according to the manufacturer's instructions (Sigma) and immunoblotted with the _α -FLAG antibody (clone M2, Sigma) at 1 μg/ml. For visualisation of immunolabelled bands, the ECL system was used according to the manufacturer's instructions (Amersham Pharmacia). Adipose, as documented in Fig. 11 , is part of a (potentially multimeric) proteineous complex. Said complex probably comprises multiple Adipose molecules. Therefore, ADP is not only capable of dimerization and/or oligomerization but also of multimerization with ohter (proteinous) molecules.

Example XI: Association of Adipose with 120 kD protein

Tagged fusion proteins of human adipose were constructed by polymerase chain reaction as described in Example IX. HEK293 cells were transiently transfected as described by Chen and Okayama (1987), loc. cit. 24 hours after transfection, the culture medium of the cells was changed to DMEM high glucose (Life Technologies) containing 0.5% of dialysed fetal calf serum and 25μCi / ml of ³⁵S- methionine (Amersham Pharmacia). Lysis of the cells was performed as described by Lammers _et al- (1993), loc. cit. Immunoprecipitations were done with protein-G sepharose according to Ciossek et al. (1997), loc. cit. using 4_μg of _α-FLAG M2 antibody (Sigma, IP _α-FLAG). An aliquot of the cell lysates was heat-inactivated prior to immunoprecipitation by adjusting to 1.0% SDS and 1.0% β- Mercaptoethanol, heating to 95°C for 10 minutes followed by ten fold dilution of the lysates with HNTG buffer (20mM HEPES pH 7.5, 150mM NaCl, 10% glycerol, 0.1% Triton X-100, 10mM NaF).

The immunoprecipitates were resolved by SDS-PAGE on 7.5% polyacrylamide gels, dried on a vacuum dryer and exposed for 1 day.

Immunoprecipitation of ³⁵S-methionine-labelled human FLAG-tagged adipose (ADP-FLAG) or the short form of human FLAG-tagged adipose (ADP(short)- FLAG) from HEK293 cells. Shown is the autoradiograph of the SDS-gel. The right part of the gel shows immunoprecipitations after heat inactivation of the cell lysates. The arrow in Figure 12 indicates a reproducibly co-precipitating band of approximately 120 kilodalton. Therefore, human adipose is in vivo associated with a 120 kD protein/(poly)peptide. Example XII: Association of different Y2H clones with human Adipose

FLAG-tagged human adipose (ADP-FLAG) was constructed by polymerase chain reaction as described in Example IX. Y2H clones found to interact in the yeasts- hybrid (Y2H) system (Matchmaker, Clontech) with either complete human adipose (BC11 ) or the TPR domain of human adipose (ST39, BT6, BT23, BT28, BT41) were subcloned as a Bglll restriction fragment from the yeast-2-hybrid vector pACT2 into the BamHI site of an mammalian expression vector under the control of the immediate early cytomegalvirus promoter. The resulting expression vectors code for the Y2H clones devoid of the GaI4 activation domain but still containing an N-terminal HA-Tag.

HEK293 cells were transiently transfected as described by Chen and Okayama (1987), loc. cit. Treatment and lysis of the cells were performed as described by Lammers et al- (1 93), loc. cit.

Immunoprecipitations were done with protein-G sepharose according to Ciossek et al. (1997), loc. cit. using 1μl of an _α~HA ascites (monoclonal anti-HA, clone HA-7, Sigma). The immunoprecipitates were resolved by SDS-PAGE on 7.5% polyacrylamide gels, transferred to nitrocellulose membranes by semi-dry blotting according to the manufacturer's instructions (Sigma) and immunoblotted with the _α -FLAG antibody (1 μg/ml). For visualisation of immunolabelled bands, the ECL system was used according to the manufacturer's instructions (Amersham Pharmacia).

Therefore, HEK293 cells transiently transfected with the indicated constructs were lysed and the HA-tagged proteins immunoprecipitated (IP) with an _α-HA antibody. Immunoprecipitated proteins were resolved by SDS-PAGE, transferred to nitrocellulose and immunoblotted with an _α-FLAG antibody (ID). An association of adipose with different Y2H clones is detected by the strong protein band around 70 kD representing FLAG-tagged human adipose as documented in Figure 13. Example XIII: Human ADP localization in NIH3T3 cells

A fusion protein between human adipose and the enhanced GFP (pEGFP-C1 , CLONTECH) was constructed by PCR. Human adipose was amplified by polymerase chain reaction using cloned pf_u DNA polymerase (Stratagene) with the forward primer 5'-CGCGGATCCAAGATGGCGAAAGTCAAC-3' (SEQ ID NO: 62) and the reverse primer 5'-GATCGAATTCGCTGGGCCGGCACTGCACCTG-3' (SEQ ID NO: 67) introducing an EcoRI site directly in front of the stop codon of human adipose. Equally, an EcoRI site followed by three glycine residues was introduced in frame into enhanced GFP again using cloned fu DNA polymerase with the forward primer 5'-

GATCGAATTCGGAGGTGGAGTGAGCAAGGGCGAGGAGCTG-3' (SEQ ID NO: 68) and the reverse primer 5'-GATCGTCGACCTATTGAGCTCGAGATCTGAG-3' (SEQ ID NO: 69). The two PCR fragments were digested with BamHI and EcoRI (adipose) and EcoRI and Sail (GFP) and cloned into the BamHI and Sail sites of an immediate early cytomegalovirus promoter based mammalian expression vector to form the human ADP-GFP fusion protein.

NIH3T3 cells were seeded into 24 wells plates containing Poly-D-Lysine coated coverslips (BD Biosciences) at 25.000 cells per well. The day after seeding, cells were transiently transfected with the ADP-GFP expression construct with Lipofectamin Plus (Life Technologies) according to the manufacturer's instructions. 48 hours after transfection, cells were fixed in 4% para-formaldehyde and mounted on glass slides. Cells were examined in an fluorescence microscope with the appropriate filters for GFP.

In summary, NIH 3T3 cells were transiently transfected with human ADP-GFP, fixed and examined at 400x magnification and appropriate filters for GFP. Different subcellular localisation of ADP-GFP was observed in transfected cells ranging from diffuse cytoplasmatic staining up to a highly punctuate appearance as shown in Figure 14. Example XIV: Adipose expression in adult mouse tissues.

An RT-PCR analysis employing protocols as disclosed herein was carried out on samples of adult mouse tissues.

RT-PCR analysis of adult mouse mRNA samples using the following primers: forward primer: 5' gac ctt acg gta aag gag acg a 3' (SEQ ID NO. 70) reverse primer: 5' gcc tgt gag gtc ttc act etc 13' (SEQ ID NO: 71 ) Adipose is expressed in most adult tissues including white adipose tissue (WAT) and brown adipose tissue (BAT), as documented in Fig. 16.

Example XV: Adipose antisense experiments

3T3-L1 preadipocytes (obtained from ATCC) were differentiated at 37 °c according to the following protocol:

Approx. 100000 cells were plated in a 35 mm dish and incubated in medium 1 until cells reached confluency (day 0).

At day 0 medium was exchanged against 2 ml morpholino medium (containing special delivery morpholino oligonucleotides (Gene Tools), used according to manufacturers instruction). After 3 hours incubation morpholino medium was exchanged against medium 2.

At day 2 medium 2 was exchanged against 2 ml differentiation medium.

At day 5 differentiation medium was exchanged against medium 2 plus 5 μg/ml insulin.

From day 7 on medium is exchanged every 2 day against medium 2 plus 5 μg/ml insulin.

Medium 1 : DMEM plus 4.5 % glucose (Gibco)

10 % calf serum (Gibco) Medium 2: DMEM plus 4.5 % glucose

10 % fetal calf serum (Gibco) Differentiation medium: DMEM plus 4.5 % glucose

10 % fetal calf serum

5 μg/ml insulin 0.5 mM 3-isobutyl-1-methylxantine 1 mM dexamethasone Morpholino medium: DMEM plus 4.5 % glucose

1.4 μMol morpholino oligonucleotides (Gene Tools,

Corvallis, OR)

0.56 _μMol EPEI (Gene Tools)

At given time point cells were harvested and expression of marker genes for adipogenesis measured using Taqman PCR-analysis according to manufacturers instruction (Applied Biosystems).

Sequence of the adp antisense oligo (adp as): 5^'-CTCTAGTTATGTTGACTTTTGCCAT (SEQ ID NO: 72)

Sequence of the inverted adp antisense oligo (adp inv): 5^'-TACCGTTTTCAGTTGTATTGATCTC (SEQ ID NO: 73)

As shown in Fig. 17, treatment of 3T3-CI cells with adkipose antisense oligos results in a more efficient differentiation process as compared to other adipogenic markers like AP2, CEPB_α or PPAKγ.

Example XVI: Generation antibodies directed against human Adipose

HEK293 cells were transiently transfected with FLAG-tagged human Adipose (hADP-FLAG), mouse Adipose (mADP-FLAG), the short form of mouse Adipose (mADP-short-FLAG) or a control vector (GFP, pEGFP-C1 ). Cell lysates were separated by SDS-PAGE, transferred to nitrocellulose and immunoblotted with an anti-TPR antiserum. Arrows in Fig. 18 indicate the position of the short and the full- length Adipose. Size marker in Fig. 18 in kilodalton.

In detail, the TPR-region of human Adipose was subcloned into the fusion protein expression vector pGex-5x1 (Amersham Pharmacia) by polymerase chain reaction using cloned pf_u DNA polymerase (Stratagene) with the forward primer 5'-GATCGAATTCGGAGGTGGACCACCATACCTGGAGCTGG-3' (SEQ ID NO:

74) and the reverse primer 5'-GATCGGATCCCTAACCA GGTCCCTTCTTCTCC-3'

(SEQ ID NO: 75). The amplified fragment was cut with the restriction enzymes and placed into pGex-5x1 to generate a bacterial expression vector driving expression of a GST-TPR fusion protein. GST-TPR was produced as described by Smith and

Johnson, Gene 67 (1988), 31-40, and the insoluble protein purified out of inclusion bodies using the BugBuster reagent (Novagen) according to the manufacturer's instructions. The inclusion bodies were solubilized in Laemmli-buffer (20%

Glycerin, 3% SDS, 3% β-MercaptoethanoI, 10mM EDTA, 0.05% Bromphenolblau), resolved by SDS-PAGE on 12.5% polyacrylamide gels and elecfroeluted from the polyacrylamide with an electroeluter (BioRad) according to the manufacturer's instructions. The polyclonal anti-TPR antiserum was generated by BioScience

(Gόttingen) through injection of GST-TPR into rabbits.

Human FLAG-tagged Adipose was generated as described in Example IX. Mouse FLAG-tagged full-length and short Adipose were generated in a similar way with the forward primer 5'-GAATGTGCAAGGGTCTTGAG-3' (SEQ ID NO: 76) and the reverse primer 5'-GATCGAATTCCTACTTGTCATCATCGTCCTTGTAGTCGCTGG GCCGGCACTGCACCTG-3' (SEQ ID NO: 77) introducing the FLAG-TAG sequence 'DYKDDDDK' (SEQ ID NO. 64) in frame at the c-terminus of mouse full- length and short Adipose in order to generate mADP-FLAG and mADP-short- FLAG.

HEK293 cells were transiently transfected as described by Chen and Okayama (1987), loc. cit. Treatment and lysis of the cells were performed as described by Lammers _ef al- (1993), loc. cit. Samples were resolved by SDS-PAGE on 7.5% polyacrylamide gels, transferred to nitrocellulose membranes by semi-dry blotting according to the manufacturer's instructions (Sigma) and immunoblotted with the anti-TPR antiserum (Dilution 1 :10000). For visualisation of immunolabelled bands, the ECL system was used according to the manufacturer's instructions (Amersham Pharmacia).

Results are shown in Figure 18. The generated antiserum detects human as well as mouse Adipose.

Claims

1. A nucleic acid molecule encoding a (poly)peptide regulating, causing or contributing to obesity in an animal or a human wherein said nucleic acid molecule

(a) hybridizes at 65°C in a solution containing 0.2 x SSC and 0.1 % SDS to the complementary strand of a nucleic acid molecule encoding the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 52 and/or SEQ ID NO: 54;

(b) hybridizes at 65°C in a solution containing 0.2 x SSC and°0.1 % SDS to the complementary strand of a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 51 and/or SEQ ID NO: 53;

(c) is degenerate with respect to the nucleic acid molecule of (a);

(fa) on a Drosophila cDNA library or on genomic Drosophila DNA with the following set(s) of primers: (i) forward primer as depicted in SEQ ID NO: 9; backward primer as depicted in SEQ ID NO: 10; (ii) forward primer as depicted in SEQ ID NO: 11 ; backward primer as depicted in SEQ ID NO: 12; (iii) forward primer as depcited in SEQ ID NO: 36 backward primer as depicted in SEQ ID NO: 37; (iv) forward primer as depicted in SEQ ID NO: 38 backward primer as depicted in SEQ ID NO: 39; (v) forward primer as depicted in SEQ ID NO: 47 backward primer as depicted in SEQ ID NO: 48; or (vi) forward primer as depicted in SEQ ID NO: 49 backward primer as depicted in SEQ ID NO: 50;

(fb) on genomic Drosophila DNA with the following set(s) of primers:

(ix) forward primer as depicted in SEQ ID NO: 17 backward primer as depicted in SEQ ID NO: 18; (x) forward primer as depicted in SEQ ID NO: 19 backward primer as depicted in SEQ ID NO: 20; (xi) forward primer as depicted in SEQ ID NO: 40 backward primer as depicted in SEQ ID NO: 41 ; (xii) forward primer as depicted in SEQ ID NO: 42 backward primer as depicted in SEQ ID NO: 43; (xiii) forward primer as depicted in SEQ ID NO: 47 backward primer as depicted in SEQ ID NO: 48; or (xiv) forward primer as depicted in SEQ ID NO: 49 backward primer as depicted in SEQ ID NO: 50; or (xv) forward primer as depicted in SEQ ID NO: 76 backward primer as depicted in SEQ ID NO: 77; or

(fd) on a human cDNA library or on genomic human DNA with the following set of primers:

(xv) forward primer as depicted in SEQ ID NO: 21 ; backward primer as depicted in SEQ ID NO: 22; (xvi) forward primer as depicted in SEQ ID NO: 23; backward primer as depicted in SEQ ID NO: 24; (xvii) forward primer as depicted in SEQ ID NO: 25; backward primer as depicted in SEQ ID NO: 26; (xviii) forward primer as depicted in SEQ ID NO: 40; backward primer as depicted in SEQ ID NO: 44; (xix) forward primer as depicted in SEQ ID NO: 45; backward primer as depicted in SEQ ID NO: 46; (xx) forward primer as depicted in SEQ ID NO: 47; backward primer as depicted in SEQ ID NO: 48; or (xxi) forward primer as depicted in SEQ ID NO: 49; backward primer as depicted in SEQ ID NO: 50; or (xxii) forward primer as depicted in SEQ ID NO: 62; backward primer as depicted in SEQ ID NO: 63; or (xxiii) forward primer as depicted in SEQ ID NO: 65; backward primer as depicted in SEQ ID NO: 66; under the following conditions: 1 min denaturing at 94°C, 1 min annealing at 55°C, 2 min extension at 72°C for 35 cycles; or g) encodes a (poly)peptide which comprises at least one WD40-motif and at least one TPR-motif.

2. The nucleic acid molecule of claim 1 which is DNA.

3. The nucleic acid molecule of claim 1 or 2 wherein said Drosophila DNA library is a Drosophila melanogaster adult DNA library and/or said mouse DNA library is a mouse embryonic DNA library.

4. The nucleic acid molecule of claim 1 or 2 wherein said human cDNA library is a human adipocyte and/or brain cDNA library.

5. The nucleic acid molecule of claim 1 wherein said nucleic acid molecule encodes the amino acid sequence of SEQ ID NO: 2.

6. The nucleic acid molecule of claim 1 wherein said nucleic acid molecule comprises the nucleic acid sequence of SEQ ID NO: 1.

7. The nucleic acid molecule of claim 1 which differs from the nucleic acid molecule encoding the amino acid sequence of SEQ ID NO: 4, 6, 8 or 52 or 54 or which comprises the nucleic acid sequence of SEQ ID NO: 3, 5, 7, 51 or 53 by mutation and wherein said mutation causes an alteration, deletion, duplication or premature stop in the encoded (poly)peptide.

8. A vector comprising the nucleic acid molecule of any one of claims 1 to 7.

9. A host transformed with the vector of claim 8.

10. A method of producing a (poly)peptide comprising culturing the host of claim 9 under suitable conditions and isolating the (poly)peptide produced.

11. A (poly)peptide encoded by the nucleic acid molecule of any one of claims 1 to 7 or produced by the method of claim 10.

12. A fusionprotein comprising the (poly)peptide of claim 11 or (a) fragment(s) thereof.

13. An antibody fragment or derivative thereof or an aptamer or another receptor specifically recognizing the nucleic acid molecule of any one of claims 1 to 7 or the (poly)peptide of claim 11 or 12.

14. A nucleic acid molecule encoding a mammalian (poly)peptide involved in the regulation of body weight in a mammal which

(a) hybridizes at 65°C in a solution containing 0.2 x SSC and 0.1% SDS to the complementary strand of a nucleic acid molecule encoding the amino acid sequence of SEQ ID NO: 6, 8, 52 or 54;

(b) hybridizes at 65°C in a solution containing 0.2 x SSC and 0.1% SDS to the complementary strand of a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 5, 7, 51 or 53; (c) is degenerate with respect to the nucleic acid molecule of (a);

(d) encodes a (poly)peptide which is at least 60%, preferably at least 75%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, most preferably at least 99% identical to the amino acid sequence as depicted in SEQ ID NO: 6, 8, 52 or 54;

(i) forward primer as depicted in SEQ ID NO: 17; backward primer as depicted in SEQ ID NO: 18; (ii) forward primer as depicted in SEQ ID NO: 19; backward primer as depicted in SEQ ID NO: 20; (iii) forward primer as depicted in SEQ ID NO: 21 ; backward primer as depicted in SEQ ID NO 22; (iv) forward primer as depicted in SEQ ID NO: 23; backward primer as depicted in SEQ ID NO 24; (v) forward primer as depicted in SEQ ID NO: 25; backward primer as depicted in SEQ ID NO: 26; (vi) forward primer as depicted in SEQ ID NO: 40; backward primer as depicted in SEQ ID NO 41 ; (vii) forward primer as depicted in SEQ ID NO: 42; backward primer as depicted in SEQ ID NO: 43; (viii) forward primer as depicted in SEQ ID NO: 40; backward primer as depicted in SEQ ID NO: 44; (ix) forward primer as depicted in SEQ ID NO: 45; backward primer as depicted in SEQ ID NO: 46; (x) forward primer as depicted in SEQ ID NO: 47; backward primer as depicted in SEQ ID NO: 48; or (xi) forward primer as depicted in SEQ ID NO: 49; backward primer as depicted in SEQ ID NO: 50; or (xii) forward pirmer as depicted in SEQ ID NO: 62; backward primer as depicted in SEQ ID NO: 63; or (xiii) forward primer as depicted in SEQ ID NO: 65; backward primer as depicted in SEQ ID NO: 66; or (xiv) forward primer as depicted in SEQ ID NO: 76; backward primer as depicted in SEQ ID NO: 77; under the following conditions: 1 min denaturing at 94°C, 1 min annealing at 55°C, 2 min extension at 72°C for 35 cycles; or (f) encodes a (poly)peptide which comprises at least one WD40 and at least one TPR motif.

15. The nucleic acid molecule of claim 14 wherein said mammal is a mouse or a human.

16. The nucleic acid molecule of claim 15 wherein said nucleic acid molecule encodes the amino acid sequence of SEQ ID NO: 6 or 8.

17. The nucleic acid molecule of claim 15 wherein said nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO: 5 or 7.

18. A vector comprising the nucleic acid molecule of any one of claims 14 to 17.

19. The vector of claim 8 or 18 which is a gene targeting vector or a gene expression vector.

20. A host transformed with the vector of claim 18.

21. A non-human mammal transfected with the vector of claim 19.

22. A method of producing a (poly)peptide comprising culturing the host of claim 20 under suitable conditions and isolating the (poly)peptide produced.

23. A (poly)peptide encoded by the nucleic acid molecule of any one of claims 14 to 17 or produced by the method of claim 22.

24. A fusionprotein comprising the (poly)peptide of claim 23 or (a) fragment(s) thereof.

25. An antibody or a fragment or a derivative thereof or an antiserum or an aptamer or another receptor specifically recognizing the nucleic acid molecule of any one of claims 14 to 17 or the (poly)peptide of claim 23 or 24.

26. An anti-sense oligonucleotide of a nucleic acid molecule as defined in any one of claims 1 to 7 and 14 to 17.

27. A method of identifying a (poly)peptide involved in the regulation of body weight in a mammal comprising the steps of

(a) testing a collection of (poly)peptides for interaction with the (poly)peptide of claim 11 or (a) fragment(s) thereof, with the (poly)peptide of claim 23 or (a) fragment(s) thereof or with the fusionprotein of claim 12 or 24 or (a) fragment(s) thereof using a readout system; and

(b) identifying (poly)peptides that test positive for interaction in step (a).

28. A method of identifying a (poly)peptide involved in the regulation of body weight in a mammal comprising the steps of

(a) testing a collection of (poly)peptides for interaction with the (poly)peptide identified by the method of claim 27; and

29. The method of claim 27 or 28 further comprising the step of identifying the nucleic acid molecule(s) encoding the one or more interacting (poly)peptides.

30. A method of identifying a (poly)peptide involved in the regulation of body weight in a mammal comprising the steps of

(a) contacting a collection of (poly)peptides with the (poly)peptide of claim 11 or 23 or (a) fragment(s) thereof or the fusionprotein of claim 12 or 24 or (a) fragment(s) thereof under conditions that allow binding of said (poly)peptides;

(b) removing (poly)peptides from said collection of (poly)peptides that did not bind to said (poly)peptide of claim 11 or 23 or the fusionprotein of claim 12 or 24 in step (a); and

(c) identifying (poly)peptides that bind to said (poly)peptide of claim 11 or 23 or the fusionprotein of claim 12 or 24.

31. The method of claim 30 wherein said (poly)peptide of claim 11 or 23 or said fusionprotein of claim 12 or 24 is fixed to a solid support.

32. The method of claim 31 wherein said solid support is a gel filtration or an affinity chromatography material.

33. The method of any one of claims 30 to 32 wherein, prior to said identification in step (c), said binding (poly)peptides are released.

34. The method of claim 33 wherein said release is effected by elution.

35. The method of any one of claims 30 to 34 further comprising the step of identifying the nucleic acid molecule(s) encoding the one or more binding (poly)peptides.

36. A method of identifying a compound influencing the expression of the nucleic acid molecule of any one of claims 1 to 7 and 14 to 17 comprising the steps of

(a) contacting a host carrying an expression vector comprising the nucleic acid molecule of any one of claims 1 to 7 or 14 to 17 or the nucleic acid molecule identified by the method of claim 29 or 35 operatively linked to a readout system with a compound or a collection of compounds;

37. A method of identifying a compound influencing the activity of a (poly)peptide as defined in any one of claims 1 to 7 or 14 to 17 comprising the steps of

(a) contacting a host carrying an expression vector comprising the nucleic acid molecule of any one of claims 1 to 7 or 14 to 17 operatively linked to a readout system and/or carrying a (poly)peptide of the invention linked to a readout system with a compound or a collection of compounds;

(b) assaying whether said contacting results in a change of signal intensity provided by said readout system; and, optionally

(c) identifying a compound within said collection of compounds that induces a change of signal in step (b); wherein said change in signal correlates with a change in activity of said (poly)peptide.

38. The method of claim 36 or 37 wherein said host is a eukaryotic host cell.

39. The method of claim 38 wherein said eukaryotic host cell is a mammalian host cell.

40. The method of claim 36 or 37 wherein said host is a bacterium or a yeast.

41. The method of any one of claims 36 to 40 wherein said change in signal intensity is an increase in signal intensity.

42. The method of any one of claims 36 to 40 wherein said change in signal intensity is a decrease in signal intensity.

43. A method of assessing the impact of the expression of one or more (poly)peptides of claim 11 or 23 or of one or more fusionproteins of claim 12 or 24 in an animal comprising the steps of

(a) overexpressing the nucleic acid molecule of any one of claims 1 to 7 and 14 to 17 or the nucleic acid molecule of claim 29 or 35 in said animal; and

(b) determining whether the weight of said animal has increased, decreased, whether metabolic changes are induced and/or whether the eating behaviour is modified.

44. A method of assessing the impact of the expression of one or more (poly)peptides of claim 11 or 23 or of one or more fusionproteins of claim 12 or 24 in an animal comprising the steps of

(a) underexpressing the nucleic acid molecule of any one of claims 1 to 7 and 14 to 17 or the nucleic acid molecule of claim 29 or 35 in said animal; and

45. A method of identifying a gene involved in the regulation of body weight comprising the steps of

(a) mutagenizing an animal of the adipose phenotype;

46. The method of claim 45 wherein said animal is a fruit fly.

47. The method of claim 45 or 46 wherein said mutagenizing is effected by using P elements.

48. A method of screening and/or identifying for an agent which modulates the interaction of a (poly)peptide as defined in any one of claims 1 to 7 or 14 to 17 with a binding target/agent, comprising the steps of

(a) incubating a mixture comprising

(aa) a (poly)peptide of claim 11 or 23, or a fragment thereof or a fusion protein of claim 12 or 24 or a fragment thereof;

(ab) a binding target/agent of said (poly)peptide or fusionprotein or fragment thereof; and

(ac) a candidate agent under conditions whereby said (poly)peptide, fusionprotein or fragment thereof specifically binds to said binding target/agent at a reference affinity;

49. A method of screening and/or identifying an agent which modulates the dimerization, oligomerization and/or multimerization of a (poly)peptide as defined in any one of claims 1 to 7 or 14 to 17 comprising the steps of

(a) incubating a mixture comprising

(aa) a (poly)peptide of claim 11 or 23 or a fragment thereof or a fusion protein of claim 12 or 24 or a fragment thereof; and

50. A method of refining the compound identified by the method of any one of claims 36 to 42 or the agent identified by the method of claim 48 or 49 comprising

(a) modeling said compound by peptidomimetics; and

(b) chemically synthesizing the modeled compound.

51. A method of producing a composition comprising formulating the compound identified by the method of any one of claims 36 to 42 or the agent identified by the method of claim 48 or 49 or the compound refined by the method of claim 50 with a pharmaceutically acceptable carrier and/or diluent.

52. A method of producing a composition comprising the compound identified by the method of any one of claims 36 to 42 or the agent identified by the method of claim 48 or 49 comprising the steps of

(a) modifying a compound identified by the method of any one of claims 36 to 42 or the agent of claim 48 or 49 as a head compound to achieve (i) modified site of action, spectrum of activity, organ specificity, and/or (ii) improved potency, and/or

(i) esterification of carboxyl groups, or (ii) esterification of hydroxyl groups with carbon acids, or (iii) esterification of hydroxyl groups to, e.g. phosphates, pyrophosphates or sulfates or hemi succinates, or (iv) formation of pharmaceutically acceptable salts, or

(v) formation of pharmaceutically acceptable complexes, or

(vi) synthesis of pharmacologically active polymers, or

(vii) introduction of hydrophilic moieties,_, or

(viii) introduction/exchange of substituents on aromates or side chains, change of substituent pattern, or (ix) modification by introduction of isosteric or bioisosteric moieties, or (x) synthesis of homologous compounds, or (xi) introduction of branched side chains, or (xii) conversion of alkyl substituents to cyclic analogues, or (xiii) derivatisation of hydroxyl group to ketales, acetales, or (xiv) N-acetylation to amides, phenylcarbamates, or (xv) synthesis of Mannich bases, imines, or (xvi) transformation of ketones or aldehydes to Schiffs bases, oximes, acetales, ketales, enolesters, oxazolidines, thiazolidines or combinations thereof; and (b) formulating the product of said modification with a pharmaceutically acceptable carrier.

53. The method of claim 51 or 52 wherein said composition is a pharmaceutical composition.

54. The method of claim 53, wherein said composition is a pharmaceutical composition for preventing or treating obesity, adipositas, bulimia, wasting, eating disorders and/or body weight/body mass disorders.

55. A composition comprising

(a) an inhibitor of the (poly)peptide identified by the method of any one of claims 27, 28 or 30 to 34 or refined by the method of claim 50;

(b) an inhibitor of the expression of the gene identified by the method of claim 29 or 35;

(c) a compound identified by the method of claim 41 or 42; and/or (d) the vector of claim 18 or 19.

56. A composition comprising

(a) a stimulator of the (poly)peptide identified by the method of any one of claims 27, 28 or 30 to 34 or refined by the method of claim 50;

(b) a stimulator of the expression of the gene identified by the method of claim 29 or 35;

(c) a compound identified by the method of claim 41 or 42; and/or

(d) the vector of claim 18 or 19.

57. A composition comprising a nucleic acid molecule of claim 1 to 7 or 14 to 17, a (poly)peptide of claim 11 or 23, a fusion protein of claim 12 or 24 or an antibody of claim 13 or 25 or an anti-sense oligonucleotide of claim 26, a (poly)peptide as identified by the method of any one of claims 27, 28 and 30 to 35, a compound or agent as identified by the method of any one of claims 36 to 42, 48 or 49, a compound as refined by the method of claim 50 or a nucleic acid molecule or gene as identified by the method of any one of claims 29 and 45 to 47.

58. The composition of claim 55 to 57 or as defined in any one of claims 51 to 54 which is a pharmaceutical composition.

59. A composition comprising a nucleic acid molecule of claim 1 to 7 or 14 to 17, a (poly)peptide of claim 11 or 23 or a fusionprotein of claim 12 or 24 or an antibody, fragment or derivative thereof or an aptamer of claim 13 or 25, at least one primer as defined in claim 1 or 14 or an anti-sense oligonucleotide of claim 26.

60. The composition of claim 59 which is a diagnostic composition.

61. A method of treating and/or preventing obesity, adipositas, bulimia, wasting, eating disorders, and/or disorders of body weight/body mass in a mammal comprising administering the composition of claim 57 or 58 or an inhibitor, stimulator, compound or vector comprised therein to a mammal in need thereof.

62. The method of claim 61 wherein said mammal is a human.

63. Use of

(a) an inhibitor of the (poly)peptide identified by the method of any one of claims 27, 28, 30 to 34 or 36 to 42 or refined by the method of claim 50;

(c) a compound identified by the method of claim 42; and/or

(d) the vector of claim 18 or 19 for the preparation of a pharmaceutical composition for the treatment of obesity, adipositas, eating disorders, bulimia, wasting and/or body weight/body mass disorders.

64. Use of

(a) a stimulator of the (poly)peptide identified by the method of any one of claims 27, 28, 30 to 34 or 36 to 42 or refined by the method of claim 50;

(c) a compound identified by the method of claim 41 ; and/or

(d) the vector of claim 18 or 19 for the preparation of a pharmaceutical composition for the treatment of obesity, adipositas, bulimia, wasting, eating disorders and/or body weight/body mass disorders.

65. Use of an agent as identified by the method of claim 49 for the preparation of a pharmaceutical composition for the treatment and/or prevention of obesity, adipositas, eating disorders, bulimia, wasting and/or body weight/body mass disorders.

6. Kit comprising at least one of

(a) a nucleic acid molecule of any one of claims 1 to 7 or 14 to 17;

(b) a vector of claim 8, 18 or 19;

(c) a host of claim 9 or 20;

(d) a (poly)peptide of claim 11 or 23;

(e) a fusionprotein of claim 12 or 24;

(f) an antibody or a fragment or derivative thereof or an antiserum, an aptamer or another receptor of claim 13 or 25;

(g) a primer or a set of primer(s) as defined in any one of claims 1 , 14 or 59; and/or

(h) an anti-sense oligonucleotide of claim 26.