WO2002014491A2 - A hematopoietic growth factor-like protein obtained from a cdnalibrary from hs-5 stromal cell line - Google Patents

Abstract

The present invention relates to a new hematopoietic growth factor-like protein obtained from a cDNA library from HS-5 stromal cell line, nucleic acid molecules that encode the hematopoietic growth factor-like protein or a fragment thereof and nucleic acid molecules that are useful as robes or primers for detecting or amplifying the hematopoietic growth factor-like protein, respectively. The invention further relates to uses of hematopoietic growth factor-like protein. The invention also relates to applications of the factor or fragment such as forming antibodies capable of binding the factor or fragments thereof.

Description

A NEW HEMATOPOIETIC GROWTH FACTOR-LIKE PROTEIN OBTAINED FROM A cDNA LIBRARY FROM HS-5 STROMAL CELL LINE

The present application is a continuation of United States application Serial No. 09/636, 422 filed August 10, 2000, which is incorporated by reference in entirety as if written herein.

FIELD OF THE INVENTION

The present invention relates to hematopoietic stem cell growth factor produced by the HS-5 cell line, nucleic acid molecules that encode the factor or a fragment thereof, and nucleic acid molecules that are useful as probes or primers for detecting or amplifying the factor, respectively. The invention also relates to applications such as forming antibodies capable of binding the factor or fragments thereof.

BACKGROUND Hematopoiesis is the process by which blood cells are produced within bone marrow. Broadly, the process involves stem cells giving rise to progenitor cells, which in turn give rise to colonies of differentiated cells such as erythroid, granulocyte, megakaryocyte, granulocytic macrophages, and mixtures of such cells. While the stem cells are self-renewable, the differentiated cells (erythroid, granulocyte, etc.) essentially have no ability to proliferate. Thus, certain conditions lead to proliferation of stem cells, while other conditions favor differentiation.

The precise mechanisms of stem cell proliferation and differentiation are not fully understood. However, it is known that a variety of hematopoietic growth factors are involved. At least 20 growth factors having hematopoietic activity have been identified. Their biological activity generally involves high affinity receptor binding followed by signal transduction to initiate cell division and/or differentiation.

Hematopoietic growth factors are frequently characterized by their stimulation of colony formation in human hematopoietic progenitor cells. Most of these growth factors can only stimulate one type of colony formation in vitro. No two factors have been reported to stimulate exactly the same pattern of colony formation; no two factors produce the exact same colony numbers, lineage, and maturation pattern. The combination of growth factors present is believed to determine the type of differentiated cell colony produced. Two or more factors may act on a progenitor cell to induce the formation of larger numbers of progeny, thereby increasing the colony size. Activation of additional receptors on a cell by the use of two or more factors has been reported to enhance the mitotic signal (Metcalf et al, Nature 339:21 (1989), incorporated by reference in its entirety). The loss of stem cells associated with immunosuppressive therapies, for example, can result in a fatal reduction in the amount of blood cells being produced. Removing a portion of the patient's bone marrow before chemotherapy treatment begins helps avoid this problem. The removed marrow is examined and any cancerous cells are removed. After completion of the treatment, the healthy marrow is then reintroduced into the patient. In order to prevent the stem cells from differentiating ex vivo, the marrow is frozen. While freezing arrests the differentiation of stem cells, it would be more beneficial if marrow cells could be cultured, enhancing the proliferation of stem cells. Optimally, a novel method should be developed to allow the stem cells to proliferate without differentiation, thus circumventing the method of freezing to prevent differentiation. Several groups have attempted to achieve long-term ex vivo expansion of human bone marrow cells (Hassan et al, Eur. Cytokin Netw. 7:12-136 (1996); Alcόrn and Holyoake, Blood Rev. 10:161-116 (1996); Emerson et al, Bone Marrow Transp. i5:S34 (1995); Reems et al., Biol. Blood Marrow Transp. 3:133-141 (1997); Makino et al, I. Hematother. (5:475-489 (1997); Poloni et al, Hematol Cell Ther. 39:49-58 (1997), each of which is incorporated by reference in its entirety). In most methods for long-term human bone marrow cultures, proliferation is shortlived (about 2 weeks) (Schwartz et al, Cytotechnology 10:211 (1992), incorporated by reference in its entirety). Indeed, hematopoietic stem cells have only a limited proliferative potential that decreases with age (Simmons et al, Current Opinion Hematol. 2:189-195 (1995), incorporated by reference in its entirety). Hassan et al, supra, reported maintenance of the production of nonadherent erythroid clonogenic cells for about four weeks in culture.

Part of the problem with some ex vivo culture techniques is that the bone marrow microenvironment is not identically replicated. The engraftment potential of cultured cells has been reported to be reduced because of qualitative changes that occur during ex vivo expansion (Reems et al, supra). Stromal cells have been reported to provide a physical matrix on which stem cells reside. This physical matrix is reported to contribute to hematopoiesis by providing an optimal microenvironment as well as providing growth factors and cytokines that stimulate and enhance proliferation of hematopoietic cells (Lazarus etal, Bone Marrow Transp. 15:557-564 (1995), incorporated by reference in its entirety). PCT publication WO 96 02662A1 by Torok-Storb et al. (incorporated by reference in its entirety) reports that in sustaining hematopoiesis, immortalized human stromal cell lines are useful as feeder layers in ex vivo bone marrow cultures < and in colony forming assays (see also Rocklein and Torok-Storb, Blood 85:991- 1005 (1995), incorporated by reference in its entirety). Moreover, culture media that is conditioned by exposure to the immortalized human stromal cell line HS-5, but which does not actually contain the stromal cells, was also reported to sustain and expand hematopoietic precursor cells. However, this result was not observed with the HS -21 -conditioned media. Further, supplementing the HS-2- conditioned media with the additional identified cytokines detected in HS-5-conditioned media also failed to support colony formation. Differences in the DNA between HS-5 and HS- 21 were examined by a differential display technique, which revealed two isolated bands expressed in HS-5 and not expressed in HS-21. PCT publication WO 96 02662 A 1 does not report the identity of these polypeptides.

Several approaches have been used to identify and analyze differentially expressed genes. These approaches include differential cDNA library screening, subtractive libraries and PCR-based differential display, single cell amplification, and PCR Select (Diatchenko et al, Proc. Natl Acad. Sci. (U.S.A.) 93:6025-6030 (1996); Maser and Calvet, Semin. Nephrol. 15:29-42 (1995); Watson and Marguiles, Dev. Neurosci. 15:11-86 (1993); Miles and Wallace, Behring. Inst. Mitt. 88: 133-141 (1991), all of which are incorporated by reference in their entirety).

Subtractive libraries are a classic approach to the isolation of novel proteins. The subtractive hybridization approach has been reviewed by Swendeman and La Quaglia, Semin. Pedriatr. Surg. 5:149-154 (1996); Ermolaeva and Sverdlov, Genet. Anal. 73:49-58 (1996); Hara et al., Anal. Biochem. 274:58-64 (1993), all of which are incorporated by reference in their entirety. Subtractive hybridization has been used to identify cDNA clones that are predominantly expressed in the immune system (Ericsson et al, Immunol. Rev. 100:261-211 (1987), incorporated by reference in its entirety). With respect to stem cell growth factors, however, subtractive hybridization has been reported to be cumbersome.

The differential display approach has been reviewed by Wang and Feuerstein, Cardiovasc. Res. 35:414-421 (1997); Wang et al, Trends Pharmacol Sci. 17:216-219 (1996); Livesey and Hunt, Trends Neurosci. 19:84-88 (1996);

Sunday, Am. J. Physiol. 2<59:L273-L284 (1995); and Liang and Pardee, Curr. Opin. Immunol. 7:274-280 (1995); Mou et al, Biochem. Biophys. Res. Commun. 199:564- 569 (1994), all of which are incorporated by reference in their entirety. It has been reported that cytokine-inducible genes have been isolated from hematopoietic cells by the differential display approach (Zhu et al , Methods Mol. Biol. 85: 153-161

(1997); Rosok et al, Bio/Techniques 22:114-121 (1996), incorporated by reference in its entirety).

PCR-Select (suppression subtractive hybridization (SSH)) combines normalization and subtraction in a single procedure (Diatchenko et al, Proc. Natl. Acad. Sci. (U.S.A.) 93:6025-6030 (1996); Gurskaya et al, Anal Biochem. 240:90-91 (1996), incorporated by reference in its entirety; PCR-Select cDNA Subtraction Kit, CLONTECHniques X(4):2-5 (1995), incorporated by reference in its entirety). The PCR-Select approach employs suppression PCR (U.S. Patent No. 5,565,340, incorporated by reference in its entirety). A kit for PCR-Select is available from Clontech (Palo Alto, CA).

While advances in understanding hematopoiesis have been made, further elucidation of the factors involved would be desirable. However, identifying and sequencing new hematopoietic growth factors is difficult for a variety of reasons including the low concentrations involved, the inability to accurately separate proteins into individual pure fractions, the large amount of DNA involved and the complexity and degeneracy of DNA in general.

SUMMARY OF THE INVENTION Based on a study of the HS-5 cell line, a library of 294 substantially purified nucleic acid sequences was generated. These sequences are derived from the gene that codes for a new hematopoietic stem cell growth factor produced by HS-5 and are useful as probes in detecting the entire gene and as primers for amplifying the gene sequence. The present invention also relates to a substantially-purified nucleic acid molecule that encodes an HS-5 hematopoietic stem cell growth factor or fragment thereof and which comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3, substantial fragments thereof, substantial homologues thereof, or substantial complements thereof.

The present invention provides a substantially-purified nucleic acid molecule that encodes an HS-5 hematopoietic stem cell growth factor or fragment thereof, having a nucleic acid sequence that substantially hybridizes with at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO:3, and complements thereof, is also provided by the present invention.

The present invention further relates to a substantially-purified HS-5 hematopoietic stem cell growth factor, or fragment thereof, encoded by a nucleic acid molecule which substantially hybridizes to a second nucleic acid molecule, where the second nucleic acid molecule consists essentially of a nucleic acid sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO: 3, and complements thereof.

The present invention also provides a method for determining a level or pattern of an HS-5 hematopoietic stem cell growth factor in a cell comprising: (A) incubating, under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, the marker nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof, with a complementary nucleic acid molecule obtained from the cell, wherein nucleic acid hybridization between the marker nucleic acid molecule, and the complementary nucleic acid molecule obtained from the cell permits the detection of the HS-5 hematopoietic stem cell growth factor; (B) permitting hybridization between the marker nucleic acid molecule and the complementary nucleic acid molecule obtained from the cell; and (C) detecting the level or pattern of the complementary nucleic acid, wherein the detection of the complementary nucleic acid is predictive of the level or pattern of the HS-5 hematopoietic stem cell growth factor.

The present invention also provides an HS-5 hematopoietic stem cell growth factor of SEQ ID NO:6, SEQ ID NO:7, variants and fragments thereof.

The present invention also provides a method for determining a mutation in a cell whose presence is predictive of a mutation affecting the level or pattern of an HS-5 hematopoietic stem cell growth factor comprising the steps: (A) incubating, under conditions permitting nucleic acid hybridization, a marker nucleic acid molecule, the marker nucleic acid molecule comprising a nucleic acid molecule that is linked to a gene, the gene specifically hybridizes to a nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof, and a complementary nucleic acid molecule obtained from the cell, wherein nucleic acid hybridization between the marker nucleic acid molecule and the complementary nucleic acid molecule obtained from the cell permits the detection of a polymorphism whose presence is predictive of a mutation affecting the level or pattern of the HS-5 hematopoietic stem cell growth factor in the cell; (B) permitting hybridization between the marker nucleic acid molecule and the complementary nucleic acid molecule obtained from the cell; and (C) detecting the presence of the polymorphism, wherein the detection of the polymorphism is predictive of the mutation. The present invention further provides a method of producing a cell containing reduced levels of an HS-5 hematopoietic stem cell growth factor comprising: (A) transforming the cell with a functional nucleic acid molecule, wherein the functional nucleic acid molecule comprises a promoter region, wherein the promoter region is linked to a structural region, wherein the structural region comprises a nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof; wherein the structural region is linked to a 3' non-translated sequence that functions in the cell to cause termination of transcription and addition of polyadenylated ribonucleotides to a 3' end of a mRNA molecule; and wherein the functional nucleic acid molecule results in co-suppression of the HS-5 hematopoietic stem cell growth factor protein; and (B) growing the transformed cell. The present invention further provides a method for reducing expression of an HS-5 hematopoietic stem cell growth factor in a cell comprising: (A) transforming the cell with a nucleic acid molecule, the nucleic acid molecule having an exogenous promoter region which functions in a cell to cause the production of a mRNA molecule, wherein the exogenous promoter region is linked to a transcribed nucleic acid molecule having a transcribed strand and a non-transcribed strand, wherein the transcribed strand is complementary to a nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof and the transcribed strand is complementary to an endogenous mRNA molecule; and wherein the transcribed nucleic acid molecule is linked to a 3' non-translated sequence that functions in the cell to cause termination of transcription and addition of polyadenylated ribonucleotides to a 3' end of a mRNA molecule; and (B) growing the transformed cell.

The present invention also provides a method of isolating a nucleic acid that encodes an HS-5 hematopoietic stem cell growth factor or fragment thereof comprising: (A) incubating under conditions permitting nucleic acid hybridization, a first nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof with a complementary second nucleic acid molecule obtained from a cell; (B) permitting hybridization between the first nucleic acid molecule and the second nucleic acid molecule obtained from the cell; and (C) isolating the second nucleic acid molecule. The present invention also provides a method for proliferating or expanding a hematopoietic stem cell population ex vivo comprising culturing the hematopoietic stem cell population in the presence of a cocktail of cytokines wherein the cocktail comprises a stem cell factor isolated from HS-5 cell line, an IL-3 variant taught in WO 94/12639 and WO 94/12638, a fusion protein taught in WO 95/21197 and WO 95/21254, a G-CSF receptor agonists disclosed in WO 97/12977, a c-mpl receptor agonists disclosed in WO 97/12978, a IL-3 receptor agonists disclosed in WO 97/12979 and a multi-functional receptor agonists taught in WO 97/12985, flt3 receptor agonists disclosed in WO 98/18923, stem cell factor receptor agonists disclosed in WO 98/18924, erythropoietin receptor agonists disclosed in WO 98/18926, and multi-functional chimeric hematopoietic receptor agonists disclosed in WO 98/17810, and wherein the culturing promotes the growth of myeloid-type progenitor cells. As used herein 'TL-3 variants" refer to IL-3 variants taught in WO 94/12639 and WO 94/12638. As used herein "fusion proteins" refer to fusion protein taught in WO 95/21197, and WO 95/21254. As used herein "G-CSF receptor agonists" refer to G-CSF receptor agonists disclosed in WO 97/12978. As used herein "c-mpl receptor agonists" refer to c-mpl receptor agonists disclosed in WO 97/12978. As used herein "IL-3 receptor agonists" refer to IL-3 receptor agonists disclosed in WO 97/12979. As used herein "multi-functional receptor agonists" refer to multi-functional receptor agonists taught in WO 97/12985. As used herein "flt3 receptor agonists" refers to flt3 receptor agonists disclosed in WO 98/18923. As used herein "stem cell factor receptor agonists" refers to stem cell factor receptor agonists disclosed in WO 98/18924. As used herein "erythropoietin receptor agonists" refers to erythropoietin receptor agonists disclosed in WO 98/18926. As used herein "multi-functional chimeric hematopoietic receptor agonists" refers to multi-functional chimeric hematopoietic receptor agonists disclosed in WO 98/17810.

Definitions The following is a list of abbreviations and the corresponding meanings as used interchangeably herein:

DMEM = Dulbecco's modified Eagle media

DTT = dithiothreitol HBSS = Hanks balanced salt solution

HPLC = high performance liquid chromatography

IMDM = Iscove's modified Dulbecco's media mg = milligram ml = milliliter mL = milliliter μg = microgram μl = microliter

PBS = phosphate buffered saline

TFA = trifluoracetic acid ug = microgram ul = microliter

The following is a list definitions of various terms used herein: The term "altered" means that expression differs from the expression response of cells or tissues not exhibiting the phenotype.

The term "amino acid(s)" means all naturally occurring L-amino acids. The term "chromosome walking" means a process of extending a genetic map by successive hybridization steps.

The term "cluster" means that BLAST scores from pairwise sequence comparisons of the member clones are similar enough to be considered identical with experimental error.

The term "complete complementarity" means that every nucleotide of one molecule is complementary to a nucleotide of another molecule.

The term "degenerate" means that two nucleic acid molecules encode for the same amino acid sequences but comprise different nucleotide sequences. The term "exogenous genetic material" means any genetic material, whether naturally occurring or otherwise, from any source that is capable of being inserted into any organism.

The term "expansion" means the differentiation and proliferation of cells. The term "expressed sequence tags (ESTs) means randomly sequenced members of a cDNA or complementary DNA library.

The term "expression response" means the mutation affecting the level or pattern of the expression encoded in part or whole by one or more nucleic acid molecules. The term "fragment" means a nucleic acid molecule whose sequence is shorter than the target or identified nucleic acid molecule and having the identical, the substantial complement, or the substantial homologue of at least 10 contiguous nucleotides of the target or identified nucleic acid molecule.

The term "fusion molecule" means a protein-encoding molecule or fragment that upon expression, produces a fusion protein.

The term "fusion protein" means a protein or fragment thereof that comprises one or more additional peptide regions not derived from that protein.

The term "marker nucleic acid" means a nucleic acid molecule that is utilized to determine an attribute or feature (e.g., presence or absence, location, correlation, etc.) of a molecule, cell, or tissue.

The term "mimetic compound" means a chemically synthesized compound with similar properties to a naturally occurring compound or a fragment of that compound, which exhibits an ability to specifically bind to antibodies directed against that compound. The term "phenotype" means any of one or more characteristics of an organism, tissue, or cell.

The term "probe" means an agent that is utilized to determine an attribute or feature (e.g. presence or absence, location, correlation, etc.) of a molecule, cell, tissue, or organism. The term "protein fragment" means a peptide or polypeptide molecule whose amino acid sequence comprises a subset of the amino acid sequence of that protein. The term "protein molecule/peptide molecule" means any molecule that comprises five or more amino acids.

The term "recombinant" means any agent (e.g., DNA, peptide, etc.), that is, or results from, however indirectly, human manipulation of a nucleic acid molecule. The term "selectable or screenable marker genes" means genes who's expression can be detected by a probe as a means of identifying or selecting for transformed cells.

The term "singleton" means a single clone.

The term "specifically bind" means that the binding of an antibody or peptide is not competitively inhibited by the presence of non-related molecules.

The term "specifically hybridizing" means that two nucleic acid molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure.

The term "stem cell" means totipotent hematopoietic stem cells, as well as early precursors and progenitor cells, which can be isolated from bone marrow, spleen, or peripheral blood.

The term "stem cell growth factor" means a factor that acts on progenitor cells as well as stem cells.

The term "substantial complement" means that a nucleic acid sequence shares at least 80% sequence identity with the complement. The term "substantial fragment" means a fragment, which comprises at least

100 nucleotides.

The term "substantial homologue" means that a nucleic acid molecule shares at least 80% sequence identity with another.

The term "substantially hybridizing" means that two nucleic acid molecules can form an anti-parallel, double-stranded nucleic acid structure under conditions (e.g. salt and temperature) that permit hybridization of sequences that exhibit 90% sequence identity or greater with each other and exhibit this identity for at least a contiguous 50 nucleotides of the nucleic acid molecules.

The term "substantially purified" means that one or more molecules that are or may be present in a naturally occurring preparation containing the target molecule will have been removed or reduced in concentration. The term "tissue sample" means any sample that comprises more than one cell.

BRIEF DECRYPTION OF THE FIGURES

Figure 1 shows Northern blot analysis of HS-5 poly A+ RNA to determine the transcript size of various candidate clones identified as potential growth factors. Poly A+ RNA was electrophoresed on formaldehyde gel and probed with Digoxigenin-labeled PCR fragment of the EST of interest. The RNA marker sizes are shown in numbers.

Figure 2 shows cell proliferation of AS-E2 cell line in response to EPO. The cells were incubated with various concentrations of EPO for 3 days. Cells were pulsed with 3H-thymidine and harvested the following day. The radioactivity was quantitated as a measure of growth.

Figure 3 shows cell proliferation of AS-E2 cell line in response to SCF. The cells were incubated with various concentrations of SCF for 3 days, in the presence or absence of neutralizing antibodies to SCF. Cells were pulsed with ^H-thymidine and harvested the following day. The radioactivity was quantitated as a measure of growth.

Figure 4 shows cell proliferation of AS-E2 cell line in response to HS-5 CM. The cells were incubated with various concentrations of HS-5 CM for 3 days, in the presence or absence of neutralizing antibodies to SCF. Cells were pulsed with 3H- thymidine and harvested the following day. The radioactivity was quantitated as a measure of growth. The neutralizing antibodies to SCF do not inhibit proliferation of AS-E2 cell s in response to HS-5 CM suggesting that the cells respond to something other than SCF in HS-CM.

Figure 5 shows proliferation of human bone marrow CD34+ cells in response to HS-CM. CD34+ cells were incubated with varying concentrations of HS-5 CM for 7 days. The cells were pulsed with 3H-thymidine and harvested. The radioactivity was quantitated as a measure of proliferation. HS-5 CM induces proliferation of CD 34+ cells to a greater extent that induced by reconstituted HS-5 containing a cocktail of cytokines known to be present in the HS-5 CM.

Figure 6 shows colony forming unit assay using human CD34⁺ cells in response to

HS-5 CM, reconstituted HS-5 and a literature control. CD34+ cells were plated in methylcellulose at a density of 10,000 cells per well and incubated at 37°C for 12 cells. The number of colonies containing >50 cells were counted using a microscope.

Figure 7 shows the 2-D gel profile of HS-5 conditioned medium. The protein spots analyzed by MALDI-TOF and ES-MS are annotated.

Figure 8 shows the 2-D gel profile of column fractions containing bioactivity for AS-E2 cells. Fractions from RP-HPLC were assayed for proliferative activity in AS- E2 cells. Biologically active fractions were run on 2-D PAGE and the gel was stained with Ammoniacal silver. The panels show common and unique proteins in various fractions.

Figure 9 shows the DNA sequence SEQ ID NO: 2 that encodes the deduced open reading frame of the hematopoietic growth factor-like protein of SEQ ID NO: 6. The arrow indicates potential cleavage sites between residues 24 and 25 as predicted by SignalP.

Figure 10 shows the alignment of the hematopoietic growth factor-like protein of SEQ ID NO:6 and gi/32698 (SEQ ID NO:8) generated using ALIGN (version 2.0) to calculate the global alignment of the two sequences (Myers and Miller, CABIOS, 1998).

DETAILED DESCRIPTION OF THE INVENTION A library of expressed sequence tags (ESTs) was created from a cDNA library derived from the HS-5 cell line. ESTs are randomly sequenced members of a cDNA library (or complementary DNA)(McCombie et al, Nature Genetics 7.T24- 130 (1992); Kurata et al, Nature Genetics 8: 365-372 (1994); Okubo et al, Nature Genetics 2: 173-179 (1992), all of which references are incorporated in their entirety). The selected clones comprise inserts that can represent a copy of up to the full length of a mRNA transcript.

The cDNA library was prepared in part by subtracting the mRNA in HS-5 that was common to HS-21, HS-27, and HS-23. The EST sequences were compared to sequences in various databases by computer algorithms. The sequences set forth herein importantly have a growth factor and/or secretion motif. Accordingly, these sequences correspond to the hematopoietic stem cell growth factor expressed by HS-5, and found in HS-5 conditioned media, but not expressed by HS-21, HS-27, and HS-23. The degeneracy of the genetic code, which allows different nucleic acid sequences to code for the same protein or peptide, is known in the literature (U.S. Patent No. 4,757,006, the entirety of which is incorporated by reference). As used herein^ a nucleic acid molecule is "degenerate" of another nucleic acid molecule when the nucleic acid molecules encode for the same amino acid sequences but comprise different nucleotide sequences. Nucleic acid molecules of the present invention include, but are not limited to, homologous nucleic acid molecules that are degenerate of those set forth in SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof.

As used herein, a "substantial homologue" of a nucleic acid molecule is one that shares at least 80% sequence identity therewith. Variations are due to the degeneracy of the genetic code. Preferably, a homologue shares at least 90%, more preferably at least 95%, sequence identity with the target nucleic acid molecule. In some embodiments, the substantial homologue will differ from the target nucleic acid molecule by no more than 5 nucleotides, preferably no more than 3 nucleotides. A nucleic acid molecule is said to be the "complement" of another nucleic acid molecule if every nucleotide of one of the molecules is complementary to a nucleotide of the other (complete complementarity). A "substantial complement" shares at least 80% sequence identity with the complement. Preferably, the substantial complement shares at least 90%, more preferably at least 95%, sequence identity with the complement. In some embodiments, the substantial complement will differ from the complement by no more than 5 nucleotides, preferably no more than 3 nucleotides.

A "fragment" as used herein means a nucleic acid molecule whose sequence is shorter than the target or identified nucleic acid molecule and having the identical, the substantial complement, or the substantial homologue of at least 10 contiguous nucleotides of the target or identified nucleic acid molecule. Accordingly, a fragment contains at least 10 nucleotides, typically at least 50 nucleotides, more typically at least 60 nucleotides, and preferably at least 100 nucleotides. The upper limit on the number of nucleotides is essentially only limited by the number of nucleotides in the target nucleic acid molecule.

As indicated above, the fragment can be of a substantial homologue or substantial complement of one of the sequences set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3. Preferably, the fragment is identical or complementary to at least 50 contiguous nucleotides in one of SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3. Such a "substantial fragment" preferably comprises at least 100 nucleotides. As used herein, the term "substantially purified," means that one or more molecules that are or may be present in a naturally occurring preparation containing the target molecule will have been removed or reduced in concentration.

It is understood that the sequences of the present invention described above, including the homologues, complements, and fragments, also include the labeled forms thereof (e.g., fluorescent labels (Prober et al, Science 238:336-340 (1987); Albarella et al, European Patent 144914), chemical labels (Sheldon et al, U.S. Patent 4,582,789; Albarella et al, U.S. Patent 4,563,417), modified nucleotides (Miyoshi et al, European Patent 119448), all of which are incorporated by reference in their entirety).

The nucleic acid molecules comprising SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3, or complements thereof, substantial homologues thereof, and substantial fragments thereof, can encode, either by themselves or as part of a longer sequence, an HS-5 hematopoietic stem cell growth factor, or fragment thereof. Accordingly, one aspect of the present invention is a substantially-purified nucleic acid molecule that comprises at least one nucleic acid sequence that is identical to, a substantial homologue to, or a substantial complement to a sequence set forth in SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3. In one embodiment of the present invention, one or more of the nucleic acid molecules of the present invention share between 90% and 100% sequence identity with one or more of the nucleic acid sequences set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof. In a further aspect of the present invention, one or more of the nucleic acid molecules share between 95% and 100%, preferably between 98% and 100%, and more preferably between 99% and 100% sequence identity with one or more of the nucleic acid sequences set forth in SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof.

In a preferred embodiment, a nucleic acid of the present invention will specifically hybridize to one or more of the nucleic acid molecules set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof under moderately stringent conditions, for example at about 2x sodium chloride/sodium citrate (SSC) and about 40°C. In a particularly preferred embodiment, a nucleic acid of the present invention will specifically hybridize to one or more of the nucleic acid molecules set forth in SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof under high stringency conditions.

Conventional stringency conditions are described by Sambrook et al, In: Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, New York (1989)), and by Haymes et al, In: Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985), the entirety of which is incorporated by reference. Departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure.

Appropriate stringency conditions which promote DNA hybridization, for example, 6x SCC at about 45°C, followed by a wash of 2x SSC at 50°C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6 (incorporated by reference in its entirety). For example, the salt concentration in the wash step can be selected from a low stringency of about 2x SSC at 50°C to a high stringency of about 0.2x SSC at 50°C. In addition, the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22°C, to high stringency conditions at about 65°C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed.

Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules are said to be capable of "specifically hybridizing" to one another if the two molecules are capable of forming an anti- parallel, double-stranded nucleic acid structure.

The present invention also relates to the substantially purified protein, fragment thereof, or polypeptide molecule of SEQ ID NO:6 or SEQ ID NO:7. That is, substantially purified recombinant proteins, protein fragments and polypeptides. As used herein, the term "recombinant" means any agent (e.g., DNA, peptide, etc.), that is, or results from, however indirectly, human manipulation of a nucleic acid molecule. As used herein, the term "protein molecule" or "peptide molecule" includes any molecule that comprises five or more amino acids. It is well known in the art that proteins may undergo modification, including post-translational modifications, such as, but not limited to, disulfide bond formation, glycosylation, phosphorylation, or oligomerization. Thus, as used herein, the term "protein molecule" or "peptide molecule" includes any protein molecule that is modified by any biological or non-biological process. The terms "amino acid" and "amino acids" refer to all naturally occurring L-amino acids. This definition is meant to include norleucine, ornithine, homocysteine, and homoserine.

Non-limiting examples of the protein or fragment molecules of the present invention are a novel HS-5 hematopoietic stem cell growth factor or fragment thereof of SEQ ID NO:6 or SEQ ID NO:7. For clarity, a "stem cell growth factor" is not meant to require activity, exclusively or otherwise, on the stem cells per se, but instead is used broadly to embrace activity on progenitor cells as well as stem cells. Preferably, the protein is an HS-5 hematopoietic stem cell growth factor or a fragment thereof. Another aspect of the nucleic acid molecules of the present invention is that they can encode a homologue or fragment thereof of a hematopoietic stem cell growth factor. As used herein, a homologue protein molecule or fragment thereof is a counterpart protein molecule or fragment thereof in a second species (e.g., human's interleukin-2 cytokine is a homologue of mouse's interleukin-2 cytokine).

One or more of the protein or fragment of peptide molecules may be produced by chemical synthesis, or more preferably, by expressing in a suitable bacterial or eukaryotic host. Suitable methods for expression are described by Sambrook et al., (In: Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, New York (1989)), or similar texts.

A "protein fragment" is a peptide or polypeptide molecule whose amino acid sequence comprises a subset of the amino acid sequence of that protein. A protein or fragment thereof that comprises one or more additional peptide regions not derived from that protein is a "fusion protein". Such molecules may be derivatized to contain carbohydrate or other moieties (such as keyhole limpet hemocyanin, etc.). Fusion proteins or peptide molecules of the present invention are preferably produced by recombinant means.

The sequences of the present invention can be formed by well-known and conventional techniques. For example, genetic engineering techniques may be employed in the construction of the DNA sequences of the present invention (U.S Patent No. 4,935,233, incorporated by reference in its entirety; Sambrook et al, "Molecular Cloning A Laboratory Manual", Cold Spring Harbor (1989)). Any of a variety of methods may be used to obtain one or more of the above-described nucleic acid molecules (Zamechik et al, Proc. Natl. Acad. Sci. (U.S.A.) 53:4143- 4146 (1986), the entirety of which is incorporated by reference; Goodchild et al, Proc. Natl. Acad. Sci. (U.S.A.) §5:5507-5511 (1988), the entirety of which is incorporated by reference; Wickstrom et al, Proc. Natl. Acad. Sci. (U.S.A.) 55:1028-1032 (1988), the entirety of which is incorporated by reference; Holt et al, Molec. Cell. Biol. 8:963-913 (1988), the entirety of which is incorporated by reference; Gerwirtz et al, Science 242:1303-1306 (1988), the entirety of which is incorporated by reference; Anfossi et al., Proc. Natl. Acad. Sci. (U.S.A.) 86:3319- 3383 (1989), the entirety of which is incorporated by reference; Becker et al, EMBO J. #3685-3691 (1989); the entirety of which is incorporated by reference). Automated nucleic acid synthesizers may be employed for this purpose. In lieu of such synthesis, the disclosed nucleic acid molecules may be used to define a pair of primers that can be used with the polymerase chain reaction (Mullis et al, Cold Spring Harbor Symp. Quant. Biol. 51:263-213 (1986); Erlich et al, European Patent 50,424; European Patent 84,796, European Patent 258,017, European Patent 237,362; Mullis, European Patent 201,184; Mullis et al, U.S. Patent 4,683,202; Erlich, U.S. Patent 4,582,788; and Saiki, R. et al, U.S. Patent 4,683,194, all of which are incorporated by reference in their entirety) to amplify and obtain any desired nucleic acid molecule or fragment. The nucleic acid molecules of the present invention may be used as probes in connection with methods that require probes. As used herein, a "probe" is a nucleic acid molecule that is utilized to determine an attribute or feature (e.g., presence or absence, location, correlation, etc.) of a molecule, cell, or tissue. Preferably, the nucleic acids of the present invention are used as a probe for a stem cell. Nucleic acid molecules and fragments thereof of the present invention may be employed to obtain other nucleic acid molecules from the same species (e.g., ESTs from the HS-5 cell line may be utilized to obtain other nucleic acid molecules from other hematopoietic stem or stromal cell lines). Such nucleic acid molecules include the nucleic acid molecules that encode, the complete coding sequence of a protein, and promoters and flanking sequences of such molecules. In addition, such nucleic acid molecules include nucleic acid molecules that encode for other isozymes or gene family members. Such molecules can be readily obtained by using the above-described nucleic acid molecules or fragments thereof to screen cDNA or genomic libraries obtained from a hematopoietic stem cell. Methods for forming such libraries are well known in the art.

Nucleic acid molecules and fragments thereof of the present invention may also be employed to obtain nucleic acid homologues. Such homologues include the nucleic acid molecule of other hematopoietic cell lines or other tissues (e.g., HS-5 stromal cell line, etc.) including the nucleic acid molecules that encode, in whole or in part, protein homologues of other hematopoietic stem cell lines or other tissues, sequences of genetic elements such as promoters and transcriptional regulatory elements. Such molecules can be readily obtained by using the above-described nucleic acid molecules or fragments thereof to screen cDNA or genomic libraries. Methods for forming such libraries are well known in the art. Such homologue molecules may differ in their nucleotide sequences from those found in one or more of SEQ ID NO:l, SEQ ID NO: 2, SEQ ID NO:3 or complements thereof because complete complementarity is not needed for stable hybridization. The nucleic acid molecules of the present invention therefore also include molecules that, although capable of specifically hybridizing with the nucleic acid molecules, may lack "complete complementarity."

Promoter sequence(s) and other genetic elements, including but not limited to transcriptional regulatory flanking sequences, associated with one or more of the disclosed nucleic acid sequences can also be obtained using the disclosed nucleic acid sequence provided. In one embodiment, such sequences are obtained by incubating EST nucleic acid molecules or preferably fragments thereof with members of genomic libraries (e.g. HS-5 stromal cell line) and recovering clones that hybridize to the EST nucleic acid molecule or fragment thereof. In a second embodiment, methods of "chromosome walking," or inverse PCR may be used to obtain such sequences (Frohman et al, Proc. Natl. Acad. Sci. (U.S.A.) §5:8998-9002 (1988); Ohara et al, Proc. Natl. Acad. Sci. (U.S.A.) 86: 5673-5677 (1989); Pang et al, Biotechniques 22(6): 1046-1048 (1977); Huang et al, Methods Mol. Biol. 69: 89-96 (1997); Huang, et al, Method Mol. Biol. 67:281-294 (1997); Benkel et al, Genet. Anal. 13: 123-127 (1996); Hartl et al, Methods Mol. Biol. 58: 293-301 (1996), all of which are incorporated by reference in their entirety).

The nucleic acid molecules of the present invention may be used to isolate promoters of cell-enhanced, cell-specific, tissue-enhanced, tissue-specific, developmentally- or physiologically-regulated expression profiles. Isolation and functional analysis of the 5' flanking promoter sequences of these genes from genomic libraries, for example, using genomic screening methods and PCR techniques would result in the isolation of useful promoters and transcriptional regulatory elements. These methods are known to those of skill in the art and have been described (see, for example, Birren et al, Genome Analysis: Analyzing DNA, 1, (1997), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., the entirety of which is incorporated by reference). Promoters obtained utilizing the nucleic acid molecules of the present invention could also be modified to affect their control characteristics. Examples of such modifications would include, but are not limited to, enhancer sequences as reported by Kay et al, Science 236:1299 (1987), incorporated by reference in its entirety. Genetic elements such as these could be used to enhance gene expression of new and existing hematopoietic stem cell growth factors. In one aspect of the present invention, one or more of the nucleic molecules are used to determine whether a cell (preferably a hematopoietic cell) has a mutation affecting the level (i.e., the concentration of mRNA in a sample, etc.) or pattern (i.e., the kinetics of expression, rate of decomposition, stability profile, etc.) of the expression encoded in part or whole by one or more of the nucleic acid molecules of the present invention (collectively, the "Expression Response" of a cell or tissue). As used herein, the Expression Response manifested by a cell or tissue is said to be "altered" if it differs from the Expression Response of cells or tissues not exhibiting the phenotype. To determine whether an Expression Response is altered, the Expression Response manifested by the cell or tissue exhibiting the phenotype is compared with that of a similar cell or tissue sample not exhibiting the phenotype. It is not necessary to re-determine the Expression Response of the cell or tissue sample not exhibiting the phenotype each time such a comparison is made; the Expression Response of a particular cell, for example, may be compared with previously obtained values of normal cells. As used herein, the "phenotype" of the organism is any of one or more characteristics of an organism, tissue, or cell (e.g., cell growth, cell differentiation, etc.). A change in genotype or phenotype may be transient or permanent. Also as used herein, a "tissue sample" is any sample that comprises more than one cell. In one aspect, a tissue sample comprises cells that share a common characteristic (e.g., derived from hematopoietic stem cell line, etc.). In one embodiment of the present invention, an evaluation can be conducted to determine whether a particular mRNA molecule is present. One or more of the nucleic acid molecules of the present invention, preferably one or more of the EST nucleic acid molecules of the present invention are utilized to detect the presence or quantity of the mRNA species. Such molecules are then incubated with cell or tissue extracts of a cell under conditions sufficient to permit nucleic acid hybridization. The detection of double-stranded probe-mRNA hybrid molecules is indicative of the presence of the mRNA. The amount of hybrid molecules formed is proportional to the amount of mRNA. Thus, such probes may be used to ascertain the level and extent of the mRNA production in a cell or tissue. Such nucleic acid hybridization may be conducted under quantitative conditions (thereby providing a numerical value of the amount of the mRNA present). Alternatively, the assay may be conducted as a qualitative assay indicating the presence of the mRNA, or that its level exceeds a predefined value.

A principle of in situ hybridization is that a labeled, single-stranded nucleic acid probe will hybridize to a complementary strand of cellular DNA or RNA and, under the appropriate conditions, these molecules will form a stable hybrid. When nucleic acid hybridization is combined with histological techniques, specific DNA or RNA sequences can be identified within a single cell. An advantage of in situ hybridization over more conventional techniques for the detection of nucleic acids is that it allows an investigator to determine the precise local concentration of the nucleic acid molecule within a tissue or cell (Angerer et al, Dev. Biol. 101: 477-484 (1984), the entirety of which is incorporated by reference; Angerer et al, Dev. Biol. 112: 157-166 (1985), the entirety of which is incorporated by reference; Dixon et al. , EMBO J. 10: 1317-1324 (1991), the entirety of which is incorporated by reference). In situ hybridization may be used to measure the steady-state level of RNA accumulation. It is a sensitive technique and RNA sequences present in as few as 5-10 copies per cell can be detected (Hardin et al, J. Mol Biol. 202: 417-431 (1989), the entirety of which is incorporated by reference). A number of protocols have been devised for in situ hybridization, each with tissue preparation, hybridization, and washing conditions. In situ hybridization also allows for the localization of proteins within a tissue or cell (Wilkinson, In Situ Hybridization, Oxford University Press, Oxford (1992), the entirety of which is incorporated by reference). It is understood that one or more of the molecules of the present invention, preferably one or more of the EST nucleic acid molecules of the present invention or one or more of the antibodies of the present invention, may be utilized to detect the level or pattern of a hematopoietic stem cell growth factor pathway enzyme or mRNA thereof by in situ hybridization.

Fluorescent in situ hybridization allows the localization of a particular DNA sequence along a chromosome. This technique is useful for gene mapping, following chromosomes in hybrid lines, or detecting chromosomes with translocations, transversions, or deletions, among others. It is understood that the nucleic acid molecules of the present invention may be used as probes or markers to localize sequences along a chromosome. A microarray-based method for high-throughput monitoring of gene expression may be utilized to measure gene-specific hybridization targets. This 'chip'-based approach involves using microarrays of nucleic acid molecules as gene-specific hybridization targets to quantitatively measure expression of the corresponding genes (Schena et al, Science 270:461-410 (1995), the entirety of which is incorporated by reference; Shalon, Ph.D. Thesis. Stanford University (1996), the entirety of which is incorporated by reference). Every nucleotide in a large sequence can be queried at the same time. Hybridization can be used to efficiently analyze nucleotide sequences. Several microarray methods have been described. One method compares the sequences to be analyzed by hybridization to a set of oligonucleotides representing all possible subsequences (Bains and Smith, J. Theor. Biol. 135:303-301 (1989), the entirety of which is incorporated by reference). A second method hybridizes the sample to an array of oligonucleotide or cDNA molecules. An array consisting of oligonucleotides complementary to subsequences of a target sequence can be used to determine the identity of a target sequence, measure its amount, and detect differences between the target and a reference sequence. Nucleic acid molecule microarrays may also be screened with protein molecules, or fragments thereof, to determine nucleic acid molecules that specifically bind protein molecules, or fragments thereof.

The microarray approach may be used with polypeptide targets (U.S. Patent No. 5,445,934; U.S. Patent No: 5,143,854; U.S. Patent No. 5,079,600; U.S. Patent No. 4,923,901, all of which are incorporated by reference in their entirety). Essentially, polypeptides are synthesized on a substrate (microarray) and these polypeptides can be screened with either protein molecules or fragments thereof including but not limited to antibodies, or nucleic acid molecules in order to screen for either protein molecules or fragments thereof, or nucleic acid molecules that specifically bind the target polypeptides, or small molecules with substantial affinity for protein molecules, or small molecules with substantial affinity for specific protein molecules. Implementation of these techniques relies on recently developed combinatorial technologies to generate any ordered array of a large number of oligonucleotide probes (Fodor et al., Science 251:161-113 (1991), the entirety of which is incorporated by reference). It is understood that one or more of the nucleic acid molecules, proteins, or fragments thereof of the present invention may be utilized in a microarray-based method.

Site-directed mutagenesis may be utilized to modify nucleic acid sequences. This technique allows one or more of the amino acids encoded by a nucleic acid molecule to be altered (e.g. a threonine to be replaced by a methionine). Three basic methods for site-directed mutagenesis are often employed. These are cassette mutagenesis (Wells et al, Gene 34:315-323 (1985), the entirety of which is incorporated by reference), primer extension (Gilliam et al., Gene 12:129-131 (1980), the entirety of which is incorporated by reference; Zoller and Smith, Methods Enzymol 20*9:468-500 (1983), the entirety of which is incorporated by reference; Dalbadie-McFarland et al, Proc. Natl Acad. Sci. (U.S.A.) 79:6409-6413 (1982), the entirety of which is incorporated by reference) and methods based upon PCR (Scharf et al. , Science 233: 1076-1078 (1986), the entirety of which is incorporated by reference; Higuchi et al., Nucleic Acids Res. 76:7351-7367 (1988), the entirety of which is incorporated by reference). Site-directed mutagenesis approaches are also described in European Patent 0 385 962, the entirety of which is incorporated by reference, European Patent 0 359 472, the entirety of which is incorporated by reference, and PCT Patent Application WO 93/07278, the entirety of which is incorporated by reference. Site-directed mutagenesis strategies applied for both in vitro as well as in vivo site directed mutagenesis have been reviewed by Ling and Robinson, Anal. Biochem. 254:151-118 (1997); Chong et al, Biotechniques 77:719-720 (1994); Weiner et al, Gene 151:119-123 (1994); Chen et al, Nucleic Acids Res. 25:682-684 (1997); Weiner et al, Gene 126:35-41 (1993), all of which are incorporated by reference in their entirety.

Any of the nucleic acid molecules of the present invention may either be modified by site-directed mutagenesis or used as, for example, nucleic acid molecules that are used to target other nucleic acid molecules for modification. Mutants containing one or more altered nucleotide can be constructed using common laboratory techniques such as isolating restriction fragments and ligating such fragments into an expression vector (see, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (1989)). One aspect of the present invention concerns antibodies, single-chain antigen binding molecules, or other proteins that specifically bind to one or more of the protein or peptide molecules of the present invention, and their homologues, fusions or fragments. Such antibodies may be used to quantitatively or qualitatively detect the protein or peptide molecules of the present invention. As used herein, an antibody or peptide is said to "specifically bind" to a protein or peptide molecule of the present invention if such binding is not competitively inhibited by the presence of non-related molecules.

Nucleic acid molecules that encode all or part of the protein of the present invention can be expressed, by recombinant means, to yield protein or peptides that can be used to elicit antibodies that are capable of binding the expressed protein or peptide. Such antibodies may be used in immunoassays for that protein. Such protein-encoding molecules, or their fragments may be a "fusion molecule" (i.e., a part of a larger nucleic acid molecule) such that, upon expression, produce a fusion protein. It is understood that any of the nucleic acid molecules of the present invention may be expressed, by recombinant means, to yield proteins or peptides encoded by these nucleic acid molecules.

The antibodies that specifically bind proteins and protein fragments of the present invention may be polyclonal or monoclonal, and may comprise intact immunoglobulins, or antigen binding portions of immunoglobulins fragments (such as (F(ab'), F(ab')2), or single-chain immunoglobulins producible, for example, by recombinant means. It is understood that practitioners are familiar with the standard resource materials, which describe specific conditions and procedures for the construction, manipulation, and isolation of antibodies (see, for example, Harlow and Lane, In Antibodies: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, New York (1988), the entirety of which is incorporated by reference).

Murine monoclonal antibodies are particularly preferred. BALB/c mice are preferred for this purpose, however, equivalent strains may also be used. The animals are preferably immunized with approximately 25 μg of purified protein (or fragment thereof) that has been emulsified in a suitable adjuvant (such as TiterMax adjuvant (Vaxcel, Norcross, GA)). Immunization is preferably conducted at two intramuscular sites, one intraperitoneal site, and one subcutaneous site at the base of the tail. An additional i.v. injection of approximately 25 μg of antigen is preferably given in normal saline three weeks later. After approximately 11 days following the second injection, the mice may be bled and the blood screened for the presence of anti-protein or peptide antibodies. Preferably, a direct binding Enzyme-Linked Lnmunoassay (ELIS A) is employed for this purpose. More preferably, the mouse having the highest antibody titer is given a third i.v. injection of approximately 25 μg of the same protein or fragment. The splenic leukocytes from this animal may be recovered three days later, and then permitted to fuse, most preferably, using polyethylene glycol, with cells of a suitable myeloma cell line (such as, for example, the P3X63Ag8.653 myeloma cell line). Hybridoma cells are selected by culturing the cells under "HAT" (hypoxanthine-aminopterin- thymine) selection for about one week. The resulting clones may then be screened for their capacity to produce monoclonal antibodies (mAbs), preferably by direct ELISA. In one embodiment, anti-protein or peptide monoclonal antibodies are isolated using a fusion of a protein or peptide of the present invention, or conjugate of a protein or peptide of the present invention, as immunogens. Thus, for example, a group of mice can be immunized using a fusion protein emulsified in Freund's complete adjuvant (e.g. approximately 50 μg of antigen per immunization). At three- week intervals, an identical amount of antigen is emulsified in Freund's incomplete adjuvant and used to immunize the animals. Ten days following the third immunization, serum samples are taken and evaluated for the presence of antibody. If antibody titers are too low, a fourth booster can be employed. Polysera capable of binding the protein or peptide can also be obtained using this method.

In a preferred procedure for obtaining monoclonal antibodies, the spleens of the above-described immunized mice are removed, disrupted, and immune splenocytes are isolated over a ficoll gradient. The isolated splenocytes are fused, using polyethylene glycol with B ALB/c-derived HGPRT (hypoxanthine guanine phosphoribosyl transferase) deficient P3x63xAg8.653 plasmacytoma cells. The fused cells are plated into 96 well microtiter plates and screened for hybridoma fusion cells by their capacity to grow in culture medium supplemented with hypothanthine, aminopterin, and thymidine for approximately 2-3 weeks.

Hybridoma cells that arise from such incubation are preferably screened for their capacity to produce an immunoglobulin that binds to a protein of interest. An indirect ELIS A may be used for this purpose. In brief, the supernatants of hybridomas are incubated in microtiter wells that contain immobilized protein. After washing, the titer of bound immunoglobulin can be determined using, for example, a goat anti-mouse antibody conjugated to horseradish peroxidase. After additional washing, the amount of immobilized enzyme is determined (for example through the use of a chromogenic substrate). Such screening is performed as quickly as possible after the identification of the hybridoma in order to ensure that a desired clone is not overgrown by non-secreting neighbor cells. Desirably, the fusion plates are screened several times since the rates of hybridoma growth vary. In a preferred sub-embodiment, a different antigenic form may be used to screen the hybridoma. Thus, for example, the splenocytes may be immunized with one immunogen, but the resulting hybridomas can be screened using a different immunogen. It is understood that any of the protein or peptide molecules of the present invention may be used to raise antibodies.

As discussed below, such antibody molecules or their fragments may be used for diagnostic purposes. Where the antibodies are intended for diagnostic purposes, it may be desirable to derivatize them, for example with a ligand group (such as biotin) or a detectable marker group (such as a fluorescent group, a radioisotope or an enzyme).

The ability to produce antibodies that bind the protein or peptide molecules of the present invention permits the identification of mimetic compounds of those molecules. A "mimetic compound" is a compound that is closely related to a compound in either structure or function, or a fragment of that compound, but which nonetheless exhibits an ability to specifically bind to antibodies directed against that compound.

It is understood that any of the antibodies of the present invention may be expressed and that such expression can result in a physiological effect. It is also understood that any of the expressed antibodies may be catalytic.

Another aspect of the present invention provides plasmid DNA vectors for use in the expression of the hematopoietic growth factor of the present invention. These vectors contain the DNA sequences described above which code for the polypeptides of the invention. Appropriate vectors which can transform microorganisms capable of expressing the hematopoietic growth factor include expression vectors comprising nucleotide sequences coding for the hematopoietic growth factor joined to transcriptional and translational regulatory sequences, which are selected according to the host cells used. Vectors incorporating modified sequences as described above are included in the present invention and are useful in the production of the hematopoietic growth factor polypeptides. The vector employed in the method also contains selected regulatory sequences in operative association with the DNA coding sequences of the invention and which are capable of directing the replication and expression thereof in selected host cells.

Transfer of a nucleic acid that encodes for a protein can result in overexpression of that protein in a transformed cell. One or more of the proteins or fragments thereof encoded by nucleic acid molecules of the present invention may be overexpressed in a transformed cell. Particularly, any of the hematopoietic stem cell growth factors or fragments thereof may be overexpressed in a transformed cell. Such overexpression may be the result of transient or stable transfer of the exogenous genetic material. "Exogenous genetic material" is any genetic material, whether naturally occurring or otherwise, from any source that is capable of being inserted into any organism.

A construct or vector may include a promoter to express the protein or protein fragment of choice. Preferably, the promoter of the present invention is a hematopoietic stem cell-specific promoter. More preferably, the hematopoietic stem cell-specific promoter of the present invention is the CD34 promoter (Burn et al., U.S. Patent No. 5,556,954, incorporated by reference in its entirety). Additional promoters that can be used in the present invention include the glucose-6- phosphatase promoter (Yoshiuchi et al, J. Clin. Endocrin. Metab. §3:1016-1019 (1998), incorporated by reference in its entirety), interleukin-1 alpha promoter (Mori and Prager, Leuk. Lymphoma 2*5:421-433 (1997), incorporated by reference in its entirety), CMV promoter (Tong et al., AnticancerRes. 18:119-125 (1998), incorporated by reference in its entirety; Norman et al, Vaccine 75:801-803 (1997), incorporated by reference in its entirety); RSV promoter (Elshami et al, Cancer Gene Ther. 4:213-221 (1997), incorporated by reference in its entirety; Baldwin et al, Gene Ther. 4:1142-1149 (1997), incorporated by reference in its entirety); SV40 promoter (Harms and Splitter, Hum. Gene Ther. 6:1291-1297 (1995), incorporated by reference in its entirety), CD1 lc integrin gene promoter (Corbi and Lopez- Rodriguez, Leuk. Lymphoma 25:415-425 (1997), incorporated by reference in its entirety), GM-CSF promoter (Shannon et al, Crit. Rev. Immunol. 77:301-323 (1997), incorporated by reference in its entirety), interleukin-5R alpha promoter (Sun et al, Curr. Top. Microbiol. Immunol 211:113-181 (1996), incorporated by reference in its entirety), interleukin-2 promoter (Serfing et al, Biochim. Biophys. Acta 7263:181-200 (1995), incorporated by reference in its entirety; O'Neill et al, Transplant Proc. 23:2862-2866 (1991), incorporated by reference in its entirety), c- fos promoter (Janknecht, Immunobiology 193:131-142 (1995), incorporated by reference in its entirety; Janknecht et al, Carcino genesis 76:443-450 (1995), incorporated by reference in its entirety; Takai et al, Princess Takamatsu Symp. 22:191-204 (1991), incorporated by reference in its entirety), h-ras promoter (Rachal et al. , EXS 64:330-342 (1993), incorporated by reference in its entirety), and DMD gene promoter (Ray et al, Adv. Exp. Med. Biol. 2§0:107-111 (1990), incorporated by reference in its entirety).

Promoters suitable for expression of the stem cell growth factor protein of the present invention in bacteria have been described by Hawley and McClure, Nucleic Acids Res. 77:2237-2255 (1983), and Harley and Reynolds, Nucleic Acids Res. 75:2343-2361 (1987), both of which are incorporated by reference in their entirety. Such promoters include, for example, the rec A promoter (Fernandez de Henestrosa et al, FEMS Microbiol. Lett. 147:209-213 (1997); Nussbaumer et al, FEMS Microbiol. Lett. 118:51-63 (1994); Weisemann et al, Biochimie 73: 457-470 (1991), all of which are incorporated by reference in their entirety), the ptac promoter (Hasan et al, Gene 56:141-151 (1987); Marsh, Nucleic Acids Res. 14:3603 (1986), both of which are incorporated by reference in their entirety); and a ptac-rec A hybrid promoter. It is preferred that the particular promoter selected is capable of causing sufficient expression to result in the production of an effective amount of the stem cell growth factor protein to cause the desired phenotype.

Constructs or vectors may also include with the coding region of interest a nucleic acid sequence that acts, in whole or in part, to terminate transcription of that region.

It is understood that the nucleic acid molecules of the present invention may be used to isolate regulatory elements preferentially associated with hematopoietic stem cell growth factors. For example, the nucleic acid molecules of the present invention may be used to isolate promoter sequences associated with hematopoietic stem cell growth factors. More preferably, the nucleic acid molecules of the present invention are used to isolate promoter sequences associated with the growth factor of the HS-5 cell line of the present invention.

Translational enhancers may also be incorporated as part of the vector DNA. DNA constructs could contain one or more 5' non-translated leader sequences that may serve to enhance expression of the gene products from the resulting mRNA transcripts. Such sequences may be derived from the promoter selected to express the gene or can be specifically modified to increase translation of the mRNA. Such regions may also be obtained from viral RNAs, from suitable eukaryotic genes, or from a synthetic gene sequence.

A vector or construct may also include a screenable marker. Screenable markers may be used to monitor expression. Exemplary screenable markers include β-glucuronidase encoded by the uidA gene (GUS) (Jefferson, Plant Mol Biol. Rep. 5: 387-405 (1987), the entirety of which is incorporated by reference; Jefferson et al, EMBO I. 6: 3901-3907 (1987), the entirety of which is incorporated by reference); β-lactamase (Sutcliffe et al, Proc. Natl Acad. Sci. (U.S.A.) 75: 3737- 3741 (1978), the entirety of which is incorporated by reference), luciferase (Clontech) (Ow et al, Science 234: 856-859 (1986), the entirety of which is incorporated by reference); β-galactosidase (Clontech); GST (Stratagene); Protein A (Calbiochem); blue fluorescent protein (Clontech); and green fluorescent protein (Clontech).

Included within the terms "selectable or screenable marker genes" are also genes, which encode a secretable marker whose secretion can be detected as a means of identifying or selecting for transformed cells. Examples include markers, which encode a secretable antigen that can be identified by antibody interaction, or even secretable enzymes, which can be detected by catalytic reactions. Secretable proteins fall into a number of classes, including small, diffusible proteins, which are detectable, (e.g., by ELISA), small active enzymes, which are detectable in extracellular solution (e.g., α-amylase, β-lactamase, phosphinothricin transferase), or proteins, which are inserted or trapped in the cell membrane (such as proteins which include a leader sequence). Other possible selectable and/or screenable marker genes will be apparent to those of skill in the art. ^l As another aspect of the present invention, there is provided a method for producing the hematopoietic growth factor. Suitable cells or cell lines may be bacterial cells. For example, the various strains of E. coli are well known as host cells in the field of biotechnology. Examples of such strains include E. coli strains JM101 (Yanish-Perron et al. Gene 33:103-119 (1985), incorporated by reference in its entirety) and MON105 (Obukowicz et al, Applied Environmental Microbiology 58:1511-1523 (1992), incorporated by reference in its entirety). Also included in the present invention is the expression of the hematopoietic growth factor protein utilizing a chromosomal expression vector for E. coli based on the bacteriophage Mu (Weinberg et al., Gene 126:25-33 (1993), incorporated by reference in its entirety). Various strains of B. subtilis may also be employed in this method. Many strains of yeast cells known to those skilled in the art are also available as host cells for expression of the polypeptides of the present invention. When expressed in the E. coli cytoplasm, the gene encoding the hematopoietic growth factor of the present invention may also be constructed such

9 1 1 that the 5' end of the gene codons are added to encode Met^" -Ala^" - or Met ^" at the N-terminus of the protein. The N termini of proteins made in the cytoplasm of E. coli are affected by post-translational processing by methionine aminopeptidase (Bassat et al, J. Bac. 169:151-151 (1987), incorporated by reference in its entirety) and possibly by other peptidases so that upon expression the methionine is cleaved off the N-terminus. The hematopoietic growth factor of the present invention may be hematopoietic growth factor polypeptides having Met^"1, Ala^"1 or Met^"2 -Ala^"1 at the N-terminus. These hematopoietic growth factor polypeptides may also be expressed in E. coli by fusing a secretion signal peptide of the N-terminus. This signal peptide can be cleaved from the polypeptide as part of the secretion process.

Under another embodiment, the stem cell growth factor protein of the present invention is expressed in a yeast cell, preferably Saccharomyces cerevisiae. The stem cell growth factor protein of the present invention can be expressed in S. cerevisiae by fusing it to the N-terminus of the URA3, CYC1 or ARG3 genes (Guarente and Ptashne, Proc. Natl. Acad. Sci. (U.S.A.) 7§:2199-2203 (1981); Rose et al, Proc. Natl. Acad. Sci. (U.S.A.) 7§:2460-2464 (1981); and Crabeel et al, EMBO J. 2:205-212 (1983), all of which are incorporated by reference in their entirety). Alternatively, the stem cell growth factor protein of the present invention can be fused to either the PGK or TRP1 genes (Tuite et al, EMBO I. 7:603-608 (1982); andDobson et al, Nucleic Acids. Res. 77:2287-2302 (1983), both of which are incorporated by reference in their entirety). More preferably, the stem cell growth factor protein of the present invention is expressed as a mature protein (Hitzeman et al, Nature 293:111-122 (1981); Valenzuela et al, Nature 298:341- 350 (1982); and Derynck et al, Nucleic Acids Res. 77:1819-1837 (1983), all of which are incorporated by reference in their entirety). Native and engineered yeast promoters suitable for use in the present invention have been reviewed by Romanos et al, Yeast §:423-488 (1992), incorporated by reference in its entirety. Most preferably, the stem cell growth factor of the present invention is secreted by the yeast cell (Blobel and Dobberstein, J. Cell Biol. 67:835-851 (1975); Kurjan and Herskowitz, Cell 30:933-943 (1982); Bostian et al, Cell 36:741-751 (1984); Rothman and Orci, Nature 355:409-415 (1992); Julius et al, Cell 32:839-852 (1983); and Julius et al, Cell 36:309-318 (1984), all of which are incorporated by reference in their entirety).

Where desired, insect cells may be utilized as host cells in the method of the present invention (See, e.g., Luckow, Protein Eng. J. L. Cleland., Wiley-Liss, New York, NY: 183-2180 (1996) and references cited therein). In addition, general methods for expression of foreign genes in insect cells using baculovirus vectors are described in: O'Reilly et al, Baculovirus Expression Vectors: A Laboratory Manual. New York, W.H. Freeman and Company (1992), and King and Possee, The Baculovirus Expression System: A Laboratory Guide, London, Chapman & Hall, both of which are incorporated by reference in their entirety. An expression vector is constructed comprising a baculovirus transfer vector, in which a strong baculovirus promoter (such as the polyhedrin promoter) drives transcription of a eukaryotic secretion signal peptide coding region, which is translationally joined to the coding region for the desired protein. For example, the plasmid pVL1393 (obtained from Invitrogen Corp., San Diego, California) can be used. After construction of the vector carrying the gene encoding desired recombinant protein, two micrograms of this DNA is co-transfected with one microgram of baculovirus DNA into cultured Spodopterafrugiperda (Sf9) insect cells. Alternatively, recombinant baculoviruses can be created using a baculovirus shuttle vector system (Luckow et al, I. Virol. 67: 4566-4579 (1993), incorporated by reference in its entirety), now marketed as the Bac-To-Bac™ Expression System (Life Technologies, Inc. Rockville, MD). Pure recombinant baculoviruses carrying the desired gene are used to infect cells cultured, for example, in serum-free medium such as Excell 401 (JRH Biosciences, Lenexa, Kansas) or Sf900-II (Life Technologies, Inc.). The recombinant protein secreted into the medium can be recovered by standard biochemical approaches. Supernatants from mammalian or insect cells expressing the recombinant proteins can be first concentrated using any of a number of commercial concentration units. Proteins accumulating within infected cells can be recovered from cell pastes by standard techniques.

Alternatively, mammalian cells can be used to express the nucleic acid molecules of the present invention. There are a variety of methods, known to those with skill in the art, for introducing genetic material into a host cell. A number of vectors, both viral and non- viral have been developed for transferring genes into primary cells. Several reviews describe the application of viral vectors for gene therapy (Robbins et al., Trends Biotechnol 76:35-40 (1998), incorporated by reference in its entirety). Suitable viral vectors include, but are not limited to, adenovirus vectors (including replication-deficient recombinant adenovirus (Berkner, BioTechniques 6:616-629 (1988); Berkner, Current Top. Microbiol. Immunol. 158:39-66 (1992); Brody and Crystal, Annal New York Acad. Sci. 776:90- 103 (1994), all of which are incorporated by reference in their entirety), retroviral vectors (including replication deficient recombinant retrovirus (Boris-Lawrie and Temin, Curr. Opin. Genet. Dev. 3:102-109 (1993); Boris-Lawrie and Temin, Annal. New York Acad. Sci. 776:59-71 (1994); Miller, Current Top. Microbiol Immunol 158:1-24 (1992), all of which are incorporated by reference in their entirety), poxvirus vectors, herpesvirus vectors, adeno associated vectors (AAV), alphavirus vectors, lentivirus vectors, and combination vectors. Non-viral based vectors include protein/DNA complexes (Cristiano et al, Proc. Natl. Acad. Sci. (U.S.A). 90:2122-2126 (1993); Curiel et al, Proc. Natl Acad. Sci. (U.S.A). §§:8850-8854 (1991); Curiel, Annal. New York Acad. Sci. 776:36-58 (1994), all of which are incorporated by reference in their entirety), and electroporation and liposome mediated delivery such as cationic liposomes (Farhood et al., Annal New York Acad. Sci. 776:23-35 (1994), incorporated by reference in its entirety).

Preferably, the nucleic acid molecules of the present invention are cloned into a suitable retroviral vector (see, e.g., Dunbar et al, Blood §5:3048-3057 (1995), herein incorporated by reference in its entirety; Baum et al, J. Hematother. 5: 323- 329 (1996), incorporated by reference in its entirety; Bregni et al, Blood §0:1418- 1422 (1992), herein incorporated by reference in its entirety; Boris-Lawrie and Temin, Curr. Opin. Genet. Dev. 3:102-109 (1993), incorporated by reference in its entirety; Boris-Lawrie and Temin, Annal. New York Acad. Sci. 776:59-71 (1994), incorporated by reference in its entirety; Miller, Current Top. Microbiol Immunol 158:1-24 (1992), incorporated by reference in its entirety), adenovirus vector (Berkner, BioTechniques 6:616-629 (1988), incorporated by reference in its entirety; Berkner, Current Top. Microbiol Immunol. 158:39-66 (1992), incorporated by reference in its entirety; Brody and Crystal, Annal. New York Acad. Sci. 776:90-103 (1994), incorporated by reference in its entirety; Baldwin et al. , Gene Ther. 4: 1142- 1149 (1997), incorporated by reference in its entirety), RSV, MuSV, SSV, MuLV (Baum et al, I. Hematother. 5: 323-329 (1996)), AAV (Chen et al, Gene Ther. 5:50-58 (1998), incorporated by reference in its entirety; Hallek et al, Cytokines Mol. Ther. 2: 69-19 (1996), incorporated by reference in its entirety), AEV, AMV, or CMV (Griffiths et al, Biochem. J. 241: 313-324 (1987), incorporated by reference in its entirety).

Adenovirus vectors for the expression of cytokines in the gut have been reported (Macdonald, Gut 42:460-461 (1998), incorporated by reference in its entirety). Adenovirus vectors have also been reported to express alpha interferon in hematopoietic stem cells (Ahmed et al, Leuk. Res. 22: 119-124 (1998), incorporated by reference in its entirety).

Poxvirus vectors include vaccinia and various avianpox (canarypox and fowlpox) or swinepox viruses. Qin and Chatterjee (Hum. Gene Ther. 7:1853-1860 (1996), incorporated by reference in its entirety) report the expression of GM-CSF from a vaccinia virus. A vaccinia and a fowlpox virus have been reported to express model tumor antigens (Irvine et al., I. Natl. Cancer Inst. §9:1595-1601 (1997), incorporated by reference in its entirety). Several herpesvirus vectors have been reported for expression of genes neuronal tissues (Oligino et al, Gene Ther. 5:491-496 (1998), incorporated by reference in its entirety) or in hematopoietic cells (Dilloo et al, Blood §9:119-127 (1997), incorporated by reference in its entirety).

An adeno-associated virus has been reported to express factor IX in a dog model of hemophilia (Monahan et al, Gene Ther. 5:40-49 (1998), incorporated by reference in its entirety). It has also been reported that the insulin gene has been expressed by an adeno-associated virus in a diabetic mouse (Sugiyama et al, Horm. Metab. Res. 29:599-603 (1997), incorporated by reference in its entirety).

Retroviruses were the first vectors reported to be used in human gene therapy. Retroviruses have been used to express proteins in many tissue types, including the expression of green fluorescent protein in niurine hematopoietic cells (Bagley et al, Transplantation 65:1233-1240 (1998), incorporated by reference in its entirety) and gene expression in human cord blood stem cells (Conneally et al,

(1998), incorporated by reference in its entirety). Pushko et al. (Virology 239:389- 401 (1997), incorporated by reference in its entirety) have reported expression of heterologous proteins from a Venezuelan equine, encephalitis virus vector system that is useful for vaccine delivery. Vector systems consisting of retrovirus and adenovirus components have been reported (Feng et al., Nat. Biotechnol 15:866-810 (1997), incorporated by reference in its entirety). This system combines the high transient expression of adenovirus with the integration capabilities of retroviruses.

Vectors can be used for delivery of the naked plasmid DNA expressing the nucleic acid molecules of the present invention. Delivery can, for example, be in an aqueous solution by intramuscular injection or by a gene gun approach. The vectors can also be formulated with a variety of liposomes for delivery. Vectors suitable for naked DNA delivery include, but are not limited to, pCMV which is available from Clonetech (Rodriguez et al, Journal of Virology 72:5174-5181 (1998), incorporated by reference in its entirety) and pCI, which is available from Promega (Polo et al., Nature Biotechnology 76:517-518 (1998), incorporated by reference in its entirety).

Methods and compositions for transforming a bacteria and other microorganisms are known in the art (see, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1980)).

Technology for introduction of DNA into cells is well known to those of skill in the art. Four general methods for delivering a gene into cells have been described: (1) chemical methods (Graham and van der Eb, Virology 54:536-539 (1973), the entirety of which is incorporated by reference); (2) physical methods such as microinjection (Capecchi, Cell 22:479-488 (1980), the entirety of which is incorporated by reference), electroporation (Wong and Neumann, Biochem. Biophys. Res. Commun. 707:584-587 (1982); Fromm et al, Proc. Natl Acad. Sci. (U.S.A.) §2:5824-5828 (1985); U.S. Patent No. 5,384,253, all of which are incorporated in their entirety); and the gene gun (Johnston and Tang, Methods Cell Biol 43:353-365 (1994), the entirety of which is incorporated by reference); (3) viral vectors (Clapp, Clin. Perinatol. 20:155-168 (1993); Lu et al, J. Exp. Med. 17§:2089-2096 (1993); Eglitis and Anderson, Biotechniques, 6:608-614 (1988), all of which are incorporated in their entirety); and (4) receptor-mediated mechanisms (Curiel et al, Hum. Gen. Ther. 3:147-154 (1992), Wagner et al, Proc. Natl. Acad. Sci. (U.S.A.) §9:6099-6103 (1992), all of which are incorporated by reference in their entirety). Transformation can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments (see for example Potrykus et al, Mol. Gen. Genet. 205:193-200 (1986); Lorz et al, Mol. Gen. Genet. 199:118 (1985); Fromm et al, Nature 319:191 (1986); Uchimiya et al, Mol Gen. Genet. 204:204 (1986); Marcotte et al, Nature 335:454-457 (1988), all of which are incorporated by reference in their entirety). Assays for gene expression based on the transient expression of cloned nucleic acid constructs have been developed by introducing the nucleic acid molecules into cells by polyethylene glycol treatment, electroporation, or particle bombardment (Marcotte et al, Nature 335: 454-457 (1988), the entirety of which is incorporated by reference; McCarty et al, Cell 66: 895-905 (1991), the entirety of which is incorporated by reference; Hattori et al, Genes Dev. 6: 609-618 (1992), the entirety of which is incorporated by reference; Goff et al, EMBO J. 9: 2517-2522 (1990), the entirety of which is incorporated by reference). Transient expression systems may be used to functionally dissect gene constructs (see generally, Mailga et al, Methods in Plant Molecular Biology, Cold Spring Harbor Press (1995)).

Another aspect of the present invention is the use of an HS-5 hematopoietic stem cell growth factor in both ex vivo and in vivo proliferation and/or expansion of stem cells. Several methods for ex vivo expansion of stem cells have been reported. Such selection methods and expansion methods use various colony stimulating factors including c-kit ligand (Brandt et al, Blood §3:1507-1514 (1994), incorporated by reference in its entirety; McKenna et al, Blood §6:3413-3420 (1995), incorporated by reference in its entirety), IL-3 (Brandt et al, Blood §3:1507- 1514 (1994); Sato et al, Blood §2:3600-3609 (1993), incorporated by reference in its entirety), G-CSF (Sato et al, Blood §2:3600-3609 (1993)), IL-1 (Muench et al, Blood §7:3463-3473 (1993), incorporated by reference in its entirety), D -6 (Sato et al, Blood §2:3600-3609 (1993)), IL-11 (Lemoli et al, Exp. Hem. 27:1668-1672 (1993), incorporated by reference in its entirety; Sato et al, Blood §2:3600-3609 (1993)), flt-3 ligand (McKenna et al, Blood §6:3413-3420 (1995)), GM-CSF (Haylock et al., Blood §0:1405-1412 (1992), incorporated by reference in its entirety; Sato et al., Blood §2:3600-3609 (1993)); EPO (Fisher, P.S.E.B.M. 276:358- 366 (1997), incorporated by reference in its entirety; TPO (Schipper et. al., Br. J. Haematol. 707:425-435 (1998), incorporated by reference in its entirety; and/or combinations thereof (Brandt et al. , Blood §3: 1507-1514 (1994); Haylock et al. , Blood §0:1405-1412 (1992), incorporated by reference in its entirety; Koller et al, Biotechnology 77:358-363 (1993), incorporated by reference in its entirety; Lemoli et al, Exp. Hem. 27:1668-1672 (1993); McKenna et al, Blood §6:3413-3420 (1995); Muench et al, Blood §7:3463-3473 (1993); Patchen et al, Biotherapy 7:13- 26 (1994), incorporated by reference in its entirety; Sato et al. , Blood §2:3600-3609 (1993); Smith et al, Exp. Hem. 27:870-877 (1993), incorporated by reference in its entirety; Steen et al, Stem Cells 72:214-224 (1994), incorporated by reference in its entirety; Tsujino et al, Exp. Hem. 27:1379-1386 (1993), incorporated by reference in its entirety). Although hIL-3 has been reported to be the most potent growth factor in expanding peripheral blood CD34⁺ cells (Sato et al. , Blood §2:3600-3609 (1993); Kobayashi et al, Blood 73:1836-1841 (1989), incorporated by reference in its entirety). No single factor has been reported to be as effective as a combination of multiple factors. Therefore, under an embodiment of the present invention, the hematopoietic stem cell growth factor of the present invention is co-administered with at least one other stem cell growth factor.

Under one embodiment, the nucleic acid molecules of the present invention are used as a surrogate marker to measure the activity of another growth factor. All growth factors are capable of both ex vivo and in vivo proliferation and/or expansion of stem cells. Therefore, the nucleic acid molecules of the present invention are used, as a surrogate marker, to measure the proliferation and/or expansion activity of a growth factor.

It is understood that the expressed hematopoietic stem cell growth factor of the present invention may be used for the ex vivo expansion of hematopoietic progenitor cells.

Bone marrow transplants have been used to treat patients with neutropenia and thrombocytopenia. Several problems associated with the use of bone marrow in reconstitution of a compromised hematopoietic system include: the limited number of stem cells in bone marrow, spleen, or peripheral; Graft Versus Host Disease; graft rejection; and possible contamination with tumor cells. It has been reported that stem cells exhibit a dose response such that the greater the number of cells, the more enhanced hematopoietic recovery. Therefore, the ex vivo expansion of stem cells should enhance hematopoietic recovery and thereby enhance patient survival. Graft Versus Host disease and graft rejection have been reported for even

HLA- matched sibling donors. An alternative to allogenic none marrow transplants is autologous bone marrow transplants. In autologous bone marrow transplants, a portion of a patient's marrow is harvested prior to myeloblative therapy, e.g., high- dose chemotherapy and radiation therapy, and is transplanted back into the patient after completion of the myeloblative therapy regimen. Autologous transplantation eliminates the risk of Graft Versus Host Disease and graft rejection. However, autologous bone marrow transplants still present problems in terms of the limited number of stem cells in the marrow and the potential contamination with tumor cells. The limited number of stem cells may be overcome by ex vivo expansion of the stem cells.

Under another embodiment of the present invention the ex vivo expanded hematopoietic progenitor cells are used in bone marrow transplantation (Kessinger and Armitage, Blood 77:211-213 (1991), incorporated by reference in its entirety).

By expanding the hematopoietic progenitor cells, it is possible to reduce the number and duration of leucapheresis procedures required during autologous transplantation, thereby reducing the risk of disease contamination in the apheresis products (Alcorn and Holyoake, SZoo Rev. 70:167-176 (1996)). Under another embodiment of the present invention, the hematopoietic stem cell growth factor of the present invention is used for the ex vivo expansion of umbilical cord blood cells (Lu et al, Exp. Hematol. 27:1442-1446 (1993); Westwood et al, Br. J. Haematol. §6:468-474 (1994); Traycoff et al, Blood §5:2059-2068 (1995); Reems et al, Bio. Blood Marrow Transp. 3:133-141 (1997), all of which are incorporated by reference in their entirety). The expanded umbilical cord blood cells can then be used in allogenic transplantation. Alternatively, the hematopoietic stem cell growth factor of the present invention is used for the ex vivo expansion of fetal tissue. Reems et al describe the ex vivo expansion of cord blood cells in the presence of an HS-5 supernatant and kit ligand (Reems et al, Bio. Blood Marrow Transp. 3:133-141 (1997)).

Under one embodiment, the ex vivo expansion of the hematopoietic progenitor cells occurs in a stroma-free long term culture in the presence of various combinations of interleukins, stem cell growth factors, granulocyte macrophage colony stimulating factor and the hematopoietic stem cell growth factor of the present invention. A stroma-free, cytokine-based culture is preferable, in that cultures can be established under relatively defined serum-free conditions and cell proliferation and differentiation can be manipulated according to the hematopoietic growth factor(s) employed (Mayani et al, Blood 82:2664-2612 (1994); Rebel et al, Blood §3:128-136 (1994); Ploemacher et al, Leukemia 7:1381-1388 (1993); Henschler et al. , Blood §4:2898-2903 (1994), all of which are incorporated by reference in their entirety). The ex vivo expansion of the hematopoietic progenitor cells in a stroma-free long term culture has been described by De Bruyn et al, J. Hematotherapy 6:93-102 (1997), incorporated by reference in its entirety.

More preferably, the ex vivo method for expansion of the hematopoietic progenitor cells is capable of sustaining long term ex vivo expansion. Colony stimulating factors (CSFs), such as hE -3, have been administered alone, co-administered with other CSFs, or in combination with bone marrow transplants subsequent to high dose chemotherapy to treat neutropenia and thrombocytopenia, which are often the result of such treatment (Bacigalupo, Eur. J. Cancer 30:S26-S29 (1994), incorporated by reference in its entirety). The administration of CSFs, however, have not been sufficient to completely eliminate neutropenia and thrombocytopenia. The myeloid lineage, which is comprised of monocytes (macrophages), granulocytes (including neutrophils) and megakaryocytes, plays a role in preventing potentially life-threatening infections and bleeding. The hematopoietic growth factor of the present invention may be used in the treatment of diseases characterized by decreased levels of either myeloid, erythroid, lymphoid, or megakaryocyte cells, or a combination thereof, within the hematopoietic system. In addition, they may be used to activate mature myeloid and/or lymphoid cells. Conditions or diseases that can be treated or ameliorated by the hematopoietic growth factor of the present invention include, but are not limited to, leukopenia, neutropenia, aplastic anemia, cyclic neutropenia, idiopathic neutropenia, Chediak-Higashi syndrome, systemic lupus erythematosus (SLE), leukemia, myelodysplastic syndrome, myelofibrosis, and thrombocytopenia.

Leukopenia is a reduction in the number of circulating leukocytes (white blood cells) that has been reported to be induced by exposure to certain viruses or radiation. It is often a reported side effect of various forms of cancer therapy, e.g., exposure to chemotherapeutic drugs or radiation treatments, and of infection or hemorrhage. Therapeutic treatment of leukopenia with the hematopoietic stem cell growth factor of the present invention may avoid or ameliorate undesirable side effects caused by treatment with the various forms of cancer therapy.

The only reported therapy for thrombocytopenia is platelet transfusions, which are costly and carry the significant risks of infection (e.g., HIV, HBV, etc.) and alloimmunization. The hematopoietic stem cell growth factor of the present invention may alleviate or diminish the need for platelet transfusion.

The hematopoietic stem cell growth factor of the present invention may be used in the mobilization of hematopoietic progenitor and stem cells in peripheral blood. Peripheral blood derived progenitors have been reported to be effective in reconstituting patients who have undergone autologous bone marrow transplantation. The hematopoietic growth factors G-CSF and GM-CSF have been reported to enhance the number of circulating progenitor and stem cells in the peripheral blood. This has simplified the procedure for peripheral stem cell collection and decreased the cost of the procedure by decreasing the number of pheresis required. The hematopoietic stem cell growth factor of the present invention may be used in mobilizing stem cells and further enhancing the efficiency of peripheral stem cell transplantation.

One aspect of the present invention provides a method for selective ex vivo expansion of stem cells. The term "stem cell" refers to totipotent hematopoietic stem cells, as well as precursors and progenitor cells, which can be isolated from bone marrow, spleen, or peripheral blood. The term "expansion" refers to the differentiation and proliferation of the cells. The present invention provides a method for selective ex vivo expansion of stem cells comprising: (a) culturing isolated and purified stem cells with a selective media which contains a hematopoietic stem cell growth factor and (b) harvesting said stem cells.

Stem cells, as well as progenitor cells committed to becoming neutrophils, erythrocytes, platelets, etc. may be distinguished from most other cells by the presence or absence of particular progenitor marker antigens, such as CD34, that are present on the surface of these cells and/or by morphological characteristics. The phenotype for a highly enriched human stem cell population is reported as CD34⁺, CD38^" , Thy-1⁺' and lin^". It is to be understood that the present invention is not limited to this stem cell population.

CD34⁺ enriched human stem cells can be separated by a number of reported methods, including affinity columns or beads, magnetic beads or flow cytometry using antibodies directed to surface antigens such as CD34⁺. Further, physical separation methods such as counterflow elutriation may be used to enrich hematopoietic progenitor cells. CD34⁺ progenitors are reported to be heterogeneous, and may be divided into several sub-populations characterized by the presence or absence of co-expression of different lineage associated cell surface associated molecules. Very immature progenitor cells are not reported to express any reported lineage associated markers, such as HLA-DR or CD38, but they may express CD90 (thy-1). Other surface antigens such as CD33, CD38, CD41, CD71, HLA-DR, or c-kit can be used to selectively isolate hematopoietic progenitor cells. Cell surface antigens that are up-regulated in, or specifically expressed on, cancer cells have been reported (Greipp and Witzig, Curr. Opinion Oncol. 8:20-21 (1996), incorporated by reference in its entirety).

The separated cells can be incubated in selected medium in a culture flask, sterile bag, or in hollow fibers. Various colony stimulating factors may be utilized in order to selectively expand the cells. Factors which have been reported in the ex vivo expansion of bone marrow include, but are not limited to, GM-CSF, G-CSF, c- mpl ligand (also known as TPO or MGDF), M-CSF, erythropoietin (EPO), IL-1, IL- 4, IL-2, BL-3, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, 1L-15, IL-16, LIF, flt3 ligand, stem cell factor (SCF) also known as steel factor or c-kit ligand or combinations thereof.

Another aspect of the invention provides methods of sustaining and/or expanding hematopoietic precursor cells which include inoculating the cells into a culture vessel which contains a culture medium that has been conditioned by exposure to a stromal cell line especially HS-5 (WO 96/02662, Roecklein and Torok-Strob, Blood 85:997-1105, 1995) that has been supplemented with the hematopoietic stem cell growth factor of the present invention. Many drugs have been reported to cause bone marrow suppression or hematopoietic deficiencies. Examples of such drugs are AZT, DDI, alkylating agents and anti-metabolites used in chemotherapy, antibiotics such as chloramphenicol, penicillin, gancyclovir, daunomycin and sulfa drugs, phenothiazones, tranquilizers such as meprobamate, analgesics such as aminopyrine and dipyrone, anti-convulsants such as phenytoin or carbamazepine, antithyroids such as propylthiouracil and methimazole and diuretics. The hematopoietic stem cell growth factor of the present invention may be useful in preventing or treating the bone marrow suppression or hematopoietic deficiencies, which often occur in patients treated with these drugs.

Hematopoietic deficiencies may also occur as a result of viral, microbial, or parasitic infections and as a result of treatment for renal disease or renal failure, e.g., dialysis. The hematopoietic stem cell growth factor of the present invention may be useful in treating such hematopoietic deficiencies.

The treatment of hematopoietic deficiency may include administration of a pharmaceutical composition containing the hematopoietic stem cell growth factor to a patient. The hematopoietic stem cell growth factor of the present invention may also be useful for the activation and amplification of hematopoietic precursor cells by treating these cells in vitro with the hematopoietic stem cell growth factor proteins of the present invention prior to injecting the cells into a patient.

Various immunodeficiencies, e.g., in T and or B lymphocytes, or immune disorders, e.g., rheumatoid arthritis, may also be beneficially affected by treatment with the hematopoietic stem cell growth factor of the present invention.

Immunodeficiencies may be the result of viral infections, e.g., HTLVI, HTLVII, HTLNm, severe exposure to radiation, cancer therapy or the result of other medical treatment. The hematopoietic stem cell growth factor of the present invention may also be employed, alone or in combination with other colony stimulating factors, in the treatment of other blood cell deficiencies, including thrombocytopenia (platelet deficiency), or anemia. Other uses for these polypeptides are the in vivo and ex vivo treatment of patients recovering from bone marrow transplants, and in the development of monoclonal and polyclonal antibodies generated by standard methods for diagnostic or therapeutic use. Other aspects of the present invention are methods and therapeutic compositions for treating the conditions referred to above. Such compositions comprise a therapeutically effective amount of one or more of the hematopoietic stem cell growth factor of the present invention in a mixture with a pharmaceutically acceptable carrier. This composition can be administered either parenterally, intravenously or subcutaneously. When administered, the therapeutic composition for use in this invention is preferably in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such a parenterally acceptable protein solution, having due regard to pH, isotonicity, stability and the like, is within the skill of the art.

The dosage regimen involved in a method for treating the above-described conditions will be determined by the attending physician considering various factors which modify the action of drugs, e.g., the condition, body weight, sex and diet of the patient, the severity of any infection, time of administration and other clinical factors. Generally, a daily regimen may be in the range of 0.2 - 150 μg/kg of hematopoietic stem cell growth factor protein per kilogram of body weight. Preferably, the daily regimen is in the range of 0.2 - 100 μg/kg of hematopoietic stem cell growth factor protein per kilogram of body weight. More preferably, the daily regimen is in the range of 0.5 - 50 μg/kg and most preferably it is in the range of 0.5 - 10 μg/kg of hematopoietic stem cell growth factor protein per kilogram of body weight. Dosages would be adjusted relative to the activity of a given hematopoietic stem cell growth factor protein and it would not be unreasonable to note that dosage regimens may include doses as low as 0.1 microgram and as high as 1 milligram per kilogram of body weight per day. In addition, there may exist specific circumstances where dosages of hematopoietic stem cell growth factor would be adjusted higher or lower than the range of 0.2 - 150 micrograms per kilogram of body weight. These include co-administration with other colony stimulating factors of IL-3 variants or growth factors; co-administration with chemotherapeutic drugs and or radiation; the use of glycosylated hematopoietic stem cell growth factor protein; and various patient-related issues mentioned earlier in this section.

As indicated above, the therapeutic method and compositions may also include co-administration with other human factors. A non-exclusive list of other appropriate colony stimulating factors (CSFs), cytokines, lymphokines, hematopoietic growth factors and interleukins for simultaneous or serial co- administration with the polypeptides of the present invention includes GM-CSF, G- CSF, c-mpl ligand (also known as TPO or MGDF), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL-3, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, EL- 16, LIF, flt3 ligand, stem cell factor (SCF) also known as steel factor or c-kit ligand, or combinations thereof. The dosage recited above would be adjusted to compensate for such additional components in the therapeutic composition. Progress of the treated patient can be monitored by periodic assessment of the hematological profile, e.g., differential cell count and the like.

Under one embodiment, the nucleic acid molecules of the present invention are used as a surrogate marker to measure the effectiveness of a therapeutic composition for treating hematopoietic deficiencies. Alternatively, the nucleic acid molecules of the present invention can be used as a surrogate marker to measure the effect of a drug at causing hematopoietic deficiencies. Such measurements can be performed, for example, by measuring the presence, absence, or the level of expression of a nucleic acid molecule complementary to a nucleic acid molecule of the present invention.

EXAMPLES Having now generally described the invention, the same will be more readily understood through reference to the following examples, which are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified.

Example 1 The HS-5, HS-21, HS-22, HS-23, HS-27, HS-32 and HS-33 cells are separately frozen in liquid nitrogen and the mRNA is isolated using known RNA isolation methods. The isolated RNA is stored at -80°C until subsequent manipulation.

The stored RNA is purified using Trizol reagent from Life Technologies (Gaithersburg, Maryland), essentially as recommended by the manufacturer. Poly

A+ RNA (mRNA) is purified using magnetic oligo dT beads essentially as recommended by the manufacturer (Dynabeads, Dynal Corporation, Lake Success,

New York).

Construction of cDNA libraries is well known in the art and a number of cloning strategies exist. A number of cDNA library construction kits are commercially available. The PCR-Select Differential Screening Kit (CLONTECH Laboratories, Inc., Palo Alto, CA) is used, following the conditions suggested by the manufacturer.

Normalized libraries are made using essentially the Soares procedure (Soares et. al, Proc. Natl. Acad. Sci. (U.S.A.) 91: 9228-9232 (1994), the entirety of which is incorporated by reference). This approach is designed to reduce the initial 10,000- fold variation in individual cDNA frequencies to achieve abundances within one order of magnitude, while maintaining the overall sequence complexity of the library. In the normalization process, the prevalence of high-abundance cDNA clones decreases dramatically, clones with mid-level abundance are relatively unaffected, and clones for rare transcripts are effectively increased in abundance.

Example 2

Bacteria harboring the cDNA libraries are plated on LB agar containing the appropriate antibiotics for selection and incubated at 37°C for a sufficient time to allow the growth of individual colonies. Single colonies are individually placed in each well of a 96-well microtiter plates containing LB liquid including the selective antibiotics. The plates are incubated overnight at approximately 37°C with gentle shaking to promote growth of the cultures. The plasmid DNA is isolated from each clone using Qiaprep plasmid isolation kits, using the conditions recommended by the manufacturer (Qiagen Inc., Santa Clara, CA).

Template plasmid DNA clones are used for subsequent sequencing. ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq™ DNA Polymerase, FS, is used for sequencing, (PE Applied Biosystems, Foster City, CA). Example 3

DNA isolation and characterization

Plasmid DNA is isolated using the Promega Wizard™ Miniprep kit (Madison, WI), the Qiagen QIAwell Plasmid isolation kits (Chatsworth, GA) or Qiagen Plasmid Midi kit. These kits follow the same general procedure for plasmid DNA isolation. Briefly, cells are pelleted by centrifugation (5000 x g), plasmid DNA released with sequential NaOH/acid treatment, and cellular debris is removed by centrifugation (10000 x g). The supernatant (containing the plasmid DNA) is loaded onto a column containing a DNA-binding resin, the column is washed, and plasmid DNA eluted with TE. After screening for the colonies with the plasmid of interest, the E. coli cells are inoculated into 50-100 mis of LB plus appropriate antibiotic for overnight growth at 37°C in an air incubator while shaking. The purified plasmid DNA is used for DNA sequencing, further restriction enzyme digestion, additional subcloning of DNA fragments and transfection or transduction into mammalian, E. coli or other cells.

Sequence confirmation

Purified plasmid DNA is resuspended in dH O and quantitated by measuring the absorbance at 260/280 nm in a Bausch and Lomb Spectronic 601 UN spectrometer. DΝA samples are sequenced using ABI PRISM™ DyeDeoxy™ terminator sequencing chemistry (Applied Biosystems Division of Perkin Elmer Corporation, Lincoln City, CA) kits (Part Number 401388 or 402078) according to the manufacturers suggested protocol usually modified by the addition of 5% DMSO to the sequencing mixture. Sequencing reactions are performed in a Model 480 DNA thermal cycler (Perkin Elmer Corporation, Norwalk, CT) following the recommended amplification conditions. Samples are purified to remove excess dye terminators with Centri-Sep™ spin columns (Princeton Separations, Adelphia, NJ) and lyophilized. Fluorescent dye labeled sequencing reactions are resuspended in deionized formamide, and sequenced on denaturing 4.75% polyacrylamide-8M urea gels using an ABI Model 373 A automated DNA sequencer. Overlapping DNA sequence fragments are analyzed and assembled into master DNA contigs using Sequencher v3.0 DNA analysis software (Gene Codes Corporation, Ann Arbor, MI).

Expression of hematopoietic stem cell growth factor in mammalian cells

Mammalian Cell Transfection/Production of Conditioned Media

The BHK-21 cell line is obtained from the ATCC (Rockville, MD). The cells are cultured in Dulbecco's modified Eagle media (DMEM high-glucose), supplemented to 2 mM (mM) L-glutamine and 10% fetal bovine serum (FBS). This formulation is designated BHK growth media. Selective media is BHK growth media supplemented with 453 units/mL hygromycin B (Calbiochem, San Diego, CA). The BHK-21 cell line is stably transfected with the HSN transactivating protein NP16, which transactivates the IE110 promoter found on the plasmid pMOΝ3359 (See Hippenmeyer et al, Bio/Technology 11: 1037-1041 (1993), incorporated by reference in its entirety). The NP16 protein drives expression of genes inserted behind the IE110 promoter. BHK-21 cells expressing the transactivating protein NP16 are designated BHK-VP16. The plasmid pMOΝl 118 (See Highkin et al, Poultry Sci. 70:910-981 (1991), incorporated by reference in its entirety) expresses the hygromycin resistance gene from the SN40 promoter. A similar plasmid, available from ATCC, is pSN2-hph.

BHK-NP-16 cells are seeded into a 60 millimeter (mm) tissue culture dish at 3 x 10⁵ cells per dish 24 hours prior to transfection. Cells are transfected for 16 hours in 3 mL of OPTIMEM™ (Gibco-BRL, Gaithersburg, MD) containing 10 μg of plasmid DΝA containing the gene of interest, 3 μg hygromycin resistance plasmid, pMOΝl 118, and 80 ug of Gibco-BRL LIPOFECTAMIΝE™ per dish. The media is subsequently aspirated and replaced with 3 mL of growth media. At 48 hours post-transfection, media from each dish is collected and assayed for activity (transient conditioned media). The cells are removed from the dish by trypsin- EDTA, diluted 1:10 and transferred to 100 mm tissue culture dishes containing 10 mL of selective media. After approximately 7 days in selective media, resistant cells grow into colonies several millimeters in diameter. The colonies are removed from the dish with filter paper (cut to approximately the same size as the colonies and soaked in trypsin EDTA) and transferred to individual wells of a 24 wellplate containing 1 mL of selective media. After the clones are grown to confluence, the conditioned media is re-assayed, and positive clones are expanded into growth media.

Expression of hematopoietic stem cell growth factor in E. coli

E. coli strain MON105 or JM101 harboring the plasmid of interest are grown at 37°C in M9 plus casamino acids medium with shaking in an air incubator Model G25 from New Brunswick Scientific (Edison, New Jersey). Growth is monitored at OD₆oo until it reaches a value of 1.0 at which time Nalidixic acid (10 milligrams/mL) in 0.1 N NaOH is added to a final concentration of 50 μg/mL. The cultures are then shaken at 37°C for three to four additional hours. A high degree of aeration is maintained throughout culture period in order to achieve maximal production of the desired gene product. The cells are examined under a light microscope for the presence of inclusion bodies (IB). One mL aliquots of the culture are removed for analysis of protein content by boiling the pelleted cells, treating them with reducing buffer and electrophoresis via SDS-PAGE (see Maniatis et al, Molecular Cloning: A Laboratory Manual (1982)). The culture is centrifuged (5000 x g) to pellet the cells.

Inclusion Body Preparation, Extraction, Refolding, Dialysis, DEAE

Chromatography, and Characterization of the hematopoietic Stem Cell Growth Factor

Isolation of Inclusion Bodies:

The cell pellet from a 330 mL E. coli culture is resuspended in 15 mL of sonication buffer (10 mM 2-amino-2-(hydroxymethyl) 1,3-propanediol hydrochloride (Tris-HCl), pH 8.0 + 1 mM ethylenediaminetetraacetic acid (EDTA). These rounds of sonication in sonication buffer followed by centrifugation are employed to disrupt the cells and wash the inclusion bodies (IB). The first round of sonication is a 3 minute burst followed by a 1 minute burst, and the final two rounds of sonication are for 1 minute each.

Extraction and refolding of proteins from inclusion body pellets: Following the final centrifugation step, the IB pellet is resuspended in 10 mL of 50 mM Tris-HCl, pH 9.5, 8 M urea and 5 mM dithiothreitol (DTT) and stirred at room temperature for approximately 45 minutes to allow for denaturation of the expressed protein.

The extraction solution is transferred to a beaker containing 70 mL of 5 mM Tris-HCl, pH 9.5 and 2.3 M urea and gently stirred while exposed to air at 4°C for 18 to 48 hours to allow the proteins to refold. Refolding is monitored by analysis on a Vydac (Hesperia, Ca.) C18 reversed-phase-high pressure liquid chromatography (RP-HPLC) column (0.46x25 cm). A linear gradient of 40% to 65% acetonitrile, containing 0.15 trifluoracetic acid (TFA), is employed to monitor the refolding. This gradient is developed over 30 minutes at a flow rate of 1.5 mL per minute. Denatured proteins generally elute later in the gradient than the refolded proteins.

Purification:

Following the refold, contaminating E. coli proteins are removed by acid precipitation. The pH of the refold solution is titrated to between pH 5.0 and pH 5.2 using 15% (v/v) acetic acid (HO Ac). This solution is stirred at 4°C for 2 hours and then centrifuged for 20 minutes at 12,000 x g to pellet any insoluble protein.

The supernatant from the acid precipitation step is dialyzed using a Spectra Por 3 membrane with a molecular weight cut off (MWCO) of 3,500 daltons. The dialysis is against 2 changes of 4 liters (a 50-fold excess) of 10 mM Tris-HCl, pH 8.0 for a total of 18 hours. Dialysis lowers the sample conductivity and removes urea prior to DEAE chromatography. The sample is then centrifuged (20 minutes at 12,000 x g) to pellet any insoluble protein following dialysis.

A Bio-Rad Bio-Scale DEAE2 column (7 x 52 mm) is used for ion exchange chromatography. The column is equilibrated in a buffer containing 10 mM Tris- HCl, pH 8.0, and a 0-to-500 mM sodium chloride (NaCl) gradient, in equilibration buffer, over 45 column volumes is used to elute the protein. A flow rate of 1.0 mL per minute is used throughout the run. Column fractions (2.0 mL per fraction) are collected across the gradient and analyzed by RP-HPLC on a Vydac (Hesperia, Ca.) C18 column (0.46 x 25 cm). A linear gradient of 40% to 65% acetonitrile, containing 0.1% trifluoroacetic acid (TFA), is employed. This gradient is developed over 30 minutes at a flow rate of 1.5 mL per minute. Pooled fractions are then dialyzed against 2 changes of 4 liters (50-to-500-fold excess) of 10 mM ammonium acetate (NFL-Ac), pH 4.0 for a total of 18 hours. Dialysis is performed using a Spectra/Por 3 membrane with a MWCO of 3,500 daltons. Finally, the sample is sterile filtered using a 0.22μm syringe filter (μStar LB syringe filter, Costar, Cambridge, Ma.), and stored at 4°C.

In some cases, the folded proteins can be affinity purified using affinity reagents such as mAbs or receptor subunits attached to a suitable matrix. Alternatively, (or in addition) purification can be accomplished using any of a variety of chromatographic methods such as: ion exchange, gel filtration or hydrophobic chromatography or reversed phase HPLC.

These and other protein purification methods are described in detail in Deutgscher ed., Methods in Enzymology, Vol. 182 'Guide to Protein Purification' Academic Press, San Diego, CA (1990).

Protein Characterization:

The purified protein is analyzed by RP-HPLC, electrospray mass spectrometry, and SDS-PAGE. The protein quantitation is done by amino acid composition, RP-HPLC, and Bradford protein determination. In some cases tryptic peptide mapping is performed in conjunction with electrospray mass spectrometry to confirm the identity of the protein.

AML Proliferation Assay for Bioactive Human Interleukin-3

The factor-dependent cell line AML 193 is obtained from the American Type Culture Collection (ATCC, Rockville, MD). This cell line, established from a patient with acute myelogenous leukemia, is a growth factor-dependent cell line, which displayed enhanced growth in GM-CSF-supplemented medium (Lange et al, Blood 70:192 (1987); Valtieri et al, J. Immunol. 138:4042 (1987), both of which are incorporated by reference in their entirety). The ability of AML 193 cells to proliferate in the presence of human EL-3 has also been reported. (Santoli et al, J. Immunol. 739:348 (1987), incorporated by reference in its entirety). A cell line variant is used, AML 193 1.3, which is adapted for long term growth in IL-3 by washing out the growth factors and starving the cytokine dependent AML 193 cells for growth factors for 24 hours. The cells are then replated at lxlO⁵ cells/well in a 24 well plate in media containing 100 U/mL IL-3. It takes approximately 2 months for the cells to grow rapidly in IL-3. These cells are maintained as AML 193 1.3 thereafter by supplementing tissue culture medium with human IL-3.

AML 193 1.3 cells are washed 6 times in cold Hanks balanced salt solution (HBSS, Gibco, Grand Island, NY) by centrifuging cell suspensions at 250 x g for 10 minutes followed by decantation of the supernatant. Pelleted cells are resuspended in HBSS and the procedure is repeated until six wash cycles are completed. Cells washed six times by this procedure are resuspended in tissue culture medium at a density ranging from 2 x 10⁵ viable cells/mL. This medium is prepared by supplementing Iscove's modified Dulbecco's medium (IMDM, Hazelton, Lenexa, KS) with albumin, transferring, lipids and 2-mercaptoethanol. Bovine albumin (Boehringer-Mannheim, Indianapolis, IN) is added at 500 μg/mL; human transferrin (Boehringer-Mannheim, Indianapolis, IN) is added at 100 μg/mL; soybean lipid (Boehringer-Mannheim, Indianapolis, IN) is added at 50 μg/mL; and 2- mercaptoethanol (Sigma, St. Louis, MO) is added at 5 x 10^"5 M.

Serial dilutions of human interleukin-3 or hematopoietic stem cell growth factor proteins are made in triplicate series in tissue culture medium supplemented as stated above in 96 well Costar 3596 tissue culture plates. Each well contained 50 μl of medium containing interleukin-3 or hematopoietic stem cell growth factor proteins once serial dilutions are completed. Control wells contained tissue culture medium alone (negative control). AML 193 1.3 cell suspensions prepared as above are added to each well by pipetting 50 μl (2.5 x 10⁴ cells) into each well. Tissue culture plates are incubated at 37°C with 5% CO₂ in humidified air for 3 days. On day 3, 0.5 μCi ³H-thymidine (2 Ci/mM, New England Nuclear, Boston, MA) is added in 50 μl of tissue culture medium. Cultures are incubated at 37°C with 5% CO₂ in humidified air for 18-24 hours. Cellular DNA is harvested onto glass filter mats (Pharmacia LKB, Gaithersburg, MD) using a TOMTEC cell harvester (TOMTEC, Orange, CT), which utilized a water wash cycle followed by a 70% ethanol wash cycle. Filter mats are allowed to air dry and then placed into sample bags to which scintillation fluid (Scintiverse π, Fisher Scientific, St. Louis, MO or BetaPlate Scintillation fluid, Pharmacia LKB, Gaithersburg, MD) is added. Beta emissions of samples from individual tissue culture wells are counted in a LKB BetaPlate model 1205 scintillation counter (Pharmacia LKB, Gaithersburg, MD) and data is expressed as counts per minute of ³H-thymidine incorporated into cells from each tissue culture well. Activity of each human interleukin-3 preparation or hematopoietic stem cell growth factor protein preparation is quantitated by measuring cell proliferation (³H-thymidien incorporation) induced by grated concentrations of interleukin-3 or hematopoietic stem cell growth factor. Typically, concentration ranges from 0.05 pM -10⁵ pM are quantitated in these assays.

Activity is determined by measuring the dose of interleukin-3 or hematopoietic stem cell growth factor protein which provides 50% of maximal proliferation (EC₅₀ = 0.5 x (maximum average counts per minute of ³H-thymidine incorporated per well among triplicate cultures of all concentrations of interleukin-3 tested - background proliferation measured by H-thymidine incorporation observed in triplicate cultures lacking interleukin-3). This EC₅₀ value is also equivalent to 1 unit of bioactivity. Every assay is performed with native interleukin-3 as a reference standard so that relative activity levels could be assigned.

Typically, the hematopoietic stem cell growth factor proteins are tested in a concentration range of 2000 pM to 0.06 pM titrated in serial 2 fold dilutions.

Activity for each sample is determined by the concentration that gave 50% of the maximal response by fitting a four-parameter logistic model to the data. It is observed that the upper plateau (maximal response) for the sample and the standard with which it is compared did not differ. Therefore relative potency calculation for each sample is determined from EC50 estimations for the sample and the standard as indicated above. AML 193.1.3 cells proliferate in response to hIL-3, hGM-CSF, and hG-CSF. Therefore the following additional assays are performed for some samples to demonstrate that the G-CSF receptor agonist proteins are active. The proliferation assay is performed with the hematopoietic stem cell growth factor plus and minus neutralizing monoclonal antibodies.

TFI c-mpl ligand dependent proliferation assay The c-mpl ligand proliferative activity can be assayed using a subclone of the pluripotential human cell line TFI (Kitamura et al., /. Cell Physiol 140:323-334. [1989]). TFI cells are maintained in h-IL3 (100 U/mL). To establish a sub-clone responsive to c-mpl ligand, cells are maintained in passage media containing 10% supernatant from BHK cells transfected with the gene expressing the 1-153 form of c-mpl ligand (pMON26448). Most the cells die, but a subset of cells survive. After dilution cloning, a c-mpl ligand responsive clone is selected, and these cells are split into passage media to a density of 0.3 x 10⁶ cells/mL the day prior to assay set-up. Passage media for these cells is the following: RPMI 1640 (Gibco), 10% FBS (Harlan, Lot #91206), 10% c-mpl ligand supernatant from transfected BHK cells, 1 mM sodium pyruvate (Gibco), 2 mM glutamine (Gibco), and 100 μg/mL penicillin- streptomycin (Gibco). The next day, cells are harvested and washed twice in RPMI or IMDM media with a final wash in the ATL, or assay media. ATL medium consists of the following: IMDM (Gibco), 500 μg/mL of bovine serum albumin, 100 ug/mL of human transferrin, 50 ug/mL soybean lipids, 4 x 10^"8 M beta- mercaptoethanol and 2 mL of A9909 (sigma, antibiotic solution) per 1000 mL of ATL. Cells are diluted in assay media to a final density of 0.25 x 10⁶ cells/mL in a 96-well low evaporation plate (Costar) to a final volume of 50 ul. Transient supernatants (conditioned media) from transfected clones are added at a volume of 50 ul as duplicate samples at a final concentration of 50% and diluted three-fold to a final dilution of 1.8%. Triplicate samples of a dose curve of IL-3 variant pMON13288 starting at 1 ng/mL and diluted using three-fold dilutions to 0.0014ng/mL is included as a positive control. Plates are incubated at 5% CO₂ and 37°C. At day six of culture, the plate is pulsed with 0.5 μCi of 3μl/well (NEN) in a volume of 20 μl/well and allowed to incubate at 5% CO₂ and 37°C for four hours. The plate is harvested and counted on a Betaplate counter. MUTZ-2 cell line proliferation assay

MUTZ-2 cells are seeded at 2.5xl0⁴ cells per well in microwell plates (Costar) with or without cytokines in serum-free IMDM containing bovine serum albumin (500 mg/ml), human transferrin (100 mg/ml), soybean lipids (50 mg/ml; Boehringer Manheim) and 2-mercaptoethanol (50 mM). After 60 hours, cells are incubated with [methyl-³H] thymidine (New England Nuclear) at 0.5 mCi (18.5 kBq) per well for 6 hours and then can be harvested onto a glass fiber filter mat for measurement of radioactivity with a beta counter (Pharmacia LKB).

Other in vitro cell based proliferation assays

Other in vitro cell based assays, known to those skilled in the art, may also be useful to determine the activity of the hematopoietic stem cell growth factor depending on the factors that comprise the molecule in a similar manner as described in the AML 193.1.3 cell proliferation assay. The following are examples of other useful assays.

TFI proliferation assay: TFI is a pluripotential human cell line (Kitamura et al, J. Cell Physiol 140:323-334 (1989), incorporated by reference in its entirety) that responds to hIL-3.

32D proliferation assay: 32D is a murine IL-3 dependent cell line which does not respond to human IL-3 but does respond to human G-CSF which is not species restricted.

Baf/3 proliferation assay: Baf/3 is a murine IL-3 dependent cell line which does not respond to human IL-3 or human c-mpl ligand but does respond to human G-CSF which is not species restricted.

T1165 proliferation assay: T1165 cells are a IL-6 dependent murine cell line

(Nordan et al, Science 233: 566-569 (1986), incorporated by reference in its entirety), which respond to IL-6 and IL-11. Human Plasma Clot meg-CSF Assay: Used to assay megakaryocyte colony formation activity (Mazur et al., J. Clin. Invest. 68: 733-741 (1981, incorporated by reference in its entirety).

Transfected cell lines: Cell lines such as the murine Baf/3 cell line can be transfected with a colony stimulating factor receptor, such as the human G-CSF receptor or human c-mpl receptor, which the cell line does not have. These transfected cell lines can be used to determine the activity of the ligand for which the receptor has been transfected into the cell line. One such transfected Baf/3 cell line was made by cloning the cDNA encoding c-mpl from a library made from a c-mpl responsive cell line and cloned into the multiple cloning site of the plasmid pcDNA3 (Invitrogen, San Diego, Ca.). Baf/3 cells are transfected with the plasmid via electroporation. The cells are grown under G418 selection in the presence of mouse IL-3 in Wehi-conditioned media. Clones are established through limiting dilution.

In a similar manner the human G-CSF receptor can be transfected into the Baf/3 cell line and used to determine the bioactivity of the hematopoietic stem cell growth factor.

Analysis of c-mpl ligand proliferative activity

Methods

1. Bone marrow proliferation assay

a. CD34⁺ Cell Purification

Bone marrow aspirates (15-20 mL) are obtained from normal allogeneic marrow donors after informed consent. Cells are diluted 1:3 in phosphate buffered saline (PBS, Gibco-BRL), 30 mL are layered over 15 mL Histopaque-1077 (Sigma) and centrifuged for 30 minutes at 300 xs. The mononuclear interface layer is collected and washed in PBS. CD34⁺ cells are enriched from the mononuclear cell preparation using an affinity column per manufacturer's instructions (CellPro, Lie, Bothell WA). After enrichment, the purity of CD34⁺ cells is 70% on average as determined by using flow cytometric analysis using anti-CD34 monoclonal antibody conjugated to fluorescein and anti-CD38 conjugated to phycoerythrin (Becton Dickinson, San Jose CA).

Cells are resuspended at 40,000 cells/mL in X-Vivo 10 media (Bio- Whittaker, Walkersville, MD) and 1 mL is plated in 12-well tissue culture plates (Costar). The growth factor rhIL-3 is added at 100 ng/mL (pMON5873) into some wells. HEL3 variants are used at 10 ng/mL to 100 ng/mL. Conditioned media from BHK cells transfected with plasmid encoding c-mpl ligand or hematopoietic stem cell growth factor are tested by addition of 100 μl of supernatant added to 1 mL cultures (approximately a 10% dilution). Cells are incubated at 37°C for 8-14 days at 5% CO₂ in a 37°C humidified incubator.

b. Cell Harvest and Analysis:

At the end of the culture period a total cell count is obtained for each condition. For fluorescence analysis and ploidy determination cells were washed in megakaryocyte buffer (MK buffer, 13.6 mM sodium citrate, 1 mM theophylline, 2.2 μm PGE1, 11 mM glucose, 3% w/v BSA, in PBS pH 7.4,) (Tomer et al, Blood 70:1735-1742 (1987), incorporated by reference in its entirety) resuspended in 500 μl of MK buffer containing anti-CD41a FTTC antibody (1:200, AMAC, Westbrook, ME) and washed in MK buffer. For DNA analysis cells are permeablized in MK buffer containing 0.5% TWEEN 20 (Fisher, Fair Lawn, NJ) for 20 min. on ice followed by fixation in 0.5% Tween-20 and 1% paraformaldehyde (Fisher Chemical) for 30 minutes followed by incubation in propidium iodide (Calbiochem, La Jolla Ca) (50 μg/mL) with RNase (400 U/mL) in 55% v/v MK buffer (200 mOsm) for 1-2 hours on ice. Cells are analyzed on a FACScan or Vantage flow cytometer (Becton Dickinson, San Jose, CA). Green fluorescence (CD41a-FTTC) is collected along with linear and log signals for red fluorescence (PI) to determine DNA ploidy. All cells were collected to determine the percent of cells that were CD41+. Data analysis is performed using software by LYSIS (Becton Dickinson, San Jose, CA). Percent of cells expressing the CD41 antigen is obtained from flow cytometry analysis (Percent). Absolute (Abs) number of CD41⁺ cells/mL is calculated by: (Abs) = (Cell Count) * (PercentVlOO. 2. Megakaryocyte fibrin clot assay.

CD34⁺ enriched population is isolated as described above. Cells are suspended at 25,000 cells/mL with or without cytokine(s) in a media consisting of a base Iscoves IMDM media supplemented with 0.3% BSA, 0.4mg/mL apo- transferring, 6.67 μM FeCl₂, 25 μg/mL L-asparagine, 500 μg/mL -amino-n- caproic acid and penicillin/streptomycin. Prior to plating into 35 mm plates, thrombin is added (0.25 Units/mL) to initiate clot formation. Cells are incubated at 37°C for 13 days at 5% CO₂ in a 37°C humidified incubator.

At the end of the culture period plates are fixed with methanol: acetone (1:3), air-dried and stored at -20°C until staining. A peroxidase immunocytochemistry staining procedure is used (Zymed, Histostain-SP. San Francisco, CA) using a cocktail of primary monoclonal antibodies consisting of anti-CD41a, CD42 and CD61. Colonies are counted after staining and classified as negative, CFU-MK (small colonies, 1-2 foci and less that approx. 25 cells), BFU-MK (large, multi-foci colonies with > 25 cells) or mixed colonies (mixture of both positive and negative cells.

Methylcellulose Assay

This assay reflects the ability of colony stimulating factors to stimulate normal bone marrow cells to produce different types of hematopoietic colonies in vitro (Bradley et al, Aust. Exp. Biol Sci. 44:287-300 (1966), Pluznik et al, J. Cell Comp. Physiol 66:319-324 (1965), both of which are incorporated by reference in their entirety). Methods

Approximately 30 mL of fresh, normal, healthy bone marrow aspirate are obtained from individuals following informed consent. Under sterile conditions samples are diluted 1:5 with a IX PBS (#14040.059 Life Technologies, Gaithersburg, MD.) solution in a 50 mL conical tube (#25339-50 Corning, Corning MD). Ficoll (Histopaque 1077 Sigma H-8889) is layered under the diluted sample and centrifuged, 300 x g for 30 min. The mononuclear cell band is removed and washed two times in IX PBS and once with 1% BSA PBS (CellPro Co., Bothel,

Wa). Mononuclear cells are counted and CD34⁺ cells are selected using the Ceprate LC (CD34) Kit (CellPro Co., Bothel, WA) column. This fractionation is performed since all stem and progenitor cells within the bone marrow display CD34 surface antigen.

Cultures are set up in triplicate with a final volume of 1.0 mL in a 35 x 10 mm Petri dish (Nunc# 174926). Culture medium is purchased from Terry Fox Labs. (HCC-4230 medium (Terry Fox Labs, Vancouver, B.C., Canada) and erythropoietin (Amgen, Thousand Oaks, CA.) is added to the culture media. 3,000-10,000 CD34⁺ cells are added per dish. Recombinant IL-3, purified from mammalian cells for E. coli, and hematopoietic growth factor proteins, in conditioned media from transfected mammalian cells or purified from conditioned media from transfected mammalian cells or E. coli, are added to give final concentrations ranging from 0.001 nM to 10 nM. Recombinant hIL-3, GM-CSF, c-mpl ligand and hematopoietic stem cell growth factor are supplied Monsanto. G-CSF (Neupogen) is from Amgen (Thousand Oaks Calf.). Cultures are resuspended using a 3 cc syringe and 1.0 mL is dispensed per dish. Control (baseline response) cultures received no colony stimulating factors. Positive control cultures receive conditioned media (PHA stimulated human cells: Terry Fox Lab. H2400). Cultures are incubated at 37°C, 5% CO₂ in humidified air. Hematopoietic colonies that are defined as greater than 50 cells are counted on the day of peak response (days 10-11) using a Nikon inverted phase microscope with a 40x objective combination. Groups of cells containing fewer than 50 cells are referred to as clusters. Alternatively colonies can be identified by spreading the colonies on a slide and stained or they can be picked, resuspended, and spun onto cytospin slides for staining.

AS-Ε2 Cell Proliferation Assay

The factor-dependent cell line AS-E2 cell line, established from a patient with acute myeloid leukemia, is a growth factor dependent cell line which displayed enhanced growth in erythropoietin (EPO)-supplemented media (Miyazaki, Y., Kuriyama, K., Higuchi, M., Tsushima, H., Sohda, H., Imai, N., Saito, M., Kondo, T., and Tomonaga, M. Establishment and characterization of a new erythropoietin- dependent acute myeloid leukemia cell line, AS-E2. Leukemia, ll;1941-9, 1997). This cell line also demonstrated enhanced proliferation in response to HS-5 CM and was used to measure HS-5 induced growth.

AS-E2 cells were maintained at a density of 1 x 10⁵ to 5 x 10⁵ cells/ml in tissue culture medium prepared by IMDM with 20% fetal bovine serum (FBS, Harlan, Indianapolis, IN), 4 ml/liter of 2-mercaptoethanol (Sigma, St. Louis, MO), and 1 unit/ml EPO (Epogen, Amgen, Thousand Oaks, CA or Procrit, Ortho Biotech, Raritan, NJ). Every 3 months the AS-E2 cell cultures were replaced by new cultures initiated from frozen stocks.

For cell proliferation assays, AS-E2 cells in culture media were harvested by centrifuging the cell suspensions at 250 x g for 5 minutes. Cells were washed twice in cold Dulbecco's phosphate-buffered saline by resuspension and centrifugation as above. The final cell pellet was resuspended in assay media at a density for 1 x 10⁴ to 5 x 10⁴ viable cells/50 ml. The assay medium was prepared by supplementing Iscove's modified Dulbecco's Medium (IMDM, Gibco/BRL, Grand Island, NY) with 20% fetal bovine serum (FBS, Harlan, Indianapolis, IN), 4 ml/liter of 2- mercaptoethanol (Sigma, St. Louis, MO), and 1 ml/liter of penicillin/ streptomycin solution (10,000 units penicillin/ml and 10 mg streptomycin per ml of normal saline, Sigma, St. Louis, MO).

Human Cord Blood Hematopoietic Growth Factor Assays

Bone marrow cells are traditionally used for in vitro assays of hematopoietic colony stimulating factor (CSF) activity. However, human bone marrow is not always available, and there is considerable variability between donors. Umbilical cord blood is comparable to bone marrow as a source of hematopoietic stem cells and progenitors (Broxmeyer et al, Proc. Natl. Acad. Sci. (U.S.A.) §9:4109-113 (1992); Mayani et al, Blood §7:3242-3258 (1993), both of which are incorporated by reference in their entirety). In contrast to bone marrow, cord blood is more readily available on a regular basis. There is also a potential to reduce assay variability by pooling cells obtained fresh from several donors, or to create a bank of cryopreserved cells for this purpose. By modifying the culture conditions, and/or analyzing for lineage specific markers, it is possible to assay specifically for granulocyte/macrophage colonies (CFU-GM), for megakaryocyte CSF activity, or for high proliferative potential colony forming cell (HPP-CFC) activity.

Methods Mononuclear cells (MNC) are isolated from cord blood within 24 hr. of collection, using a standard density gradient (1.077 g/mL Histopaque). Cord blood MNC is further enriched for stem cells and progenitors by several procedures, including immunomagnetic selection for CD14^"CD34⁺ cells; panning for SBA-, CD34⁺ fraction using coated flasks from Applied Immune Science (Santa Clara, CA); and CD34⁺ selection using a CellPro (Bothell, WA) avidin column. Either freshly isolated or cryopreserved CD34⁺ cell enriched fractions are used for the assay. Duplicate cultures for each serial dilution of sample (concentration range from 1 pM to 1204 pM) are prepared with lxlO⁴ cells in 1 ml of 0.9% methycellulose containing medium without additional growth factors (Methocult H4230 from Stem Cell Technologies, Vancouver, BC). In some experiments, Methocult H4330 containing erythropoietin (EPO) is used instead of Methocult H4230, or Stem Cell Factor (SCF), 50 ng/mL (Biosource International, Camarillo, CA) is added. After culturing for 7-9 days, colonies containing >30 cells are counted. In order to rule out subjective bias in scoring, assays are scored blind. Additional details about recombinant DNA methods which may be used to create the variants, express them in bacteria, mammalian cells or insect cells, purification and refold of the desired proteins and assays for determining the bioactivity of the proteins may be found in WO 95/00646, WO 94/12639, WO 94/12638, WO 95/20976, WO 95/21197, WO 95/20977, and WO 95/21254 which are hereby incorporated by reference in their entirety.

Further details known to those skilled in the art may be found in Maniatis et al, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, (1982); and in Sambrook et al, Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, (1989).

Example 4 Generation of cDNA libraries

HS-5 cells were maintained in RPMI medium. 175cm flasks were obtained, with approximately lxlO⁷ HS-5 cells per flask. The cells were trypsinized and washed once in lx PBS followed by resuspension in 12 ml of TRIzol reagent (Life

Technologies). The expressed sequence tags were obtained by preparing RNA from HS5 cells. Seventeen RNA was prepared using the standard protocol provided by the manufacturer (Life Technologies) with some modifications:

1. cells were lysed in TRIzol for 30 minutes at room temperature 2. RNA was precipitated and stored at -20C for nine days

3. A second TRIzol treatment of the RNA was used to remove residual contaminants. The protocol yielded 1.5 mg of total RNA.

The total RNA was split into two identical aliquots for purification via a poly\A+ mRNA selection procedure. Mini-oligo dT cellulose spin columns

(5prime- 3prime Inc.) were used to isolate the polyA+ mRNA using the standard kit protocol specified by the manufacturer except poly A+ mRNA was twice selected by repeat passage on the oligo dT cellulose column. The yield from the protocol was 44 ug polyA+ mRNA. Libraries were constructed from the mRNA using Superscript™ Plasmid

System for cDNA Synthesis and Plasmid Cloning (Life Technologies). The cDNA was synthesized from 3.5 ug polyA+. The library was prepared essentially according to the manufacturer's protocol with the following changes;

1. First strand synthesis for 60 minutes at 42C. Then, 1 ul Superscript II was added and the reaction was incubated at 50C for 20 minutes.

2. T4 DNA ligase and Notl reactions were carried out using Boehringer Mannheim reagents.

3. cDNA was size-fractionated via 0.8% low melt SeaPlaque GTG agarose (FMC) gel in lx TAE (Manitatis et al.) at 4C 4. Following the completion of the second strand synthesis, the Sail adapter ligation, the Notl digestion and the size-fractionation, the cDNA was purified using GeneClean II (BIO 101) with two 10 ul elutions in water (65C).

The resulting cDNA was size fractionated and two separate pools were collected, 0.5-2.3k bp range and the 2.3k-7k bp range. The collection of cloned cDNA's was collectively referred to as library HS5. The library was transformed into E. coli and individual colonies were randomly selected for sequencing. Libraries designated HS5R, HS5RODI, HS5RODI3, AND HS5RODI13 were prepared in a similar manner.

Subtractive library

Twice selected polyA+ mRNA was isolated from negative HS cell lines using the standard protocol for Poly (A) Pure kits (Cat # 1915) from Ambion (Austin, TX) . The subtracted libraries were constructed using Clontech's (Palo Alto, CA) PCR- Select cDNA Subtraction Kit (cat #K1804-1). HS5 mRNA served as "tester" and HS27 mRNA, a negative sister cell line, as "driver." After cDNA subtraction, the PCR amplified library's cDNA was ligated into the vector pCR2.1 from Invitrogen (Carlsbad, CA). The resulting library was designated HS527A and characterized by standard methods. The libraries designated LEB32, and LIB33 were prepared in a similar manner using the cell lines HS32, and HS33, respectively, as the negative cell line. The library HS5POOL was prepared in a similar manner using cell lines HS21, HS22, and HS27 together as the negative cell lines. The library HS552122 was prepared in a similar manner using cell lines HS21 and HS22, together as the negative cell lines.

Example 5

Identification of HS-5 EST Candidates

HS5 Select

In the first method, all known growth factor sequences are extracted from a suitable database, such as the SwissProt database, using keyword searches and/or manual examination. The HS-5 ESTs are searched against the collection of known growth factors by TBLASTN, which searches a protein query against a DNA database by translating each database entry into all 6-reading frames. Alternatively, the HS-5 ESTs are searched against the collection of known growth factors by BLASTX, which translates a DNA query into putative peptides. There are five implementations of BLAST, three designed for nucleotide sequences queries (BLASTN, BLASTX, and TBLASTX) and two designed for protein sequence queries (BLASTP and TBLASTN) (Coulson, Trends in Biotechnology 12: 76-80 (1994); Birren et al, Genome Analysis 1: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 543-559 (1997), both of which are incorporated by reference in their entirety). BLASTN takes a nucleotide sequence (the query sequence) and its reverse complement and searches them against a nucleotide sequence database. BLASTX takes a nucleotide sequence, translates it in three forward reading frames and three reverse complement reading frames, and then compares the six translations against a protein sequence database. BLASTX is useful for sensitive analysis of preliminary (single-pass) sequence data and is tolerant of sequencing errors (Gish and States, Nature Genetics 3: 266-272 (1993), the entirety of which is herein incorporated by reference). BLASTN and BLASTX may be used in concert for analyzing EST data (Coulson, Trends in Biotechnology 12: 76-80 (1994); Birren et al, Genome Analysis 1: 543-559 (1997)). The putative peptides are then searched against a suitable protein database.

In this method, matches found with BLASTX values = 0.001 (probability) or a BLAST Score of = 90 are classified as hits.

In the second method, BLASTN searches are performed against the GenBank nonredundant nucleic acids database and BLASTX searches are performed against the GenBank nomedundant protein database. Since TBLASTN and BLASTX search the HS-5 database as putative protein translations, ESTs from untranslated regions of a mRNA (e.g., 5' UTR and 3' UTR) can be missed or misclassified due to nonsense peptide translations. The BLASTN search is designed to reduce the misclassification of ESTs due to nonsense peptide translations. TBLASTN searches can result in misclassification because of common features shared between growth factor and non-growth factor proteins. The BLASTX search is designed to reduce the misclassification of non-growth factor sequences as growth factor sequences because of common (and/or extraneous) features. Matches found with BLASTX or BLASTN with values = 0.0001 (probability) for nucleic acid or protein sequences known to be growth factors or associated with growth factor binding, signal transduction or proliferation are classified as hits. Under the third method, the hidden Markov model (or HMMER) is used to detect more distant sequence similarities between the HS-5 candidates and known growth factor families (see Barrett et al, Comput. Appl. Biosci. 13: 191-199 (1997); McClure et al, Ismb. 4: 155-164 (1996), both of which are incorporated by reference in their entirety). Under this method, hidden Markov models of known growth factor families are used to search for growth factor-like sequences in the HS- 5 EST translations. Hits with a score =5 are considered to be positive for growth factor sequence similarity. Where the HMMSW program (which is based on a hidden Markov model constructed to detect a specific gene family) is used, a HMMSW score = 10 is classified as a hit. Because the putative HS-5 growth factor activity is present in HS-5 conditioned medium, the putative HS-5 growth factor is expected to be synthesized in the secretory pathway in the cell. Secreted proteins (which includes essentially all growth factors and growth factor receptors) share a leader sequence in the N- terminus called a signal peptide. Therefore, another method for identifying positive HS-5 ESTs encoding for the putative HS-5 growth factor is to identify HS-5 ESTs encoding for signal peptides. Two methods are employed for the identification of HS-5 ESTs encoding for signal peptides.

Novel Secreted HS5 (Indirect) Under the indirect method, putative HS-5 growth factor ESTs identified using the database search methods are analyzed using SignalP, a neural network- based algorithm, to determine whether the ESTs encode for a signal peptide. Default parameters are used. If the scores for max. Y, max. S, and mean S are all above the cutoff (set by SignalP), a positive prediction is made.

Novel Secreted HS5 (Direct) Under the direct method, sequences that did not receive any hits during the sequence database searches are analyzed using a two-step procedure. First, the GeneMark program is used to predict the coding regions of the EST sequences. The GeneMark program is a computer algorithm that identified characteristic features of nucleic acid sequences (see Isono et al, DNA Res. 7: 263-269 (1994); Mclninch et al. smb. 4: 165-175 (1996); Lukashin et al, Nucleic Acids Res. 26: 1107-1115 (1998), all of which are incorporated by reference in their entirety). Specifically, the GeneMark algorithm can be used to predict the exact boundaries of a gene. Coding regions are designated as those with a cutoff of P>0.5. Second, the coding regions identified by the GeneMark algorithm are characterized by the SignalP program. If the scores for max. Y, max. S, and mean S are all above the cutoff (set by SignalP), a positive prediction is made.

Example 6 Nucleic acid sequences that encode proteins that are secreted from the HS5 cell line are identified by comparing to secreted protein sequences in the SwissProt database. Sequence comparisons between the SwissProt database and the HS-5 EST's are made with BLASTX, which translates the EST query in the six reading frames and compares the resultant six peptide sequences against the protein sequences in the boutique library. Matches found with BLASTX values equal or less than 0.001 (probability) or a BLAST Score of equal or greater than 90 are further classified by their annotation. SwissProt annotation contains a specific field labeled "Secreted" to designate a polypeptide that is known to be a secreted protein. The annotation of SwissProt matches is parsed to reveal whether the SwissProt match is a secreted protein. If an HS5 EST matched a SwissProt entry that is a secreted protein, the EST is classified as a hit.

Example 7

Northern Blot Analysis of HS-5 ESTs Northern analysis was performed on 12 ESTs of interest from the HS-5 cDNA library to determine the full-length transcript size. Twice selected poly-A+ mRNA was prepared from HS-5 cells using the standard protocol for the Mini-Oligo (dT) Cellulose Spin Column Kit from 5 Prime - 3 Prime, Inc. Approximately one microgram HS-5 mRNA in denaturing buffer was electrophoresed per lane in a non- denaturing 1.25% agarose gel in IX MOPS buffer (FMC BioProducts.) The gels also included RNA Ladder (Gibco BRL/Life Technologies) at five micrograms per well to provide size estimate. All samples were heat denatured before loading. The RNA gels were run in IX MOPS buffer at approximately 3.5volts/cm gel length for two hours. Gels were washed for five minutes in deionized RNase free water. The portions of the gels containing the standards were removed for ethidium bromide staining and subsequent size calibration. One lane from Gel#l containing HS-5 mRNA was also removed for ethidium bromide staining to visualize the mRNA. The remaining portion of the gels was prepared for capillary transfer to nylon membranes. The gels were first soaked for 20 minutes in 0.05M sodium hydroxide. They were then soaked three times at 15 minutes each in 20X SSC buffer. Positively charged nylon was prepared by wetting first in deionized RNase free water followed by ten minutes in 20X SSC buffer. The capillary transfer was assembled in a standard manner (Molecular Cloning, A Laboratory Manual; Sambrook, et al.) using 20X SSC buffer. The transfer was allowed to proceed approximately 16 hours at room temperature. Upon completion of capillary transfer, the mRNA was irreversibly UV crosslinked to the nylon membrane. The nylon was cut into sections to provide one lane of HS-5 RNA per section. The nylon sections were hybridized individually with nonradioactive digoxigenin- labeled PCR products specific to the genes of interest. Probes were generated by standard protocol using purified plasmid DNA of each gene of interest as template, gene specific oligonucleotides, and PCR DIG Probe Synthesis Kit from Boehringer Mannheim. Membrane sections were incubated separately for one hour in DIG Easy Hyb Buffer (Boehringer Mannheim) at 50 degrees Celsius. Probes were heat denatured and utilized at two micrograms per milliliter, ten milliliters total volume DIG Easy Hybridization Buffer. Probe solution was added after the removal of prehybridization buffer. Incubation of probe and nylon was a minimum of 16 hours at 50 degrees Celsius with agitation. Sections were washed and developed per the DIG Wash Kit protocol, Boehringer Mannheim. Once autoradiographs were available, size correlations were drawn between the ethidium bromide stained RNA standards and the bands visible on the films. Figure 1 represents northern blot analysis of 12 EST clones and the asterisks in the figure represent the hybridization signal. The names of the clones are shown below each lane. The position of the size markers is shown by numbers and dashed lines. The size of the transcript was determined by extrapolation from a standard curve generated using the RNA marker.

Example 8

Preparation of HS-5 Conditioned Medium (CM)

HS-5 cells were cultured in RPMI + 5% fetal calf serum (FCS, Harlan, Indianapolis, IN) + IX penicillin/ streptomycin solution (Gibco/BRL, Grand Island, NY) at 37°C, at 5% CO₂ in a humidified incubator until the cells were 80% confluent. The culture media was then replaced by Iscove's modified Dulbecco's Medium (IMDM, Gibco/BRL, Grand Island, NY) and incubated for 3-4 days. The culture supernatant was removed and filtered through 0.22μ filter. The filtrate was used as the HS-5 conditioned medium.

The CM was characterized by ELIS A to determine the presence of some of the known cytokines in the CM. The concentrations of various cytokines were as follows:

Stem Cell Factor (SCF) 0.3 ng/ml

Interleukin-lβ 2.0 ng/ml

Granulocyte colony-stimulating factor (G-CSF) 259 ng ml Macrophage colony-stimulating factor (M-CSF) 8.2 ng/ml

GM-CSF 10 ng/ml

IL-6 739 ng/ml The following cytokines were not present at detectable levels by ELIS A: IL-3, DL-4, IL-10, c-mpl-ligand, flt3-ligand, and erythropoietin (EPO)

Example 9

AS-E2 Cell Proliferation Assay for Bioactive Factors in HS-5 Conditioned Media

The factor-dependent cell line AS-E2 cell line, established from a patient with acute myeloid leukemia, is a growth factor dependent cell line, which displayed enhanced growth in erythropoietin (EPO)-supplemented media (Miyazaki et al., 1997). This cell line also demonstrated enhanced proliferation in response to HS-5 CM and was used to measure HS-5 induced growth.

Although Miyazaki, et al., reported that AS-E2 cell proliferation is not enhanced by other growth factors including stem cell factor at 10 ng/ml, our data demonstrate the ability of AS-E2 cells to proliferate in the presence of SCF (EC₅₀ < 10 ng/ml) (Figure 3) . The proliferation induced by SCF can be abrogated by neutralizing antibodies to SCF (R & D Systems, Minneapolis, MN).

Serial dilutions of HS-5 conditioned media (CM) or chromatographic fractions obtained from HS-5 CM were aliquoted in triplicate in assay media in tissue culture plates with low evaporation lids (Costar 3072, Becton Dickinson, Franklin Lakes, NJ). Each well contained 50 ml of media containing HS-5 CM or an HS-5 CM column fraction once the dilutions were completed. Negative control wells contained tissue culture media alone. Positive control wells contained either HS-5 conditioned media, EPO, or SCF. Fifty microliters of the AS-E2 cell suspensions prepared as described above were added to each well to yield a final volume of 100 ml. Tissue culture plates were incubated for 3 days at 37°C with 5% CO2 in humidified air. On the third day, 0.5 mCi of ³H-thymidine (2 Ci/mM, New England Nuclear, Boston, MA) was added in 50 ml of assay media. Cultures were incubated overnight (18 to 24 his.) at 37°C with 5% CO₂ in humidified air. Cellular DNA was harvested onto glass fiber filter mats (Pharmacia, LKB, Gaithersburg, MD) using a TOMTEC cell harvester (TOMTEC, Orange, CT), which utilized a water wash cycle followed by a 70% ethanol wash cycle. Filter mats were dried at 37°C, placed in sealable plastic pouches, and 10 ml. of scintillation fluid (BetaPlate Scintillation Fluid, Pharmacia LKB, Gaithersburg, MD) was added. Radioactivity was counted in a LKB Betaplate model 1205 scintillation counter (Pharmacia LKB, Gaithersburg, MD) and data was expressed as radioactive counts per minute of H- thymidine incorporated into cells in each tissue culture well.

Activity of HS-5 CM or chromatographic fractions derived for HS-5 CM was quantitated by measuring cell proliferation using ³H-thymidine incorporation induced by serial dilutions of the original, unfractionated HS-5 CM. Typically, dilution ranges from 10-fold to 200,000 fold are measured in these assays. Activity is determined by measuring the dose of HS-5 CM or a chromatographic fraction derived from HS-5 CM by measuring the dose of the sample which resulted in 50% of the maximal proliferation minus the background level of proliferation [EC₅₀ = 0.5 x (maximum H-thymidine incorporation (cpm/min) among all dilutions tested) - (background ³H-thymidine incorporation (cpm ml) observed in wells without HS-5 CM)]. This EC₅₀ value is also equivalent to 1 unit of HS-5 CM bioactivity. Every assay was performed with EPO as a reference standard so that relative activity levels could also be assessed.

Figure 4 represents a proliferation assay using AS-E2 cells and HS-5 CM. In the presence of HS-5 CM, the AS-E2 cells demonstrated dose dependent proliferation. The fact that this proliferation was not due to the presence of low levels of SCF in the HS-5 CM was demonstrated using neutralizing antibodies to SCF. Addition of neutralizing antibodies did not abrogate the growth response of AS-E2 cells in response to HS-5 CM, and in fact, enhanced the growth of AS-E2 cells. This enhancement in growth may be due to neutralization of a growth inhibitory molecule. The identity of such a molecule is as yet unknown. Example 10

Protein purification

HS-5 conditioned medium was enriched for the AS-E2 cells stimulating factor by partial purification using ion exchange chromatography (IEX), reversed phase high performance liquid column chromatography (RP-HPLC) and size exclusion chromatography (SEC). The partially purified HS-5 CM was used for further analysis using 2-dimensional gel electrophoresis.

Anion exchange chromatography

HS-5 conditioned media was diluted four fold with deionized H₂O. The pH of the diluted media was adjusted to 7.7 from 7.0 using 1 M Tris base and then 0.45μ filtered. The filtrate was applied at 19 ml/ min. to a 700 ml column of Pharmacia Q fast flow resin equilibrated with 15 mM Tris Cl pH 7.5. A 15 column volume gradient from 0 to 0.3 M NaCl at a flow rate of 10 ml/ min was used to elute the protein. Fractions containing AS-E2 activity were pooled for further column purification.

Reversed phase HPLC

The pH of the pool from anion exchange chromatography was adjusted to 2.2 with trifluoroacetic acid (TFA) and acetonitrile was added to 20%. The pool was then applied to a 2.2 x 25 cm Nydac C-4 reversed phase column utilizing a 20% to 50% acetonitrile gradient in 0.1% TFA over 60 minutes at 22.5 ml/ min. Fractions were titrated to pH 7.5 with 1 M Tris base. AS-E2 activity containing fractions were pooled and the volume reduced 4 X utilizing a Buchi rotavapor without heating.

Size exclusion chromatography Pooled fractions were concentrated on a Filtron 10 k jumbosep filtration unit to 5 ml. The concentrated pool was applied to a Pharmacia 2.6 x 60 cm HiPrep Sephacryl S-100 column equilibrated in 20 mM TrisHCl, pH 8.0, 150 mM NaCl. The column was eluted at 0.5 ml/min, 4 ml fractions were collected, and elution was monitored at 280 nm. Fractions were assayed for AS-E2 activity and pooled for further analysis.

2-Dimensional Polyacrylamide Gel Electrophoresis

Conditioned media from different HS cell lines (HS-5, HS-21, HS-27MC) were sterile filtered to remove residual intact cells and the filtrate was concentrated at 4°C by centrifugation using Millipore Centriprep 3 units (3,000 Da molecular weight "cut-off; starting volume per unit: 15-20 mis and concentrated volume of 1-2 mis) in a Soravall table top centrifuge. The final concentration was performed under the same conditions using Millipore Centricon 3 units (3,000 Da molecular weight "cutoff; starting volume per unit: 1-2 ml and concentrated volume of 0.1-0.2 ml). Concentrated samples were clarified by centrifugation in microfuge tubes by centrifugation at 4°C for 3 minutes at maximum speed. For samples that were concentrated 200-fold, the conditioned media was adjusted to contain 2M urea to maintain protein solubility and the samples were concentrated an additional 2-fold in the Centricon 3 units. Concentrated sample were either used immediately or were stored as aliquots at -80°C until use. For column fractions, samples were concentrated 10-fold using Centricon 3 units and diluted with either minimally defined media (IMDM) or with 10 mM Tris-HCl, pH 8.0 and re-concentrated.

Two dimensional gel electrophoresis (2-D PAGE) was performed under denaturing, reduced conditions using immobilized pH gradient electrophoresis (IPGE, pH ranges of linear 3-10, non-linear 3-10, 4-7 and 7-10, 18 cm long IPG gel strips from Amersham-Pharmacia Biotech, in 8 M urea, 1% CHAPS, 100 mM DTT, 1.5% ampholytes pH 3-10) in the first dimension and SDS-polyacrylamide gel electrophoresis (linear 10-20% acrylamide, 20 x 25 cm "Dalt-format") in the second dimension. Sample loading of approximately 1.5 mg total protein was used. Protein was detected by staining with ammoniacal silver, colloidal Coomassie brilliant blue G-250 or Sypro orange. Post-gel characterization of selected protein spots was performed by excision of proteins from either the Coomassie blue or Sypro orange stained gels, followed by tryptic digestion of the reduced and alkylated protein, clean-up of the samples using Millipore Zip tips and analyses by matrix assisted laser desorption ionization-time of flight (MALDI-TOF) and electrospray mass (ES- MS) spectrometry. Peptide masses from the MALDI-TOF data were searched against various databases using MS-fit and peptide sequences were searched against various databases using MS-tag. Figure 7 represents a typical 2-D gel of HS-5 conditioned medium with annotation of some of the proteins identified by MALDI- TOF and ES-MS analysis.

Mini-2-D PAGE was performed using 7 cm long IPG gel strips (Bio-Rad) for pH ranges of 3-10, 3-6, 4-7 and 7-10 under the same conditions as described above. The second dimension was performed using 10-20% polyacrylamide gradient gels from Novex. Figure 8 shows 6 panels of 2-D gel images representing protein profile of biologically active fractions from RP-HPLC. The fractions containing proliferative activity for AS-E2 cells were concentrated 10-fold and analyzed by mini-2-D gel electrophoresis. The gels were stained with ammoniacal silver. The protein profile shows some common and unique proteins in each fraction.

Example 11

CD34⁺ proliferation assay activity of CM pool

CD34⁺ cells used in the following assays were isolated from fresh human bone marrow received from normal healthy donors following informed consent. CD34⁺ cells were isolated from bone marrow mononuclear cells using the Baxter Isolex 50 stem cell reagent. Conditioned medium from HS-5 cell line was characterized by measuring proliferation of CD34⁺ cells in liquid culture. Cells were plated at approximately 1000 cells/well in 96-well round bottom plates. Following a seven-day incubation at 37°C, [³H]-thymidine was added and the cells were incubated for an additional seven hours. The cells were then harvested and incorporated radioactivity was quantified (CPM, count per minute) using scintillation spectroscopy as described above.

Fig. 5 represents the growth response of CD34⁺ cells to various concentrations of HS-5 CM. The reconstituted HS-5 represents a cocktail of cytokines at concentrations described below:

0.3 ng/ml Stem Cell Factor (SCF)

2.0 ng/ml IL-1 β

259 ng/ml G-CSF 8.2 ng/ml M-CSF

10 ng/ml GM-CSF

739 ng/ml IL-6

Example 12

Colony-forming unit (CFU) assay of HS-5 CM pool

The hematopoietic activity of HS-5CM was demonstrated on human bone marrow cells in the methylcellulose colony-forming unit (CFU) assay. This assay evaluates both the proliferative and the differentiative activities of hematopoietic growth factors by measuring the number of responding precursor cells. CD34⁺ cells were isolated and placed into methylcellulose (Stem Cell Technologies, Vancouver, BC) containing HS-5CM. After 12 days in culture, total hematopoietic colonies (>50 cells) were counted by inverted phase microscopy. In vitro CFU assays were conducted with bone marrow from several donors and representative results from one donor are shown in Fig. 6. The CFU response of human CD34⁺ cells to HS- 5CM compared to reconstituted HS-5 and Literature Control demonstrated an increase in potency for HS-5 CM in this assay. The reconstituted HS-5 has been described above. The literature control consisted of a cocktail of saturating levels (50 ng/ml each) of SCF, IL-3, IL-6 and G-CSF.

Example 13

Using IL-lbeta as a probe, the public protein sequence database, GenPept, was searched using secondary structure comparisons as implemented in a program called O.R.F. (the software and underlying assumptions are described in detail in Aurora and Rose (1998) Proc. Natl. Acad. Sci. USA 95: 2818-2823). A sequence gi32698, previously identified as interferon-inducible mRNA p27 (Freidman, R.L et al. 1984 Cell 38:745-755), was recognized from the O.R.F. output as having a beta- trefoil-like secondary structure consistent with the structure of a cytokine. This sequence also scored high because it contained a secretion signal. This sequence was then compared using the BLAST program against the database of expressed sequence tags (EST) from the HS5 cell line. An EST, SEQ ID NO:l, was identified (using TBLASTN) with a P-value of 3.0 x 10³². The above sequence represents the full-length clone of the EST thus identified. The alignment of p27 (SEQ ID NO: 8) and the HS5-homolog (SEQ ID NO:6) is shown in Figure 10.

Example 14

To identify a full-length cDNA of the EST clone of SEQ ID NO: 1 a gene- specific primer pair was designed. The 113gl2pairfwdl0933025 forward primer sequence was ACTCTCCACATCATCCAACATC (SEQ ID NO:4), and 113gl2pairrevl0933025 reverse primer sequence was

CTCTTGCCTCATCTTCTTTAGC (SEQ ID NO:5). A probe was generated by amplifying a portion of the sequence using the primers 113gl2pairfwdl0933025 forward and 113gl2pairrevl0933025 reverse and reagents from a Boehringer Mannheim PCR DIG Probe Synthesis kit to incorporate DIG-labeled dUTP into the PCR product. HS-5 cDNA clones were suspended in TB-amp¹⁰⁰, and 1 mL of the suspension was dispensed into each well of 12 X 96 deep well blocks (Qiagen cat # 26173) so there were -1000 primary clones per well. The cultures were incubated at room temperature with shaking for 3 days, a fraction of each culture was mixed with glycerol and frozen, and plasmid DNA was isolated from the remainder of each culture. The plasmid DNA preps were robotically replicated onto positively charged nylon membrane (Boehringer Mannheim) in 96- well format. Approximately 1500 ng of DIG-labeled probe in approximately 100 mL DIG Easy Hyb (Boehringer Mannheim) was hybridized with the membrane at 42°C overnight. Washes and detection were performed according to DIG System protocols to identify wells that contained a clone with homology to the probe. A fraction of the freezer culture corresponding to each positive well was subcultured in TB-amp¹⁰⁰ at 37°C with shaking overnight, and plasmid DNA was prepared from the overnight culture. One μg of the plasmid DNA was digested with restriction enzymes Sail and Notl to release inserts, the digestions were run on a 1% agarose gel, and transferred to positively charged nylon membrane (Boehringer Mannheim). Hybridization and detection were performed with the same probe solution and protocol used for the initial array to identify the size of the insert of the positive clone in each positive pool. One or more of the larger clones were isolated by titering out the frozen culture that was saved from each well, hybridizing against a colony lift of the titer, and subculturing a colony that aligned with a hybridization signal. The clone was sequenced by primer walking from the 5' and 3' ends. The resulting full-length clone was designated pMON37904 and contained the DNA sequence of SEQ ID NO:l encodes the deduced hematopoietic growth factor-like protein of SEQ IDNO:6. SignalP analysis (Nielsen, H. et al., Protein Engineering 10(1), 1997) predicted a probable signal peptide at the 5' end of the largest open reading frame of the sequence indicating that the clone was full-length (Figure 9).

Various other examples will be apparent to the person skilled in the art after reading the present disclosure without departing from the spirit and scope of the invention. It is intended that all such other examples be included within the scope of the appended claims. All references, patents, or applications cited herein are incorporated by reference in their entirety as if written herein.

Claims

WE CLAIM:

1. A substantially-purified nucleic acid molecule encoding a hematopoietic growth factor-like protein or fragment thereof, said nucleic acid molecule comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, substantial homologues thereof, and substantial fragments thereof.

2. The nucleic acid molecule according to claim 1, wherein said molecule shares at least 80% sequence identity, but for the degeneracy of the genetic code, with at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, and SEQ ID NO:3.

3. A substantially-purified nucleic acid molecule that encodes a hematopoietic growth factor-like protein or fragment thereof, said nucleic acid molecule having a nucleic acid sequence that hybridizes under stringent conditions or which would but for the degeneracy of the genetic code, with at least one nucleic acid sequence selected from the group consisting of SEQ ID NO:l,

SEQ ID NO: 2, and SEQ ID NO:3.

4. The nucleic acid of claim 1, 2, or 3 wherein the nucleic acid is the sequence of SEQ ID NO:l, SEQ ID NO: 2, and SEQ ID NO:3.

5. A hematopoietic growth factor-like protein having an amino acid sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:7, a variant of SEQ ID NO:6, a variant of SEQ ID NO:7, a fragment o SEQ ID NO:6, and a fragment o SEQ ID NO:7.

6. A substantially purified antibody or fragment thereof, said antibody or fragment capable of specifically binding to the hematopoietic growth factorlike protein of claim 5.