KR100607613B1 - Thrombopoietin - Google Patents

Abstract

Disclosed herein are isolated thrombopoietin (TPO), isolated DNA encoding TPO, and recombinant or synthetic methods for making and purifying TPO. It has been found that various forms of TPO affect the replication, differentiation or maturation of blood cells, in particular megakaryocytes and megakaryocyte progenitor cells. Thus, these compounds can be used to treat thrombocytopenia.

Description

Thrombopoietin {Thrombopoietin}

Field of invention

The present invention relates to the isolation, purification and recombination or chemical synthesis of proteins that affect the survival, proliferation, differentiation or maturation of hematopoietic cells, in particular platelet progenitor cells. The present invention specifically relates to the cloning and expression of nucleic acids encoding protein ligands that can bind to and activate mpl, which is a member of the cytokine receptor phase. The invention also relates to the use of this protein alone or in combination with other cytokines to treat immune or hematopoietic diseases, including thrombocytopenia.

Background of the Invention

1. Hematopoietic system

The hematopoietic system produces mature, highly specialized blood cells known to be necessary for the survival of all mammals. These mature cells include erythrocytes, which serve to transport oxygen and carbon dioxide, T- and B-lymphocytes, which are involved in cell- and antibody-mediated immune responses, platelets, which are involved in the formation of blood clots, and granulocytes, which function as phagocytes and secondary cells that fight infection. And macrophages. Granulocytes are subdivided into cell types with separate functions: neutrophils, eosinophils, basophils and mast cells. It is noteworthy that all these differentiated mature blood cells are derived from one common primitive cell type, called pluripotent (or pluripotent) hepatocytes, which are found primarily in the bone marrow (Dexter et al., Ann. Rev. Cell Biol). , 3: 423-441 [1987]).

Mature highly specialized blood cells are continuously produced in large quantities throughout the life of a mammal. The majority of these specialized blood cells remain functionally active for hours to weeks (Cronkite et al., Blood Cells, 2: 263-284 [1976]). Thus, to maintain mammalian steady-state blood cell requirements, mature blood cells, primordial stem cells themselves, as well as intermediate or systematically linked ancestral cell lines between primitive and mature cells, need to be continuously regenerated.

In the hematopoietic system, pluripotent stem cells are at their core. These cells are relatively small in number and self-renewal by proliferation to produce daughter hepatocytes or change to more mature lineage-specific progenitor cells in a series of differentiation stages, eventually forming highly differentiated mature blood cells.

For example, certain pluripotent progenitor cells, derived from hepatocytes and called CFC-Mix, have undergone proliferation (self renewal) and developmental processes, and various bone marrow cells: red blood cells, neutrophils, megakaryocytes (platelet precursors), macrophages, basophils. Form colonies containing the instrument, eosinophils and mast cells. Other precursor cells of the lymphatic system proliferate and develop into T- and B-cells.

In addition, there is a series of intermediate progenitor cells leading to each progeny cell between the CFC-Mix progenitor cells and the bone marrow cells. These lineage defining progenitor cells are classified based on the progeny cells they produce. In other words, the known direct precursors of bone marrow cells are erythrocyte forming units (CFU-E) for erythrocytes, granulocyte / macrophage colony forming cells (GM-CFC) for neutrophils and macrophages, and megakaryocyte colony forming cells for megakaryocytes. (Meg-CFC), eosinophils are eosinophil colony forming cells, and mast cells are basophilic colony forming cells (Bas-CFC). Other intermediate precursor cells between pluripotent hepatocytes and mature blood cells are known (see below) or may be found to have varying levels of systematic definability and self-renewal.

In normal hematopoietic cell lines, there appears to be regularity in which the self-renewal capacity decreases as pluripotency is lost and lineage definability and maturity are obtained. That is, at one end of the series of hematopoietic cells, there is a pluripotent stem cell having self-renewal ability and differentiation ability into various lineage-specific linked progenitor cells. This ability is the basis for bone marrow transplantation, where primitive hepatocytes form a new hematopoietic system. At the other end of this series of hematopoietic cells are highly systematically defined progenitor cells and their progeny cells that have lost their self-renewal capacity but have acquired mature functional activity.

Proliferation and development of hepatocytes and lineage-specific progenitor cells are closely regulated by various hematopoietic growth factors, or cytokines. The in vivo role of these growth factors is complex and not fully understood. Some growth factors, such as interleukin-3 (IL-3), can stimulate pluripotent stem cells as well as several lineage precursor cells, including, for example, megakaryocytes. Other factors, such as granulocyte / macrophage colony stimulating factor (GM-CSF), were initially thought to be limited to the action of GM-CFC. However, later it was discovered that GM-CSF also affects the proliferation and development of interalia megakaryocytes. As such, it has been found that IL-3 and GM-CSF have biological activities that differ in potency but overlap each other. More recently, interleukin-6 (IL-6) and interleukin-11 (IL-11) alone do not have a clear effect on megakaryocyte colony formation, but synergistically with IL-3 to stimulate megakaryocyte maturation. (Yonemura et al., Exp. Hematol., 20: 1011-1016 [1992]).

As such, hematopoietic growth factors affect the growth and differentiation of one or more lineages and may overlap or synergize with other growth factors in affecting a single progenitor cell line.

Hematopoietic growth factors may also have their effect at different stages of cell development from pluripotent stem cells into mature blood cells via various lineage limiting progenitor cells. For example, erythropoietin (epo) appears to promote the proliferation of mature erythroid progenitor cells only. IL-3 goes further and affects primordial hepatocytes and intermediate lineage restriction precursor cells. Other growth factors, such as hepatocyte factor (SCF), will have more impact on primitive cell development.

From the foregoing, novel hematopoietic growth factors affecting the survival, proliferation, differentiation or maturation of blood cells or their precursors will be particularly useful in helping to regenerate the decayed hematopoietic system induced after disease or radiotherapy or chemotherapy. .

II. Megakaryocyte formation-platelet generation

The regulation of megakaryocyte formation and platelet production is described in Mazur [Exp. Hematol., 15: 248 [1987] and Hoffman, Blood, 74: 1196-1212 [1989]. In short, myeloid pluripotent stem cells differentiate into megakaryocytes, erythrocytes, and myeloid cell lines. It is believed that megakaryocyte progenitor cells are connected to each other between hepatocytes and megakaryocytes. Three or more megakaryocyte progenitor cells, ie rupture forming unit megakaryocytes (BFU-MK), colony forming unit megakaryocytes (CFU-MK) and low density megakaryocyte progenitor cells (LD-CFU-MK), were identified. Megakaryocyte maturation itself is a sequence of developmental processes divided into stages based on standard morphological criteria. The recognizable early constituent member cells of the megakaryocytes (MK. Meg) system are giant blasts. These cells have a basal cytoplasm and one nucleus of slightly irregular shape, including loose, slightly reticular chromatin and several phosphorus, with a cell diameter of 20 to 30 um. After a period of time, the megakaryocytes contain up to 32 nuclei (multiploids) but the cytoplasm remains sparse and immature. As the maturation process progresses, the nucleus becomes more deciduous and enriched, the cytoplasm increases in quantity and more eosinophilic and granulates. In the most mature cells of this line, you can see the platelet release from the edge of the cell. Usually, less than 10% of the megakaryocytes are in stage and more than 50% are mature. According to the morphological classification that is commonly applied to the megakaryocyte system, it is divided into early forms of megakaryocytes, intermediate forms of megakaryocytes or basophils, and terminal forms of mature (eosinophilic, granular or platelet producing) megakaryocytes. Mature megakaryocytes emit cytoplasmic filaments into the sinusoidal space, where they fall apart and form individual platelets (Williams et al., Hematology, 1972).

Several regulatory factors are believed to be involved in megakaryocyte formation (Williams et al., Br. J. Hematol., 52: 173 [1982] and Williams et al., J. Cell Physiol., 110: 101 [1982). ]). The early stage of megakaryocyte formation is mitosis associated with cell proliferation and colony initiation from CFU-MK, but it is speculated that it is not affected by platelet levels (Burstein et al., J. Cell Physiol., 109: 333 [1981] And Kimura et al., Exp. Hematol., 13: 1048 [1985]). The later stages of maturation are non-mitotic, which are associated with nuclear multiploidy and cytoplasmic maturation and are probably regulated by feedback mechanisms by peripheral platelet levels (Odell et al., Blood, 48: 765 [1976] and Ebbe et. al. Blood, 32: 787 [1968].

The presence of a separate specific megakaryocyte colony stimulating factor (MK-CSF) is controversial (Mazur, Exp. Hematol., 15: 340-350 [1987]). Most authorities, however, believe that important processes in survival, such as platelet production, will be regulated by cytokines that are solely involved in this process. The hypothesis that megakaryocyte / platelet specific cytokines will exist for more than 30 years has served as a basis for studies seeking to discover them, but to date such cytokines have been purified, sequenced, or confirmed as specific MK-CSF (TPO) by analysis. It wasn't.

Experimentally designed thrombocytopenia (Hill et al., Exp. Hematol., 14: 752 [1986]) and human embryonic kidneys conditioned in [CM] medium (McDonald et al., J. Lab. Clin. Med. 85: 59 [1975]), aplastic anemia and idiopathic thrombocytopenic purpura extract (Kawakita et al., Blood, 6: 556 [1983]) and plasma (Hoffman et al., J. Clin, Invest., 75: 1174 [1985] reported that MK-CSF was partially purified, but their physiological function is still unknown in most cases.

Conditioned cultures of poke weed mutant activating spleen cells (PWM-SpCM) and murine bone marrow cell line WEHl-3 (WEHl-3CM) were used as megakaryocyte potentiators. PWM-SpCM contains factors that promote the growth of CFU-MK (Metcalf et al., Pro. Natl, Acad. Sci., USA, 72: 1744-1748 [1975]; Quesenberry et al., Blood, 65 : 214 [1985]; and Iscove, NN, in Hematopoietic Cell Differentiation, ICN-UCLA Symposia on Molecular and Cellular Biology, Vol. 10, Golde et al., Eds. [New York, Academy Press] pp 37-52 [1978 ]), One of which is interleukin-3 (IL-3), a multi-line colony stimulating factor (multi-CSF) [Burstien, Blood Cells, 11: 469 [1989]). Other factors in this culture have not yet been identified or isolated. WEHl-3 is a murine bone marrow cell line that secretes relatively large amounts of IL-3 and small amounts of GM-CSF. IL-3 has been shown to promote the growth of various hematopoietic cells (Ihle et al., J. Immumol., 13: 282 [1983]). IL-3 also synergizes with many known hematopoietic hormones or growth factors, including erythropoietin (EPO) and interleukin-1 (IL-1), for the induction of early pluripotent precursors and for the formation of large amounts of mixed hematopoietic colonies. It has been shown to cause action (Bartelmez et al., Cell Physiol., 122: 362-369 [1985] and Warren et al., J. Cell, 46: 667-674 [1988]).

Other megakaryocyte enrichment resources were found in conditioned media of rat lung, bone, macrophage line, celiac exudate cells and human fetal kidney cells. Despite some disproving data (Mazur, Exp. Hematol., 15: 340-350 [1987]), some evidence that activated T-lymphocytes, rather than monocytes, play an encouraging role in megakaryocyte formation (Geissler et al. , Br. J. Hematol. 15: 340-350 [1987]. These findings suggest that secretion of activated T-lymphocytes such as interleukin may be a regulatory factor in MK development (Geissler et al., Exp. Hematol. 15: 845-853 [1987]). Many studies on megakaryocyte formation using purified erythropoietin (EPO) (Vainchenker et al., Blood, 54: 940 [1979]); McLeod et al., Nature, 261: 492-4 [1976] and Williams et al., Exp. Hematol. 12: 734 [1984]) suggest that this hormone has an encouraging effect on the formation of MK colonies. It has also been demonstrated in the absence of serum-free and serum-containing cultures and side cells (Williams et al., Exp. Hematol. 12: 734 [1984]). EPO was estimated to be more involved in one and two cell stages of megakaryocyte formation as opposed to the action of PWM-SpCM, which is involved in the four cell stages of megakaryocyte development. The interaction of all these factors in the early and late stages of megakaryocyte development remains to be further elucidated.

Data from several laboratories suggest that the multisystem factor with MK colony stimulatory activity individually is GM-CSF and IL-3 and the B-cell stimulator IL-6, although less effective (Ikebuchi et al., Proc). Natl.Acae.Sci. USA, 84: 9035 [1987]). More recently, several authorities have reported that IL-11 and leukemia inhibitory factor (LIF) synergize with IL-3 to increase megakaryocyte size and chromosome drainage (Yonemura et al., British Journal of Hematology, 84:16 -23 [1993]; Burstein et al., J. Cell Physiol., 153: 305-312 [1992]; Metcalf et al., Blood, 76: 50-56 [1990]; Metcalf et al., Blood, 77 : 2150-2153 [1991]; Bruno et al., Exp. Hematol., 19: 378-381 [1991] and Yonemura et al., Exp. Hematol., 20: 1011-1016 [1992]).

Other related documents include: Eppstein et al., US Pat. No. 4.962,091; Chong et al., 4.879,111; Fernardes et al., 4.604,377; Wissler et al., 4.512,971; Gottlieb et al., U.S. 4.468,379; Bennet et al., U.S. 5.15,895; Kogan et al., U.S. 5.50,732; Kimura et al., Eur.J. Immunol., 20 (9): 1927-1931 [1990]; Secor et al., J of immunol., 144 (4): 1484-1489 [1990]; Warren et al., J of Immunol., 140 (1): 94-99 [1988] Warren et al., Exp. Hematol., 17 (11): 1095-1099 [1989]; Bruno et al., Exp. Hematol., 17 (10): 1038-1043 [1989]; Tanikawa et al., Exp. Hematol., 17 (8): 883-888 [1989]; Koike et al., Blood, 75 (2): 2286-2291 [1990]; Lotem et al., Blood, 75 (5): 1545- 1551 [1989]; Rennick et al., Blood, 73 (7): 1828-1835 [1989]; and Clutterbuck et al., Blood, 73 (6): 1504-1512 [1989].

III thrombocytopenia

Platelets are an important component of the blood clotting mechanism. Reduction of circulating platelet concentration, ie thrombocytopenia, occurs in various clinical conditions and diseases. Thrombocytopenia is usually defined as the number of platelets per unit liter of less than 150 × 10 ⁹ . The main causes of thrombocytopenia fall largely into three categories based on platelet lifespan; Ie (1) damage to the platelet production apparatus of the bone marrow, (2) platelet sequestration in the spleen (pyrexia) or (3) an increase in platelet destruction in the peripheral circulation (eg autoimmune thrombocytopenia or chemical and radiological treatment). In addition, thrombocytopenia may occur due to dilution in the body in patients who have been rapidly administered large amounts of low platelet containing blood products.

Clinical bleeding symptoms of thrombocytopenia depend on the severity of thrombocytopenia, its causes, and possible related coagulation defects. In general, patients with platelet counts between 20 × 10 ⁹ and 100 × 10 ⁹ per liter are at risk of excessive posterior bleeding, and patients with platelet counts per litre less than 20 × 10 ⁹ may spontaneously bleed. . Patients in the latter case are subject to platelet counts, although they carry immune and viral risks. Regardless of the severity of thrombocytopenia, the cause may be even worse if the cause is not an increase in platelet destruction but a decrease in its production. In the former, accelerated platelet replacement causes platelets to circulate less mature, larger, and hemostatic. Thrombocytopenia can result from a variety of diseases, which are described below. For further details see Schaffner, AI "Thrombocytopenia and Disorders of Platlet Function", Internal Medicine, 3rd Ed., John J. Hutton et al., Eds., Little Brown and Co., Boston / Toronto / London [1990] It is described in.

(a) thrombocytopenia due to platelet production damage

Causes of congenital thrombocytopenia include constitutional aplastic anemia (Fancony syndrome) and congenital megalocytic thrombocytopenia, which may be associated with poor skeletal formation. Acquired diseases of platelet production are caused by dysplasia of megakaryocytes or inefficient platelet formation. Megakaryocyte insufficiency can result from a variety of conditions, including bone marrow dysfunction (including spinal cord inhibition by naturally occurring or chemotherapeutic agents or radiotherapy), myeloid fibrosis, leukemia, and bone marrow invasion of metastatic tumors or granulomas. In some cases, toxins, infectious factors. Or the drug may relatively selectively interfere with platelet formation; For example, there are transient thrombocytopenia caused by alcohol and some viral infections and mild thrombocytopenia associated with the administration of thiazide-based diuretics. Finally, inefficient thrombocytopenia accompanied by macroblastic processes (folate or B ₁₂ deficiency) can also lead to thrombocytopenia, usually accompanied by anemia and leukopenia.

Current treatments for thrombocytopenia due to reduced platelet production are based on the identification and reversal of causes associated with bone marrow failure. Platelet delivery is usually the last resort for severe bleeding complications, or for blood supply during surgical procedures as allogeneic immunity can lead to additional platelet orders and treatment refractory. Mucosal bleeding caused by severe thrombocytopenia can be improved by oral or intravenous administration of antifibrolytics. However, when antifibrolytic agents are applied to patients with similar infectious endovascular coagulation (DIC), thrombotic complications can be caused.

(b) thrombocytopenia due to spleen sequestration

Any cause trophies may be associated with moderate thrombocytopenia. While the immune mediated thrombocytopenia discussed below is the active destruction of platelets by the spleen, this is a passive process mainly due to splenic platelet sequestration. Although the most common cause of non-hyperfunction is congestive dystrophy due to portal hypertension caused by alcoholic cirrhosis, other forms of congestive, invasive, or lymphoproliferative dystrophy are also associated with thrombocytopenia. Platelet counts generally do not fall below 50 × 10 ⁹ per liter by non-hyperfunctionia alone.

(c) thrombocytopenia due to non-immune mediated platelet destruction

Thrombocytopenia can result from the acceleration of platelet destruction due to various non-immune processes. Diseases of this type include infectious endotracheal clotting, prosthetic endothelial devices, extracorporeal circulation of blood and thrombotic capillary lining disorders such as thrombotic trombocytic frpura. Under all these circumstances, circulating platelets exposed to artificial surface or abnormal vasculature endothelium are exhausted or damaged at this location and then removed from the immature state by the reticulum endothelial tissue system. Disease states or conditions that can cause infectious vascular coagulation (DIC) are described in detail in Braunwald et al., (Eds), Harrison's Principles of Internal Medicine, 11th Ed., P. 1478, McGraw Hill [1987]. have. Intracardiovascular prosthetic devices, such as heart valves and intraaortic balloons, can cause mild to moderate disruptive thrombocytopenia and transient thrombocytopenia in patients undergoing pulmonary-cardiac bypass or hemodialysis treatment May be caused by platelet consumption or damage in

(d) drug-induced immune thrombocytopenia

More than 100 drugs have been considered for immune mediated thrombocytopenia. However, only the properties of quinidine, quinine, gold, sulfonamide, cephalotin and heparin are well characterized. Drug-induced thrombocytopenia is often serious and usually occurs suddenly within a few days of the patient's sensitization treatment.

(e) Immune (autoimmune) thrombocytopenic purpura (ITP)

ITP in adults is a chronic disease characterized by autoimmune platelet destruction. Other immunoglobulins have also been reported, but autoantibodies are usually IgG. Although it has been known that autoantibodies of ITP bind to platelet membrane GPII _b III _a , the specificity of these platelet antibodies has not been identified in most cases. Extracellular destruction of sensitized platelets occurs in the reticuloendothelial system of the spleen and liver. While more than half of all ITPs are spontaneous, many ITP patients simultaneously carry rheumatic or autoimmune diseases (such as lupus erythematosus) or lymphocytic proliferative diseases (such as chronic lymphocytic leukemia).

(f) HIV-induced ITP

ITP is becoming a complication of an increasingly frequent HIV infection [Morris et al., Ann. Intern, Med., 96: 714-717 [1982], in patients diagnosed with acquired immunodeficiency syndrome, in patients diagnosed with AIDS-related complications, and without AIDS symptoms but diagnosed as infected with HIV at any stage of the disease progression. May occur. HIV infection is an infectious disease that is ultimately characterized by the development of opportunistic infections and malignant tumors and severe deficiency of cellular immune function. The primary immune abnormalities due to HIV infection are progressive decline and functional impairment of T lymphocytes expressing CD ₄ cell surface glycoproteins [Lane et al., Ann. Rev. Immunol., 3: 477 [1985]). Loss of CD ₄ helper / inducer T cell function appears to cause severe loss of cellular and humoral immunity leading to opportunistic infections and malignant tumors characteristic of AIDS (H. Lane supra).

The mechanism of HIV-associated ITP is unknown, but is thought to be different from that of non-HIV infection-related ITP [Walsh et al., N. Eng. J. Med., 311: 635-639 [1984]; And Ratner Am. J. Med., 86: 194-198 [1989].

IV. Current treatment of thrombocytopenia

The approach to the treatment of thrombocytopenia patients depends on the severity and urgency of the clinical condition. This treatment is similar to the treatment of HIV-related and non-HIV-related thrombocytopenia, and many different treatments have been used, but the best treatment is controversial.

Platelet counts in patients diagnosed with thrombocytopenia have been successfully increased by treatment with glucocorticoids (eg, prednisolone), but for most patients, the response is incomplete, or the dose of glucocorticoids is reduced or their administration is stopped. Was regressed. Based on studies on HIV-related ITP patients, some scholars have suggested that glucocorticoid therapy can cause predisposition to AIDS. Glucocorticoids are usually administered when platelet count drops below 20 × 10 ⁹ per unit liter or when there is spontaneous bleeding.

For patients refractory to glucocorticoids, compound 4- (2-chlorophenyl) -9-methyl-2- [3- (4-morpholinyl-3-propanon-1-yl] 6H-thieno [ Severe cases of non-HIV-associated ITP were successfully treated with 3,2, f] [1,2,4] triazole [4,3, a] [1,4] diazepine (WEB 2086). WEB 2086 was administered to patients with platelet levels of 37000-58000 / ul and platelet count increased to 140000 to 190000 / ul 1 to 2 weeks after administration (European Patent 361.077 and Lohman et al., Lancet, 1147 [1988]). ).

Although the best treatment for acquired megakaryocytopenic thrombocytopenia (AATP) has not been determined, antihymosite globulin (ATG) (antisera in horses to human Timus tissue) has shown a more complete and complete disease differential [Trimble et. al., Am. J. Hematol., 37: 126-127 [1991]. However, recent reports suggest that the hematopoietic effect of ATG is due to thimerosal, where this protein (ATG) acts as a mercury carrier (Panella et al., Cancer Research, 50: 4429-4435 [1990]). .

Good results have been reported for splenectomy. Splenectomy removes the major site of platelet destruction and the major source of autoantibody production from many patients. In this way a large number of patients showed long-term untreated roadways. However, surgical procedures should generally be avoided by immunocompromised patients, so splenectomy does not respond to patients with severe thrombocytopenia (eg severe HIV-related ITP), 2-3 weeks after glucocorticoid treatment, or Recommended only for patients who do not show a sustained response after discontinuation of corticoids. Based on current scientific knowledge, it is uncertain whether splenectomy provides a predisposition to AIDS.

In addition to prednisolone treatment and splenectomy, some cytotoxic agents such as vincristine and azithrothymidine (AZT, zidovudine) also offer bright prospects for the treatment of HIV-induced ITP, but the results are temporary.

It will be appreciated from the above technique that one method for treating thrombocytopenia is to obtain a substance that accelerates the differentiation and maturation of megakaryocytes or their progenitor cells into platelet-forming forms. Considerable effort has already been made to identify these materials, commonly referred to as "thrombopoietin" (TPO). Other names of TPO found in the literature include platelet forming stimulating factor (TSF), megakaryocyte colony stimulating factor (MK-CSF), megakaryocyte stimulating factor and megakaryocyte enhancer. TPO activity was observed in 1959 (Rak et al., Med. Exp., 1: 125) and attempts to characterize and purify the material continue to this day. There have been reports of partial purification of TPO active polypeptides (eg, Tayrien et al., J. Biol. Chem., 262: 3262 [1987] and Hoffman et al., J. Clin. Invest. 75: 1174 [ 1985]), and some have assumed that TPO itself is not a specific entity but is a multifunctional expression of hormone (IL-3) already known [Sparrow et al., Prog. Clin. Biol. Res., 215: 123 [1985]). Regardless of their form or origin, molecules with platelet forming activity have significant therapeutic value. Although no protein has been reliably identified as TPO, much attention has been paid to recent findings that mpl (presumed to be a cytokine receptor) generates platelet formation signals.

V. mpl is a megakaryocyte-forming cytokine receptor

It is believed that the proliferation and maturation of hematopoietic cells is tightly regulated by factors that positively or negatively control the proliferation and multisystem differentiation of pluripotent stem cells. These effects are mediated through the high affinity binding of cellular protein factors to specific cell surface receptors. These cell surface receptors are generally classified as members of the cytokine receptor phase in significant homology. This family includes IL-2 (β and γ chains) (Hatakeyama et al., Science, 244: 551-556 [1989]; Takeshita et al., Science, 257: 379-382 [1991]), IL-3 (Itoh et al., Science, 247: 324-328 [1990]; Gorman et al., Proc. Natl. Acad. Sci. USA, 87: 5459-5463 [1990]; Kimura et al., Cell, 66: 1165-1174 [1991a]; Kitamura et al., Proc. Natl. Acad. Sci. USA, 88: 5082-5086 [1991b]), IL-4 (Mosely et al., Cell, 59: 335-348 [1989) ]), IL-5 (Takaki et al., EMBO J., 9: 4367-4374 [1990]; Tavernier et al., Cell, 66: 1175-1184 [1991]), IL-6 (Yamasaki et al. , Science, 241: 825-828 [1988]; Hibi et al., Cell, 63: 1149-1157 [1990]), IL-7, (Goodwin et al, Cell, 60: 941-951 [1990]). , IL-9 (Renault et al., Proc. Natl. Acad. Sci. USA, 89: 5690-5694 [1992]), granulocyte-macrophage colony stimulating factor (GM-CSF) (Gearing et al., EMBO J 8: 3667-3676 [1991]; Hayashida et al., Proc. Natl. Acad. Sci. USA, 244: 9655-9659 [1990]), and granulocyte colony stimulating factor (G-CSF) (Fukunaga et al. Cell, 61: 341-350 [1990a]; Fukunaga et al., Proc. Natl. Acad. Sci. USA, 87: 8702-8 706 [1990b] Larsen et al., J. Exp. Med., 172: 1559-1570 [1990], EPO (D'Andrea et al., Cell, 57: 277-285 [1989]; Jones et al., Blood, 76: 31-35 [1990]), leukocyte inhibitory factor (LIF) (Gearing et al., EBMO. J. 10: 2839-2849 [1991]); Oncotin M (OSM) (Rose et al., Proc. Natl. Acad. Sci. USA, 88: 8641-8645 [1991] and receptors of prolactin (Boutin et al., Proc. Natl. Acad. Sci) USA, 88: 7744-7748 [1988]; Edery et al., Proc. Natl. Acad. Sci. USA, 86: 2112-2116 [1989], growth hormone (GH) (Leung et al., Nature, 330. : 537-543 [1987] and ciliary Neutrophic Factor (CNTF) (Davis et al., Science, 253: 59-63 [1991]).

Members of the cytokine receptor superfamily can be divided into three functional categories (for details see Nicola et al., Cell, 67: 1-4 [1991]). The first class consists of single chain receptors such as erythropoietin receptors (EPO-R) or granulocyte colony stimulating receptors (G-CSF-R), which have a high affinity for ligands through the extracellular domain. Bind and also generate intracellular signals. The second class of receptors called α-subunits include interleukin-6 receptor (IL6-R), granulocyte-macrophage colony stimulating factor receptor (GM-CSF-R), interleukin-3 receptor (IL3-Rα) and cytosine. Other members of the Keen receptor phase are included. These α-subunits bind ligand with low affinity but are unable to transmit intracellular signals. Highly affinity receptors capable of signal transduction are β-sub common to the three classes of receptors called α-subunits and β-subunits (e.g. three α-subunits for IL3-Rα and GM-CSF-R). It is formed by a heterodimer with βc) as a unit.

Evidence that mpl is a member of the cytokine receptor superfamily can be found in sequence homology (Gearing, EMBO J., 8: 3667-3676 [1988]; Bazan, Proc. Natl. Acad. Sci. USA, 87: 6834-6938 [1990] Davis et al., Science, 253: 59-63 [1991] and Vigon et al., Proc. Natl. Acad. Sci. USA, 89: 5640-5644 [1992] and their ability to transmit proliferative signals to be.

The protein sequence deduced from the molecular cloning of the mouse c-mpl indicates that this protein is homologous to other cytokine receptors. The extracellular domain consists of 465 amino acid residues and consists of two subdomains with four highly conserved cysteines and one particular motif in the N-terminal and C-terminal subdomains, respectively. The extracellular domain that binds to the ligand is expected to have a similar double β-barrel fold structure. This dualized extracellular domain is highly homologous to the signal transduction chains commonly present in the IL-3, IL-5 and GM-CSF receptors as well as the low affinity binding domain of LIF (Vigon et al., Oncogene, 8 : 2607-2615 [1993]). Thus, mpl may belong to the low affinity ligand binding class of cytokine receptors.

Comparing mouse mpl and mature human mpl P, we can see that 81% of these two protein sequences are identical. More specifically, the sequences of the N-terminal and C-terminal extracellular subdomains are 75% and 80% identical, respectively. The best conserved mpl region is the cytoplasmic region showing 91% sequence identity, and the sequences of 37 residues of the transmembrane domain were identical in both species. Thus, mpl is reported to be one of the best conserved members of the cytokine receptor superfamily (Vigon supra).

Evidence that mpl is a functional receptor capable of transmitting a proliferative signal is derived by making a chimeric receptor comprising an extracellular domain and a mpl cytoplasmic domain of a cytokine receptor with high affinity for known cytokines. Since no known ligands of mpl have been reported, it was necessary to prepare chimeric high affinity ligand binding extracellular domains from first class cytokine receptors such as IL-4R or G-CSFR. Vigon et al fused the extracellular domain of G-CSFR with the transmembrane and cytoplasmic domains of c-mpl. BAF / B03 (Ba / F3), an IL-3 dependent cell line, was infected with this G-CSFR / mpl chimera and separately prepared full-length G-CSFR controls. The cells infected with the chimeras grew equally well in the presence of IL-3 or G-CSFR. Likewise, cells infected with G-CSFR also grew well in IL-3 or G-CSF. All cells died in the absence of growth factors. Similar experiments were performed by Skoda et al., EMBO J., 12 (7): 2645-2653 [1993], wherein the extracellular and transmembrane domains of the human IL-4 receptor (hIL-4-R) were expressed in rats. The mpl cytoplasmic domain was fused and infected with mouse IL-3 dependent Ba / F3 cell lines. Ba / F3 cells infected with native hIL-4 R proliferated normally in the presence of species-specific IL-4 and IL-3. Ba / F3 cell lines infected with hIL-4R / mpl grow normally in the presence of hIL-4 (with and without IL-3 position) so that mpl cytoplasmic domains in Ba / F3 cells have all the necessary elements to transmit proliferative signals. Shows that there is.

These chimeric experiments show the ability of the mpl cytoplasmic domain to generate proliferative signals, but do not say whether the mpl extracellular domain binds to the ligand. These results indicate at least two possibilities: signal transmissible β-, where mpl is a single chain (first class) receptor such as EPO-R or G-CSFR, or requires an α-subunit such as IL-3. It is consistent with the fact that it may be a subunit (class 3) (Skoda et al. Supra).

VI. Mpl ligand is a type of thrombopoietin (TPO)

As mentioned above, it has been claimed that serum contains a unique factor, synergistically with various other cytokines that promote the growth and maturation of megakaryocytes and called thrombopoietin (TPO). Although numerous researchers have made considerable efforts, none of these natural-type factors have been isolated from the serum. It is not known whether mpl binds directly to megakaryocyte stimulating factors, but recent experiments have shown that mpl is involved in propagation signal transduction from one or several factors found in the serum of patients with aplastic bone marrow. (Methia et al., Blood, 82 (5): 1395-1401 [1993]).

Evidence that unique serum colony forming factors, distinct from IL-1α, IL-3, IL-4, IL-6, IL-11, SCF, EPO, G-CSF, and GM-CSF, transmits proliferative signals through mpl The distribution of c-mpl expression in primitive hematopoietic cells and their associated hematopoietic cell lines and the mpl antisensitization studies in these cell lines are derived.

Using reverse transcriptase (RT) -PCR in immune purified human hematopoietic cells, Methia et al. Found that strong mpl mRNA information was found only in CD34 ⁺ purified cells, megakaryocytes and platelets. CD34 ⁺ cells purified from bone marrow (BM) account for about 1% of the total BM cells and are quantitatively in primitive progenitor cells of the entire lineage (e.g., erythroid, granulocyte and megakaryocytes) and associated progenitor cells. Is increased.

mpl anti-sensitizing oligodeoxynucleotides were observed to inhibit megakaryocyte colony formation in pluripotent CD34 ⁺ cells cultured in the serum of patients with aplastic bone marrow (rich megakaryocyte colony stimulating activator [MK-CSF]). These same antisensitizing oligodeoxynucleotides did not affect erythroid or granulocyte colony formation.

It is not yet known whether the mpl binds to the ligand directly and acts through mpl, a serum factor that causes megakaryocyte formation. However, it has been suggested that if mpl binds directly to the ligand, its amino acid sequence will be very well conserved and human and rat mpl extracellular domains will show significant sequence identity, resulting in interspecies reactivity (Vigon at al, supra [1993]. ]).

VII. purpose

From the foregoing, the need for isolating and identifying molecules that can stimulate proliferation, differentiation and maturation of hematopoietic cells, especially megakaryocytes or their precursor cells, for the therapeutic use of thrombocytopenia is present and will continue in the art. You will know. It is believed that these molecules are mpl ligands and that there is a further need to isolate them for evaluation of their function in the growth and differentiation of such ligand (s).

Accordingly, it is an object of the present invention to obtain pharmaceutically pure molecules that can stimulate megakaryocytes to proliferate, differentiate and / or mature into mature platelet production forms.

It is another object of the present invention to provide a molecule in a form suitable for the therapeutic use of hematopoietic diseases, in particular thrombocytopenia.

It is a further object of the present invention to isolate, purify and specifically identify protein ligands that are capable of binding in vivo to cytokine phases and receptors known as mpl to transmit proliferative signals.

It is another object of the present invention to provide nucleic acid molecules encoding such protein ligands and to produce mpl binding ligands in recombinant cell culture using these nucleic acid molecules for diagnostic and therapeutic uses.

It is another object of the present invention to provide derivatives and modified forms of protein ligands, including amino acid sequence modifications, modified glycoprotein forms, and covalent derivatives thereof.

It is another object of the present invention to provide fusion polypeptide forms by combining mpl ligands with different proteins and covalent derivatives thereof.

It is a further object of the present invention to provide a modified polypeptide form capable of combining mpl ligands with amino acid additives and substituents from EPO to produce proteins that can control the proliferation and growth of platelets and red blood cell progenitor cells.

In addition to obtaining an antibody capable of binding to the mpl ligand, it is another object of the present invention to prepare an immunogen that provides an antibody against the mpl ligand or its fusion form.

These and other objects of the present invention will be apparent to those skilled in the art having the full knowledge of the present specification.

Summary of the Invention

An object of the present invention is an isolated mammalian megakaryocyte, called "mpl ligand" (ML) or "thrombopoietin" (TPO), which can stimulate megakaryocytes to proliferate, mature, and / or differentiate into mature platelet production forms. By providing constitutive proliferation and mature anti-protein.

This substantially homogeneous protein (1) immobilizes a plasma source containing the mpl ligand molecule to be purified to an immobilized receptor polypeptide, in particular a support, under conditions such that the mpl ligand molecule to be purified selectively adsorbs to the immobilized receptor polypeptide. The mpl or mpl fusion polypeptide, and (2) wash the immobilized receptor polypeptide and its support to remove the non-adsorbed material, and (3) the mpl from the immobilized receptor polypeptide adsorbed by the mpl ligand receptor using eluent buffer. Purification from natural sources may be accomplished by a method comprising eluting the ligand material. Preferably this natural source is mammalian plasma or urine containing a mpl ligand. Optionally the mammal is aplastic and the immobilized receptor is a mpl-IgG fusion.

Optionally, the desired megakaryogenic proliferation and mature anti-protein is an isolated substantially uniform mpl ligand polypeptide prepared by synthetic or recombinant methods.

The "mpl ligand" polypeptide or "TPO" of the present invention has at least 70% sequence identity with a highly purified substantially homologous porcine mpl ligand polypeptide and has at least 80% sequence with the "EPO-domain" of the porcine mpl ligand polypeptide. Have identity. Optionally, the mpl ligands of the present invention may have a mature human mpl ligand (hML) or variant, or a post transcriptionally modified form or mature human mpl ligand, having a mature amino acid sequence provided in FIG. 1 (SEQ ID NO: 1). Protein with 80% sequence identity. Optionally the mpl ligand variant is a segment of a human mpl ligand (hML), in particular an amino terminus or an "EPO-domain" segment. Preferably, the amino terminal fragment has substantially all human ML sequences between the first and fourth cysteine residues but may comprise significant adders, leaving groups or substituents in other regions. According to this embodiment, the fragment polypeptide can be represented by the following general formula:

                     X-hML (7-151) -Y

Wherein hML (7-151) represents the human TPO (hML) amino sequence between Cys ⁷ and Cys ¹⁵¹ (including Cys ¹⁵¹ ); X represents an amino group of Cys ⁷ , or one or more amino terminal amino acid residues of mature hML or an extension of its amino acid residues such as Met, Tyr or a leader sequence comprising, for example, a protein cleavage site (eg factor Xa or thrombin). Represent; Y is or represents an carboxy terminal group of Cys ¹⁵¹ or one or more carboxy terminal amino residues of mature hML.

Optionally the mpl ligand polypeptide or fragment thereof may be fused to a heterologous polypeptide (chimeric). Preferred heterologous polypeptides are cytokines, colony stimulating factors or interleukins or fragments thereof, in particular kit ligands (KL), IL-1, IL-3, IL-6, IL-11, EPO, GM-CSF, or LIF. Any preferred nonhomologous polypeptide is an immunoglobulin chain, in particular human IgG1, IgG2, IgG3, IgG4, IgA, IgE, IgD, IgM or fragments thereof, comprising the constant domain of the IgG heavy chain.

In another aspect of the invention biologically active, preferably stimulating the incorporation of labeled nucleotides (eg ³ H-thymidine) into the DNA of IL-3 dependent Ba / F3 cells infected with human mpl. A composition comprising an isolated mpl agonist is provided. Optionally the mpl agonist is a biologically active mpl ligand and can preferably stimulate the incorporation of ³⁵ S into circulating platelets in mouse platelet reflex assays. Suitable mpl agonists include hML ₁₅₃ , hML (R153A, R154A), hML2, hML3, hML4, mML, mML2, mML3, pML and pML2 or fragments thereof.

In another embodiment, the present invention provides an isolated antibody capable of binding to a mpl ligand. An isolated antibody capable of binding to a mpl ligand can optionally be fused with another polypeptide and this antibody or fusion thereof can be used to isolate or purify the mpl ligand from the source according to the above method to obtain an immobilized mpl. In another aspect of this embodiment, the invention is directed to in vitro or in vivo detection of a mpl ligand comprising a step of contacting a sample suspected of containing a mpl ligand, in particular a serum sample, with contacting the antibody if binding occurs. Provide a method.

In another embodiment, the invention provides an isolated nucleic acid encoding a mpl ligand or fragment thereof, which nucleic acid may be optionally labeled with a detectable group and complementary to a nucleic acid molecule having a sequence encoding a mpl ligand. Nucleic acid molecules that are at or hybridize under moderate to highly stringent conditions. Preferred nucleic acid molecules are nucleic acids encoding human, pig and mouse mpl ligands and include RNA and DNA, genome and cDNA. In another aspect of this embodiment the nucleic acid molecule is a DNA encoding a mpl ligand and may further comprise a replicable vector having DNA that is functionally bound to a regulatory sequence recognized by the infected host. Optionally, the DNA is a cDNA having a sequence provided in FIGS. 1'5'-3 '(SEQ ID NO: 2), 3'-5', or a fragment thereof. This aspect of the invention expresses in a medium of infected cells a cDNA encoding a host cell, preferably a CHO cell and preferably a mpl ligand, preferably encoding a mpl ligand, using a vector to infect the host cell or its Included are methods that consist in recovering mpl ligands from host cultures.

The invention also includes a method of treating a mammal having hematopoietic disease, in particular thrombocytopenia, which comprises administering to a mammal a therapeutically effective amount of a mpl ligand. Optionally the mpl ligand is administered in combination with a cytokine, in particular a colony stimulating factor or interleukin. Preferred colony stimulating factors or interleukins include kit ligands (KL), LIF, G-CSF, GM-CSF, M-CSF, EPO, IL-1, IL-3, IL-6 and IL-11.

The invention also

(1) disrupt or lyse TPO-containing cells,

(2) optionally separating the soluble material from the insoluble material comprising TPO,

(3) solubilizing buffer to dissolve TPO in insoluble matter and

(4) isolating dissolved TPO from other soluble and insoluble materials,

(5) refolding TPO in redox buffer,

(6) A method of isolating and purifying TPO from a TPO producing microorganism, comprising separating a properly folded TPO from a misfolded TPO.

The method provides a chaotropic material used to solubilize an insoluble material containing TPO as a chaotropic material selected from guanidine salts, sodium thiocyanate or urea. The method further provides a method wherein the solubilized TPO is separated from other soluble and insoluble materials by one or more steps selected from centrifugation, gel filtration and reverse phase chromatography. The refolding step of this method provides a redox buffer containing both oxidizing and reducing agents. Generally the oxidant is a compound having oxygen or at least one disulfide bond and the reducing agent is a compound having at least one free sulfhydryl. Preferably the oxidant is selected from oxidized glutathione (GSSG) and cystine and the reducing agent is selected from reduced glutathione (GSH) and cysteine. Most preferably the oxidant is oxidized glutathione (GSSG) and the reducing agent is reduced glutathione (GSH). It is also preferred that the molar ratio of the oxidant is equal to or greater than the molar ratio of the reducing agent. The redox buffer further contains a bleach, preferably selected from CHAPS and CHAPSO and present at a concentration of at least 1%. The redox buffer further contains NaCl, preferably in a concentration range of about 0.1 to 0.5 M, and glycerol, preferably at a concentration of greater than 15%. The pH of the redox buffer is preferably in the range of about pH 7.5-pH 9.0 and the refolding step is performed at 4 degrees for 12 to 48 hours. The refolding step produces a biologically active TPO in which disulfide bonds are formed between Cys closest to the amino terminus of the EPO domain and Cys closest to the carboxy terminus.

The invention also

(1) at least dissolve the extracellular membrane of the microorganism,

(2) treating the melt containing TPO with a chaotropic substance,

(3) refold the TPO,

(4) a method of purifying biologically active TPO from microorganisms, which comprises separating impurities and misfolded TPOs from suitably folded TPOs.

Detailed description of the drawings

FIG. 1 shows the deduced amino acid sequence (SEQ ID NO: 1) and coding nucleotide sequence (SEQ ID NO: 2) of human mpl ligand (hML) cDNA. Nucleotides were numbered from the beginning of each row. 5 'and 3' untranslated regions are shown in lowercase letters. The amino acid residues are indicated on the sequence starting at Ser1 of the protein sequence of the mature mpl ligand protein (ML) sequence. The estimated boundary of exon 3 is indicated by an arrow and the potential N-glycosylation site has a rectangular border. Cysteine residues are indicated by dots above the sequence. The underlined sequences correspond to N-terminal sequences determined from mpl ligands purified from porcine plasma.

2 shows an experimental method for mpl ligand ³ H-thymidine incorporation analysis. To determine the presence of mpl ligands in various sources, mpl P Ba / F3 cells were starvated with IL-3 in 5% CO ₂ and air in a humidified incubator for 24 hours. After IL-3 starvation, cells were seeded in 96 well culture dishes with or without diluted samples and incubated in cell incubators for 24 hours. During the last 6-8 hours 20ul of serum-free RPMI medium containing 1 uCi of ³ H-thymidine was added to each well. Cells were then harvested in 96 well filter plates and washed with water. The radiation value was measured in the filter.

FIG. 3 shows the effect of pronase, DTT and heat on APP's ability to stimulate Ba / F3 mpl cell proliferation. To cleave APP using pronase, pronase (Möllinger Mannheim) or bovine serum albumin was coupled to Affi-gel10 (Biorad) and individually incubated with APP at 18 ° C. for 18 hours. The resin was then removed by centrifugation and the supernatant analyzed. APP can also be heated at 80 ° C. for 4 minutes or dialyzed against PBS by formulating 100 uM DTT.

4 shows the activity of mpl ligand eluates from phenyl toyopearl, blue sepharose and ultra link-mpl columns. 4-8 fractions from mpl affinity chromatography are the peak active fractions eluted from the column.

Figure 5 shows the SDS-PAGE of the eluted ultralink-mpl fractions. To 200 ul of each of the 2-8 fractions, 1 ml of acetone containing 1 mM HCl was added at -20 ° C. After 3 hours, the sample was centrifuged at −20 ° C. and the resulting pellet was washed twice with acetone at −20 ° C. Subsequently, acetone pellets were dissolved in 30 ul of SDS solubilization buffer to prepare 100 uM DTT and heated at 90 ° C. for 5 minutes. Samples were then split on 4-20% SDS-polyacrylamide gels and the proteins visualized by silver staining.

6 shows the mpl ligand activity of the eluate from SDS-PAGE. The sixth fraction from the mpl affinity column was separated on 4-20% SDS-polyacrylamide gels under non-reducing conditions. After electrophoresis, the gel was cut into 12 equal sizes and eluted as described in the examples. Electroeluted samples were dialyzed against PBS and analyzed at 1/20 fold dilution. The Mr standard used to calibrate the gel was the Novex Mark 12 standard.

Figure 7 shows the effect of mpl ligand-free APP on human megakaryocyte formation. The mpl ligand free APP was prepared by passing 1 ml through 1 ml of mpl affinity column (700 ug mpl-IgG / ml NHS-superrose, Pharmacis). Human peripheral hepatocyte cultures were treated with 10% APP or 10% mpl ligand free APP and incubated for 12 days. Megakaryocyte formation was quantified as described in the Examples below.

8 shows the effect of mpl-IgG on stimulation of human megakaryocyte formation by APP. Human peripheral hepatocyte medium was treated with 10% APP and incubated for 12 days. At 0, 2 and 4 days mpl-IgG (0.5 ug) or ANP-R-IgG (0.5 ug) was added. After 12 days megakaryocyte formation was quantified as described in the Examples below. The average of two sets of samples is plotted on the graph and the two measured data are listed in parentheses.

9 shows two strands of 390 bp of human genomic DNA encoding the mpl ligand. The deduced amino acid sequence of “exon 3” (SEQ ID NO: 3), coding sequence (SEQ ID NO: 4), and its complement (SEQ ID NO: 5).

10 shows deduced amino acid sequences of mature human mpl ligand (hML) (SEQ ID NO: 6) and mature human erythropoietin (hEPO) (SEQ ID NO: 7). The expected amino acid sequence of the human mpl ligand was arranged alongside the human erythropoietin sequence. Identical amino acids have a square border and the gaps generated for proper alignment are indicated by dashes. Potential N-glycosylation sites are underlined with solid lines for hML and underlined for hEPO. The two cysteines that are important for erythropoietin activity are marked with large dots.

Figure 11 shows the deduced amino acid sequence (SEQ ID NO: 6), hML2 (SEQ ID NO: 8), hML3 (SEQ ID NO: 9) and hML4 (SEQ ID NO: 10) of mature human mpl ligand isoform hML. Shows. Identical amino acids have a square border and gaps introduced for proper alignment are indicated by dashes.

12A, 12B, and 12C are quantified tests using radiolabeled IgG monoclonal antibodies specific for Ba / F3-mpl cell proliferation of human mpl ligand (A), megakaryocyte glycoprotein GPll _b lll _a (B) The effect on rat platelet formation (C) measured in ductal human megakaryocyte formation, and platelet reflex assay.

293 cells were infected overnight with pRK5 vector alone or with pRK5-hML or pRK5-ML _{153 according} to CaPO ₄ method (Gorman, C in DNA Cloning: A New Approach 2: 143-190 [1995]) (pRK5-ML ₁₅₃ was prepared by introducing a stop codon after residue 153 of hML by PCR). Cultures were then conditioned for 36 hours and analyzed for stimulation of proliferation of Ba / F3-mpl (A) or in vitro human megakaryocyte formation (B) as described in Example 1 (A) below. Megakaryocyte formation was assayed using a ¹²⁵ I labeled mouse IgG monoclonal antibody (HP1-1D) for the megakaryocyte specific glycoprotein GPll _b lll _a as described in Grant et al., Blood 69: 1334-1339. It was. The effect of partially purified recombinant ML (rML) on in vivo platelet production (C) is described by McDonald's in TP Proc. Soc. Exp. Biol. Med. 144: 1006-10012 (1973), as determined using reflex platelet formation assay. Partially purified rML was prepared from 200 ml of conditioned medium containing recombinant ML. The culture was passed through a 2 ml Blue-Separose column equilibrated in PBS and the column was washed with PBS and eluted with PBS containing 2M urea and NaCl, respectively. The active fractions were dialyzed against PBS and treated with endotoxin free BSA to a concentration of 1 mg / ml. The sample contains less than 1 unit of endotoxin per milliliter. Mice were injected with 6, 000, 32000 or 16000 units of rML or excipient alone. Each group consisted of 6 mice. List the mean and standard deviation of each group. p values were determined by a two-tailed T-test comparing the median.

Figure 13 compares the effects of modification with human mpl ligand isoforms on Ba / F3 mpl cell proliferation assays. hML, mock, hML2, hML3, hML (R153A, R154A) and hML ₁₅₃ were analyzed at various dilution concentrations as described in Example 1.

14A, 14B and 14C show the deduced amino acid sequence (SEQ ID NO: 1) and human genomic DNA coding sequence (SEQ ID NO: 11) of human mpl ligand (hML) or human TPO (hTPO). Nucleotide and amino acid residues were numbered from the beginning of each row.

15 shows SDS-PAGE of purified 293-rhML ₃₃₂ and purified 293-rhML ₁₅₃ .

Figure 16 shows the nucleotide sequence (cDNA coding sequence (SEQ ID NO: 12) and deduced amino acid sequence (SEQ ID NO: 13) of the open reading frame of the mouse's ML isoform). This mature mouse mpl ligand isoform consists of 331 amino acid residues, which is 4 less than the estimated full-length mML and is expressed as mML2. Nucleotides are numbered from the beginning of each line. Potential N-glycosylation locations are underlined. Cysteine residues are indicated by dots above the sequence.

Figure 17 shows the cDNA sequence (SEQ ID NO: 14) and the expected protein sequence (SEQ ID NO: 15) of the ML isoform (mML) of this mouse. Nucleotides are numbered from the beginning of each row. Amino acid residues are numbered above the sequence starting with Ser1. This mature mouse mpl ligand isoform contains 335 amino acid residues and is believed to be a full-length mpl ligand expressed in mML. Signal sequences are indicated by dashed lines and breakable points are indicated by arrows. 5 'and 3' untranslated regions are shown in lowercase letters. The two dropouts found as a result of alternative splicing (mML2 and mML3) are underlined. Four cysteine residues are shown as dots. Seven potential N-glycosylation sites have a rectangular border.

Figure 18 compares the deduced amino acid sequence of human ML isoform hML3 (SEQ ID NO: 9) and the amino acid sequence of rat ML isoform mML3 (SEQ ID NO: 16). The expected amino acid sequence of the human mpl ligand was arranged side by side with the mouse mpl ligand sequence. Identical amino acids have a square border and gaps generated for proper alignment are indicated by dashes. Amino acids were numbered from the beginning of each row.

Figure 19 compares the expected amino acid sequences of mouse ML (SEQ ID NO: 17), porcine-ML (SEQ ID NO: 18) and human-ML (SEQ ID NO: 6). The amino acid sequences were arranged side by side, with the gaps introduced for the proper alignment shown in dashes. Amino acids were numbered from the beginning of each row and identical residues were square borders. Potential N-glycosylation sites are indicated by shadowed square borders and cysteine residues by dots. Conserved dibasic amino acid motifs with potential protease cleavage sites are underlined. Four amino acid dropouts were found in all three species (ML2) and bordered by a bold box.

20 shows the cDNA sequence (SEQ ID NO: 19) and expected mature protein sequence (SEQ ID NO: 18) of porcine ML isoform (pML). This porcine mpl ligand isoform contains 332 amino acid residues and is believed to be a full-length porcine mpl ligand, expressed in pML. Nucleotides were numbered from the beginning of each row. Amino acid residues are numbered above the sequence starting at Ser1.

21 shows the cDNA sequence (SEQ ID NO: 20) and expected mature protein sequence (SEQ ID NO: 21) of porcine ML isoform (pML2). This porcine mpl ligand isoform contains 328 amino acid residues and is believed to have been eliminated by the 4 residues of the full-length porcine mpl ligand, represented by pML2. Nucleotides were numbered from the beginning of each row. Numbers of amino acid residues are shown above the sequence beginning with Ser1.

Figure 22 compares the deduced amino acid sequence of full-length pig ML isoform pML3 (SEQ ID NO: 18) with the deduced amino acid sequence of pig ML isoform pML2 (SEQ ID NO: 21). The expected amino acid sequence of pML was arranged side by side with the pML2 sequence. Identical amino acids have a square border and gaps generated for proper alignment are indicated by dashes. Amino acids were numbered from the beginning of each row.

Figure 23 shows the appropriate characteristics of plasmid pSV15.ID.LL.MLORF (full length or TPO ₃₃₂ ) used to infect host CHO-DP12 cells in the preparation of CHO-rhTPO ₃₃₂ .

FIG. 24 shows suitable features of the plasmid pSV15.ID.LL.MLEPO-D (fusion type or TPO ₁₅₃ ) used to infect host CHO-DP12 cells in the preparation of CHO-rhTPO ₁₅₃ .

25A, 25B, and 25C show the effect of E. coli-rhTPO (Met- ¹ , 153) on platelets (A), erythrocytes (B), and leukocytes (C) in normal mice. A PBS buffer in a day to two groups of 6 female C57 B6 mice or of 0.3 ug E. coli-rhTPO (Met -1, 153) (100 ul, subcutaneous injection) were injected. On days 0 and 3-7, 40 ul of blood was drawn from the orbital sinus. This blood was immediately diluted in 10 ml of a commercially available diluent and the final blood level was obtained using the Serrono Baker Hematology Analyzer 9018. This data is presented in the form of standard error of mean ± mean.

Figures 26A, 26B and 26C show the effect on platelets (A), erythrocytes (B) and leukocytes (C) in mice examined at sub-lethal levels of E. coli-rhTPO (Met- ¹ , 153). . Examine the gamma rays 750 cGy from a ¹³⁷ Cs source to two groups consisting of 10 female C57 B6 mice, and PBS buffer per day or 3.0 ug E. coli-rhTPO (Met -1, 153) (100 ul, subcutaneous injection), a Injection. At 0 and subsequent intermediate time points, 40 ul of blood was drawn from the orbital sinus. This blood was immediately diluted in 10 ml of a commercially available diluent and the final blood level was obtained using the Serrono Baker Hematology Analyzer 9018. This data is presented in the form of standard error of mean ± mean.

27A, 27B and 27C show the effects of CHO-rhTPO ₃₃₂ on platelets (A), erythrocytes (B) and leukocytes (C) in normal mice. Two populations of 6 female C57 B6 mice were injected with PBS buffer or 0.3 ug CHO-rhTPO ₃₃₂ (100 ul, subcutaneous injection) per day. On days 0 and 3-7, 40 ul of blood was drawn from the orbital sinus. This blood was immediately diluted in 10 ml of a commercially available diluent and the final blood level was obtained using the Serrono Baker Hematology Analyzer 9018. This data is presented in the form of standard error of mean ± mean.

Figure 28 shows dose-response curves of various forms of rhTPO from various cell lines. Dose-response curves were prepared for rhTPO from the following cell lines: hTPO ₃₃₂ from CHO (full length form from Chinese hamster egg cells); hTPO _Met- 1 ₁₅₃ (E. coli induced fusion with N-terminal methionine); hTPO ₃₃₂ (full length TPO from human 293 cells); Met 155 E Coli free (melting from E. coli without terminal methionine [rhTPO ₁₅₅ ]). Six female C57B6 mouse groups were injected with rhTPO according to the group daily for 7 days. Daily 40 ul of blood was taken from the orbital sinus and used for final blood cell counts. The data represent the maximum effect observed for various treatments, except for (met 153 E. Coli) which occurred on day 7 of the treatment period. Maximum effect in the "met 153 E. Coli" group was observed on day 5. This data is presented in the form of standard error of mean ± mean.

FIG. 29 shows a dose-response curve comparing the full length and “clipped” form of rhTPO produced in CHO cells with the nodal form from E. coli. A population of six female C57B6 mice received 0.3 ug of rhTPO of various types per day. On days 2-7, 40 ul of blood was taken from the orbital sinus and used to determine final blood levels. Treatment groups included TPO ₁₅₃ , a TPO fusion from E. coli; TPO ₃₃₂ (Mix fraction), a full length TPO containing about 80-90% of its length and 10-20% of the clipped form; TPO332 (30K fraction) = purified clipped fraction from initial “Mix” formulation; TPO332 (70K fraction) = purified full length TPO fraction from the initial “Mix” formulation. This data is presented in the form of standard error of mean ± mean.

30 shows a KIRA ELISA for measuring TPO. This figure shows the final structure (right side of the figure) as well as a flowchart (left side of the figure) showing the relevant parts of the MPL / Rse.gD chimera and origin receptor and the relevant steps of this assay.

Fig. 31 is a flowchart showing each step in the experimental method of KIRA ELISA analysis.

32A-32L provide the nucleotide sequence of the expression vector pSVl17.ID.LL (SEQ ID NO: 22) for use in expressing Rse.gD of Example 17.

33 is a schematic of preparation of plasmid pMP1.

34 is a schematic of the preparation of plasmid pMP21.

35 is a schematic of preparation of plasmid pMP151.

36 is a schematic of the preparation of plasmid pMP202.

37 is a schematic of the preparation of plasmid pMP172.

38 is a schematic of preparation of plasmid pMP210.

Fig. 39 is a table showing the five TPO clones with the highest expression in the pMP210 plasmid bank.

40 is a schematic of the preparation of plasmid pMP41.

Figure 41 is a schematic of the preparation of plasmid pMP57.

42 is a schematic of preparation of plasmid pMP251.

Detailed description of the invention

I. Definition

In general, the following terms or phrases have the meanings defined below when used in the description, examples, and claims.

A "chaotropic substance" refers to a compound that can cause changes in the spatial arrangement and morphology of a protein by partially disrupting the forces involved in maintaining the normal secondary and tertiary structure of the protein in aqueous solution and at appropriate concentrations. Such compounds include, for example, urea, guanidine-HCl and sodium thiocyanate. High concentrations of these compounds, usually from 4 to 9 M, are needed to have morphological effects on the protein.

"Cytokin" is a generic name for proteins that are released from a group of cells and act as intracellular mediators to other cells. Examples of such cytokines are lymphokines, monokines, and traditional polypeptide hormones. Cytokines include growth hormone, insulin-like growth factor, human growth hormone, N-methionyl human growth hormone, bovine growth hormone, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin, prolysine, follicle stimulating hormone (FSH) Glycoprotein hormones, such as thyroid stimulating hormone (TSH) and progesterone (LH), hematopoietic growth factor, liver growth factor, erythrocyte growth factor, prolactin, placental lactogen, tumor necrosis factor-α (TNF-α and TNF-β) ), Mullerian inhibitors, mouse gonadotropin-related peptides, inhibin, activin, vein endothelial growth factor, integrin, nerve growth factors such as NGF-β, platelet growth factor, TGFs-α and TGFs-β Transforming growth factors (TGFs), insulin-like growth factors-I and -II, erythropoietin (EPO), bone inducible factors. Interferons such as interferon-α, -β, and -γ, colony stimulating factors (CSFs) such as megakaryocyte CSF (M-CSF), granulocyte-macrophage-CSF (GM-CSF) and granulocyte-CSF (G-CSF) Such as IL-1, IL-1α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12 Interleukins (IL's) and other polypeptide factors including LIF, SCF and kit ligands. As used herein, the terms are intended to include proteins from natural sources or from recombinant cell culture. In the same context, the terms are intended to include biological equivalents (eg, differences in one or more amino acids on an amino acid sequence or in the type or extent of glycosylation).

ML, defined below, that has the property of binding to mpl, which is used interchangeably with "mpl ligand", "mpl ligand polypeptide", "ML", "thrombopoietin" or "TPO" and is a member of the cytokine receptor phase All polypeptides having the biological properties of include. Representative biological properties are the ability to stimulate the incorporation of labeled nucleotides (eg ³ H-thymidine) into DNA of IL-3 dependent Ba / F3 cells infected with human mpl P. Another representative biological property is the ability to stimulate the incorporation of ³⁵ S into circulating platelets in mouse reflex assays. This definition includes polypeptides isolated from mpl ligand sources, such as aplastic pig porcine plasma or other sources, such as other animal species, including humans, or prepared by recombinant or synthetic methods, and include organoleptic derivatives, fragments, allele traits. And variants including isoforms and analogs thereof.

A "mpl ligand fragment" or "TPO fragment" is a portion of a naturally occurring full length mpl ligand from which one or more amino acid residues or carbohydrates have been eliminated. The missing amino acid residue (s) can be present anywhere in the peptide, including the N-terminus or C-terminus or the interior. This fragment shares one or more biological properties with mpl ligands. The mpl ligand fragment is typically 10, 15, 20, 25, 30, or 40 identical to the sequence of the mpl ligand isolated from mammals, including ligands isolated from aplastic pig porcine or human or rat ligands, in particular its EPO domain. It will have a continuous sequence of more than one amino acid. Examples of representative N-terminal fragments are hML ₁₅₃ or TPO (Met- ¹ 1-153).

A "mpl ligand variant" or "mpl ligand sequence variant" as defined herein is an mpl ligand isolated from recombinant cells or aplastic pigs having a deductive sequence described in Figure 1 (SEQ ID NO: 1) as defined below. Or a biologically active mpl ligand as defined below having less than 100% sequence identity with a human ligand. Typically, biologically active mpl ligand variants have at least about 70% amino acid sequence identity with a mpl ligand or mature rat or human ligand or fragment thereof isolated from aplastic pig porcine plasma (see FIG. 1 (SEQ ID NO: 1)). Has an amino acid sequence. Sequence identity is preferably at least about 75%, more preferably at least about 80%, even more preferably at least about 85%, even more preferably at least about 90% and most preferably at least about 95%.

A “chimeric mpl ligand” is a polypeptide consisting of a full-length mpl ligand or one or more fragments thereof fused or bound to a second heterologous polypeptide or one or more fragments thereof. The chimera will share one or more properties with the mpl ligand. The second polypeptide is usually a cytokine, immunoglobulin, or fragment thereof.

"Isolated mpl ligand", "highly purified mpl ligand" and "substantially uniform mpl ligand" are used interchangeably with each other and represent mpl ligands prepared by purifying the mpl ligand source or by recombinant or synthetic methods, and other peptides. The teat or protein has been sufficiently removed (1) using either a spinning cup sequenator or a best-available amino acid sequencer or an amino acid sequencer modified according to the methods disclosed as of the filing date of the present application. A sequence of at least 15, preferably 20 amino acid residues of the internal amino acid sequence can be obtained or (2) by SDS-PAGE under non-reducing or reducing conditions, using Coomassie blue or preferably silver stain. It means a mpl ligand capable of obtaining uniformity. Uniformity herein means less than about 5% contamination with other source proteins.

"Biological properties" when used in conjunction with "mpl ligands" or "isolated mpl ligands" mean either platelet forming activity or directly or indirectly by mpl ligands (regardless of natural or processed form) or fragments thereof. It means having the effector or antigen function or activity in vivo caused or performed by. Effector functions include mpl binding and other carrier binding activities, amplification or antagonism of mpl, in particular replication, DNA regulatory functions, cytokine, receptor (especially cytokine) activation, inactivation, up-regulation or down-regulation, cell growth or differentiation, etc. Transmission of proliferative signals including biological activity is included. Antigen function means possessing an epitope or antigenic position that can cross react with an antibody made against a native mpl ligand. The main antigenic function of mpl ligand polypeptides is approximately 10 ⁶ in antibodies prepared against mpl ligands isolated from aplastic pig blood plasma. to bind with an affinity of l / mol or less. Typically, this polypeptide is about 10 ⁷ bind with an affinity of l / mol or less. Most preferably the antigenically active mpl ligand polypeptide is a polypeptide that binds to an antibody prepared against a mpl ligand having one of the above effector functions. Antibodies used to define “biological activity” are formulated in Freund's medium with mpl ligand isolated from recombinant cell medium or aplastic pig porcine plasma, injected subcutaneously and reaching the titer of the mpl ligand antibody pleto. It is a rabbit polyclonal antibody produced by intraperitoneal injection of this agent to elicit an immune response.

“Biologically active” when used in conjunction with “mpl ligand” or “isolated mpl ligand” has platelet forming activity or is isolated from aplastic pig plasma or expressed in the recombinant cell medium described herein. A mpl ligand or polypeptide that shares the effector function of the mpl ligand. The main known effector function of the mpl ligands or polypeptides of the invention binds to mpl, stimulating the labeled nucleotide ( ³ H-thymidine) to be incorporated into the DNA of IL-3 dependent Ba / F3 cells infected with human mpl P. will be. Another known effector function of the mpl ligand or polypeptide is to stimulate the incorporation of ³⁵ S into circulating platelets in mouse platelet reflex assays. Another known effector function of the mpl ligand is its ability to stimulate human megakaryocyte formation in vitro (specific to the megakaryocyte glycoprotein GPII _b III _a and quantifiable using radiolabeled monoclonal antibodies).

“Percent amino acid sequence identity” to an mpl ligand sequence is used herein to arrange sequences side by side and, if necessary, introduce a gap to obtain the maximum percent sequence identity, provided that conservative substitutions are not considered part of sequence identity. Is defined as the percentage of amino acid residues in a candidate sequence that show identity to residues of a mpl ligand sequence or a mouse or human ligand isolated from aplastic pig plasma having a deduced amino acid sequence (SEQ ID NO: 1) as described in FIG. . Insertors into N-terminal, C-terminal or internal extenders or dropping groups or mpl ligands should be considered not to affect sequence identity and homology. As such, representative biologically active mpl ligand polypeptides that are thought to have the same sequence include prepro-mpl ligands, pro-mpl ligands, and mature mpl ligands.

"mpl ligand microsequencing" can be performed according to any suitable standard method that is sufficiently sensitive. In one such method, the highly purified polypeptide obtained from the SDS gel or from the final HPLC step was subjected to automated Edman (phenyl) using a Model 470A Applied Biosystems gas phase sequencer equipped with a 120A phenylthiohydantoin (PTH) amino acid analyzer. Isothiocyanate) digestion. In addition, fragment purification after chemical (e.g. CNBr, hydroxylamine, 2-nitro-5-thiocyanobenzoate) or enzymatic (e.g. trypsin, Clostripain, staphylococcal protease) digestion Ampl ligand fragments prepared by (eg HPLC) are also sequenced in a similar manner. PTH amino acids are analyzed using a chromperfect data system (Justice Innovationa, Palo Alto, Calif.). Sequence analysis is described in VAX 11/785 Digital Equipment Co. It is performed using a computer (Henzel et al., Chromatography, 404: 41-52 [1978]). Optionally, partial portions of HPLC fractions can be electrophoresed on 5-20% SDS-PAGE, electrophoresed to PVDF membranes (ProBlott, AIB, Foster City, CA) and stained using Coomassie Brilliant Blue ( Matsurdiara, J. Biol. Chem., 262: 10035-10038 [1987]). The specific protein identified by this dye is cut out from the blot portion and characterized by the N-terminal sequence using a gaseous sequencer according to the method described above. For internal protein sequences, HPLC fractions were dried under vacuum (SpeedVac), resuspended in appropriate buffer, cyanogenbromide, Lys-specific enzyme Lys-C (Wako Chemicals, Richmond, VA) or Asp-N (Boeringer Mannheim). , Indianapolis, IN). After digestion, the resulting peptides are sequenced in the form of a mixture or gas phase sequence after cleavage by HPLC on a C4 column developed using a propanol gradient in 0.1% TFA.

"Thrombocytopenia" indicates that the number of platelets in a liter of blood is less than 150 × 10 ⁹ .

A "platelet forming activity" is defined as a biological activity consisting of accelerating the proliferation, differentiation and / or maturation of megakaryocytes or megakaryocyte progenitor cells into their platelet production form. This activity was measured by in vivo platelet reflex assay, platelet cell surface antigen induction assay (anti-GPII _b III _a ) against human leukemia megakaryocyte cell line (CMK) and multiploidy in megakaryocyte cell line (DAMI). It can be measured by various assays, including induction.

"Trompopoietin (TPO)" is defined as a compound that has the ability to form platelets or can increase serum platelet counts in mammals. TPO can preferably increase the number of necrotic platelets by at least 10%, more preferably by 50%, and in humans most preferably increase the platelet count by at least 150 × 10 ⁹ per liter of blood.

An “isolated mpl ligand nucleic acid” is an RNA or DNA containing at least 16, preferably at least 20, contiguous nucleotide bases that encode a biologically active mpl ligand or fragment thereof and is complementary or complementary to the RNA or DNA Or hybridize with the RNA or DNA to remain stable bound under moderate and harsh conditions. This RNA or DNA does not comprise one or more contaminating source nucleic acids that are normally associated with each other in a natural source, and preferably contains substantially no other mammalian RNA or DNA. The phrase “does not include one or more contaminating source nucleic acids that are normally in bound state with one another” means that the nucleic acid is present in the source or natural cell, provided that the nucleic acid is present in another chromosomal location or is normally present in the source cell. Includes cases where no nucleic acid sequence not found within is inserted. Examples of isolated mpl ligand nucleic acids include at least 75% sequence identity, more preferably at least 80% sequence identity, even more preferably at least 85% sequence identity, even more preferably 90%, with mpl ligands of human, rat or pig RNA or DNA encoding a biologically active mpl ligand having the above sequence identity, most preferably at least 95% sequence identity.

In the context of expression “regulatory sequence” means the DNA sequence required for the expression of a functionally linked coding sequence in a particular host organism. Regulatory sequences suitable for prokaryotic cells include, for example, promoters, optionally operator sequences, ribosomal binding sites, and possibly others that are not yet well known. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

By "functionally linked" with respect to a nucleic acid is meant that a particular nucleic acid is located in a functional relationship with another nucleic acid sequence. For example, if the DNA of a presequence or secretory leader is expressed as a shear protein involved in the secretion of a polypeptide, it is functionally bound to the DNA of the polypeptide, and if the promoter or enhancer affects the transcription of the sequence, These are functionally linked to this coding sequence, or if a ribosome binding site is present to encourage translation, it is functionally bound to the coding sequence. In general, "functionally linked" means that the bound DNA sequences are contiguous with each other and, in the case of a secretory leader, contiguous and readable. However, enhancers do not have to be contiguous. Linking is linked by ligation at advantageous restriction sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers can be used in accordance with conventional practice.

"Exogenous" when used in connection with a factor refers to the presence of a factor in the host cell nucleic acid that is not normally found, even if it is derived from or extracellular.

"Cells", "cell lines", and "cell cultures" are used interchangeably herein and include the cell or all child cells of the cell line. That is, for example, "variants" and "modified cells" include primary test cells and cultures derived therefrom regardless of metastasis values. It will also be appreciated that due to intentional or accidental mutations, all progeny cells may not exactly match each other in DNA content. Also included are mutant progeny cells that have the same function or biological activity as that detected for early modified cells. If a clear name is intended, it will be clarified from the contextual relationship.

A "plasmid" is a circular DNA molecule that has independent origins of replication and can be arbitrarily replicated, and is represented herein by writing the small letter "p" before the word and optionally followed by capital letters and / or numbers. Starting plasmids used in the present invention may be commercially available, without limitation, or prepared from such commercially available plasmids according to published methods. Other corresponding plasmids are also known in the art and will be apparent to those of ordinary skill in the art.

“Restriction enzyme digestion” used in connection with DNA refers to catalytic cleavage of the internal phosphodiester bonds of the DNA with enzymes that act only at specific locations or sites of the DNA sequence. Such enzymes are called "limiting endonucleases". Each restriction endonuclease recognizes a specific DNA sequence called a "restriction site" with double symmetry. Various restriction enzymes used in the present invention are commercially available and the reaction conditions, coenzymes and other requirements determined by the supplier of the enzyme are used. Restriction enzymes are usually denoted by an uppercase letter followed by other letters representing the microorganism from which each restriction enzyme was obtained and a number representing the specific enzyme. Generally, about 1 ug of plasmid or DNA fragment is used with about 1 to 2 units in about 20 ul of buffer. The amount of suitable buffer and substrate used for a particular restriction enzyme is defined by the manufacturer. It is usually incubated at 37 ° C. for about 1 hour but can be varied as directed by the supplier. After incubation, the protein or polypeptide is extracted and removed with phenol and chloroform, and the digested nucleic acid can be recovered in the aqueous fraction by ethanol precipitation. After digestion with restriction enzymes, the 5 'terminal phosphate can be hydrolyzed with bacterial alkaline phosphatase to prevent the two DNA ends from "cyclizing" to one another to form a closed loop, preventing another DNA from being inserted into the restriction site. Unless stated otherwise, the plasmid is not digested followed by the dephosphation process at the 5 'end. Methods and reagents for dephosphate are in accordance with conventional methods as described in section 1.56-1.61 of Sambrook et al., Molecular Cloning: A Laboratory Manual [New York: Cold Spring Harbor Laboratory Press, 1989]. .

The "recovery" or "isolation" of a given fragment of DNA from a restriction digest is followed by separation of the digestion on polyacrylamide or agarose gel by electrophoresis, followed by the mobility of the marker DNA fragment with a known molecular weight and the desired fragment. By comparing the mobility, the target fragment is identified, and the gel section containing the target fragment is removed to separate the gel from the DNA. This method is generally known. See, eg, Lawn et al., Nucleic Acids Res., 9: 6103-6114 [1981] and Goeddel et al., Nucleic Acids Res., 8: 4057 [1980].

"Southern analysis" or "southern blotting" refers to the presence of a labeled oligonucleotide or DNA fragment, known as the presence of a DNA sequence in a restriction enzyme endonuclease digest of a DNA or DNA-containing composition. It is a method of confirming by hybridizing to. Southern analysis is typically performed by electrophoresis of DNA fragments on an agarose gel, followed by denaturation of DNA and transfer of the DNA to nitrocellulose, nylon or other suitable membrane support to radiolabeled or biotinylated or enzyme-labeled probes. Analysis steps using [Sambrook et al., Sections 9.37-9.52 of supra].

"Northern analysis" or "northern blotting" is a method used to identify RNA sequences hybridized with known probes such as oligonucleotides, DNA fragments, cDNAs or fragments or RNA fragments thereof. The probe is labeled with a radioactive isotope, or biotin or enzyme such as ³² P. The RNA to be analyzed is usually electrophoretically separated on agarose or polyacrylamide gels using standard methods known in the art, such as those described in sections 7.39-7.52 of Sambrook et al., Supra, followed by nitrocellulose. After transfer to nylon, or other suitable membrane, hybridize with the probe.

"Ligation" is the process of forming phosphodiester bonds between two nucleic acid fragments. For ligation of two sections, both ends of the section must be suitable for ligation. In some cases, both ends may be suitable immediately after endonuclease digestion. However, there is a need to replace staggered ends that occur after endonuclease digestion with blunt ends to be suitable for ligation. To blunt the ends, the DNA is quenched in a suitable buffer at 15 ° C. for at least 15 minutes with about 10 units of clebnow sections of DNA polymerase I or T4 DNA polymerase in the presence of four deoxynucleotide triphosphates. Process. The DNA is then extracted with phenol-chloroform and precipitated with ethanol. DNA fragments to be ligated with each other are added to the solution in approximately equal molar amounts. This solution contains about 10 units of ligase such as ATP, ligase buffer, and T4 DNA ligase per 0.5 ug of DNA. If DNA is ligated to the vector, the vector is first chained by digesting with appropriate restriction endonucleases. The straightened sections are then treated with bacterial alkaline phosphatase or calf intestinal phosphatase to prevent self ligation during the ligation step.

"Preparation" of DNA from a cell means the isolation of plasmid DNA from the culture of the host cell. Commonly used methods for DNA preparation are large and small scale plasmid preparation methods, as described in section 1.25-1.33 of Sambrook et al., Supra. After the DNA is prepared, it can be purified according to methods known in the art described in section 1.40 of Sambrook et al., Supra.

"Oliconucleotides" can be obtained using known methods (e.g., solid phase techniques described in European Patent No. 266,032 published May 4, 1988, or by Froehler et al., Nucl. Acids Res., 14: 5399-5407 [1986] of short, single or double strands chemically synthesized by phosphoriester, phosphite or phosphoramidite chemistry using deoxynucleotide H-phosphonate intermediates Polydeoxynucleotides. Additional methods include polymerase chain reaction and autoprimer methods described below, and oligonucleotide synthesis on solid supports. All of these methods are described in Engels et al., Agnew. Chem. Int. Ed. Engls. 28: 716-734 [1989]. These methods are used when the sequence of the entire nucleic acid of the gene is known or the sequence of the nucleic acid complementary to the coding strand can be known. Alternatively, if the target amino acid sequence is known, possible nucleic acid sequences can be inferred using known preferred coding residues corresponding to each amino acid residue. This oligonucleotide is then purified on polyacrylamide gel.

"Polymerase chain reaction" or "PCR" is a method or technique for augmenting a particular amount of traces of nucleic acid, RNA and / or DNA, as described in US Pat. No. 4,683,195, issued July 28, 1987. . Subsequently, in order to prepare oligonucleotide primers, it is necessary to know sequence information about the ends of the region of interest or adjacent extension portions thereof, the sequence of these primers being identical or similar to the sequence of the other strand of the template to be extended. Do. The 5 'terminal nucleotides of the two primers will match the ends of the extended material. PCR is used to amplify specific genomic DNA and specific RNA sequences, such as cDNA, bacteriophage or plasmid sequences transcribed from whole cell RNA, and specific DNA sequences. [Generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51: 263 [1987]; Erlich, ed., PCR Technology, (Stockton Press, NY, 1989). The term PCR, as used herein, is one example and method of nucleic acid polymerase reaction methods for nucleic acid test sample enrichment consisting of using known nucleic acids and nucleic acid polymerases as primers to extend or prepare specific fragments of nucleic acid. It is not an example.

“Stringent conditions” means (1) using conditions of low ionic strength and high temperature at washing, eg, 0.015 M NaCl / 0.0015 M sodium citrate / 0.1% NaDodSO ₄ (SDS) and 50 ° C. or (2) 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polybitylpyrrolidine / 50 mM sodium phosphate containing formamide, for example 750 mM NaCl, 75 mM sodium citrate, as denaturation reagent in the hybridization. Conditions using buffer pH 6.5. Other examples include 50% formamide, 5 × SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 × Denhardt's solution, sonication Trout sperm DNA (50 ug / ml). 0.1% SDS, and 10% dextran sulphate are used at 42 ° C. and 42 ° C. and 0.2 × SSC and 0.1% SDS are used for washing.

"Moderately harsh conditions" are described in Sambrook et al., Supra and use of less severe wash solutions and hybridization conditions (eg, temperature, ionic strength and% SDS) than in the case of such harsh conditions. Examples of moderate harsh conditions include 20% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × Denhardt solution, 10% dextran sulfate And incubated at 37 ° C. in a solution consisting of denatured sheared trout sperm DNA (20 ug / ml) followed by washing at about 37-50 ° C. in 1 × SSC. One skilled in the art will know how to adjust temperature, ionic strength, etc. as needed to adjust factors such as probe length.

"Abs" or "immunoglobulins (Igs)" are glycoproteins with the same structural characteristics. While antibodies show binding specificity for specific antigens, immunoglobulins include antibodies and other antibody like molecules that do not have antigen specificity. The latter kind of polypeptide is produced, for example, at low concentrations in the lymphatic system and at high concentrations in myeloma.

“Natural antibodies and immunoglobulins” are typically heterotetrameric glycoproteins of about 150,000 Daltons and consist of two identical light chains and two identical heavy chains. Each light chain is linked to the heavy chain by one disulfide bond, and the number of disulfide bonds varies with different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced interchain disulfide bridges. Each heavy chain has at one end a variable domain (V _H ) and several constant domains linked thereto. Each light chain has a variable domain (V _L ) at one end and a constant domain at the other end; The constant domain of the light chain is arranged side by side with the first constant domain of the heavy chain, and the light chain variable domain is arranged side by side with the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light and heavy chain variable domains (Clothia et al., J. Mol. Biol., 186: 651-663 [1985]; Novontny and Habor, Proc. Natl. Acad Sci. USA, 82: 4592-4596 [1985]).

The term "variable" means that differences in the sequence of certain portions of the variable domains appear broadly between antibodies and that each particular antibody is used to specifically bind its specific antigen. However, the variability is not evenly distributed throughout the variable regions of the antibody. Variability is concentrated in three segments called complementarity determining regions (CDRs) or hypervariable regions of the light chain and heavy chain variable domains. A more conserved portion of the variable domain is called a framework (FR). The variable domains of the natural heavy and light chains each consist of four FR regions, which generally take the β-sheet structure, form the loop linkages and in some cases form three CDRs that form part of the β-sheet structure; It is connected. The CDRs in each chain are very closely linked to each other by the FRs and contribute to forming the antigen binding site of the antibody with the CDRs from the other chain (Kabat et al., Sequences of Proteins of Immumological Interest, National Inatitute of Health, Bethesda, MD [1987]). The constant domains are not directly involved in binding the antibody to the antigen but exhibit various effector functions, including being involved in antigen dependent cytotoxicity.

Papain digestion of antibodies yields "Fc" fragments, which can be readily seen to crystallize from two identical antigen binding fragments called "Fab" fragments, each with a single antigen binding site and name. Treatment with pepsin results in F (ab ') ₂ having two antigen binding sites and still cross-linking to the antigen.

"Fv" is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of one heavy chain and one light chain that are tightly coupled non-covalently. It is in this structure that the three CDRs of each of the variable domains interact to form an antigen binding site on the surface of the V _H -V _L dimer. In total, these six CDRs provide the specificity of binding to the antibody. However, even a single variable domain (or half of the Fv consisting of only three CDRs specific for the antigen) has the ability to recognize and bind antigens, although with a lower affinity than the overall antigen binding site.

Fab fragments also include the constant domain of the light chain and the first constant domain of the heavy chain (CH1). The Fab 'fragment differs from Fab in that it additionally has several residues at the carboxy terminus of the heavy chain CH1, including one or more cysteines of the antibody hinge region. Fab'-SH herein refers to Fab 'in which the cysteine residues of the constant domains have free thiol groups. F (ab ') ₂ antibody fragments were originally made as a pair of Fab' fragments with hinge cysteines in between. The fact that antibody fragments are otherwise chemically coupled is also known.

The "light chains" of antibodies of the vertebrate species (immunoglobulins) can be classified into distinctly distinct types, called kappa and lambda (λ), depending on the amino acid sequence of the constant domain.

Depending on the amino acid sequence of the constant domain of the heavy chain, immunoglobulins can be classified into different classes. The five major classes of immunoglobulins are lgA, lgD, lgE, lgG and lgM, some of which can be further classified into subclasses (isotypes) (eg lgG-1, lgG-2, lgG-). 3 and lgG-4; lgA-1 and lgA-2). Corresponding heavy chain constant domains of different classes of immunoglobulins are named alpha, delta, epsilon, gamma, and mu, respectively. The subunit structures and tertiary structures of different classes of immunoglobulins are well known.

The term "antibody" is used in a broad sense and specifically refers to a single monoclonal antibody (including agonist and antagonistic antibodies), an antibody composition with polyepitope specificity and an antibody fragment (e.g., Fab, F (ab ') ₂ and Fv).

As used herein, the term "monoclonal antibody" refers to an antibody obtained from a group of substantially homogeneous antibodies, i.e., except in the case of probable naturally occurring mutations in which the individual antibodies that make up the group are present in small amounts. And are the same. Monoclonal antibodies bind highly specific to a single antigenic site. In addition, unlike conventional (polyclonal) antibody preparations which usually include different antibodies that bind to different determinants (epitopes), each monoclonal antibody binds only to a single determinant of the antigen. In addition to specificity, it is advantageous that monoclonal antibodies can be prepared from hybridoma cultures without being contaminated by other immunoglobulins. The modifier "monoclonal" refers to a property of an antibody that is obtained from a group of substantially uniform antibodies, and does not mean that the antibody should be prepared by a particular formulation. For example, the monoclonal antibodies used in the present invention are referred to the hybridoma method [Nature 256: 495 (1975)] or recombinant DNA method [Ca. Patent No. 4.816.567 Cabilly et al.] First published by Koller and Milstein. ] Can be prepared.

A monoclonal antibody herein includes a portion of the heavy and / or light chain that is derived from a particular species or is homologous or homologous to the corresponding sequence of an antibody belonging to a particular antibody class or subclass, wherein said chain (s) "Chimeric" antibodies (immunoglobulins) that are derived from, or homologous to, the corresponding sequence of an antibody derived from a specific species other than the stomach or belonging to a specific antibody class or subclass different from the stomach, and the desired biological activity. Eggplants include fragments of one such antibody [US Patent No. 4.816.567 Cabilly et al; And Morrison et al., Proc. Natl. Acad. Sci. USA 81: 6851-6855 [1984].

A “humanized” form of nonhuman (eg murine) antibodies is a chimeric immunoglobulin comprising a minimal sequence derived from a nonhuman immunoglobulin. Immunoglobulin chains or fragments thereof (eg Fv, Fab, Fab ', F (ab') ₂ ). Mostly, humanized antibodies are humans in which residues of a complementary determining region (CDR) of a human antibody are substituted with residues of a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit, having the desired specificity, affinity and potency. Immunoglobulin. For example, Fv framework residues of human immunoglobulins are replaced with corresponding non-human residues. Humanized antibodies may also include residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. Such modifications are made to improve and optimize antibody function. In general, humanized antibodies are substantially all composed of one or more, typically two variable domains, where all or substantially all CDR regions correspond to CDR regions of non-human immunoglobulins and all or substantially all FR regions FR regions of human immunoglobulin matched sequences. Preferably the humanized antibody will comprise at least one immunoglobulin constant region (Fc), generally the constant region of human immunoglobulin. For further details see John et al., Naure 321: 522-525 [1986]; Reoghman et al., Nature, 332: 323-329 [1988] and Presta, Curr. Op. Struct. Biol. 2: 593-596 [1992].

II Preferred Embodiments of the Invention

Preferred polypeptides of the invention have the property of binding to mpl, which is a member of the receptor cytokine family, and to stimulate the incorporation of ³ H-thymidine into the DNA of IL-3 dependent Ba / F3 cells infected with human mpl P. It is a substantially uniform polypeptide called mpl ligand or thrombopoietin (TPO) that has properties. More preferred mpl ligand (s) are isolated mammalian proteins that can stimulate hematopoietic, in particular megakaryocytic or plateletogenic activity, ie immature megakaryocytes or their precursor cells to proliferate, mature and / or differentiate into mature platelet production forms. . Most preferred polypeptides of the invention are human mpl ligands (including fragments thereof) having hematopoietic, megakaryogenic or platelet forming activity. Optionally these human mpl ligand (s) are not glycosylated. Another preferred human mpl ligand amino acid sequence of Figure 1, called the called hML, hML ₂₄₅ or hTPO section of hML called the ₂₄₅ yunghyeong and hML, hML ₃₃₂ or hTPO ₃₃₂ to hML ₁₅₃ or hTPO _153: with (SEQ ID NO 1) "EPO-domain" and biologically active substitution-modified hML (R153A, R154A) of mature full-length polypeptides.

Any preferred polypeptide of the invention is a biologically or immunologically active mpl ligand variant selected from hML2, hML3, hML4, mML, mML2, mML3, pML and pML2.

Preferred optional polypeptides of the invention include human mpl ligands (see FIG. 1: [SEQ ID NO: 1]), mouse mpl ligands (see FIG. 16: [SEQ ID NO: 12 & 13]), recombinant porcine mpl ligands ( Figure 19: [SEQ ID NO: 18]) or at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85% with mpl ligands isolated from aplastic pig porcine plasma; And, even more preferably, biologically active mpl ligand variant (s) having an amino acid sequence having at least 90%, most preferably at least 95% sequence identity.

The mpl ligand isolated from aplastic pig blood has the following properties:

(1): Partially purified ligand elutes with 60000-70000 Mr in a gel filtration column using PBS, PBS containing 0.1% SDS or PBS containing SDS or 4M MgCl ₂ ;

(2): the activity of this ligand is destroyed by pronase;

(3): this ligand is stable to low pH (2.5), 0.1% SDS and 2M urea;

(4): Based on binding to various lectin columns, this ligand is a glycoprotein;

(5): Highly purified ligand elutes from non-reducing SDS-PAGE with Mr of 25000-35000. Small amounts of active elute with 18000-22000 or less and 60000 Mr;

(6): Highly purified ligand is split into doublets with Mr of 28000 and 31000 on reduced SDS-PAGE;

(7): amino terminal sequences of the bands 18000-22000, 28000 and 31000 are all identically SPAPPACDPRLLNKLLRDDHVLHGR (SEQ ID NO: 29);

(8): This ligand binds to and elutes from the following affinity column

Blue Sepharose,

CM blue sepharose,

MONO-Q,

MONO-S,

Lentil Lectin-Sepharose,

WGA-Sepharose,

Con A-Sepharose,

Ether 650 m toyopearl,

Butyl 650 m Saturday Pearl,

Phenyl 650 m toyopearl, and

Phenyl Sepharose.

More preferred mpl ligand polypeptides are those encoded by the human genome or cDNA having the amino acid sequence of FIG. 1 (SEQ ID NO: 1).

Other preferred naturally occurring biologically active mpl ligand polypeptides of the invention are prepro-mpl ligands, pro-mpl ligands, mature mpl ligands, mpl ligand fragments and glycosylation variants thereof.

Still other preferred polypeptides of the invention include mpl ligand sequence variants and chimeras. Typically, preferred mpl ligand sequence variants and chimeras are at least 70%, preferably at least 75%, more preferably at least 80%, even more preferably at least 85 with mpl ligands isolated from human mpl ligand or aplastic pig porcine plasma. , Even more preferably a biologically active mpl ligand variant having at least 90%, most preferably at least 95% sequence identity. An exemplary preferred mpl ligand variant is an N-terminal domain hML variant (called "EPO-domain" due to sequence homology with erythropoietin). Preferred hML EPO domains are called hML ₁₅₃ and consist of the first 153 amino acid residues of mature hML. Optionally preferred hML sequence variants include those in which one or more basic or dibasic amino acid residues of the C-terminal domain have been replaced with nonbasic amino acid residues (eg hydrophobic, neutral, acidic, aromatic, Gly, Pro, etc.). Preferred hML C-terminal domain sequence variants include those in which Arg residues 153 and 154 are substituted with Ala residues. This variant is called hML ₃₃₂ (R153A, R154A). Another preferred hML variant includes hML ₃₃₂ or hML ₁₅₃ in which amino acid residues 111-114 (QLPP or LPPQ) have been eliminated or substituted with other tetrapeptide sequences (eg AGAG, etc.). The dropout mutations are called Δ4hML ₃₃₂ or Δ4hML ₁₅₃ .

Preferred chimeras are fusions of mpl ligands or fragments thereof (defined below) with heterologous polypeptides or fragments thereof. For example, hML ₁₅₃ may be fused with a lgG fragment to improve serum half-life or may be fused with IL-3, G-CSF or EPO to become a molecule with enhanced platelet formation or chimeric hematopoietic activity.

Other preferred human mpl ligand chimeras are 153 to 157 hML of N-terminus substituted with one or more (but not all) human EPO hML residues when arranged roughly side by side as shown in FIG. 10 (SEQ ID NO: 7). "ML-EPO domain chimera" comprising residues. In this embodiment, the hML chimera is about 153 in length, with individual or one block of residues of the human EPO sequence added or substituted with the hML sequence at a position corresponding to the arrangement shown in FIG. 10 (SEQ ID NO: 6). And from 166 residues. Representative block sequence insertions into the N-terminal portion of hML include (EPO) one or more N-glycosylation positions at 24-27, 38-40 and 83-85; (EPO) one or more four expected amphiphilic α-helical bundles at positions 9-22, 59-76, 90-107, and 132-152; And highly conserved regions, including N-terminal and C-terminal regions and residue positions (epo) 44-52 [Wen wt al., Blood, 82: 1507-1516 [1993] and Biossel et al., J Biol. Chem., 268 (21): 15983-15993 [1993] It will be appreciated that this "ML-EPO domain chimera" will have a hybrid platelet formation-erythrocyte formation (TEPO) biological activity.

Other preferred polypeptides of the invention include at least 10, 15, 20, 25, 30, or 40 amino acids identical to the sequence of an mpl ligand isolated from aplastic pig blood or a human mpl ligand described herein (see Table 14, Example 24). Mpl ligand fragments having a contiguous sequence with residues are included. Preferred mpl ligand fragments are human ML [1-X], wherein human X is 153, 191, 205, 217, 229 or 245 (see FIG. 1 (see SEQ ID NO: 1 for the sequence of 1-X). Ligand fragments include those prepared as the product of chemical or enzymatic hydrolysis of this purified ligand.

Another preferred aspect of the invention is contacting an mpl ligand source containing an mpl ligand molecule with an immobilized receptor polypeptide, specifically a mpl or mpl fusion polypeptide, under conditions in which the mpl ligand molecule to be purified selectively adsorbs to the immobilized receptor polypeptide, This immobilization support is washed to remove non-adsorbed material and eluting buffer to elute the molecules to be purified from the immobilized receptor polypeptide. If the source containing the mpl ligand is plasma, the immobilized receptor is preferably mpl-lgG fusion.

In another method, the mpl ligand containing source is a recombinant cell culture in which the concentration of mpl ligand in culture medium or cell lysate is higher than the concentration in plasma or natural source. In this case, the mpl-lgG immunoaffinity method (although it is used) is usually unnecessary and more conventional, and known protein purification methods can be applied. In short, the preferred purification method of providing a substantially uniform mpl ligand removes particulate debris from the host cell or lysed fragments, for example by centrifugation or ultrafiltration, and concentrates the protein with a commercial protein concentration filter. , Immunoaffinity, ion exchange (e.g., matrix containing DEAE or carboxymethyl or sulfopropyl groups), blue sepharose, CM blue sepharose, MONO-Q, MONO-S, lentillectin sepharose, WGA-sepharose , Con A-Sepharose, ether toy, butyl toy, phenyl toy, Protein A Sepharose, SDS-PAGE, reversed phase HPLC (e.g. silica gel with attached aliphatic group) or Sephadex molecular sieve or molecular exclusion chromatography And separating this ligand from other impurities by one or more steps selected from ethanol or ammonium sulphate precipitation. Protease inhibitors such as methylsulfonylfluoride (PMSF) can be included in any of the above steps to inhibit proteolysis.

In a preferred embodiment, the invention provides an isolated antibody capable of binding to a mpl ligand. Preferred mpl ligand isolating antibodies are monoclonal (Kohler and Milstein, Nature, 256: 495-497 [1975]; Campbell, Laboratory Techniques in Biochemistry and Molecular Biology, Burdon et al., Eds, volume 13 elsvier science publisers, Amsterdam [1985] and Huse wt al., Science, 246: 1275-1281 [1989]. Preferred mpl ligand isolated antibodies are those that bind an mpl ligand with an affinity of at least about 10 ⁶ l / mol. More preferably, the antibody binds with an affinity of at least about 10 ⁷ l / mole. Most preferably, this antibody is prepared against a mpl ligand having one or more of said effector functions. An isolated antibody capable of binding to a mpl ligand can optionally be fused to a second polypeptide and the antibody or fusion thereof can be used to isolate or purify the mpl ligand from a source as described for the immobilized mpl polypeptide. In a further preferred aspect of this embodiment, the present invention is directed to an in vitro or in vivo mpl ligand consisting in contacting a sample suspected of containing a mpl ligand, in particular a serum sample, with contact occurring after the binding is generated. A detection method is provided.

In a further preferred embodiment, the invention is complementary or severe to a nucleic acid molecule that is or is not labeled with a detectable moiety and that has a nucleic acid molecule encoding a mpl ligand or fragment thereof and a sequence encoding a mpl ligand. Or nucleic acid molecules having sequences that can hybridize under moderate harsh conditions. Preferred mpl ligands are biologically biologically possessing at least 75%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% sequence identity with human mpl ligands. RNA or DNA encoding the active mpl ligand. More preferred isolated nucleic acid molecules include (a): DNA based on the coding region of the mammalian mpl ligand gene (eg, DNA or fragments thereof consisting of the nucleotide sequences provided in FIG. 1 (SEQ ID NO: 2)); (b) DNA capable of hybridizing with the DNA of (a) above moderate to severe conditions; And (c) a DNA sequence encoding a biologically active mpl ligand selected from DNA degenerate into DNA defined in (a) or (b) due to degeneracy of the genetic code. The novel mpl ligands described herein are members of ligands or cytokines with appropriate sequence identity such that their DNA is inferior or intermediate to the DNA (or complement thereof or fragment thereof) of Figure 1 (SEQ ID NO: 2). It will be appreciated that hybridization will occur under severe conditions of degree. As such, another aspect of the invention includes DNA encoding the mpl ligand polypeptide and hybridizes under moderate or moderate harsh conditions.

In a further preferred embodiment of the invention, the nucleic acid molecule is a cDNA encoding a mpl ligand and further comprises a replicable vector containing said cDNA operably linked to a regulatory sequence recognized by a host infected with a replicable vector. do. This aspect further comprises recovering the mpl ligand from the host cell culture by expressing the cDNA encoding the mpl ligand in a culture of the infected host cell, including the host cell infected with the replicable vector and encoding the mpl ligand. It includes a method using the cDNA. The mpl ligand prepared in this way is preferably a substantially uniform human mpl ligand. Preferred host cells for preparing mpl ligands are

 Chinese hamster egg (CHO) cells.

The present invention further includes a preferred method of treating a mammal having an immune or hematopoietic disease, in particular thrombocytopenia, consisting of administering to the mammal a therapeutically effective amount of mpl ligand. Optionally this mpl ligand may be administered in combination with a cytokine, in particular a colony stimulating factor or interleukin. Preferred colony stimulating factors or interleukins include kit-ligand, LIF, G-CSF, GM-CSF, M-CSF, EPO, IL-1, IL-2, IL-3, IL-5, IL-6, IL- 7, IL-8, IL-9 or IL-11.

III, manufacturing method

Platelet production has long been thought to be regulated by multiple lineage specific humoral factors by some authorities. Two separate cytokine activators, called megakaryocyte colony stimulating factor (meg-CSF) and thrombopoietin, were thought to regulate megakaryocyte formation and platelet formation (Williams et al., J. Cell Phisiol. 110: 101 -104 [1982]; Williams et al., Blood. Cells 15: 123-133 [1989]; and Gordon et al., Blood, 80: 302-307 [0992]. According to this hypothesis, meg-CSF stimulates proliferation of prokaryotic cells in megakaryocytes, and thrombopoietin mainly affects the maturation and final platelet release of more differentiated cells. Since the 1960s, there have been many reports of induction and appearance of meg-CSF and thrombopoietin activity in plasma, serum and urine after the development of thrombocytopenia in animals and humans [Odell et al., Proc. Soc. Exp. Biol. Med., 108: 428-431 [1961]; Nakeff et al., Acta Haematol. 54: 340-344 [1975]; Specter, Proc. Soc. Exp. Biol. 108: 146-149 [1961]; Schreiner et al., J. Clin. Invest. 49: 1709-1713 [1970]; Ebbe, Blood, 44: 605-608 [1974]; Hoffman et al., N. Engl. H. Med., 305: 553 [1981]; Straneva et al., Exp. Hematol. 17: 1122-1127 [1988]; Mazur et al., Exp. Hematol. 13: 1164 [1974]; Mazur et al., J. Clin, Invest. 68: 733-741 [1981]; Sceiner et al., Blood, 56: 183-188 [1980]; Hill et al., Exp. Hematol., 20: 354-360 [1992]; And Heygi et al., Int. J. Cell Cloning, 8: 236-244 [1990]. These activities have been reported to be lineage specific and distinct from known cytokines [Hill R.J. et al., Blood 80: 346 (1992); Erickson-Miller C. L. et al., Brit, J, Heamatol., 84: 197-203 (1993); Straneva J.E. et al., Exp. Hematol. 20: 4750 (1992): and Tsukada J. et al., Blood 81: 866-867 [1993]. To date, attempts to purify meg-CSF or thrombopoietin from plasma or urine in thrombocytopenia have not been successful.

In connection with the above observation of plasma of thrombocytopenia, the inventors have found that aplastic pig porcine plasma (APP) obtained from irradiated pigs stimulates human megakaryocyte formation in vitro. We found that this stimulatory activity is disrupted by the soluble extracellular domain of c-mpl, identifying APP as a potential source of putative mpl ligand (ML). We have now successfully purified mpl ligands from APP and amino acid information was used to isolate murine, porcine and human ML cDNAs. These MLs have sequence homology with erythropoietin and have meg-CSF and thrombopoietin-like activity.

1. Purification and Identification of mpl Ligand from Plasma

As indicated above, aplastic plasma from various species has activity to stimulate hematopoiesis in vitro, but no hematopoietic stimulating factor has yet been reported to have been isolated from plasma. This aplastic pig plasma (APP) stimulates human hematopoiesis in vitro. To determine if the APP contains a mpl ligand, its effect by measuring the insertion of ³ H-thymidine into Ba / F3 cells infected with human mpl P (Ba / F3-mpl) in the manner as shown in FIG. Was analyzed. APP stimulated the insertion of ³ H-thymidine into Ba / F3 mpl cells but not Ba / F3 control cells (ie: cells not infected with human mpl P). In addition, this activity was not observed in normal pig plasma. These results show that APP transmits proliferative signals through the mpl receptor and therefore contains factors or ligands that may be natural ligands of this receptor. This was also supported by the discovery that treating APP with soluble mpl-IgG blocked the stimulatory effects of APP on Ba / F3 cells.

The activator in the APP appeared to be a protein in view of the fact that pronase, DTT or heat disrupted the activity in the APP. This activator is also nondialysis. However, the activator is stable at low pH (pH 2.5 for 2 hours) and binds to several lectin affinity columns to elute, indicating that it is a glycoprotein. It was further affinity purified from APP using mpl-IgG chimera to elucidate the structure and identity of this activator.

The APP was processed according to the protocols presented in Examples 1 and 2. In sum, mpl ligands were purified using hydrophobic interaction chromatography (HIC), immobilized dye chromatography, and mpl affinity chromatography. Recovery of the activator from each step is shown in FIG. 4 and fold purification is provided in Table 1. The overall recovery of activator from the mpl-affinity column is about 10%. The peak activator fraction (F6) from the mpl affinity column is about 9.8 x 10 ⁶ Has an estimated specific activity of unit / mg. Overall purification of 5 liters of APP was about 4 × 10 ⁶ fold (0.8 units / mg to 3.3 × 10 ⁶ units / mg) with 83 × 10 ⁶ -fold reduction in protein (250 gms to 3 μg). We estimated that the specific activity of the ligand eluted from the mpl affinity column would be less than 3 × 10 ⁶ units / mg.

Sample Volume (ml)  Protein mg / ml Unit / ml  Unit Inactive Units / mg Yield%  Tablet drainage APP 5000 50 40 200,000 0.8 - One Phenyl 4700 0.8 40 200,000 50 94 62 Blue-Sepharose  640 0.93 400 256,000 430 128 538 mpl (μl)   12 5 x 10 ^-4 1666  20,000 3,300,000 10 4,100,000

Proteins were determined by Bradford assay. The protein concentration of the mpl elution fractions 5 to 7 is an estimate based on the staining intensity of SDS-gel stained with silver. One unit is defined as the value that causes 50% of the maximum stimulus amount of Ba / F3-mpl cell proliferation.

Analysis of the elution fractions from the mpl affinity column using SDS-PAGE (4-20%, Novex gel) running under reducing conditions revealed the presence of several proteins (FIG. 5). The silver stained protein with the strongest intensity was split alongside the apparent Mr of 66000, 55000, 30000, 28000 and 18000-22000. To determine which proteins stimulate the proliferation of Ba / F3-mpl cell cultures, these proteins were eluted from the gel as described in Example 2.

According to the results of this experiment, most of the activator is eluted from the gel piece containing proteins with Mr. 28000 to 32000 and a smaller amount of the activator is eluted in the 18000-22000 region of the gel (Figure 6). The only proteins observed in this region are Mr 30000, 28000 and 18000-22000. In order to identify and obtain protein sequences of proteins that split in this region of the gel (eg bands at 30, 28 and 18-22 kDa), these three proteins were electrically blown into PVDF as described in Example 3. And sequenced. The resulting amino terminal sequences are shown in Table 2.

< Table 2>

Computer-aided analysis shows that these amino acid sequences are novel. Because these three sequences were identical, it was believed that the 30 kDa, 28 kDa and 18-22 kDa proteins are related to each other and may be different forms of the same novel protein. In addition, since the activator was cleaved in the same region (28000-32000) of the 4-20% gel of SDS-PAGE, this protein (s) was likely a candidate for the native mpl ligand. In addition, when gel filtration chromatography using a Superrose 12 (Pharmacia) column, the partially purified ligand migrated with 17000-30000 Mr. It is believed that different Mr aspects of the ligand are the result of proteolytic or glycosylation differences or other post- or pre-translational modifications.

As mentioned above, anti-sensitized human mpl RNA inhibits megakaryocyte formation in human bone marrow cultures enriched for CD 34 ⁺ progenitor cells but does not affect the differentiation of other hematopoietic cell lineages (Methia et al., Supra). These results suggest that this mpl receptor plays a role in seedling and proliferation of megakaryocytes in vitro. To further elucidate the function of the mpl ligand in megakaryocyte formation, the effects of APP and mpl ligand depleted APP on in vitro human megakaryocyte formation were compared. The influence of APP on human megakaryocyte formation was measured using one variation of the liquid suspension megakaryocyte formation assay as described in Example 4. In this assay, human peripheral hepatocytes (PSCs) were treated with APP before and after mpl-IgG affinity chromatography. GPII _b III _a stimulation of megakaryocyte formation was quantified using ¹²⁵ I-anti-II _b III _a antibodies (FIG. 7). As shown in FIG. 7, 10% APP could induce a stimulating effect about 3 times, whereas APP without mpl ligand had no effect. Practically, APP without mpl ligand removal did not induce proliferation of Ba / F3-mpl cells.

In another experiment, soluble human mpl-IgG was added to cultures containing 10% APP on days 0, 2, and 4 which disrupted the stimulatory effect of APP on human megakaryocyte formation (FIG. 8). These results suggest that the mpl ligand functions as a regulator of human megakaryocyte formation and thus may be useful in the treatment of thrombocytopenia.

2. Molecular Cloning of the mpl Ligand

Based on the amino terminal amino acid sequences obtained from the 30 kDa, 28 kDa and 18-22 kDa proteins, two degenerate oligonucleotide primer pools were planned and used to increase pig genomic DNA by PCR. If the amino terminal amino acid sequence was encoded by only one exon, the correct PCR product was estimated to be 69 bp in length. DNA fragments of this size were found and subcloned with pGEMT. The sequence of the oligonucleotide PCR primers and the three clones obtained are shown in Example 5. The amino acid sequence of the peptide encoded between the PCR primers (PRLLNKLLR [SEQ ID NO: 33]) was identical to the sequence obtained by amino terminal protein sequencing of the porcine ligand (9-17 residues of the 28 and 30 kDa porcine proteins above). Reference).

Synthetic oligonucleotides based on the sequences of PCR fragments are used to search human genomic DNA libraries. 45-mer oligonucleotides called pR45 were designed and synthesized based on the sequence of the PCR fragment. This oligonucleotide had the following sequence:

5'GCC-GTG-AAG-GAC-GTG-GTC-GTC-ACG-AAG-CAG-TTT-ATT-TAG-GAG-TCG-3 '

(SEQ ID NO: 34)

This deoxyoligonucleotide was used to search the human genomic DNA library in λgem12 under the less severe hybrid hybrid and wash conditions of Example 6. Positive clones were taken and flake purified and analyzed by restriction mapping and Southern blotting. The 390 bp EcoRI-XbaI fragment hybridizing to the 45-mer was subcloned into pBluescript SK-. DNA sequencing of the clones confirmed that the DNA encoding the human homolog of the pig mpl ligand was isolated. This human DNA sequence and deduced amino acid sequence are shown in Figure 9 (SEQ ID NO: 3 & 4). The predicted intron position in the genomic sequence is also indicated by the arrow and the putative exon (“exon 3”) was determined.

Based on the human “exon 3” sequence (Example 6), oligonucleotides corresponding to the 3 ′ and 5 ′ ends of the exon sequence were synthesized. These two primers were used in the PCR reaction as a template using cDNA prepared from various human tissues. The expected size of the correct PCR product was 140 bp. After analysis of the PCR product on a 12% polyacrylamide gel, DNA fragments of expected size were detected in human adult kidney, cDNA library prepared from 293 fetal kidney cells and cDNA prepared from human fetal liver.

Fetal liver cDNA libraries (7 × 10 ⁶ clones) in lambda DR2 were searched using the 45-mer oligonucleotides that were used to search fetal liver cDNA libraries under human genome libraries and under severe harsh conditions. Positive clones were taken, flakes were purified and insertion size determined using PCR. Clones with 1.8 kb inserts were selected for subsequent analysis. The method described in Example 7 was used to obtain nucleotide and deduced amino acid sequences of human mpl ligand (hML). These sequences are shown in Figure 1 (SEQ ID NO: 1 & 2).

3, the structure of human mpl ligand (hML)

The human mpl ligand (hML) cDNA sequence (FIG. 1 [SEQ ID NO: 2]) consists of 1774 nucleotides followed by a poly (A) tail. It represents a 5 'untranslated sequence of 215 nucleotides and a 3' untranslated region of 498 nucleotides. The putative initiation codon at nucleotide positions 216-218 is in a matching sequence suitable for initiation of eukaryotic cellular translation. The open reading frame is 1059 nucleotides in length and encodes 353 amino acid residue polypeptides starting at nucleotide position 220. The N-terminus of the expected amino acid sequence is very hydrophobic and probably seems to correspond to the signal polypeptide. Computer analysis of the predicted amino acid sequence (von Heijne et al., Eur. J. Biochem., 133: 17-21 [1983]) indicates that residues 21 and 22 are potential cleavage sites for signal peptidase. Cleavage at this position forms a mature polypeptide of 332 amino acid residues starting from the amino terminal sequence obtained from the mpl ligand purified from porcine plasma. The expected non-glycosylated molecular weight of this 332 amino acid residue ligand is about 38 kDa. There are six potential N-glycosylation sites and four cysteine residues.

Comparing the mpl ligand sequence with the Genbank sequence database revealed that the amino acid 153 residues of the mature human mpl ligand and human erythropoietin show 23% identity (FIG. 10: [SEQ ID NO] : 6 & 7]). Considering conservative substituents, this region of hML shows 50% similarity to human erythropoietin (hEPO). Both hEPO and hML contain four cysteines. Three of the four cysteines (including the first and last cysteines) are conserved in hML. Site-directed mutagenesis experiments show that the first and last cysteines of erythropoietin form disulfide bonds necessary for function (Wang F. F. et al., Endocrinology 116: 2286-2292 [1983]). Likewise, the first and last cysteines of hML also form important disulfide bonds. None of the glycosylation sites is conserved in hML. All potential hML N-binding glycosylation sites are located on the carboxy terminal half of the hML polypeptide.

Like hEPO, hML mRNAs do not contain the coincident polyadenylation sequence AAUAAA and do not have the regulatory element AUUUA, which is present in the 3 'untranslated region of many cytokines and is thought to affect mRNA stability (Shawet et al., Cell, 46: 659-667 [1986]). Northern blot analysis revealed low concentrations of a single 1.8 kb hML RNA in fetal and adult livers. After prolonged exposure, weaker bands of the same size are detected in the adult liver. In contrast, human erythropoietin is expressed in fetal liver and for hypoxia in adult kidney and liver (Jacobs et al., Nature, 313: 804-809 [1985] and Bondurant et al., Molec. Cell. Biol. , 6: 2731-2733 [1986]).

The importance of the C-terminal region of hML is not yet fully understood. Based on the fact that there are six potential sites of N-linked glycosylation, this region of hML is likely to be glycosylated. In some gel elution experiments, activators that split with about 60000 Mr, indicating full length glycosylation molecules, were observed. The C-terminal region may therefore serve to stabilize circulating hML and increase its half-life. In the case of erythropoietin, the non-glycosylated form has complete in vitro biological activity but significantly reduced plasma half-life compared to glycosylated erythropoietin (Takeuchi et al., J. Biol. Chem., 265: 12127- 12130 [1990]; Narhi et al., J. Biol. Chem., 266: 23022-23026 [1991] and Spivak et al., Blood, 7: 90-99 [1989]. The C-terminal domain of hML contains two dibasic amino acid sequences (Arg-Arg motifs at positions 153-154 and 245-246) that can serve as potential processing sites. Cleavage at these sites appears to be involved in the production of 30, 28 and 18-22 kDa forms of ML isolated from APP. Indeed, the Arg ₁₅₃ -Arg ₁₅₄ sequence immediately follows the ML's erythropoietin-like domain. These observations suggest that, through limited proteolysis, full-length ML represents a precursor protein that forms a mature ligand.

4. Isoforms and variants of human mpl ligands

Isoforms or other spliced forms of human mpl ligands were detected by PCR in human adult liver. In sum, primers were synthesized to correspond to both ends as well as selected internal regions of the coding sequence of hML. These primers were used in RT-PCR to increase the RNA of human adult liver as described in Example 10. Full-length forms, represented by hML, and three other forms, represented by hML2, hML3, and hML4, were observed or deduced. The mature deduced amino acid sequences of all four isoforms are shown in FIG. 11 (SEQ ID NO: 6, 8, 9 & 10). hML3 loses 116 nucleotides at position 700, causing amino acid dropouts and frameshifts. The cDNA now encodes a mature polypeptide that is 265 amino acids long and differs from the hML sequence at 139 amino acid residues. Finally hML4 shows 12 nucleotide dropouts (also observed in mouse and pig sequences (see below)) and 116 bp dropout after the 618 nucleotide position observed in hML3. Clones showing 12 bp dropouts (after 619 nucleotide positions) have not yet been isolated in humans (labeled hML2), but these isoforms have been identified in mice and pigs (see below) and nucleotide dropouts in hML4 This form will exist because it has been identified in relation to.

To determine if full-length ML is required for biological activity, an "EPO domain" truncation of hML and hML with the dibasic Arg ₁₅₃ -Arg ₁₅₄ sequence replaced by two alanine residues was prepared. Arg ₁₅₃ -Arg ₁₅₄ dibasic sequence substitution variants, called hML (R153A, R154A), were prepared using PCR as described in Example 10. A "EPO domain" fusion, hML ₁₅₃ was also prepared using PCR by introducing a stop codon after Arg153.

5. Expression of recombinant human mpl ligand (rhML) in transiently infected human embryonic kidney (293) cells

To confirm that the cloned human cDNA encodes a mpl ligand, this ligand was expressed in mammalian 293 cells under the control of the cytomegalovirus intermediate early promoter using expression vectors pRK5-hML or pRK5-hML ₁₅₃ . It has been found that supernatants from transiently infected human embryonic kidney 293 cells stimulate ³ H-thymidine insertion in Ba / F3-mpl cells but not in progenitor Ba / F3 cells. Cultures from 293 cells infected only with the pRK vector alone did not have this activity. The addition of mpl-IgG to the medium eliminated this activity (data not shown). This result indicates that the cloned cDNA encodes a functional human ML (hML).

To determine whether only "EPO-domain" binds to and activates mpl, the truncated forms of hML, rhML ₁₅₃ were expressed in 293 cells. Supernatants from infected cells were found to have activities similar to those present in supernatants from cells expressing full-length hML (FIG. 12A), indicating that the C-terminus of ML is not required for binding and activation of c-mpl. It turned out.

6. mpl ligand stimulates megakaryocyte formation and platelet formation

Both full length rhML and recombinant rhML ₁₅₃ of recombinant hML stimulated human megakaryocyte formation in vitro (FIG. 12B). This effect was observed even in the absence of other exogenous hematopoietic growth factors. Except for IL-3, the ML is the only subject hematopoietic growth factor that exhibits this activity. IL-11, IL-6, IL-1, erythropoietin, G-CSF, IL-9, LIF, kit ligand (KL), M-CSF, OSM and GM-CSF, when tested separately in this assay, It did not affect megakaryocyte formation (data not shown). This result shows that ML has megakaryocyte stimulating activity and the role of ML in regulating megakaryocyte formation.

Thrombocytopenia The platelet activating agents present in the plasma of animals appear to stimulate platelet production in mouse reflex platelet formation assays (McDonald, Proc. Soc.Exp. Biol. Med., 14: 1006-1001 [1973] and MecDonald) et al., Scand. J. haematol., 16 326-334 [1976]. In this model, mice are acutely developed with thrombocytopenia using antiplatelet serum, leading to predictable reflex thrombocytopenia. Just as hypoxia mice are more sensitive to erythropoietin than normal mice, these immune thrombocytomic mice respond better to exogenous thrombopoietin-like activity than normal mice (McDonald, et al., J. Lab. Clin. Med. , 77: 134-143 [1971]. To determine if rML stimulates platelet production in vivo, mice in reflex thrombocytopenia are injected with partially purified rhML. Platelet count and the degree of ³⁵ S insertion into platelets were quantified. Injection of 64000 or 32000 units of rML into mice significantly increased platelet production, evidenced by a 20% increase in platelet count in control mice injected with excipients only for treated mice (p = 0.0005 and 0.0001 each) The degree of insertion of ³⁵ S into platelets increased by 40% (FIG. 12C). This level of stimulation is comparable to that observed for IL-6 in this model (data not shown). Treatment with 16000 units of rML did not significantly stimulate platelet production. These results show that ML stimulates platelet production in a dose dependent manner and therefore has thrombopoietin-like activity.

293 cells were also infected with the other hML isoform constructs and their supernatants were analyzed using Ba / F3-mpl proliferation assay (FIG. 13). hML2 and hML3 showed no detectable activity in this assay, but the activity of hML (R153A, R154A) is similar to hML and hML _{153 so} that processing at the Arg ₁₅₃ -Arg ₁₅₄ dibasic sites is not necessary and impairs activity. It does not indicate that.

7. megakaryocyte formation and mpl ligand

Megakaryocyte formation has been suggested to be regulated at multiple cellular levels (Williams et al., J. Cell Phisiol., 110: 101-104 [1982] and Williams et al., Blood Cells, 15: 123-133 [1989] ). The proposal is based primarily on the observation that certain hematopoietic growth factors stimulate megakaryocyte proliferation, while other hematopoietic growth factors appear to have a major influence on the maturation of megakaryocytes. These results presented herein suggest that ML acts as a proliferation and maturation factor. It is supported by a series of evidence that ML stimulates proliferation of megakaryocyte progenitor cells. First, APP stimulates proliferation and maturation of human megakaryocytes in vitro and this stimulation is completely inhibited by mpl-IgG (7 and 8 degrees). In addition, inhibition of megakaryocyte colony formation by c-mpl antisensitizing oligonucleotides (Methia et al., EMBO, 12: 2645-2653 [1993]) and the discovery that c-mpl can transmit proliferative signals into cells infected with itself (Skoda et., EMBO, 12: 2645-2653 [1993] and Vigon et al., Oncogene, 8: 2607-2615 [1993]) also suggest that ML stimulates proliferation. Apparent expression of c-mpl (Methia et al., Blood, 82: 1395-1401 [1993]) during all stages of megakaryocyte differentiation and the ability of recombinant ML to stimulate platelet production rapidly in vivo, Influences. Recombinant ML is easy to obtain and can closely assess its role in the regulation of megakaryocyte formation and platelet formation as well as its potential to affect other hematopoietic lineages.

8. Isolation of the Human mpl Ligand (TPO) Gene

Human genomic DNA clones of the TPO gene were isolated by searching for human genome libraries in λ-Gem12 with pR45 under poorly severe or highly severe conditions using 3 'half of the human cDNA encoding the mpl ligand. . Two overlapping lambda clones up to 35 kb were isolated. Two overlapping fragments (BamH1 and EcoRI) containing the entire TPO gene were subcloned and sequenced (Figures 14A, 14B and 14C).

The structure of the human gene consists of six exons in 7 kb genomic DNA. The linking sites of all exo / introns match consensus motifs defined for mammalian genes (Shapiro, M. B. et al., Nucl. Acids Res. 15: 7155 [1987]). Exon 1 and exon 2 comprise the 5 ′ untranslated sequence and the first four amino acids of the signal peptide. The remainder of this secretion signal and the first 26 amino acids of the mature protein are encoded in exon 3. The entire amino acid and carboxyl domain and 3 'untranslated portion of this erythropoietin-like domain are encoded in exon 6. The four amino acids involved in the dropout observed in hML-2 (hTPO-2) are encoded at the 5 'end of exon6.

Human genomic DNA analysis by Southern blot shows that the gene of TPO exists as a single copy. The intrachromosomal location of this gene was determined by in situ fluorescence hybridization (FISH) and placed 3q27-28 on the gene map.

9. Expression and Purification of TPO from 293 Cells

Preparation and purification of ML or TPO from 293 cells is described in detail in Example 19. In short, cDNA corresponding to the TPO full open reading frame was prepared by PCR using pRK5-hmpl 1. This PCR product was purified and cloned between the restriction positions Clal and Xbal of the plasmid pRK5tkneo (pRK5 induction vector modified to express neomycin resistance gene under the control of the thymidine kinase promoter) to encode vector pRK5tkneo.ORF (full open reading frame coding). Vector).

Another vector encoding the EPO homology domain was tested in the same manner as above except using a different PCR primer to obtain a final product called pRK5-tkneoEPO-D.

These two products were infected with human embryonic kidney cells by CaPO ₄ method and selected to grow neomycin resistant clones to colonize. Expression of ML ₁₅₃ or ML ₃₃₂ in conditioned cultures from these clones was evaluated using Ba / F3-mpl proliferation assay.

Purification of rhML ₃₃₂ was performed as described in Example 19. In sum, 293-rhML ₃₃₂ conditioned medium was added to a Blue-Sepharose (Pharmacia) column and then washed with buffer containing 2M urea. This column was eluted with a buffer containing 2M urea and 1 M NaCl. The blue Sepharose elution pool was added directly to the WGA-Sepharose column and washed with 10 times the buffer of the column volume containing 2M urea and 1 M NaCl and the same buffer as above containing 0.5 M N-acetyl-D-glucosamine Eluted. WGA-Sepharose eluate was added to a C4-HPLC column (Synchrom, Inc.) and eluted using a discontinuous propanol gradient. Using SDS-PAGE, purified 293-rhML ₃₃₂ was developed as a wide band in the 68-80 kDa region of the gel (see Figure 15).

Purification of rhML ₁₅₃ was also performed as described in Example 19. In short, partitioning was done on blue-sepharose as described for 293-rhML ₃₃₂ . This Blue Sepharose Eluate was added directly to the mpl affinity column as described above. RhML ₁₅₃ eluted from the mpl affinity column was purified to be uniform using a C4-HPLC column operated under the same conditions as used for rhML ₃₃₂ . Purified rhML ₁₅₃ using SDS-PAGE was divided into two large bands and two small bands with Mr 18000-22000 or less (see FIG. 15).

10. Rat mpl ligand

DNA fragments corresponding to coding regions of human mpl ligands were prepared by PCR, purified using gels and labeled in the presence of ³² P-dATP and ³² P-dCTP. This probe was used to search for 10 ⁶ clones of the mouse liver cDNA library in λGT10. One clone of rats containing 1443 base inserts (FIG. 16: [SEQ ID NO: 12 & 13]) was isolated and sequenced. The expected initiation codon at the 138-141 nucleotide position was in the consensus sequence that facilitated the translational initiation of eukaryotic cells (Kozak, MJ Cell Biol., 108: 229-241 [1989]). This sequence constitutes an open reading frame of 1056 nucleotides, thereby predicting the translation product of the primary 352 amino acids. 137 nucleotides of the 5 'untranslated sequence and 247 nucleotides of the 3' untranslated sequence are linked to this open reading frame. There is no poly (A) tail following the 3 'untranslated region, indicating that this clone is probably not complete. The N-terminus of the expected amino acid sequence is very hydrophobic and probably indicates a signal peptide. Computer analysis (von Heijne, G. Eur. J. Biochem. 133: 17-21 [1983]) revealed that residues 21 and 22 are potential cleavage sites for signal peptidase. Cleavage at this position will result in a mature peptide of 331 amino acids (35 kDa) identified as mML ₃₃₁ (or also referred to as mML2 for the following reasons). This sequence contains four cysteines (conserved in the mode human sequence) and seven potential N-glycosylation sites (five of which are conserved in the human sequence). Like hML, all of these potential N-glycosylation sites are located at the C-terminus of this protein.

Compared with human MLs, significant identity was observed in the nucleotide and deduced amino acid sequences of the "EPO domain" of these MLs. However, when the deduced amino acid sequences of human and mouse MLs are arranged side by side, the mouse sequence corresponds to residue 111 corresponding to 12 nucleotide dropout after nucleotide position 618 when viewed in human (see above) and pig (see below) cDNAs. Tetrapeptide between -114 appears to be eliminated. Therefore, additional clones were examined to detect possible rat ML isoforms. One clone encoded a 335 amino acid deduced sequence polypeptide comprising a "peptide" tetrapeptide LPLQ. This type is believed to be ML of full-length mice and is called mML or mML ₃₃₅ . Nucleotides and deduced amino acids of mML are provided in Figure 17 (SEQ ID NO: 14 & 15). This cDNA clone consists of 1443 base pairs followed by a poly (A) tail. This clone has an open reading frame of 1068 bp to which the 134 base 5 'and 241 base 3' untranslated sequences are linked. The putative start codon is at nucleotides 138-140. The open reading frame encodes the expected protein of 356 amino acids, of which the first 21 appear to be very hydrophobic and act as secretory signals. Finally, clones of the third mouse were isolated, sequenced and found to have dropped 116 nucleotides, such as hML3. Therefore, the mouse's isoform was named mML3. A comparison of the amino acid sequences of these two isoforms is shown in Figure 18 (SEQ ID NO: 9 & 16).

The overall amino acid sequence identity between human and rat MLs (Fig. 19 [SEQ ID NO: 6 & 16) is 72% but this homology is not evenly distributed. The region defined as the "EPO domain" (1-153 amino acids of the human sequence and 1-149 amino acids of the mouse sequence) was better conserved (86% homology) than the carboxy region (62% homology) of this protein. This also suggests that only the "EPO domain" of this protein is important. Interestingly, of the two dibasic motifs found in hML, only those dibasic motifs (residue positions 153-154) immediately following the "EPO domain" in the human sequence are present in the rat sequence. This is consistent with the possibility that this full length ML may represent a precursor protein that forms through a limited proteolysis and becomes a mature ligand. In another method, proteolysis between Arg _153- Arg ₁₅₄ can facilitate removal of hML.

Expression vectors comprising the entire coding sequence of mML were transiently infected with 293 cells as described in Example 1. Conditioned media from these cells stimulated the insertion of ³ H-thymidine into Ba / F3 cells expressing mpls of rats or humans but had no effect on the parent mpl cell line. This suggests that the cloned murine ML dDNA encodes a functional ligand that activates murine and human ML receptors (mpl).

11. Porcine mpl ligand

Porcine ML (pML) cDNA was isolated using RACE PCR as described in Example 13. PCR cDNA product of 1342 bp was found in the kidney and subcloned. Several clones were sequenced and a pig mpl ligand with 332 amino acid residues called pML (or pML ₃₃₂ ) had the nucleotide and deduced amino acid sequences shown in FIG. 20 (SEQ ID NOs: 18 & 19). It turned out.

A second type (228 amino acid residues) called pML2 with four amino acid residues eliminated was identified (FIG. 21 (SEQ ID NO: 21)). Comparison of the pML and pML2 amino acid sequences revealed the latter type to be identical except that the tetrapeptide QLPP corresponding to residues 11-114 was eliminated (Figure 22 [SEQ ID NO: 18 & 21]). The dropping of the four amino acids observed in the ML cDNA of rats and pigs occurs at exactly the same position in the expected protein.

A comparison of the expected amino acid sequences of mature MLs from humans, mice and pigs (FIG. 19 [SEQ ID NO: 6, 17 & 18]) showed that the overall sequence identity was 72% in mice and humans, and in mice and pigs. 68% of cases and 73% of pigs and humans. This homology is substantially higher than at the amino terminal half of the ML (EPO homologous domain). This domain is 80-84% identical between any two species, while the carboxy terminal half (carboxylate domain) is 57-67% identical. Dibasic amino acid motifs representing protease cleavage sites are present at the carboxyl terminus of the erythropoietin homology domain. This motif is preserved between three species at this position (Figure 19 [SEQ ID NO: 6, 17 & 18]). The second dibasic position present at positions 245 and 246 of the human sequence was not present in the mouse or pig. Mouse and pig ML sequences contain four cysteines, all of which are conserved within human sequences. There are seven potential N-glycosylation sites in the mouse ligand, six potential N-glycosylation sites in pig ML strains, five of which are conserved in the human sequence. All potential N-glycosylation sites are located at the C-terminus of this protein.

12. TPO Expression and Purification from Chinese Hamster Egg (CHO) Cells

Expression vectors used to infect CHO cells are referred to as pSV15.ID.LL.MLORF (full length or TPO ₃₃₂ ), pSV15.ID.LL.MLEPO-D (fusion type or TPO ₁₅₃ ). Appropriate properties of these plasmids are shown in FIGS. 23 and 24.

The infection method is described in Example 20. In short, cDNA corresponding to the full open reading frame of TPO is produced using PCR. This PCR product was purified and cloned between two restriction sites (Clal and Sall) of plasmid pSV15.ID.LL to obtain pSV15.ID.LL.MLORF. The second construct, corresponding to the EPO homologous domain, was prepared in the same manner except using a different reverse primer (EPOD.Sal). The final construct of the vector encoding the EPO homologous domain of TPO is called pSV15.ID.LL.MLEPO-D.

These two constructs were linearized with Notl and electroporated with Chinese hamster egg cells (CHO-DP12 cells) (European Patent No. 307,247 published March 15, 1989). 10 ⁷ cells are described in Andreason, GLJ Tissue Cult. Meth. 15,56 [1993] were electroporated in a BRL electroporation device (350 volts, 330 mF, low volume) in the presence of 10, 25 or 50 mg of DNA. The day after infection, cells were cut in DHFR selection medium (Mglycine high glucose DMEM-F12 50:50, 2 mM glutamine, 2-5% dialysis fetal calf serum). After 10-15 days individual colonies are transferred to 96 well plates and allowed to grow into colonies. Expression of ML ₁₅₃ or ML ₃₃₂ from these clones was assessed using Ba / F3-mpl proliferation assay (described in Example 1).

The method for purifying and isolating TPO from recovered CHO cell culture is described in Example 20. in short. The recovered cell culture (HCCF) was added to the Blue Sepharose column (Pharmacia) at a rate of 100 L of liquid per liter of resin. This column is then washed with three to five fold column volumes of buffer followed by three to five fold column volumes of buffer comprising 2.0 M urea. TPO was then eluted with 3 to 5 column volumes of buffer containing 2.0 M urea and 1.0 M NaCl.

The blue Sepharose eluate pool containing TPO was then buffered at a ratio of 8-16 ml of Blue Sepharose Eluate per liter of resin on a Wheat Germ Lectin Sepharose column (Pharmacia) equilibrated in Blue Sepharose. It was added while eluting. TPO was then eluted at a 2 to 5 fold column volume containing 2.0 M urea and 0.5 M N-acetyl-D-glucosamine.

Wheat point lectin eluate containing TPO was acidified and C ₁₂ E _{8 was added} to a final concentration of 0.04%. The resulting pool was added to a C ₄ reversed phase column equilibrated in 0.1% TFA, 0.04 C ₁₂ E ₈ , with 0.2-0.5 mg of protein per liter of resin loaded. This protein is eluted in a two-phase linear gradient of acetonitrile containing 0.1% TFA, 0.04 C ₁₂ E ₈ and the pool is prepared on the basis of SDS-PAGE.

The C4 pool was diluted and diafiltered on an ultrafiltration membrane such as Amicon YM with a 10000 to 30000 Dalton molecular weight blocking limit for about 6 volumes of buffer. The dialysis filtrate obtained can be processed directly or further concentrated by ultrafiltration. Dialysis filtration / concentrate is usually adjusted so that the final concentration of Tween-80 is 0.01%.

All or a portion of the diafiltrate / concentrate with a calculated column capacity of 2-5% was added to a Sephacryl S-300 HR column (Paracia) equilibrated in a buffer containing 0.01% Tween-80 and chromatographed. It was. TPO containing fractions without aggregates and proteolytic products were pooled based on SDS-PAGE. The resulting pool was filtered and stored at 2-8 ° C.

13. Method of modifying and inducing TPO synthesis in microorganisms and isolating, purifying and refolding TPO prepared therefrom

The construction of the E. coli TPO expression vector is described in detail in Example 21. In short, plasmids pMP21, pMP151, pMP41, pMP57 and pMP202 are adjusted to express the first 155 amino acids of TPO downstream of the small leader of the different constructs. The reader is primarily provided for high translation initiation and rapid purification. Plasmids pMP210-1, T8, -21, -22, -24, -25 are directed to express the first 153 amino acids of TPO downstream of the initiating methionine and differ only in the use of codons in the first six amino acids of TPO. , Plasmid pMP251 is a derivative of pMP210-1 with two more amino acids added to the carboxy terminus of TPO. All of these plasmids will lead to high intracellular expression of TPO in E. coli when induced with tryptophan promoter (Yansura, DG et al., Methods in Enzymology (Goeddel, DV, Ed.) 185: 54-60 , Academic Press, San Diego [1990]). Plasmids pMP1 and pMP172 are intermediates in the construction of the intracellular expression plasmid of the TPO.

The TPO expressing plasmid was used to transform E. coli using CaCl ₂ heat shock method [Mandel, M. et al., J. Mol. Biol., 53: 159-162 [1970]). Other methods are described in Example 21. In short, transformed cells were grown until the optical density of the culture (600 nm) reached about 2-3. This culture was then diluted and grown with air, and then acid was added. This culture was then grown under air injection for an additional 15 hours, after which the cells were recovered by centrifugation.

The following isolation, purification, and refolding methods for the preparation of biologically active refolded human TPO or fragments thereof are described in Examples 22 and 23 and apply to the recovery of all TPO variants, including the N and C terminal extensions. Can be. Other methods suitable for refolding recombinant or synthetic TPO can be found in the following patents; Builder et al., US Pat. No. 4,511,502; For a general description of methods for the recovery and refolding of various recombinant proteins expressed in insolubles in Jones et al., US Pat. No. 4,512,922, Olson et al., US Pat. No. 4,518,526, and E. coli, see US Pat. You can find it.

A. Recovery of Insoluble TPO

Microorganisms, such as E. coli, expressing TPO encoded by any suitable plasmid are fermented under conditions in which TPO precipitates into an insoluble "refractive body". Optionally the cells are washed in cell disruption buffer. Typically, about 100 g of cells are resuspended in about 10 doses of cell disruption buffer (e.g., 10 mM Tris, 5 mM EDTA, pH 8) using, for example, Polytron homogenizer and 5000 × for 30 minutes. Centrifuge at g. The cells are then lysed using conventional techniques such as tonic shock, sonication, pressure cycling, chemical or enzymatic methods. For example, the washed cell pellets can be resuspended in an additional 10 doses of cell disruption buffer using a homogenizer and the cell suspension can be resuspended in LH cell disruptor (LH Inceltech, Inc.) or Microfluidics (Microfluidics). International) may be used in accordance with the manufacturer's instructions. The particulate material containing TPO was then separated from the liquid phase and optionally washed with a suitable liquid. For example, suspensions of cell lysates can be centrifuged at 5000 × g for 30 minutes, resuspended and optionally centrifuged again to prepare washed refractive pellets. This washed pellet can be used immediately or optionally frozen (eg -70 ° C).

B. Solubilization and Purification of Monomer TPO

Insoluble TPO in the refractory pellet is solubilized using solubilization buffer. This solubilization buffer contains chaotropic reagents and is usually buffered to base pH and contains a reducing agent to improve the yield of monomeric TPO. Representative chaotropic reagents include urea, guanidine-HCl, and sodium thiocyanate. Preferred chaotropic reagent is guanidine-HCl. The concentration of chaotropic reagent is usually 4 to 9 M, preferably 6 to 8 M. The pH of the solubilization buffer is maintained by any suitable buffer at pH about 7.5-9.5, preferably 8.0-9.0 and most preferably 8.0. It is also preferred that the solubilization buffer contains a reducing agent to aid in the formation of the monomeric form of TPO. Suitable reducing agents include dithiothreitol (DTT), dithioerythritol (DTE), mercaptoethanol, glyctathione (GSH), cystiamine and cysteine. Preferred reducing agent is ditrithritol (DTT). Optionally, the solubilization buffer can contain a mild oxidant (eg, molecular oxygen) and sulfite salts to form monomeric TPO through sulfitolysis. In this embodiment, the resulting TPO-S-sulfonate can be refolded in a redox buffer (eg GSH / GSSG) to produce a properly folded TPO.

TPO proteins are usually further purified using, for example, centrifugation, gel filtration chromatography and reverse phase column chromatography.

As an example, the monomer TPO is prepared in an appropriate yield by the following method. Refractory pellets were resuspended in about 5-fold doses by weight of solubilization buffer (20 mM Tris, pH 8, 6-8 M guanidine and 25 mM DTT) and stirred at 4 ° C. for 1-3 hours or overnight. Solubilize the TPO protein. High concentrations (6-8 M) of urea are useful but generally show slightly lower yields than guanidine. After solubilization, this solution is centrifuged at 30000 x g for 30 minutes to prepare a clear supernatant containing denatured monomeric TPO protein. This supernatant is then chromatographed on a Superdex 200 gel filtration column (Pharmacia, 2.6 × 60 cm) at a rate of 2 ml / min and the protein is eluted using 20 mM Na phosphate at pH 6.0 containing 10 mM DTT. Fractions containing denatured TPO protein of monomer eluted between 160 and 200 ml were pooled. This TPO protein can be further purified on a semiprepared C4 reversed phase column (2 × 20 cm VYDAC). This sample is added to a column equilibrated in 0.1% TFA (trifluoroacetic acid) containing 30% acetonitrile at 5 ml / min. This protein is eluted under a linear gradient of acetonitrile (30-60% for 60 minutes). Purified reducing protein is eluted with about 50% acetonitrile. This material is used to refold to obtain biologically active TPO variants.

C. Refolding of TPO to Prepare Biologically Active Forms

After solubilization and further purification of TPO, biologically active forms are prepared by refolding the modified monomeric TPO in redox buffer. Due to the high potency of TPO (half of the maximum stimulus in the Ba / F3 assay is obtained at about 3 pg / ml), it is possible to prepare biologically active materials using many different buffers, bleaches and redox conditions. . However, under most conditions, only a small amount of properly folded material is obtained (> 10%). For commercial manufacturing methods, the refolding yield is at least 10%, more preferably 30-50%, most preferably more than 50%. Various bleaches such as Troton X-100, Dodecyl-Beta-Maltoside, CHAPS, CHAPSO, SDS, Sarcosyl, Tween 20 and Tween 80, Zwittergent 3-14, etc. have been found to be suitable for the preparation of slightly more properly folded materials. lost. Of these, however, the most preferred bleach is the bleach of the CHAPS family (CHAPS and CHAPSO), which has been found to work best in refolding reactions and to limit protein aggregation and inadequate disulfide bond formation. The concentration of CHAPS is preferably at least about 1%. 0.1 M to 0.5 M sodium chloride is required to obtain the best yield. The presence of EDTA (1-5 mM) in redox buffers is also preferred in that it limits the metal catalytic oxidation (and aggregation) observed in some formulations. Concentrations of glycerol above 15% are optimal refolding conditions. For best yields, it is necessary to include redox pairs consisting of oxidized and reduced organic thiols (RSH) in redox buffers. Suitable redox pairs are mercaptoethanol, glutathione (GSH), cysteamine, cysteine and the corresponding oxidation forms. Preferred redox pairs are glutathione (GSH): oxidized glutathione (GSSG). In general, higher yields are obtained when the molar ratio of the oxidized form of the redox pair is equal to or higher than the molar ratio of the reduced form of the redox pair. pH 7.5 to about 9 is the most optimal pH for refolding these TPO variants. Organic solvents (eg ethanol, acetonitrile, methanol) were allowed at concentrations of 10-15% or less. When the concentration of the organic solvent is high, an inappropriate folding type is increased. Tris and phosphate buffers are generally useful. Incubation at 4 ° C. also allows for the production of high concentrations of properly folded TPO.

Refolding yields of 40-60% (based on the amount of reduced and modified TPO used in the refolding reaction) are typical yields for the preparation of TPO initially purified via the C4 step. Even less pure formulations (e.g., just after Superdex 200 columns or initial refractor extraction) may yield slightly lower yields due to extensive precipitation and interference of non-TPO proteins during the TPO refolding reaction, but the active material can be obtained. There is.

TPO contains four cysteines, which are capable of forming three different disulfide versions.

Version 1: cysteine residues 1-4 and 2-3

Version 2: cysteine residues 1-2 and 3-4

Version 3: cysteine residues 1-3 and 2-4

During the initial search for refolding conditions determination, several different peaks containing TPO protein were separated by C4 reversed phase chromatography. Only one of these peaks had an effective biological activity determined using Ba / F3 analysis. The refolding conditions were then optimized to selectively form this version. Under these conditions, the misfolded version was less than 10-20% of the total monomer TPO obtained from the solubilization step.

Disulfide binding patterns of biologically active TPO were found to be cysteines 1-4 and 2-3 by mass spectrometry and protein sequencing, where the cysteines were numbered sequentially from the amino terminus. This cysteine crosslinking pattern is consistent with the known disulfide bonds of the related molecule, erythropoietin.

D. Biological Activity of Recombinant, Refolded TPO

Refolded and purified TPO had activity in both in vivo and in vitro assays. For example, in the Ba / F3 assay, half of the maximum stimulation of thymidine insertion of TPO (Met- ¹ , 1-153) into Ba / F3 cells was achieved at 3.3 pg (0.3 pM). In ELISA based mpl receptors, half of the maximum activity was obtained at 1.9 ng / ml (120 pM). In myelosuppressive animals made with normal and radical myocardium X-ray irradiation, refolded TPO (Met- ¹ , 1-153) was very potent in stimulating the production of new platelets (low dose of 30 ng / ml). Showed activity). Similar biological activity was also observed in other forms of TPO refolded according to this method (Figures 25, 26 and 28).

14, platelet formation activity measurement method

Platelet activity is measured by platelet cells assayed by Ba / F3 mpl ligand assay described in Example 1, in vivo mouse platelet reflex synthesis assay, antiplatelet immunoassay against human leukemia megakaryocyte cell line (CMK) (anti-GPII _b III _a ) Surface antigen induction assay (see Sato et al., Brit. J. Haenatol., 72: 184-190 [1989]) (see liquid suspension megakaryocyte formation assay described in Example 4) and multiploidy in megakaryoblastic cell lines (DAMI) Can be measured by various assays including induction (Ogura et al., Blood, 72 (1): 49-50 [1988]). The maturation process from immature, largely non-DNA-synthesized cells to morphologically identifiable megakaryocytes includes the appearance of cell organelles, acquisition of membrane antigens (GPII _b III _a ), intracellular replication of platelets as described in the background of the invention, and The glass step is involved. It will be expected that lineage specific promoters (eg, mpl ligands) in megakaryocyte maturation will induce at least some of these changes in immature megakaryocytes leading to alleviation of platelet free and thrombocytopenia. As such, the assay was designed to measure the appearance of these parameters in immature megakaryocyte cell lines such as CMK and DAMI cells. CMK analysis (Example 4) measures the appearance and platelet excretion of GPII _b III _a , which is an indication of specific platelets. The increase in polyploids in the DAMI assay (Example 15) is an indicator of mature megakaryocytes and thus measures the replication of the cells. Recognized megakaryocytes have multiples of 2N, 4N, 8N, 16N, 32N, and the like. Finally, in vivo mouse platelet reflex assay (Example 16) is useful for showing an increase in platelet levels caused by administration of test compounds (mpl ligands in this specification).

Two additional in vitro assays were developed to measure TPO activity. First, the mpl ligand was exposed to the mpl ligand of the mpl-Rse chimera, followed by infection of the mpl-Rse chimera in CHO cells, followed by kinase receptor activation (Kirase Receptor), which measures the tyrosine phosphorylation of Rse by ELISA. Activation (KIRA) ELISA. The second method is based on an ELISA method in which an ELISA plate coated with rabbit anti-human IgG captures the human chimeric receptor mpl-IgG that binds to the mpl ligand to be analyzed. Biotinylated rabbit polyclonal antibody to mpl ligand (TPO ₁₅₅ ) is used for the detection of binding mpl ligand measured using strepdavidin-peroxidase as described in Example 18.

15. In Vivo Biological Responses of TPO Treated Mice Investigated in Normal and Quasi-Definition

Both mice examined in normal and quasi-digestive conditions were treated with fused and full-length TPO isolated from Chinese hamster egg (CHO) cells, E. coli and human embryonic kidney 293 cells. However, although both types of TPOs produced from these three hosts stimulate platelet production in mice, full-length TPOs isolated from CHO cells appear to be the largest response in vivo. These results indicate that proper glycosylation of the carboxy domain will be required for optimal in vivo activity.

(a) E. coli-rhTPO (Met ^-One , 153)

The "Met" form of the EPO domain prepared in E. coli (where Met is located at the -1 position in front of the first 153 residues of the human TPO) was transferred to normal female C57 B6 mice as described in the description of 25A, 25B and 25C. Injection daily. These figures show that refolded aglycosylated nodal forms, prepared in E. coli, can stimulate platelet production to double, without affecting erythrocytes or leukocyte clusters in normal mice.

This same molecule, injected daily into sub-lethalally investigated ( ¹³⁷ Cs) female C57 B6 mice as described in Figures 26A, 26B and 26C, stimulates platelet recovery and further lowers the lowest levels affecting red blood cells or white blood cells. It was.

(b) CHO-rhTPO ₃₃₂

The full-length form of TPO is prepared in CHO and injected daily into normal female C57 B6 mice as described in Figures 27A, 27B and 27C, and induces platelet production without affecting erythrocytes or white blood cell clusters in normal mice. Increased by fold.

(c) CHO-rhTPO ₃₃₂  ; E. coli-rhTPO (Met ^-One , 153); 293-rhTPO ₃₃₂  And E.coli-rhTPO ₁₅₅

For treatment of normal mice with rhTPO from various cell lines (CHO-rhTPO ₃₃₂ ; E. coli-rhTPO (Met- ¹ , 153); 293-rhTPO ₃₃₂ and E. coli-rhTPO ₁₅₅ ) as described in the description of FIG. Dose response curves were prepared. This figure shows that all test forms of the molecule stimulate platelet production, but the full-length form produced in CHO has the highest in vivo activity.

(d) CHO-rhTPO ₁₅₃ , CHO-rhTPO _"clipped"  And CHO-rhTPO ₃₃₂

Dose response curves were prepared for treatment of normal mice with various forms of rhTPO produced in CHO (CHO-rhTPO ₁₅₃ , CHO-rhTPO _"clipped" and CHO-rhTPO ₃₃₂ ) as described in the description of FIG. 29. This figure shows that all test forms of the molecule stimulate platelet production, but the full-length form produced among the CHO has the greatest in vivo activity.

16. General Recombinant Preparation of mpl Ligands and Variants

Preferably the mpl ligand comprises a standard recombinant method consisting of culturing an infected cell (typically transforming the cell with an expression vector) to express the mpl ligand nucleic acid and preparing the mpl ligand polypeptide by recovering the polypeptide from the cell. Is manufactured by. However, it can be seen that optionally this mpl ligand can be prepared by homologous recombination or recombinant preparation using regulatory elements introduced into cells already containing DNA encoding the mpl ligand. For example, a strong promoter / enhancer element, suppressor or exogenous transcriptional regulatory element can be inserted into the genome of the desired host cell at a distance and orientation sufficient to affect the transcription of the DNA encoding the desired mpl ligand polypeptide. . These regulatory elements do not encode mpl ligands, but rather this DNA is unique to the host cell genome. It searches for and searches for the cells that make up the receptor polypeptides of the invention or performs a search for the desired level of increased or decreased levels of expression.

As such, the invention inserts a transcriptional regulatory element at a distance and orientation sufficient to affect its transcription encoding a desired mpl ligand polypeptide in the genome of a cell comprising a mpl ligand nucleic acid molecule and optionally comprises a transcriptional regulatory element and nucleic acid molecule. Consider a method for preparing mpl ligand, which consists of an additional step consisting of culturing cells. The present invention also contemplates host cells containing cell native mpl ligand nucleic acid molecules that are functionally bound to exogenous regulatory sequences recognized by the host cell.

A. Isolation of DNA Encoding mpl Ligand Polypeptides

DNA encoding the mpl ligand polypeptide can be prepared from a cDNA library prepared from tissue that has mpl ligand mRNA and is believed to express it at a detectable concentration. The mpl ligand gene can also be prepared by in vitro oligonucleotide synthesis from complete nucleotide or amino acid sequences from genomic DNA libraries.

The library is searched using probes designed to identify the gene of interest or the protein encoded by it. For cDNA libraries, suitable probes include monoclonal or polyclonal antibodies that recognize and specifically bind mpl ligands. In cDNA libraries, suitable probes encode a known or suspected portion of a complementary or homologous cDNA or fragment thereof encoding the mpl ligand cDNA and / or the same or similar genes from the same or different species. Oligonucleotides about 20 to 80 bases in length. Suitable probes for searching genomic DNA libraries include oligonucleotides, cDNAs or fragments thereof that encode identical or similar genes and / or homologous genomic DNA or fragments thereof. Retrieval of cDNA or genomic libraries using selected probes is performed using standard methods described in Sambrook et al., Supra, Chapters 10-12.

Another method of isolating a gene encoding a mpl ligand uses the PCR method described in section 14 of Sambrook et al., Supra. This method requires the use of oligonucleotide probes to hybridize with DNA encoding the mpl ligand.

A preferred method of practicing the invention is to search cDNA libraries from various tissues, preferably human or swine kidney (adult or fetal) or hepatocyte lines, using carefully selected oligonucleotide sequences. For example, human fetal hepatocyte line cDNA libraries are searched using oligonucleotide probes. In another method, the human genome library can be searched using oligonucleotide probes.

Oligonucleotides selected as probes should be of sufficient length and sufficiently clear to minimize false positive signals. The actual nucleotide sequence (s) is typically designed based on the region of the mpl ligand with minimal codon overlap. Oligonucleotides may degenerate at one or more positions. Using degenerate oligonucleotides is particularly important when searching libraries from species for which the use of a particular codon is not known.

Oligonucleotides should be labeled so that they can be detected when hybridized to DNA in the library to be searched. A preferred method of labeling is to label the 5 'end of the oligonucleotide using ATP (e.g. γ ³² P) and polynucleotide kinase. However, other methods can be used to label oligonucleotides, including but not limited to biotinylation or enzyme labeling.

Of particular interest are mpl ligand nucleic acids encoding full length mpl ligand polypeptides. In some preferred embodiments, the nucleic acid sequence comprises a native mpl ligand signal sequence. Nucleic acids with all coding sequences of this protein are obtained by searching selected cDNAs or genomic libraries using deduced amino acid sequences.

B. Amino Acid Sequence Modification of Natural mpl Ligands

The amino acid sequence of the mpl ligand is prepared by introducing appropriate nucleotide changes into the mpl ligand DNA or by synthesizing the desired mpl ligand polypeptide in vitro. For example, such variants include missing, inserted or substituted forms of residues in the amino acid sequence of a porcine mpl ligand. For example, the carboxy terminal portion of a mature full length mpl ligand is removed by cloning or expressing a proteolytic cleavage or fragment or DNA encoding a full length mpl ligand in vivo or in vitro to produce a biologically active variant. As long as the final construct has the desired biological activity, the final construct is made from any combination of dropout, insertion, and substitution forms. Amino acid changes, such as changing the number or location of glycosylation sites, can also alter the post-translational process. In the design of amino acid sequence variants of mpl ligands, the mutation site location and mutation properties are dependent on the mpl ligand properties being modified. Mutation sites can be replaced individually or in series, for example with (1) conserved amino acid substitutions with more disruptive amino acid groups, (2) dropping target residues, or (3) identical or Or residues of different families can be inserted in close proximity to the localized site or modified by a combination of one to three options.

Useful methods used to identify specific residues or regions in the mpl ligand polypeptides, which are preferred positions for mutagenesis, are described in "Alanine Injection Mutagenesis, as described in Runningham and Wells, Science, 244: 1081-1085 [1989]. "to be. In this method, one residue or group of target residues are identified (e.g., charged residues such as arg, asp, his, lys and glu), and all amino acids, but preferably neutral or anion-charged amino acids ( Most preferably with alanine, polyalanine) to affect the interaction of amino acids with the surrounding aqueous environment inside and outside the cell. Domains showing functional sensitivity to substitution of amino acid residues are refined by introducing additional or other modifications at or near the site of substitution. As a result, the site for introducing the amino acid sequence modification is predetermined, but the nature of the mutation itself does not need to be predetermined. For example, to optimize mutation performance at specific sites, ala injections or any mutations are generated at the desired codons or regions to search for and search for the optimal combination of desired activities of these mpl ligand variants.

There are two main variables in the construction of amino acid sequence variants: the position of the mutation site and the mutant nature. For example, variants of mpl ligand polypeptides include variants of the mpl ligand sequence, which are intended to reach naturally occurring alleles (which do not require additional manipulation of mpl ligand DNA) or alleles or variants not found in nature. Can refer to a predetermined mutation made by mutating the DNA. In general, the location and nature of mutagenesis depends on the mpl ligand properties to be modified.

Amino acid sequence deletions generally occur at about 1 to 30 residues, more preferably 1 to 10 residues and are usually contiguous with each other. Alternatively, sequence dropouts may occur in the entire carboxy terminal glycoprotein domain of the mpl ligand. One or more dropouts in one or more loop regions may optionally occur between “helical bundles”. Successive dropouts usually occur as even residues, but one or odd dropouts are also within their scope. In order to modify the activity of the mpl ligand, dropout may occur in regions of low homology within the mpl ligands having the highest sequence identity. Alternatively, dropout may occur in regions of low homology within human and other mammalian mpl ligand polypeptides that have the highest sequence identity with the human mpl ligand. If amino acid dropouts occur in mammalian mpl ligand polypeptides in regions with significant homology to other mammalian mpl ligands, it is likely that the biological activity of the mpl ligands will be modified more significantly. The number of consecutive dropping residues is selected to preserve the tertiary structure (eg beta pleated sheet or alpha helix) of the mpl ligand in the affected domain.

Amino acid sequence insertions include fusion to the amino and / or carboxy terminus, ranging from one residue in length to polypeptides comprising 100 or more residues, and insertion of single or multiple amino acid residues in the middle of the sequence. Sequence intermediate inserts (eg, insertion into a mature mpl ligand sequence) may generally be about 1 to 10 residues in length, more preferably 1 to 5 residues, and most preferably 1 to 3 residues in length. . Exemplary preferred fusions are fusions of mpl ligands or fragments thereof and other cytokines or fragments thereof. Examples of terminal insertions include mature mpl ligands with N-terminal methionyl residues, artificial structures of direct expression of mature mpl ligands in recombinant cell culture, and mature mpl ligands to facilitate secretion of mature mpl ligands from recombinant host cells. Fusion of the heterologous N-terminal signal sequence to the N-terminus of the ligand molecule. Such signal sequences are generally homologous since they are prepared from the desired host cell species. Suitable sequences include STII or Ipp in E. coli and viral signals such as alpha factor in yeast and herpes gD in mammalian cells.

Other insertional variants of the mpl ligand molecule include a bacterial polypeptide such as a beta lactamase or an fusion of an immunogenic polypeptide (eg not from the host cell to which the fusion is administered) to the N- or C-terminus of the mpl ligand (eg, beta lactamase or E. enzymes or yeast proteins encoded by the coli trp locus) and C-terminal fusions with proteins with long half-lives such as immunoglobulin constant regions (or other immunoglobulin regions), albumin or ferritin (April 6, 1989) Published in International Publication No. 89/02922.

The third group of variants is amino acid substitution variants. In these variants one or more amino acid residues are removed and other residues are inserted in place. The most preferred sites for substitutional mutagenesis include the various mpl ligand species and / or one mpl, although the amino acids found in the sites identified as active sites of the mpl ligand and in other analogues differ in terms of side chain volume, charge amount or hydrophobicity. Sites with high sequence identity at specific sites among various animal analogs of the ligand member are included.

Preferred other sites are those sites where the mpl ligands obtained from various family members and / or animal species within one family are identical. Such sites, in particular those corresponding to the sequence of three or more other identically conserved sites, are substituted so that the sequence is relatively conserved. Such conservative substituents are listed in Table 3 under the name preferred substituents. If such substituents resulted in a change in biological activity, more substantial changes, which are named as representative substituents in Table 3 or described further below with reference to amino acid classes, were introduced and the products were searched.

<Table 3>

Substantial modifications in the function or immunological identity of the mpl ligands include (a) the polypeptide backbone structure (eg, sheet or helical form) in the substitution region, (b) the charge or hydrophobicity of the molecule at the site of interest, (c) the side chain Each influence on maintaining the volume is achieved by choosing different substituents. Naturally occurring residues are divided into several groups based on common side chain properties:

(1) hydrophobic: norleucine, Met, Ala, Val, Leu, Ile;

(2) neutral hydrophilic: Cys, Ser, Thr;

(3) acidic: Asp, Glu;

(4) basic: Asn, Gln, His, Lys, Arg;

(5) residues that affect chain orientation: Gly, Pro; And

(6) aromatic: Trp, Tyr, Phe

Non-conservative substituents are those that substitute a member of one of these classes with a member of another class. Such substitution residues may also be introduced at conservative substitution sites or preferably at conservative sites or more preferably at the remaining (non-conserved) sites.

In an embodiment of the invention, it is preferred to activate one or more protease sites present in the molecule. These sites are identified by examining the encoded amino acid sequence (for trypsin, for example, recognizing argin or lysine residues). If protease cleavage sites are identified, they are replaced with other residues, preferably basic residues such as glutamine or hydrophobic residues such as serine; Or by dropping this residue; Or by incorporating a prolyl residue immediately after this residue to inactivate the protein cleavage site.

In another embodiment, all of the methionyl residues except for the starting methionyl residues of the signal sequence or residues that are three residues away from the C- or N-terminus toward each such methionyl residue, preferably from other residues (preferably Table 3 Or drop out). In another method, about 1 to 3 residues are inserted adjacent to this site.

All cysteine residues that are not involved in maintaining the proper form of the mpl ligand can also be generally substituted with serine to improve the oxidative stability of the molecule and to prevent abnormal crosslinking. When numbered from the amino terminus, it was found that the first and fourth cysteines of the epo domain are needed to maintain proper form and the second and third cysteines are not. Thus, the second and third cysteines of the epo domain can be substituted.

Nucleic acid molecules encoding amino acid sequence modifications of the mpl ligands are prepared according to methods known in the art. These methods include isolation from natural sources (for naturally occurring amino acid sequence variants) or oligonucleotide mediated (or site directed) mutations, PCR mutagenesis, and early production of mpl ligand polypeptides, or variants of unmodified versions of cassettes. Manufacturing method is included.

Oligonucleotide mediated mutagenesis is a preferred method for the substitution, deletion, and insertion of mpl ligand DNA. This technique is known in the art as published by Adelman et al. In DNA, 2: 183 [1983]. In sum, the mpl ligand DNA is modified by hybridizing oligonucleotides encoding the desired mutations to a DNA template, which is a single strand of plasmid or bacteriophage containing the altered or native DNA sequence of the mpl ligand. After hybridization, oligonucleotide primers are inserted using DNA polymerase to synthesize a second overall complementary strand of this template encoding a specific alteration in the mpl ligand DNA.

In general, those 25 nucleotides or more in length are used. Optimal oligonucleotides are 12-15 nucleotides that are completely complementary to the template on either side of the nucleotide encoding the mutant. This ensures that this oligonucleotide will hybridize appropriately to a single strand of DNA template molecule. These oligonucleotides are described by Crea et al. In Proc. Natl. Acad. Sci. USA, 75: 5765 [1978], can be readily synthesized using techniques known in the art.

DNA templates are described in Viera et al. Meth. As described in Enzymol., 153: 3 [1987], the bacteriophage M13 vector (commercially available M13mp18 and M13mp19 are suitable) or a vector derived from vectors containing the origin of replication of a single stranded phage. This single strand template is described by Sambrook et al in sections 4.21-4.41 of the Molecular Cloning: A Laboratpty Manual (Cold Spring Harbor Labortory Press, NY 1989).

In another method, single stranded DNA templates can be prepared by denaturing double stranded plasmids using standard techniques.

In altering native DNA sequences (eg, preparing amino acid sequence variants), oligonucleotides hybridize to a single strand template under appropriate hybridization conditions. Clebenau fragments of DNA polymerase, usually DNA polymerase I, are added to synthesize the complementary strand of the template using this oligonucleotide as a primer for synthesis. This results in the formation of a hetero double molecule, where one strand of the DNA encodes a mutant of the mpl ligand and the other strand (original template) encodes a naturally unaltered sequence. This heterodouble molecule is transformed into a suitable host cell (typically prokaryotic cells such as E. coli JM101). Cells are grown and seeded on agarose plates and searched using oligonucleotide primers radiolabeled with 32-phosphate to identify bacterial colonies containing mutant DNA. Subsequently, the mutant region is removed and introduced into a suitable vector for protein production, generally an expression vector of the type commonly used for transformation of a suitable host cell.

The method just described can be modified such that the two plasmids produce homo double molecules containing mutations. The modification method is as follows: Single strand oligonucleotides are ligated to a single strand template as above. A mixture of three deoxyribonucleotides (deoxyriboadenosine (dATP), deoxyriboguanosine (dGTP) and deoxyribothymidine (dTTP) is a modified thio-deoxyribo called dCTP- (aS) Combined with cytosine (commercially available from Amersham Coporation) This mixture is added to a template-oligonucleotide complex, which adds DNA polymerase to the same DNA strand, except for the mutant base, the same as the template above. This new strand of DNA contains dCTP- (aS) instead of dCTP, which functions to protect against restriction endonuclease hydrolysis.

After the template strand of the double strand hetero duplex is nicked with a suitable restriction enzyme, the template strand can be hydrolyzed to ExoIII nuclease or other suitable nuclease after the region containing the site to be mutated. This reaction is then stopped to yield a partially single stranded molecule. Complete double stranded DNA homo duplexes are prepared using DNA polymerase in the presence of all four deoxyribonucleotide triphosphates, ATP and DNA ligase. This homoduplex molecule is then used to transform a suitable host cell such as E. coli JM101 as described above.

DNA encoding a mpl ligand mutation with one or more amino acids to be substituted can be prepared by several methods. If amino acids are located close to the polypeptide chain, they can be mutated using one oligonucleotide encoding all of the desired amino acid substituents. However, when these amino acids are far apart from each other (10 amino acids apart), it becomes more difficult to produce a single oligonucleotide that encodes all of the desired changes. Instead of this method, two different methods can be used.

In the first method, a separate oligonucleotide is prepared for each amino acid to be substituted. The oligonucleotide is then ligated simultaneously with the single stranded template DNA and the second DNA strand synthesized from this template will encode all of the desired amino acid substituents.

In another method, the mutagenesis is performed two or more times to produce the desired mutation. The first is as described for a single mutation: using wild type DNA as template, oligonucleotides encoding the first desired amino acid substituent (s) are ligated to this template and heteroduplex DNA molecules are prepared. In the second mutagenesis, the mutant DNA produced in the first mutagenesis is used as a template. As such, this template comprises one or more mutants. Oligonucleotides encoding additional desired amino acid substituents are ligated to this template, and the strands of DNA obtained thereby encode mutators from the first and second mutations. The resulting DNA can be used for third and subsequent mutagenesis.

PCR mutations are also suitable for preparing amino acid variants of mpl ligand polypeptides. Although the following technique relates to DNA, it can be seen that this technique can also be applied to RNA. PCR techniques are generally by the following methods (Erlich, supra, R. Higudhi, p, 61-70): When a small amount of template DNA is used as starting material in PCR, it is slightly different from the sequence from the corresponding region of the template DNA. Other primers can be used to prepare relatively large amounts of specific DNA fragments that differ from the template sequence only at locations where the primer is different from the template. In order to introduce mutations into plasmid DNA, one of the primers must be designed to contain the mutator in duplicate of the mutation site and the other of the primers must be identical to the extension of the other sequence of the plasmid, but this sequence can be found anywhere in the plasmid DNA. Can be located. However, the sequence of the second primer can be located within 200 nucleotides from the first primer sequence so that in the last step the entire extended region of DNA bound to this primer can be easily sequenced. PCR amplification using the same primer pair as the primer pair may produce a different set of DNA fragments at different positions from time to time because different mutations may occur at the mutation sites defined by the primers and some errors may occur during template copying. do.

If the ratio of template to product material is very low, the desired mutation is inserted in a very large amount of product DNA. This product is used to replace the corresponding region in the plasmid that serves as a PCR template using standard DNA techniques. Mutations at separate positions are simultaneously linked to the vector fragments with three (or more) partial ligations obtained by performing a second PCR using a second mutant primer or a different mutant primer. Can be introduced.

In a specific example of PCR mutagenesis, template plasmid DNA (1 μg) is straight chained by hydrolysis with restriction endonucleases having a unique recognition site in the plasmid DNA outside the region to be extended. 100 ng of this material is contained in a PCR mixture containing four PCR buffers (containing four deoxyribonucleotide triphosphates and purchased from the GeneAmp ^® kit (available from Perkin-Elmer Cetus, Norwalk, CT and Emerymille, CA)) Oligonucleotide primer 25 pmole and the final volume is 50 ul). This reaction mixture is added to 35 ul of mineral oil. The reaction mixture is denatured at 100 ° C. for 5 minutes, allowed to stand on ice for a short time, and then 1 ul Thermus aquaticus (Taq) DNA polymerase (5 units / ul, purchased from Perkin-Elmer Cetus) is added under the mineral oil layer.

This reaction mixture was added to a DNA Termal Cycler (purchased from Perkin-Elmer Cetus) programmed as follows.

2 minutes, 55 ℃

30 seconds, 72 ℃

19 cycles:

30 sec, 94 ° C

30 sec, 55 ° C. and

30 sec, 72 ° C.

At the end of the program run, the reaction vial was taken out of the thermal cycler, the aqueous phase was transferred to a new vial, extracted with phenol / chloroform (50:50 volumes), precipitated with ethanol and the DNA was recovered according to standard methods. This material was subsequently appropriately processed and inserted into the vector.

Cassette mutagenesis, another method of making variants, is based on the technique as described by Wells et al., Gene, 34: 315 [1985]. The starting material is a plasmid (or other vector) containing the mpl ligand DNA to be mutated. Codons in mpl ligand DNA are identified. There should be a unique restriction endonuclease site on each side of the identified mutation site. If such restriction sites do not exist, they can be prepared by introducing them at appropriate positions in the mpl ligand DNA using the oligonucleotide mediated mutagenesis. After the restriction site is introduced into the plasmid, the plasmid is cleaved at this site and straightened. Double stranded oligonucleotides encoding DNA between these restriction sites but containing the desired mutations are synthesized using standard methods. These two strands were synthesized separately and hybridized using standard techniques. This double stranded oligonucleotide is called a cassette. This cassette is designed to have 3 'and 5' ends that fit into the ends of the straight chained plasmid so that it can be directly linked to the plasmid. This plasmid now contains a mutated mpl ligand DNA sequence.

C. Insertion of Nucleic Acids into Replicable Vectors

Nucleic acid encoding a natural or modified mpl ligand polypeptide (eg cDNA or genomic DNA) is inserted into a replicable vector for subsequent cloning (increase of DNA) or expression. Many vectors are available and a suitable vector is selected depending on (1) whether it can be used for DNA expansion or DNA expression, (2) the size of nucleic acid to be inserted into the vector, and (3) the host cell to be transformed with the vector. . Each vector contains various components depending on its function (extension of DNA or expression of DNA) and the appropriate host cell. Vector components include, but are not limited to, one or more of the following components from the group consisting of signal sequence, replication start, one or more marker genes, enhancer elements, promoters and transcription termination sequences.

(i) signal sequence components

The mpl ligands of the invention can be expressed not only directly, but also as fusions with heterologous polypeptides, preferably signal sequences or other polypeptides having a specific cleavage site at the N-terminus of the mature protein or polypeptide. In general, the signal sequence may be a component of the vector or may be part of the mpl ligand DNA into which the vector is inserted. The heterologous signal sequence selected should be one that is recognized and processed (eg, cleaved by signal peptidase) by the host cell. For prokaryotic host cells that are unable to recognize and process mpl ligand signal sequences, the signal sequences may be, for example, prokaryotic selected from the group consisting of alkaline phosphatase, penicillase, Ipp, or thermostable enterotoxin II leaders. It should be replaced with the cell signal sequence. For yeast secretion, natural sequence signals are described, for example, yeast invertase, alpha factor, or acid phosphatase readers, C, albicans glucosylase leader (European Patent No. 362,179 published April 4, 1990). ) Or the signal described in WO 90/13646 published November 15, 1990. In mammalian cell expression, natural signal sequences (e.g., mpl ligand sequences that normally secrete mpl ligands from their natural mammalian cells in vivo) are satisfactory, but viral secretion leaders (e.g., herpes simplex gD signals) As well as other mammalian signal sequences, such as signal sequences from other mpl ligand polypeptides or from the same mpl ligand from different animal species, signal sequences of mpl ligands, and secretory polypeptides of the same or related species.

(ii) origin of replication components

Both expression and cloning vectors contain nucleic acid sequences that allow the vector to replicate among one or more selected host cells. In general, in cloning vectors, this sequence allows replication to be independent of the chromosomal DNA of the host cell and includes the origin of replication, ie, the spontaneously replicating sequence. Such sequences are well known in various bacteria, yeasts and viruses. Replication initiation sequences from plasmid pBR322 are suitable for most gram positive bacteria, 2μ plasmid initiation sequences are useful for yeast, and various viral start sequences (SV40, polyoma, adenovirus, VSV or BPV) are cloned in mammalian cells. Useful as a vector. In general, replication start sequence components are not needed for mammalian expression vectors (SV40 start sequence is commonly used because it includes the initial promoter).

Most expression vectors are "shuttle" vectors, ie they are capable of replication in one or more classes of organisms but can be expressed by infection with other organisms. For example, after a vector is cloned in E. coli, the same vector is infected for its expression in yeast or mammalian cells, although it cannot replicate independently of the chromosome of the host cell.

DNA can also be extended by insertion into the host genome. This can be readily accomplished using Bacillus species as a host, for example, by introducing into the vector a DNA sequence that is complementary to the sequence found in Bacillus genomic DNA. Infection of Bacillus with this vector results in homologous recombination with the genome to insert mpl ligand DNA. However, recovery of genomic DNA encoding mpl ligands is more complex than recovery of exogenously replicated vectors because restriction enzyme hydrolysis requires the cleavage of the mpl ligand DNA.

(iii) gene component selection

Expression and cloning vectors must contain a selection gene (also called a selectable marker). This gene encodes a protein required for transformed survival or growth grown in selective culture medium. Host cells not transformed with the vector containing the selection gene do not survive the selection culture medium. Typical selection genes are (a) tolerate antibiotics or toxins such as ampicillin, neomycin, methotrexate or tetracycline, (b) compensate for autotrophic deficiencies, or (c) obtain in complex media. It encodes a protein that supplies countless essential nutrients (in the case of Bacillus, genetically encoded D-alanine).

One example of the selection scheme uses drugs to arrest the growth of host cells. These cells successfully transformed with a heterologous gene express a protein that confers drug resistance and thereby survive a selective regimen. One example of such dominant selection is the drug neomycin (Southern et al., J. Molec. Appl. Genet., 1: 327 [1982]), mycophenolic acid (Mulligan et al., Science, 209: 1422 [1980]). ) Or hygromycin (Sudgen et al., Mol. Cell. Biol., 5: 410-413 [1985]). The three examples given above use bacterial genes under eukaryotic control to confer resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid), or hygromycin, respectively.

Examples of other suitable selectable markers for use in mammalian cells are those capable of identifying cells capable of acquiring mpl ligand nucleic acids such as dihydrofolate (DHFR) or thymidine kinase. Mammalian cell transformants are placed under selection pressure that is adapted to allow the transformed cells to survive by acquiring a marker. Selection pressure is applied by culturing the transformed cells under conditions such that the concentration of the selection reagent in the medium is varied stepwise to increase the DNA encoding the selection gene and mpl ligand polypeptide. Increasing is the process by which genes with greater demand for the production of proteins necessary for growth are repeated in the chromosomes of successive generations of recombinant cells. The amount of mpl ligand is increased by the increased DNA.

For example, by culturing all the transformed cells in a culture medium containing methotrexate (Mtx), an antagonist of DHFR, cells first transformed by the DHFR selection gene are identified. Suitable host cells when wild type DHFR are used are described by Urlaub and Chasin in Proc. Natl. Acad.Sci. USA, 77: 4216 [1980], a Chinese hamster egg (CHO) cell line without DHFR activity, prepared and propagated as described. Transformed cells are then exposed to increased concentrations of Mtx. This leads to the synthesis of multiple copies of the DHFR gene and multiple copies of other DNA (DNA encoding the mpl ligand) that make up the expression vector at the same time. For example, even if mutant DHFR genes that are highly resistant to Mtx are used and endogenous DHFR is present (European Patent No. 117,060), this extension technique can be used in other suitable host cells (e.g. ATCC No. CCL61 CHO-K1). . In another method, transformed or transformed host cells (particularly endogenous DHFR) with DNA sequences encoding mpl ligands, wild type DHFR proteins and other selection markers such as aminoglycoside 3 ′ phosphotransferase (APH) Wild-type host cells may be selected by cell growth in a medium containing a selection reagent of an aminoglycosidic antibiotic (eg, kanamycin, neomycin or G418) (US Pat. No. 4,965,199).

A suitable selection gene to use is the trp1 gene present in yeast plasmid YRp7 (Stinchcomb et al., Nature, 282: 39 [1979]; Kingsman et al., Gene, 7: 141 [1979]; Or Tschemper et al., Gene, 10: 157 [1980]. The trp1 gene provides a selection marker for yeast mutants (eg ATCC No.44076 or PEP4-1) that cannot grow on tryptophan (Jones, Genetics, 85:12 [1977]). The presence of trp1 lesions in the yeast host cell genome provides an effective environment for detecting transformation by growth in the absence of tryptophan. Likewise, Leu-2 deficient yeast strains (ATCC No. 20,622 or 38,626) are complemented by known plasmids with the Leu2 gene.

(iv) promoter components

Expression and cloning vectors typically contain a promoter recognized by the host organism and functionally linked to the mpl ligand nucleic acid. Promoters are untranslated sequences located upstream (5 ') of the start codon of the structural gene (typically 100 to 1000 bp) that control the transcription and translation of a particular nucleic acid sequence, such as the mpl ligand nucleic acid sequence, to which they are functionally linked. Such promoters typically fall into two classes of inducible and constitutive. Inducible promoters are promoters that increase the level of transcription from the DNA they are controlling in response to changes in culture conditions (eg, the presence or absence of nutrients or a change in temperature). Currently, many promoters are known that are recognized by a variety of potential host cells. These promoters are functionally bound to the mpl ligand coding DNA by removing the promoter from the source DNA by restriction enzyme hydrolysis and inserting the isolated promoter sequence into the vector. Native mpl ligand promoter sequences and many heterologous promoters can be used to amplify and / or express mpl ligand DNA. However, heterologous promoters are preferred because heterologous promoters generally provide higher transcription and higher yield of expressed mpl ligands as compared to native mpl ligand promoters.

Promoters suitable for use in prokaryotic host cells include the β-lactamase and lactose promoter lines (Chang et al., Nature, 275: 615 [1978]; and Goeddel et al., Nature, 281: 544 [1979]), Hybrid promoters such as alkaline phosphatase, tryptophan (trp) promoter systems (Goeddel, Nucleic Acids Res., 8: 4057 [1980] and European Patent No. 36,776) and tac promoters (deBoer et al., Proc. Natl. Sci. USA, 80: 21-25 [1983]. However, other known promoters are also suitable. Their nucleotide sequences are disclosed, allowing the skilled person to link them to DNA encoding mpl ligands by using linkers or adapters to provide any desired restriction sites (Siebenlist et al., Cell, 20: 269 [1980]). Promoters used in the bacterial system will also include a Shine-Dalgano (S.D.) sequence functionally linked to the DNA encoding the mpl ligand polypeptide.

Promoter sequences are also known in eukaryotic cells. In virtually all genes there is an AT-rich region located upstream by about 25 to 30 bases from the site of transcription. Another sequence found upstream by 70 to 80 bases from the start of transcription of many genes is the CXCAAT region where X can be any nucleotide. The AATAAA sequence, which may be a signal for the addition of the polyA tail at the 3 'end of the coding sequence, is located at the 3' end of most genes. These sequences are appropriately inserted into the expression vector of the eukaryotic cell.

Examples of suitable promoter sequences for use in yeast host cells include 3-phosphoglycerate kinases (Hitzeaman et al., J. Biol. Chem 255: 2073 [1980]) or enolase, glyceraldehyde-3-phosphate di Hydrogenase, hexokinase, pyruvate decarboxylase, phosphofetokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosphosphate isomerase, phosph Other glycolic enzymes such as poglocose isomerase, and glucokinase (Hess et al., J. Adv. Enxyme Reg., 7: 149 [1968] and Holland, Biochemistry, 17: 4900 [1978]). do.

Other yeast promoters, which are inducible promoters with the added benefit of transcription controlled by growth conditions, are alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradable elements associated with nitrogen metabolism, metallothionein, glyceraldehyde Promoter region of the enzyme involved in the use of -3-phosphate dehydrogenase and maltose and galactose. Suitable vectors and promoters for use in yeast expression are further described in Hitzman et al., European Patent Publication No. 73,657. East enhancers are also advantageous with the East promoter.

Mpl ligand transcription from vectors of mammalian host cells is described, for example, in polyoma virus, flowfox virus (British patent 2,211,504 published July 5, 1989), adenovirus (adenovirus 2), bovine papilloma virus, Heterotypic mammals such as promoters, actin promoters or immunoglobulin promoters derived from the genome of viruses such as Avian sacoma virus, cytomegalovirus, retrovirus, hepatitis-B virus and most preferably Simian virus 40 (SV40) It is regulated by a promoter and a promoter usually linked to the mpl ligand sequence, provided that such promoters are suitable for the host cell line.

Early and late promoters of the SV40 virus are obtained as SV40 restriction fragments that together contain the SV40 virus origin of replication [Fiers et al., Nature, 273: 113 [1978]; Mulligan and Berg, Science, 209: 1422-1427 [1980]; Pavlakis et al., Proc. Natl. Acad. Sci. USA, 78: 7398-7402 [1981]. Early promoters of human cytomegalovirus are advantageously obtained as HindIII E restriction fragments (Greenaway et al., Gene, 18: 355-360 [1982]). A system for expressing DNA in a mammalian host using bovine papilloma virus as a vector is described in US Pat. No. 4,419,446. Modified systems of this system are described in US Pat. No. 4,601,978. Expression of cDNA encoding immune interferon in monkey cells is also described in Gray et al., 295: 503-508 [1982], in mouse cells under the control of the thymidine kinase promoter from the herpes simplex virus. For expression of human β-interferon cDNA (Reyes et al., Nature, 297: 598-601 [1982]), for expression of the human interferon β1 gene in mouse and rat culture cells Canaani and Berg, Proc . Natl. Acad. Sci. USA, 79: 5166-5170 [1982] and as a promoter in the CV-1 monkey kidney cells, chick embryos, Chinese hamster egg cells, HeLa cells, and mouse NIH-3T3 cells using the Raus sacoma virus long term repeat as a promoter. For expression of bacterial CAT sequences, see Gorman et al., Proc. Natl. Acad. Sci. USA, 79: 6777-6781 [1982].

(v) enhancer element components

Transcription of DNA encoding the mpl ligands of the invention by higher eukaryotic cells is often increased by inserting enhancer sequences into the vector. Enhancers are cis-acting elements of DNA, typically about 10 to 300 bp, that act on the promoter and increase its transcription. Enhancers are not only within the coding sequence itself (Osborne et al., Mol. Cell Bio., 4: 1293 [1984]) but also within the intron [Banerji et al., Cell, 33: 729 [1983]. (Laimins et al., Proc. Natl. Acad. Sci. USA, 78: 993 [1981] and 3 '[Luski et al., Mol. Cell Bio., 3: 1108 [1983]) It is independent of orientation and position. Many enhancer sequences are known from mammalian genes (globin, elastase, albumin, a-phytoprotein and insulin). However, enhancers of eukaryotic cell viruses are usually used. Examples include the SV40 enhancer (100-270 bp) at the second half of the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer at the second half of the origin of replication and the adenovirus enhancer. For enhancer elements of eukaryotic cell promoters, see Yaniv et al., Nature, 297: 17-18 [1982]. The enhancer may be linked to the 3 'or 5' position of the mpl ligand coding sequence in the vector, but is preferably located at the 5 'region of the promoter.

(vi) transcription termination component

Expression vectors used in eukaryotic host cells (nucleated cells from yeast, fungi, insects, plants, animals, humans or other multinuclear organisms) will also contain the sequences necessary to terminate transcription and stabilize mRNA. Such sequences are typically located 5 'and sometimes 3' of the untranslated region of eukaryotic or viral DNAs or cDNAs. These regions have nucleotide fragments that are transcribed into polyadenylation fragments in the untranslated portion of the mRNA encoding the mpl ligand.

(vii) construction and analysis of vectors

Standard ligation techniques are used to produce suitable vectors containing one or more of the above components. Isolated plasmid or DNA fragments are cut, tailored and re-ligated to form the form necessary to produce the desired plasmid.

In the assay to confirm the accuracy of the sequences in the prepared plasmids, the ligation mixture was used to transform E. coli K12 strain 294 (ATCC No. 31,446) and successfully transformed cells with moderate ampicillin or tetracycline resistance. Screened according to ownership. Obtained plasmid from the transformant, analyzed by restriction endonuclease hydrolysis and / or by Messing et al., Nucleic Acids Res., 9: 309 [1981] or by Mexam et al. Methods in Enzymology , 65: 499 [1980].

(viii) transient expression vectors

Expression vectors that allow for the transient expression of DNA encoding mpl ligand polypeptides in mammalian cells are particularly useful in the practice of the present invention. In general, transient expression uses an expression vector capable of efficiently replicating in the host cell, whereby a large number of copies of the expression vector accumulate in the host cell, and thus the desired polypeptide encoded by the expression vector is synthesized at a high concentration. [Sambrook et al., supra pp 16.17-16.22. By using a transient expression system consisting of a suitable expression vector and a host cell, it is convenient to positively identify a polypeptide encoded by the cloned DNA and to quickly search for a polypeptide having the desired biological or physiological properties. As such, transient expression systems are particularly useful in the present invention for the purpose of identifying analogs and variants of mpl ligand polypeptides having mpl ligand polypeptide biological activity.

(ix) suitable representative vertebrate cell vectors

Other methods, vectors and host cells suitable for application in the synthesis of mpl ligands in recombinant vertebrate cell culture are described in Genet et al., Nature, 293: 620-625 [1981]; Mantei et al., Nature, 281: 40-46 [1979]; Levinson et al., European Patent No. 117,060; European Patent No. 117,058. Particularly useful plasmids used for expression of mpl ligands in mammalian cells are pRK5 (European Patent No. 307,247, U.S. Patent No. 5,258.287) or pSV16B (PCT Publication No. 91/08291).

D. Selection and Transformation of Host Cells

Suitable host cells for cloning or expressing a vector in the present invention are such prokaryotic, yeast or higher prokaryotic cells. Suitable prokaryotic cells include Gram-negative or Gram-positive organisms (eg, Bacillus, such as E. coli, B. subtilis, Pseudomonas species, such as P. aeruginosa). , Salmonella tynphimurium or Serratia marcescans, such as E. coli B, E. coli X1776 (ATCC No. 31,536) and E. coli W3110 (ATCC No. 27,325). Although other E. coli are suitable, the preferred E. coli cloning host is E. coli 294 (ATCC No. 31,446) These examples are illustrative of the invention and do not limit the scope of the invention. Cells should secrete minimal amounts of proteolytic enzymes Alternatively, in vitro cloning methods such as PCR or other nucleic acid polymerase reactions are suitable.

In addition to prokaryotic cells, eukaryotic microorganisms such as filamentous mushrooms or yeast are also suitable as host cells of the mpl ligand coding vector. Saccharomyces cerevisiae or conventional baker's yeast is most commonly used as a lower prokaryotic host microorganism. However, many other genera, species and strains are commonly available and are used in the present invention, for example Schizosaccharomyces pombe (Beach and Nurse, Nature, 290: 140 [1981]; European Patent 139,383, published May 2, 1985). ), For example, K. lactis (Louvencourt et al., J. Bacteriol., 737 [1983]), K. fragillis. Kluyveromyces host cells such as K.bulgaricus, K.thermotolearns and K. marxianus (US Pat. No. 4,943,529), yarrowia [European Patent 402,226], Pichia pastoris (European Patent 183,070; Sreekrina et al., J. Basic) Microbiol., 28: 265-278 [1988]), Candida, Trichoderma reesia (European Patent No. 244,234), Neurespora crassa (Case et al., Proc. Natl. Acad. Sci. USA, 76: 5259-5263 [1979] ]), Neurospora, Penicillin, Tolypocalidium (International Publication No. 91/00357, published January 10, 1991), and A. nidulans (Ballancd et al., Biochem. Biophys. Res. Commun. 112: 284-289) [1983]; Tilburn et al., Gene, 26: 205-221 [1983]; Yelton et al., Proc. Natl. Acad. Sci. USA, 81: 1470-1474 [1984]) and A. niger (Kelly) And Aspergillus host cells such as Hynes, EMBO J., 4: 475-479 [1985].

Suitable host cells for the expression of glycosylated mpl ligands are from multicellular organisms. Such host cells have complex processes and glycosylation activity. In principle, all higher eukaryotic cell media are available regardless of vertebrate or invertebrate cells. Examples of invertebrate cells are plant and insect cells. Many viral strains and variants and corresponding acceptable insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes aldopictus (mosquito), Drosophila melanogaster (fruit fly) and Bombyx mori have been identified. Luckow et al., Bio / Technology, 6: 47-55 [1988]; Miler et al., Genetic Engineering, Setlow et al., Eds., Vol. 8 (Plenum Publishing, 1986) pp. 277-279; And Nature, 315: 592-594 [1985]. Various virus strains to be used for infection are known (e.g., L-1 variant of Autigrapha californica NPV and Bm-5 strain of Bombyx mori NPV) and these viruses are used in the present invention, in particular as viruses for infection of Spodoptera frugiperda cells. Can be.

Cotton, corn, potatoes, soybeans, petunia. Plant cultures such as tomatoes and tobacco can also be used as hosts. Typically, plant cells are infected by incubating with certain strains of the bacterial Agarobacterium tumefaciens that have been previously engineered to contain mpl ligand DNA. By incubating the plant cell culture with A. tumefaciens, the DNA encoding the mpl ligand is transferred to the plant cell, which infects the plant cell and expresses the mpl ligand DNA under suitable conditions. Also suitable are regulatory and signal sequences suitable for plant cells, such as nopalin synthetase promoter and polyadenylation signal sequences (Depoker et al., J, Mol. Appl. Gen., 1: 561 [1982]). . In addition, DNA fragments isolated in the upstream region of the T-DNA 780 gene can activate and increase the degree of transcription of plant-expressable genes in recombinant DNA-containing plant tissues (European Patent No. 321,196, published June 21, 1989). .

However, interest in vertebrate cells is at its peak and breeding of vertebrates in culture (tissue culture) in recent years has become a common procedure (Tissue Culture, Academic Press, Kruse and Patterson, editors [1973]). Examples of useful mammalian host cell lines include monkey kidney CV1 cell lines infected by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney cell lines (293 cells or 293 cells subcloned for growth in suspension medium) (Graham et al. , J. Gen Viol., 36:59 [1977]); baby hamster kidney cells (BHK, ARCC CCL 10); Chinese hamster egg cells / -DHFR (CHO) (Urlaub and Chasin, Proc. Natl. Sci. USA, 77: 4216 [1980]); mouse Sertoli cells (TM4, Mather, Biol. Reprod., 23: 243-251 [1980]; monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76 , ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK ATCC CCL 34); buffalo rats Intestinal cells (BRL 3A ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammalian tumors (MMT 060562, ATCC CCL51); TRI cells (Mather et al. , Annals NY Acad. Sci., 383: 44-68 [1982]); MRC 5 cells; FS4 cells: and human hepatoma cell line (Hep G2).

Host cells are cultured in a nutrient medium designed to be infected or preferably transformed with the expression and cloning vectors of the present invention and to be suitable for promoter induction, transformant selection, or augmentation of genes encoding sequences of interest.

Infection means that the expression vector is taken up by the host cell regardless of whether the coding sequences are actually expressed. Many methods of infection are known to those skilled in the art, for example, the CaPO ₄ method and the electroporation method. The success of the infection is generally confirmed by the development of an indication of the behavior of this vector in the host cell.

Transformation means introducing DNA into an organism so that the DNA is replicable as an extrachromosomal element or as a component within the chromosome. Depending on the host cell used, calcium treatment with calcium chloride, as described in Sambrook et al., Supra, is used for prokaryotic or other cells with substantial cell wall barriers. Agarobacterium tumfacience is used for transformation of certain plant cells, as described by Shaw et al., Gene, 23: 315 [1983] and International Publication No. 89/05859, published January 10, 1991. In the case of mammalian cells without such cell walls, the calcium phosphate precipitation method described in Graham and van der Eb, Virology, 52: 456-457 is preferred. General details of mammalian cell host system transformation are described in US Pat. No. 4,399,216, issued to Axel on August 16, 1983. Istro transformations are also described by Van Solingen et al., J. Bact., 130: 946 [1977] and Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76: 3829 [1978]. However, other methods of introducing DNA into cells, such as nuclear injection, electroporation, or protoplast fusion, may also be used.

E. Host Cell Culture

Prokaryotic cells producing the mpl ligand polypeptides of the invention are generally cultured in a suitable medium as described in Sambrook et al., Supra.

Mammalian host cells used to produce the mpl ligands of the invention are cultured in a variety of media. Commercially available media such as Ham's F10 (Sigma), Minimal Essential Medium ([MEM], Sigma), RPMI-1640 (Sigma) and Dulbecco's Modified Medium ([DMEM], Sigma) are suitable for culturing these host cells. In addition, Ham and Wallace, Meth. Enz., 58:44 [1979], Barns and Sato, Anal. Biochem., 102: 255 [1980]; US Patent No. 4,767,704; 4,657,866; US Pat. 4,927,762; 4,927,762; Or 4,560,655; International Publication No. 90/03430; US 78/00195; Any medium described in U.S. Patent No. 30,985 or pending US Patent Application No. 07 / 592,107 or 07 / 592,141, filed Oct. 3, 1990, are all incorporated herein by reference. It can be used as a culture medium of host cells. Any of these media may be hormones and / or growth factors (insulin, transferrin or epidermal growth hormone), salts (sodium chloride, calcium, magnesium and phosphate), buffers (HEPES), nucleosides (adenosine and thymidine). , Antibiotics (gentamicin ^TM drugs), small amounts of urea (defined as inorganic compounds usually present in the final concentration micromolar) and glucose or equivalent energy sources can be supplemented as needed. Any other necessary supplements may be included at appropriate concentrations known in the art. Culture conditions such as temperature, pH and the like are the conditions previously used for the host cell selected for expression and are well known to those of ordinary skill in the art.

Host cells as used herein include cells in in vitro medium as well as cells in a host animal.

F. Genetic Extend / Expression Detection

Genetic amplification and / or expression patterns can be directly determined in the sample, eg, Northern blotting (Thomas, Proc. C.), which measures Southern blotting, mRNA transcription using appropriately labeled probes, based on the sequences provided herein. Natl. Acad. Sci. USA, 77: 5201-5205 [1980]) or in hybridization in a reactor. Various labels, most often radioisotopes, in particular ³² P, can be used. However, other techniques can also be used, such as methods for introducing into a polynucleotide using biotin-modified nucleotides. This biotin subsequently provides a binding site for the avidin or antibody (which can be labeled by various labels such as radionuclides, fluorescents, enzymes, etc.). In other methods, antibodies that can recognize DNA duplexes, RNA duplexes, and specific duplexes, including DNA-RNA hybrid duplexes or DNA-protein duplexes, can also be used. The antibodies are then labeled and the duplex is attached to the surface, and as the duplex is present on the surface, an analysis is performed in which the presence of the antibody bound to the duplex can be detected.

In another method, gene expression is measured by immunological methods such as immunohistochemical staining of tissue sections and analysis of cell culture or body fluids that can directly quantify expression of gene products. In immunohistochemical staining techniques, cell samples are usually dehydrated and settled, and then specific to the gene product to which they are bound, wherein the labels are typically visually detectable labels such as enzyme labels, fluorescent labels, luminescent labels, and the like. Prepared by reacting with antibodies. Particularly sensitive dyeing techniques suitable for use in the present invention are described in Hsu et al., Am. J. Clin. Path, m 75: 734-738 [1980].

Antibodies useful for immunohistochemical staining and / or analysis of sample solutions can be monoclonal or polyclonal, and can be prepared in any mammal. These antibodies are advantageously prepared against mpl ligand polypeptides or synthetic peptides based on the following DNA.

Purification of G. mpl Ligand Polypeptides

The mpl ligand can be recovered from the culture medium, preferably as a secreted polypeptide, but it can also be recovered from the host cell lysate when expressed directly without secretion signal.

When the mpl ligand is expressed in recombinant cells other than cells of human origin, the mpl ligand is devoid of human native proteins or polypeptides. However, in order to obtain a substantially uniform formulation of the mpl ligand itself, it is necessary to purify the mpl ligand from other recombinant cellular proteins or polypeptides. First, the culture medium or lysate is centrifuged to remove particulate cell debris. The membrane and soluble protein fractions are separated. Alternatively, commercial protein enrichment filters can be used (eg, Amicon or Millipore Pellicon ultrafiltration units). The mpl ligand is then purified from the soluble protein fraction and the membrane fraction of the culture lysate depending on whether the mpl ligand is bound to the membrane. Subsequent mpl ligands are purified from contaminating proteins and polypeptides by salting and exchange or chromatographic methods using various gel matrices. These matrices include those commonly used for acrylamide, agarose, dextran, cellulose and protein purification. Examples of suitable chromatographic methods suitable for protein purification include immunoaffinity chromatography (eg anti-hmpl ligand Mab), receptor affinity chromatography (eg mpl-IgG or Protein A Sepharose), hydrophobic interaction chromatography (eg Con A-Sepharose, Lentil-Lectin-Sepharose), molecular exclusion chromatography (e.g. Sephadex G-75), cation and anion exchange column chromatography (e.g. DEAE or carboxymethyl and sulfopropyl cellulose), and reverse phase High performance liquid chromatography (RP-HPLC) (see Urdal et al., J. Chromatog, 296: 171 [1984] using two consecutive RP-HPLC steps for purification of recombinant human IL-2). Other purification steps optionally include ethanol precipitation, ammonium sulfate precipitation, chromatofocusing, preparative SDS-PAGE and the like.

The mpl ligand variants with residues removed, inserted or substituted are recovered in the same manner as the native mpl ligands, taking into account substantial changes in the properties caused by the modifications. For example, mpl ligand fusion agents with other proteins or polypeptides (such as bacterial or viral antigens) may facilitate purification so that an immunoaffinity column containing an antibody against this antigen may be used to adsorb this fusion polypeptide. have. Immune affinity columns, such as rabbit polyclonal anti mpl ligand columns, can be used to adsorb mpl ligand variants by binding to one or more residual epitopes. In another method, the mpl ligand is subjected to affinity chromatography using purified mpl-IgG bound to (preferably) immobilized resins such as Affi-Gel 10 (Bio-Rad, Richmond, Calif.) According to methods known in the art. It can be purified by. Protease inhibitors such as phenyl methyl sulfonyl fluoride (PMSF) are also useful to inhibit proteolysis during purification and antibiotics may also be included to prevent the growth of accidental contaminants. Those skilled in the art will appreciate that purification methods suitable for natural mpl ligands require modifications in the method that take into account changes in the properties of the mpl ligand or its variants upon expression in recombinant cell culture.

H. mpl  Covalent Degeneration of Ligand Polypeptides

Covalent modifications of the mpl ligand polypeptides are within the scope of this invention. Both native mpl ligands and amino acid sequence variants of the mpl ligands can be covalently denatured. One type of covalently modified variant included within the scope of the present invention is the mpl ligand fragment. Variant mpl ligand fragments having up to about 40 amino acid residues may be appropriately prepared by enzymatic or chemical cleavage of full length or variant mpl ligand polypeptides or by chemical synthesis. mpl ligand or other type of covalent modification products of a fragment thereof are introduced into the molecule by reacting with an organic derivatizing agent capable of reacting with the mpl ligand or a fragment thereof selected for the target amino acid residue side chains or the N- or C- terminal residues do.

     The cysteinyl residues are mainly reacted with α-haloacetates (and corresponding amines) such as chloroacetic acid or chloroacetamide to produce carboxymethyl or carboxyamidomethyl derivatives. Cysteinyl residues also include bromotrifluoroacetone, α-bromo-β- (5-imidozoyl) propionic acid, chloroacetyl phosphate, N-alkylmaleimide, 3-nitro-2-pyridyl disulfide, methyl Derivatized by reaction with 2-pyridyl disulfide, p-chloromercurybenzoate, 2-chloromercury-4-nitrophenol, or chloro-7-nitrobenzo-2-oxa-1,3-diazole .

     Since diethylpyrocarbonate has relatively specificity for histidyl side chains, histidyl residues are derivatized by reaction with diethylcarbonate at pH 5.5-7.0. Parabromophenacyl bromide is also useful; This reaction is preferably carried out in 0.1 M sodium cacodylate at pH 6.0.

     Lysinyl and amino terminal residues react with succinic acid or other carboxylic anhydrides. Derivatization with these reagents has the effect of reversing the charge of the lysinyl residues. Other reagents suitable for derivatizing amino containing moieties include imidoesters such as methyl picolinimidate; Pyridoxal phosphate; Pyridoxal; Chloroborohydride; Trinitrobenzenesulfonic acid; O-methylisourea; 2,4-pentanedione, and also includes a transaminase catalytic reaction with glyoxylate.

     Arginyl residues are modified by reaction with one or more conventional reagents, and such reagents include phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin. Derivatization of arginine residues requires that the reaction be carried out under alkaline conditions because of the high pKa of the guanidine functional group. Moreover, these reagents can react with not only lysine but also arginine epsilon-amino groups.

Tyrosyl residues can be specifically modified, and are achieved by introducing spectral labels into tyrosyl residues, in particular by reaction with aromatic diazonium compounds or tetranitromethane. Most often, N-acetylimidazole and tetranitromethane are used to form O-acetyl tyrosyl species and 3-nitro derivatives, respectively. In order to prepare labeled proteins for use in radioimmunoassay, ¹²⁵ or ¹³¹ I is used to iodo-tyrosine residues, and the chloramine T method is suitable.

     Carboxyl side chain groups (aspartyl or glutamyl) are carbodiimides [RN = C = NR 'where R and R' are other alkyl groups], for example 1-cyclohexyl-3- (2- And optionally modified by reaction with morpholinyl-4-ethyl) carbodiimide or 1-ethyl-3- (4-azonia-4,4-dimethylpentyl) carbodiimide. In addition, aspartyl and glutamyl residues are converted to asparaginyl and glutaminil residues by reaction with ammonium ions.

Derivatization with bifunctional reagents is useful for crosslinking mpl ligands to water-insoluble support matrices or surfaces for use in anti- mpl ligand antibody purification methods and vice versa. Commonly used crosslinkers include, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example esters with 4-azidosalicylic acid. , Homobifunctional imidoesters (including disuccinimidyl esters such as 3,3'-dithiobis (succinimidylpropionate)) and difunctional maleimides (e.g. bis-N-maleimide-1, 8-octane). Derivatizing agents such as methyl-3-[(p-azidophenyl) dithio] propioimidate produce photoactive intermediates which can form crosslinks in the presence of light. On the other hand, protein immobilization utilizes reactive water insoluble matrices such as cyanogen bromide activated carbohydrates and reactive matrices described in US Pat. Glutaminyl and asparaginyl residues are mainly deamidated to form the corresponding glutamyl and aspartyl residues, respectively. These residues are deamidated under neutral or basic conditions. Deamidated forms of these residues are also within the scope of the present invention.

Other denaturing methods include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, and methylation of α-amino groups of lysine, arginine and histidine side chains (TE Creighton, Proteins: Structure and Molecular Properties, WH Freeman & Co., San Francisco, pp. 79-86, 1983), acetylation of N-terminal amines and amidation of any C-terminal carboxyl groups.

     Another type of covalent modification of mpl ligand polypeptides encompassed within the scope of the present invention is to alter the natural glycosylation pattern of the polypeptide. The term alter refers to the deletion of one or more carbohydrate moieties found in the natural mpl ligand, and / or the insertion of one or more glycosylation sites that are not present in the natural mpl ligand.

     Glycosylation of polypeptides is typically N-linked or O-linked. The term N-bond means the attachment of a carbohydrate moiety to the side chain of an asparagine residue. The tripeptide sequences asparagine-X-serine and asparagine-X-threonine, where X is an amino acid except proline, are recognition sequences for enzymatic attachment of carbohydrate moieties to the asparagine side chains. Thus, the presence of either of these tripeptide sequences in one polypeptide provides a potential glycosylation site. O-linked glycosylation is achieved by the use of N-acetylgalactosamine, galactose or xylose saccharides in hydroxyamino acids (primarily serine or threonine may be used, but 5-hydroxyproline or 5-hydroxylysine may also be used). It means to be attached.

Insertion of a glycosylation site into the mpl ligand polypeptide is suitably achieved by altering the amino acid sequence such that the polypeptide contains one or more such tripeptide sequences (in the case of an N-linked glycosylation site). This alteration can also be accomplished by inserting or replacing one or more serine or threonine residues in the native mpl ligand sequence (for O-linked glycosylation sites). For convenience, the mpl ligand amino acid sequence is preferably altered by changes in the DNA level, particularly by mutating the DNA encoding the mpl ligand polypeptide at a given base such that codons are translated to the desired amino acid. . DAN variations can be obtained using the methods described under the heading "Amino Acid Sequence Variants of the mpl Ligand".

Another method for increasing the number of carbohydrate moieties on the mpl ligand is chemical or enzymatic coupling of glycosides to the polypeptide. These methods are advantageous in that they do not require the production of polypeptides in host cells with glycosylation capacity for N- or O-linked glycosylation. Depending on the coupling method used, the sugars can be (a) arginine and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups (e.g. sulfhydryls of cysteine), (d) free hydroxyl groups (e.g. : A hydroxyl group of serine, threonine or hydroxyproline), (e) an aromatic moiety (eg, an aromatic moiety of phenylalanine, tyrosine or tryptophan), or (f) an amide group of glutamine. These methods are described in International Publication No. 87/05330 (published September 11, 1987) and in Wriston, CRC Crit. Rev. Biochem., Pp 259-306 (1981).

     Removal of carbohydrate moieties present on the mpl ligand polypeptide can be performed chemically or enzymatically. Chemical deglycosylation requires exposing the polypeptide to trifluoromethanesulfonic acid or equivalents thereof. This treatment results in the cleavage of almost all sugars except the binding sugar (N-acetylglucosamine or N-acetylgalactosamine), while the polypeptide remains intact. Chemical deglycosylation is described by Hakimuddin et al. Arch. Biochem. Biophys., 259: 52, 1987 and Edge et al., Anal. Biochem., 118: 131,1981. Enzymatic cleavage of the carbohydrate moiety on the polypeptide is described by Thotakura et al. Meth. Enzymol., 138: 350, 1987, can be achieved using various endo- and exo-glycosidases.

     Glycosylation at potential glycosylation sites is described by Duskin et al. Biol. Chem., 257: 3105, 1982, can be used to prevent tunicamycin. Tunicamycin blocks the formation of protein-N-glycoside bonds.

Other types of covalent denaturation of mpl ligands can be accomplished by varying the mpl ligand polypeptides to various nonproteinaceous polymers by the methods described in US Pat. Nos. 4,640,835,44,966,4301144,4670417,4791192, or 44179337. Such as, for example, binding to one of polyethylene glycol, polypropylene glycol or polyoxyalkylene. A mpl ligand polypeptide covalently bound to this polymer is referred to herein as a pegylated mpl ligand polypeptide.

     Partial retrieval of recovered mpl ligand variants is necessary to select the optimal variant that has the immunological and / or biological activity and binds to mpl. Searches for stability (eg for proteolytic cleavage) in recombinant cell culture or cytoplasm, high affinity for mpl components, oxidative stability, ability to be secreted in high yield, and the like. For example, changes in immunological properties of mpl ligand polypeptides such as affinity for a particular antibody are measured by competitive immunoassays. Other potential denaturation of protein or polypeptide properties such as redox or thermal stability, hydrophobicity or susceptibility to proteolytic degradation is assessed by methods known in the art.

17. General method for the preparation of antibodies to mpl ligands

Antibody manufacturing

    (1) polyclonal antibodies

Polyclonal antibodies to mpl ligand polypeptides or fragments generally occur by subcutaneous (sc) or intraperitoneal (ip) injection of mpl ligands and adjuvants into an animal multiple times. Bifunctional or derivatives of mpl ligands or fragments containing target amino acid sequences to immunogenic proteins of the species to be immunized, such as keyhole limpet hemocyanin, serum albumin, bovine tyroglobulin or soybean trypsin inhibitor Oxidation reagents such as maleimidobenzoyl sulfosuccinimide esters (conjugation via cysteine residues), N-hydroxysuccinimides (conjugation via lysine residues), glycaraldehyde, succinic anhydride, SOCl ₂ or R ¹ N It is useful to join using = C = NR, where R and R ¹ are different alkyl groups.

     Animals are immunized against mpl ligand polypeptides or fragments, immunogenic conjugates or derivatives by mixing 1 μg of peptide or conjugate (respectively, rabbit or mouse) with 3 volumes of Front Complete Auxiliary Solution and intravenously injecting this solution into various sites. After one month, the animals are boosted by subcutaneous injection of 1/5 to 1/10 of the original amount of peptide or conjugate in the frontal complete supplement. After 7-14 days, animals are bled and serum is analyzed for mpl ligand antibody titers. Boost the animals until the titer reaches a plateau. Preferably, animals are boosted with conjugates of the same mpl ligand, but conjugated to different proteins via different crosslinkers. Conjugates can also be prepared in recombinant cell culture as protein fusions. In addition, flocculants such as alum are used to enhance the immune response.

     (ii) monoclonal antibodies

     Monoclonal antibodies are obtained substantially from the homologous antibody group (ie, the individual antibodies that make up this group are identical except that small amounts of naturally occurring mutations may be present). Thus, the denaturant "monoclonal" indicates that the nature of the antibody is not a mixture of individual antibodies.

For example, the mpl ligand monoclonal antibodies of the invention can be prepared using the hybridoma method first described in Kohler & Milstein, Nature, 256: 495 (1975), or by recombinant DNA methods (US Pat. No. 48,165,673). Ho, Cabilly, etc.).

     In the hybridoma method, mice or other suitable host animals, such as hamsters, are immunized as described above to infer lymphocytes capable of producing or producing antibodies that specifically bind to the proteins used for immunization. Alternatively, lymphocytes may be immunized in vivo. Lymphocytes are then fused with myeloma cells using a suitable fusing agent such as polyethylene glycol to form hybridoma cells. Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 [Academic Press, 1986].

     The hybridoma cells thus prepared are preferably grown by seeding in a suitable medium containing one or more substances that inhibit the growth or survival of unfused parental myeloma cells. For example, if the parental myeloma cells lack hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT) enzymes, the medium for hybridoma is typically hypoxanthine, aminopterin and thymidine (these substances are HGPRT). Impede growth of deficient cells) (HAT medium).

     Preferred myeloma cells are those that fuse efficiently, support stable and high levels of antibody expression by selected antibody producing cells, and are sensitive to media such as HAT media. Among these, preferred myeloma cell lines are mouse myeloma cells, such as those derived from MOPC-21 and MPC-11 mouse tumors (Salk Institute Cell Distribution Center, San Diego, CA, USA), and SP-2 cells (American Type Culture Collection, In Rockville, Maryland. Human myeloma and mouse-human heteromyeloma cell lines have also been described for use in the production of human monoclonal antibodies [Kozbor, J. Immunol., 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Application, pp. 51-63, Marcel Dekker, Inc., New York, 1987].

     The medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies against mpl ligands. Preferably, the binding specificity of the monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or in vitro binding assays (radioimmunoassay, RIA) or enzyme linked immunosorbent assay (ELISA).

The binding affinity of monoclonal antibodies is described, for example, in Scatchard analysis; Munson & Pollard, Anal. Biochem., 107: 220 (1980).

      After identifying hybridoma cells that produce antibodies with the specificity, affinity, and / or activity of interest, the clones can be subcloned by limiting dilution and grown by standard methods (God et al., Supra). Suitable media for this purpose include, for example, Dulbecco's modified Eagle's medium or RPMI-1640 medium. In addition, hybridoma cells can be grown in vivo as ascites tumors in an animal.

     Monoclonal antibodies secreted by subclones are media, ascites, by conventional immunoglobulin purification methods such as protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography. It is appropriate to separate from body fluids or serum.

     The DNA encoding the monoclonal antibodies of the invention are easily isolated and sequenced using conventional methods, such as oligonucleotide probes that can specifically bind genes encoding the heavy and light chains of murine antibodies. Hybridoma cells of the invention are preferred sources of such DNA. Once isolated, the DNA is placed in an expression vector and then transfected into host cells, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin proteins, to monoclonal in recombinant host cells. Synthesize antibodies. DNA can also be used, for example, using coding sequences for human heavy and light chain constant domains instead of homologous mouse sequences (see, eg, Cabilly et al., Morrison et al., Proc. Nat. Acad. Sci., 81: 6851 (1984). Or, by covalently linking all or a portion of a coding sequence for a non-immunoglobulin polypeptide to an immunoglobulin coding sequence.

     Typically, such non-immunoglobulin polypeptides are substituted in place of the constant domains of the antibodies of the invention, or in place of the variable domains of the antigen binding sites of the antibodies of the invention, thereby having one antigen binding site having specificity for the mpl ligand and It produces chimeric bivalent antibodies consisting of another antigen binding site having specificity for different antigens.

     Chimeric or hybrid antibodies may also be prepared in vitro using methods known in synthetic protein chemistry, including methods using crosslinking agents. For example, immunotoxins can be prepared using disulfide exchange reactions or by forming thioether bonds. Examples of suitable reagents for this purpose include iminothiolates and methyl-4-mercaptobutyrimidate.

For applications in the diagnostic field, antibodies of the invention will typically be labeled by detectable moieties. The detectable moieties may be those capable of producing a detectable signal directly or indirectly. For example, the detectable moiety can be a radioactive isotope such as ³ H, ¹⁴ C, ³² P, ³⁵ S, or ¹²⁵ I, a fluorescing or chemiluminescent compound such as fluorescein isothiocyanate, rodamine or luciferin, eg For example, radioactive isotope markers such as ¹²⁵ I, ³² P, ¹⁴ C, or ³ H, or enzymes such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase.

     Individual conjugation of the antibody to the detectable moiety is known in the art, such as, eg, Hunter et al., Nature, 144: 945 (1962); David et al., Biochemistry, 13: 1014 (1974); Pain et al., J. Immunol. Meth., 40: 219 (1981); Nygren, Hystochem. and Cytochem., 30: 407 (1982).

     Antibodies of the invention can be used in known assays such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays (Zola, Monoclonal Antibodies: A Manual of Techniques. Pp 147-158 (CRC Press, Inc., 1987)).

     Competition binding assays rely on the ability of a labeled standard (mpl ligand or immunologically reactive portion thereof) to compete with a test sample analyte (mpl ligand) for binding to a limited amount of antibody. The amount of mpl ligand in the test sample is inversely proportional to the amount of standard bound to the antibody. In order to facilitate determination of the amount of standards bound, it is generally appropriate to insolubilize the antibody before or after competition to separate the standards and analytes bound to the antibody from the unbound standards and analytes.

The sandwich assay uses two antibodies, each of which can bind to different immunogenic portions or epitopes of the protein to be detected (mpl ligand). In the sandwich assay, the test sample analyte is bound by a first antibody immobilized on a solid support, and then the second antibody is bound to the analyte to form an insoluble three part complex. (US Patent No. 4,376,110 to David & Greene). The second antibody can itself be labeled with a detectable moiety (direct sandwich assay) or can be measured using an anti-immunoglobulin antibody labeled by the detectable moiety (indirect sandwich assay). For example, one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme (eg horseradish peroxidase).

     (iii) humanized antibodies and human antibodies

     Methods for humanizing nonhuman antibodies are known in the art. In general, humanized antibodies have one or more amino acid residues introduced from a non-human source. These nonhuman amino acid residues are often referred to as "import" residues, which are generally taken from the "import" variable domain. Humanization is described by Winter et al. (Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988). ) Can be performed by substituting the corresponding sequences of the human antibody with a tongue or CDR sequences. Thus, this “humanized” antibody is a chimeric antibody (see Cabilly et al., Supra), wherein substantially less than intact human variable domains are replaced by corresponding sequences from non-human species. Indeed, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites of rodent antibodies.

     The choice of heavy and light chain human variable domains used to prepare humanized antibodies is of great importance for reducing antigenicity. According to the so-called "best-fit" method, the sequence of the variable domains of rodent antibodies is searched against the entire library of known human variable domain sequences. Human sequences most similar to rodent sequences are recognized as human frameworks (FR) for humanized antibodies (Sims et al., J. Immunol. 151: 2296 (1993); Chothia and Lesk, J. Mol. Biol. 196: 901 (1987)). Another method uses a specific framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework can be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA, 89: 4285 (1992); Presta et al., J. Immol., 151: 2623 (1993) ).

     It is also important that the antibody be humanized with high affinity for the antigen and other advantageous biological properties. To achieve this object, according to a preferred method, humanized antibodies are prepared by methods of analyzing the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are well known to those skilled in the art. Computer programs are available that illustrate and display the possible placement structures of selected candidate immunoglobulin sequences. By observing this indication, it is possible to analyze for possible roles of residues in the functionalization of candidate immunoglobulin sequences, ie for residues that affect the ability of a candidate immunoglobulin to bind its antigen. By this method, FR residues can be selected and linked from consensus and import sequences, thus obtaining desired antibody properties such as increased affinity for the target antigen (s). In general, CDR residues are directly related to directly affecting antigen binding. See US Patent Application No. 07 / 934,373, filed Aug. 21, 1992, which is part of US Patent Application No. 07/715272, filed Jun. 14, 1991.

Alternatively, it is currently possible to produce transgenic animals (eg mice) capable of producing a complete repertoire of human antibodies under conditions where there is no endogenous immunoglobulin production upon immunization. For example, homozygous deletion of the antibody heavy chain linkage region (J _H ) gene in chimeric and germline mutant mice has been described as causing complete inhibition of endogenous antibody production. Metastasis of the human germline immunoglobulin gene sequence in such germline mice leads to the production of human antibodies upon antigen challenge (Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90: 2551-255 (1993) Jakobovits et al. Nature, 362: 255-258 (1993); Bruggermann et al., Year in Immuno., 7:33 (1993)). Human antibodies can also be produced in phage display libraries (Hoogenboom and Winter, J. Mol. Biol. 227, 381 (1991); Marks et al., J. Mol. Biol. 222, 581 (1991)).

     (iv) bispecific antibodies

     Bispecific antibodies are monoclonal, preferably human or humanized antibodies with binding specificities for at least two different antigens. Methods of making bispecific antibodies are known in the art.

     Typically, recombinant production of bispecific antibodies is based on the coexpression of two immunoglobulin heavy chain-light chain pairs, where the two heavy chains have different specificities (Millstein and Cuello, Nature, 305: 537-539 (1983). )). Because of the random classification of immunoglobulin heavy and light chains, these hybridomas (quadromas) are potential mixtures of ten different antibody molecules, only one of which has the correct bispecific structure. Purification of the correct molecule is usually performed by an affinity chromatography step, which is rather cumbersome and yields low production. Similar methods are described in International Publication No. 93/08829 (published May 13, 1993) and in Trauneker et al., EMBO, 10: 3655-3659 (1991).

     According to a different, more preferred method, the antibody variable domain (antibody-antigen binding site) with the desired binding specificity is fused to an immunoglobulin constant domain sequence. Fusion is preferably with an immunoglobulin heavy chain constant domain sequence comprising at least a portion of a hinge, CH2 and CH3 region. It is preferred to have a first heavy chain constant region (CH1) containing a site necessary for light chain binding, present in at least one of the fusions. The immunoglobulin heavy chain fusions and, if desired, the DNA encoding the immunoglobulin light chain are inserted into separate expression vectors and cotransfected into the appropriate host organism. This provides a great deal of flexibility in adjusting the mutual proportions of the three polypeptide fragments when the uneven proportion of the three polypeptide chains used in the preparation provides the optimum yield. However, when the expression of two or more polypeptide chains in equal proportions provides a high yield, or when the ratio is not so important, the coding sequence for two or all three polypeptide chains is inserted into one expression vector. It is also possible. In a preferred embodiment of this method, the bispecific antibody has a hybrid immunoglobulin heavy chain with a first binding specificity on one arm and a hybrid immunoglobulin heavy chain-light chain pair on the other arm (providing a second binding specificity). Has This asymmetric structure facilitates the separation of the desired bispecific compound from unnecessary immunoglobulin chain combinations, as it provides an easy separation where only half of the bispecific molecule is present with an immunoglobulin light chain. This method is described in pending US patent application Ser. No. 07/931811, filed Aug. 17, 1992.

     For details on producing bispecific antibodies, see, eg, Methods in Enzymology 121: 210 (1986) by Suresh et al.

     (v) heteroconjugated antibodies

     Heteroconjugate antibodies are also included within the scope of the present invention. Heteroconjugate antibodies consist of two covalently linked antibodies. Such antibodies, for example, target immune system cells to unwanted cells (US Pat. No. 4,676,980) and treat HIV infections (International Publication No. 91/00360, International Publication No. 92/00373, European Patent No. 103089). Is proposed. Heteroconjugate antibodies can be prepared using suitable crosslinking methods. Suitable crosslinkers are known in the art and are described in US Pat. No. 4,676,980 with many crosslinking techniques.

IV. Therapeutic uses of megakaryocyte-producing protein mpl ligand

Biologically active mpl ligands having hematopoietic effector functions, referred to herein as megakaryocyte-producing or progenitor proteins (TPOs), may be responsible for the megakaryocyte-producing or progenitor-producing activity of patients suffering from protropenia due to platelet damage, sequestration or increased destruction It can be used in stimulating sterile pharmaceutical formulations. Myelodysplasia associated with megakaryocytopenia (eg, aplastic anemia associated with chemotherapy or bone marrow transplantation) can be effectively treated with the compounds of the present invention, and also with disseminated intravascular coagulation (DIC), immunoprogenitor reduction (HIV-induced). ITP and non-HIV-induced ITP), chronic idiopathic protropenia, congenital protropenia, spinal dysplasia and thrombocytopenia can also be effectively treated with the compounds of the present invention. In addition, these megakaryocyte-producing proteins may be useful for the treatment of proliferative myeloproliferative as well as for prostatic hyperplasia derived from inflammatory diseases.

     Preferred uses of the megakaryocyte-producing or progenitor protein (TPO) of the present invention are myelotoxic chemotherapy for the treatment of leukemia or solid tumors, spinal cord resection chemotherapy for self or allogeneic bone marrow transplantation, spinal dysplasia, idiopathic aplastic anemia, congenital progenitors Use in reduction and immune pro-reduction.

     Other diseases that can be effectively treated with the megakaryocyte-producing protein of the present invention include platelet defects or damage due to activation of drugs, toxins or artificial surfaces. In this case, the compounds of the present invention can be used to stimulate "dropout" of new "intact" platelets. For a more complete list of useful applications see the above "Background" section, in particular (a) to (f) and the references cited therein.

     The megakaryocyte-producing protein of the present invention may be used alone or in combination with other cytokines, hematopoietic, interleukin, growth factors or antibodies in the treatment of the above diseases and symptoms. Thus, the compounds of the present invention include G-CSF, GM-CSF, LIF, M-CSF, IL-1, IL-3, erythrocyte hematopoietic (EPO), kit ligands, IL-6 and IL-11 It can be used in combination with other proteins or peptides having production activity.

     The megakaryocyte-producing protein of the present invention is prepared by mixing with a pharmaceutically acceptable carrier. This therapeutic composition may be administered intravenously or through the nose or lungs. The compositions of the present invention can also be administered parenterally or subcutaneously as needed. For systemic administration, the therapeutic composition of the present invention should be pyrogen free and in a parenterally acceptable solution state with adequate pH, isotonicity and stability. These conditions are known in the art. In brief, the formulations of the compounds of the present invention are prepared for storage or administration by mixing a compound having the desired purity with a physiologically acceptable carrier, excipient or stabilizer. Such materials are nontoxic to the recipient at the dosages and concentrations employed and include buffers such as phosphates, citrate, acetates and other organic acid salts; Antioxidants such as ascorbic acid; Low molecular weight (with less than about 10 residues) peptides such as polyarginine, proteins such as serum albumin, gelatin or immunoglobulins; Hydrophilic polymers such as polyvinylpyrrolidinone; Amino acids such as glycine, glutamic acid, aspartic acid or arginine; Monosaccharides, disaccharides, and other carbohydrates, including cellulose or derivatives thereof, glucose, mannose, or dextrins; Chelating agents such as EDTA; Sugar alcohols such as mannitol or sorbitol; Counter ions such as sodium and / or nonionic surfactants such as Tween, Pluronics or polyethylene glycol.

     About 0.5 to 500 mg of the megakaryocyte-producing protein compound or mixture in free acid or base form or in the form of a pharmaceutically acceptable salt is a physiologically acceptable vehicle, carrier, excipient, binder, preservative, stabilizer required for acceptable pharmaceutical practice. , Flavor and so on. The amount of active ingredient in these compositions is such that a suitable dosage can be obtained within the ranges indicated.

     Sterile compositions for injection can be prepared according to conventional pharmaceutical practice. For example, a solution or suspension of the active compound in a vehicle, for example a natural vegetable oil such as sesame oil, peanut oil or cottonseed oil, or a synthetic fatty vehicle such as ethyl oleate may be preferred. Buffers, preservatives, antioxidants and the like can be incorporated according to accepted pharmaceutical practices.

Suitable examples of sustained release formulations are those containing the polypeptide of the invention in a semipermeable solid hydrophobic polymer matrix in the form of shaped articles, eg films, or microcapsules. Examples of sustained release matrices include polyesters, hydrogels such as Langer et al., J. Biomed. Mater. Res., 15: 167-277, 1981 and Langer, Chem. Poly (2-hydroxyethylmethacrylate) or poly (vinyl alcohol) described in Tech., 12: 98-105, 1982], polylactide (US Patent No. 3773919, European Patent No. 58,481), L- Copolymers of glutamic acid and gamma ethyl-L-glutamate (Sidman et al., Biopolymers, 22: 547-556, 1983), non-degradable ethylene-vinyl acetate (Langer et al., Supra), degradable lactic acid-glycolic acid copolymers (e.g. loop theory to port ^TM (Lupron Depot ^TM; lactic acid-glycolic acid copolymer and loop roll fluoride injectable globule consisting of acetate), and poly -D - (-) - 3- hydroxybutyric acid include (European Patent No. 133 988) do.

     Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid allow release of molecules for more than 100 days, but some hydrogels release proteins for shorter time periods. When encapsulated proteins are present in the body for long periods of time, they may denature or aggregate as a result of exposure to moisture at 37 ° C., resulting in a loss of biological activity and a change in immunogenicity. Depending on the mechanism involved, suitable methods for protein stabilization can be devised. For example, if an aggregation mechanism is found to form intermolecular SS bonds via disulfide exchange, stabilization denatures sulfhydryl residues, lyophilizes from acidic solutions, adjusts the moisture content, and uses suitable additives. And developing specific polymer matrix compositions.

     In addition, sustained release megakaryocyte-producing protein compositions include megakaryocyte-producing proteins entrapped with liposomes. Liposomes containing megakaryocyte-producing proteins are prepared by known methods: Federal Republic of Germany Patent No. 3218121; Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688-3692, 1985; Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030-4034, 1980; European Patent No. 52222; European Patent No. 36676; European Patent No. 88046; European Patent No. 143,949; European Patent No. 142641; Japanese Patent Application No. 83-118008; U.S. Patent Nos. 4485045 and 4544545; And European Patent No. 102324. Typically, liposomes are small (about 200-800 mm 3) monolayers with lipids of at least about 30 mole percent cholesterol, and this ratio is adjusted for optimal megakaryocyte-producing protein treatment.

     Dosage may be determined by the attending physician taking into account various factors known to alter the action of the drug, including the depth and type of disease, weight, sex, diet, time and route of administration, other dosages and related clinical factors. Typically, the daily dose is 0.1-100 μg / kg body weight. Preferably, the dosage is 0.1-50 μg / kg body weight. More preferably, the initial dose is 1-5 μg / kg / day. Optionally, the dosage may be the same as that of other cytokines, in particular G-CSF, GM-CSF and EPO. The therapeutically effective amount can be determined by in vitro or in vivo methods.

Example

Although no longer described, one of ordinary skill in the art will fully utilize the present invention using the above description and examples. Accordingly, the following working examples specifically illustrate preferred embodiments of the invention and will not be limited in any aspect of the remainder of the disclosure.

Example 1

Partial purification of porcine mpl ligand

Plasma deficient plasma was collected from normal or aplastic anemia pigs. Pigs were irradiated at 900 cGy throughout the body using a 4mEV linear accelerator to induce aplastic anemia. Irradiated pigs received intramuscular injection of cefazoline for 6-8 days. Subsequently, their entire blood was removed under general anesthesia, heparinized, and then centrifuged at 1800 × g for 30 minutes to prepare platelet deficient plasma. The megakaryocyte stimulating activity peaked 6 days after irradiation.

Aplastic anemia pig plasma obtained from irradiated pigs was prepared at 4M using NaCl and then stirred at room temperature for 30 minutes. The resulting precipitate was removed by centrifugation at 3,800 rpm in Sorvall RC3B, and the supernatant was added dropwise onto a Phenyl-Toyopearl column (220 mL) equilibrated with 10 mM NaPO ₄ containing 4M NaCl. It was. The column was washed with the above buffer until A ₂₈₀ was below 0.05 and eluted with dH ₂ O. Eluted protein peak was diluted with dH ₂ O to 15 mS of conductivity and loaded onto a Blue-Sepharose column (240 mL) equilibrated with PBS. The column was then washed with PBS and NaPO ₄ (pH 7.4), each containing 5 times the column volume of 2M urea. Protein was eluted from the column using NaPO ₄ (pH 7.4) containing 2M urea and 1M NaCl. The peak of the eluted protein was prepared with 0.01% octyl glocoside (n-octyl β-D-glucopyranoside) and 1M EDTA and Pepaloc (Boehinger Mannheim) and serially linked CD4-IgG (carpon (Capon, DJ) et al. (Nature, 337: 525-531 (1989)) and mpl -IgG Ultralink (Ultralink: Pierce) column directly dropping (see below). After loading the sample, the CD4-IgG (2 mL) column was removed, the mpl- IgG (4 mL) column was washed with 10-fold column volume PBS and PBS containing 2M NaCl, 0.1M glycine-HCl (pH) 2.25). Fractions were collected with 1/10 dose of 1M Tris-HCl, pH 8.0.

Analysis of the fractions eluted from the mpl-affinity column by running SDS-PAGE (4-20%, Novex gel) under reducing conditions revealed the presence of several proteins (see FIG. 5). Silver stained proteins at maximum intensity were analyzed to have apparent molecular weights of 66,000, 55,000, 30,000, 28,000 and 14,000. Among these proteins, proteins were eluted from the gel as described in Example 2 below to determine which proteins stimulate the proliferation of Ba / F3- mpl cell culture tissues.

Ultralink Affinity Columns

10-20 mg of mpl- IgG or CD4-IgG in PBS was bound to 0.5 g of Ultralink resin (Pierce) as described by the manufacturer's instructions.

Composition and Expression of mpl-IgG

Chimeric molecules comprising the entire extracellular domain of human mpl (amino acids 1-491) and the Fc region of human IgG1 molecules were expressed in 293 cells. CDNA fragments encoding amino acids 1-491 of the human mpl were obtained by PCR from a human megakaryocyte CMK cell cDNA library and sequenced. The ClaI site was inserted at the 5 'end and the BstEII site was inserted at the 3' end. Partially digested the PCR product with BstEII due to two different BstEII sites present in the DNA encoding the extracellular domain of mpl and then upstream of the IgG1 Fc coding region in the Bluescript vector between the ClaI and BstEII sites. Cloned. The BstEII site introduced at the 3 'end of the mpl PCR product was designed such that the Fc region had the form of an mpl extracellular domain. The construct was surfcloned with the pRK5tkneo vector between the ClaI and XbaI sites and transfected into 293 human embryonic kidney cells by the calcium phosphate method. Cells were selected in 0.4 mg / ml G418 and isolated into individual clones. Mpl -IgG expression from isolated clones was measured using human Fc specific ELISA. The best expressing clones had an expression level of mpl -IgG of 1-2 mg / ml.

Ba / F3 mpl P expressing cells

Cloned the cDNA corresponding to the entire coding region of human mpl P in pRK50tkneo and was then linearized with NotI coming, electroporation transfected with the IL-3 dependent cell line Ba / F3 (1 × 10 ⁷ cells, 9605F, 250 volts) Infected. After 3 days, selection was started in the presence of 2 mg / ml of G418. Cells were selected as pools or individual clones were obtained by limiting dilution in 96-well plates. Selected cells were stored in RPMI containing 15% FBS, 1 mg / ml G418, 20 mM glutamine, 10 mM HEPES and 100 μg / ml Pen-Strep. Expression of mpl P in selected clones was measured by FACS assay using anti- mpl P earth polyclonal antibodies.

Ba / F3 mpl ligand assay

mpl ligand analysis was performed as shown in FIG. 2. To determine the presence of mpl ligands from several sources, mpl P Ba / F3 cells were plated with IL-3 for 24 hours at a cell density of 5 × 10 ⁵ cells / ml in a wet incubator at 37 ° C. and 5% CO _2. It was starved. After IL-3 stabilization, cells were placed in 96-well culture dishes at 50,000 cell density in 200 μl of medium with or without diluted samples and incubated for 24 hours in a cell culture incubator. 20 μl of serum-free RPMI medium containing 1 μCi of ³ H-thymidine was added to each well for 6-8 hours later. Cells were then collected on 96-well GF / C filter plates and washed five times with water. Filters were counted in the presence of 40 μl of scintillation liquid (Microscint 20) on a Packard Top Count counter.

Example 2

Highly purified porcine mpl ligand

Gel Elution Protocol

Equal amounts of affinity purified mpl ligand (fraction 6 eluted from mpl- IgG column) and 2 × Laemmli sample buffer were mixed at room temperature without reducing reagent and Novox 4-20% as soon as possible It was dripped on the polyacrylamide gel. The sample was not heated. For control, ligand free sample buffer was added to the side lanes. The gel was performed at 4-6 ° C. at 135 volts for about 2.25 hours. Performance buffer was initially at room temperature. The gel was then removed from the gel box and the plate on one side of the gel removed.

A replica of the gel was prepared on nitrocellulose as follows: A piece of nitrocellulose was wetted with distilled water to rule out air bubbles and carefully placed on top of the exposed gel surface. Reference marks were placed on nitrocellulose and gel plates so that the replicas were correctly repositioned after staining. After about 2 minutes, nitrocellulose was carefully removed and the gel wrapped in a plastic wrap and placed in the refrigerator. Nitrocellulose was first stirred in 3 × 10 ml of 0.1% Tween 20 + 0.5 M NaCl + 0.1 M Tris-HCl (pH 7.5) over about 45 minutes and then stirred for 5 minutes with 3 × 10 ml of purified water over Biorad's. Stained by total protein gold staining. Gold staining was then applied and developed until bands appeared in the standard. The replica was then washed with water, placed on a plastic wrap on the gel, and carefully aligned using reference marks. The location of the Novex standard was marked on the gel plate and lined to indicate the cut location. The nitrocellulose and plastic wrap were then removed and the gel was cut along the indicated lines using a sharp razor blade. When staining gels, cuts were made to at least the sample lane to be used to position the slices. After removing the slices, the remaining gel was silver stained and the position and cleavage marks of the standards were measured. The molecular weight corresponding to the cleavage site was determined from the Novex standard.

Twelve gel slices were placed in cells in two Biorad Model 422 electroeligators. A cleaved membrane cap of 12-14K molecular weight was used for the cells. 50 mM ammonium bicarbonate + 0.05% SDS (about pH 7.8) was the elution buffer. 1 L of buffer was cooled in cooling at 4-6 ° C. for about 1 hour before use. Gel slices were eluted at 10 ma / cell (initial 40 v) at cooling at 4-6 ° C. Elution was performed for about 4 hours. The cells were then carefully removed and the liquid on the frit was pipetted off. The elution chamber was removed and the liquid on the membrane cap was pipetted off. The liquid in the membrane cap was removed with Pipetman and stored. Then, 50 μl of purified water was added to the cap until all SDS crystals dissolved, stirred and removed. These washes were mixed with the stored liquid. Total elution sample volume was 300-500 μl per gel slice. Samples were placed in a 10 mm Spectrapor 4 12-14K cut dialysis tube and immersed in purified water for several hours. This was dialyzed overnight at 4-6 ° C. with 600 ml of phosphate buffered saline (PBS is about 4 mM with potassium) per six samples. The buffer was replaced the next morning and dialysis continued for 2.5 hours. The sample was then removed from the dialysis bag and placed in a microcentrifuge tube. The tube was placed on ice for 1 hour and then microcentrifuged at 14 K rpm for 3 minutes, then the supernatant was carefully removed from the precipitated SDS. The supernatant was then placed on ice for at least about 1 hour and then microcentrifuged for 4 minutes. The supernatant was diluted with phosphate buffered saline and provided for activity analysis. The remaining sample was frozen at-70 ° C.

Example 3

Microsequencing of Porcine mpl Ligands

Fraction 6 (2.6 mL) obtained from the mpl- IgG affinity column was concentrated on Microcon-10 (Amicon). To prevent the mpl ligand from absorbing into the microcone, the membrane was washed with 1% SDS and 5 μl of 10% SDS was added to fraction 6. After microcon concentration (20 μl), 2 × sample buffer (20 μl) was added to fraction # 6, and the total dose (40 μl) was placed on a single lane of 4-20% gradient of acrylamide gel (Novex). It dripped. Gels were performed according to the Novex protocol. The gel was then equilibrated for 5 minutes before electroblotting with 10 mM 3- (cyclohexylamino) -1-propanesulfonic acid (CAPS) buffer (pH 11.0) containing 10% methanol. Electroblotting on an Immobilon-PSQ membrane (Millipore) was performed for 45 minutes at a constant current of 250 mA in BioRad Trans-Blot mobile cells 32. PVDF membranes were stained for 1 minute with 0.1% Coomassie Blue R-250, 0.1% acetic acid in 40% methanol and decolorized for 2-3 minutes with 10% acetic acid in 50% methanol. The molecular weights of the only proteins visualized in the molecular weight 18,000-35,000 region of the blot were 30,000, 28,000 and 22,000.

The bands at 30, 28 and 22 kDa were protein sequenced. Automated protein sequencing was performed on a Model 470A Applied Biosystem Sequencer equipped with an online PTH analyzer. The sequencer was modified to inject 80-90% of the sample (see Rodriguez, J. Chromatogr., 350: 217-225 (1985)). Acetone (˜12 μl / L) was added to Solution A to balance the UV absorber. The electrically blotted protein was sequenced in a Blott cartridge. Peaks were integrated with Justice Innovation software using a Nelson Analytical 970 interface. Sequence reads were performed on VAX 5900 (Henzel et al., J. Chromatogr., 404: 41-52 (1987)). The N-terminal sequence (using the one letter code describing the uncertainty residues in parentheses) and the amount of material obtained (listed in angular parentheses) are listed in Table 2.

< Table 2>

Example 4

Liquid Suspension Megakaryocytosis Analysis

Human peripheral liver cells (PSCs) (obtained from consented patients) were diluted 5-fold with IMDM medium (Gibco) and centrifuged at 800 × g for 15 minutes at room temperature. Cell pellets were resuspended in IMDM, layered on 60% Percoll (Percoll: density 1.077 gm / ml), and then centrifuged at 800 × g for 30 minutes. Low density mononuclear cells were aspirated at the interface and washed twice with IMDM, then 1-2 × 10 ^{6 in} IMDM (final dose 1 ml) containing 30% FBS of 24-well tissue culture cluster (Costar) Plated at cells / ml. APP or APP depleted mpl ligand was added to 10% and cultures were incubated for 12-14 days in a humidified incubator in 37% 5% CO ₂ and air. In addition, cultures to which 0.5 μg of mpl- IgG were added at 0, 2 and 4 days were incubated in the presence of 10% APP. APP was depleted from the mpl ligand by passing APP through a mpl -IgG affinity column.

To quantify megakaryocyte angiogenesis in the liquid suspension culture, modifications such as Solberg et al. Were used and radiolabeled mouse IgG monoclonal antibodies (HP1-1D) against GPIIbIIIa (provided by Dr. Nichols, Mayo Clinic) ) Was used. Enzymobeads (Biorad, Richmond, Calif.) As 100 μg of HP1-1D (see Grant, B. et al. (Blood 69: 1334-1339 (1987))) were described as manufacturer's instructions. Radiolabeled with 1 mCi Na ¹²⁵ I used. Radiolabeled HP1-1D was stored at −70 ° C. in PBS containing 0.01% octyl-glucoside. Typical inactivation was 1-2 × 10 ⁶ cpm / μg (precipitated at least 95% by 12.5% trichloroacetic acid).

Three liquid suspension cultures were prepared for each experimental time point. After incubation for 12-14 days, 1 ml of the culture was transferred to a 1.5 ml eppendorf tube, centrifuged at 800 × g for 10 minutes at room temperature, and the resulting cell pellet was 0.02% EDTA and 20% Resuspend in 100 μl of PBS containing calf serum. 10 ng of ¹²⁵ I-HP1-1D in 50 μl of assay buffer was added to the resuspended culture and incubated for 60 minutes with occasional shaking at room temperature (RT). Cells were then collected by centrifugation at 800 × g for 10 min at RT and washed twice with assay buffer. Pellets were counted for 1 minute at a gamma counter (Packard). Nonspecific binding was measured by adding 1 μg of unlabeled HP1-1D for 60 minutes before adding labeled HP1-1D. Specific binding was determined by subtracting the total ¹²⁵ I-HP1-1D binding from binding in the presence of excess unlabeled HP1-1D.

Example 5

Oligonucleotide PCR Primer

Based on the amino-terminal amino acid sequences obtained from 30 kDa, 28 kDa and 18-22 kDa proteins, degenerate oligonucleotides were designed for use as polymerase chain reaction (PCR) primers (see Table 4). Two primer pools of antisense 21-mer pools complementary to the sequences encoding amino acid residues 2-8 ( mpl 1) with the sense 20-mer pool and amino acids 18-24 ( mpl 2) were synthesized.

< Table 4>

Porcine genomic DNA isolated from porcine peripheral blood lymphocytes was used as template for PCR. 50 μl of reaction was 0.8 in 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 3 mM MgCl ₂ , 100 μg / ml BSA, 400 μM dNTPs, 1 μM of each primer pool and 2.5 units of Taq polymerase. Μg porcine genomic DNA was included. The mold was first denatured at 94 ° C. for 8 minutes, followed by 45 seconds at 94 ° C., 1 minute at 55 ° C., and 1 minute at 72 ° C., 35 times. The last denaturation was performed at 72 ° C. for an additional 10 minutes. PCR products were separated by electrophoresis on 12% polyacrylamide gels and visualized by staining with ethidium bromide. When the amino-terminal amino acid sequence was encoded by a single exon, it was reasonable to expect 69 bp of proper PCR product. DNA fragments of this size were eluted from the gel and subcloned with pGEMT (Promega). The sequences of the three clones are listed in Table 5 below.

< Table 5>

The location of the PCR primers is indicated by underlined bases. These results demonstrate the N-terminal sequences obtained for amino acids 9-17 for the 30 kDa, 28 kDa and 18-22 kDa proteins and showed that these sequences were encoded by a single exon of porcine DNA.

Example 6

Human mpl ligand gene

According to the results of Example 5, 45-mer deoxyoligonucleotides named pR45 were designed and synthesized to search for genomic libraries. 45-mer had the following sequence:

5 'GCC-GTG-AAG-GAC-GTG-GTC-GTC-ACG-AAG-CAG-TTT-ATT-TAG-GAG-TCG 3'

(SEQ ID NO: 28)

The oligonucleotides were labeled with ³² P using (γ ³² P) -ATP and T4 kinase and were used under low urge hybridization and wash conditions to search for human genomic DNA libraries in λgem12 (see Example 7). Sheep clones were collected and purified, followed by restriction gene mapping and Southern blotting. Clone # 4 was selected for further analysis.

2.8 kb BamHI-XbaI fragment hybridized to 45-mer was subcloned into pBluescript SK-. Partial DNA sequencing of this clone was performed using oligonucleotides specific for the porcine mpl ligand DNA sequence as primers. The obtained sequence demonstrated that DNA encoding human analogues of porcine mpl ligands was isolated. EcoRI restriction sites were detected in the sequence that isolated the 390 bp EcoRI-XbaI fragment from 2.8 kb BamHI-XbaI and subcloned it in pBluescript SK-.

Both double chains of the fragments were sequenced. Human DNA sequences and putative amino acid sequences are shown in Figure 9 (SEQ ID NOs: 3 and 4). In addition, the putative position of the intron in the genomic sequence is indicated by an arrow and putative exon (“exon 3”) was defined.

Examination of the putative amino acid sequence (measured by direct amino acid sequence analysis) demonstrated that the serine residue is the first amino acid of the mature mpl ligand. It was assumed that the putative amino acid sequence immediately upstream of this codon was the signal sequence associated with mature mpl ligand secretion. The coding sequence of this signal sequence will probably be interrupted at nucleotide position 68 by the intron.

Exons in the 3 'direction appear to terminate at nucleotide 196. Thus, this exon codes for 42 amino acid sequences, of which 16 will be part of the signal sequence, 26 of which are part of the mature human mpl ligand.

Example 7

Full length human mpl ligand cDNA

Based on the human "exon 3" sequence (Example 6), two non-degenerate oligonucleotides corresponding to the 3 'and 5' ends of the "exon 3" sequence were synthesized (Table 6).

< Table 6>

These two primers were used for PCR reactions as template DNA obtained from various human cDNA libraries using the conditions described in Example 5 or using 1 ng of Quick Clone cDNA (Clonetech) from various tissues. The expected size of a reasonable PCR product was 140 bp. After analyzing the PCR product on a 12% polyacrylamide gel, DNA fragments of the expected size were collected from adult kidney, cDNA library prepared from 293 fetal kidney cells, and cDNA prepared from human fetal liver (Clonetech cat. # 7171-1). Detected.

Fetal liver cDNA libraries (λ Clonetech cat. # HL1151x) in λ DR2 were searched using the same 45-mer oligonucleotides that were used to search the human genome library. Oligonucleotides were labeled with (γ ³² P) -ATP using T4 polynucleotide kinase. The library was searched under low urge hybridization conditions. The filter was prehybridized for 2 hours and then overnight in 42% 20% formamide, 5xSSC, 10xDenhardt's, 0.05 M sodium phosphate (pH 6.5), 0.1% sodium pyrophosphate, 50 μg / ml sonicated salmon sperm DNA Hybridization with probes. The filter was then washed with 2 × SSC and once with 42 × 0.5 × SSC, 0.1% SDS. The filter was exposed to Kodak X-ray film overnight. After collecting the positive clones to purify the flakes, the insertion size was determined by PCR using oligonucleotides flanking BamHI-XbaI cloned in λ DR2 (Clonetech cat. # 6475-1). 5 μl of phage concentrate was used as template source. First denatured at 94 ° C. for 7 minutes and then amplified 30 times (1 minute at 94 ° C., 1 minute at 52 ° C. and 1.5 minutes at 72 ° C.). The last extended another 15 minutes at 72 ℃. Clone # FL2b had an insertion of 1.8 kb and was selected for another analysis.

Plasmid pDR2 contained in the λDR2 phage arm (Clonetech, λDR2 & pDR2 cloning and Expression System Library Protocol Handbook, p 42) was obtained as described by the manufacturer's instructions (Clonetech, λDR2 & pDR2 cloning and Expression System Library Protocol Handbook, pp 29-30). Restriction analysis of the plasmid pDR2-FL2b using BamHI and XbaI revealed an internal BamHI restriction site at the insertion of about position 650. Insertion was cut into two fragments (0.65 kb and 1.15 kb) by digesting the plasmid with BamHI-XbaI. DNA sequences were measured using three different classes of templates derived from plasmid pDR2-FL2b. DNA sequencing of double-stranded plasmid DNA was subjected to AB1373 (Foster City, Calif.) Using standard protocols for stained labeled dideoxy nucleoside triphosphate transcription termination factor (stain-transcription termination factor) and commonly synthesized working primers. Applied Biosystems, Inc.), automated fluorescent DNA sequencing (Sanger et al., Proc. Natl. Acad. Sci. USA, 74: 5463-5467 (1977)) and Smith et al. Nature. , 321: 674-679 (1986)). Direct sequencing of the fragments amplified by the polymerase chain reaction from the plasmid was performed with the AB1373 sequencer using conventional primer and stain-transcription termination factor reactions. Single chain templates were prepared with the M13 Janus vector (DNASTAR, Inc., Madison, Wisconsin) (see Burland et al. Nucl. Acids Res., 21: 3385-3390 (1993)). BamHI-XbaI (1.15 kb) and BamHI (0.65 kb) fragments were isolated from plasmid pDR2-FL2b and the ends were filled with T4 DNA polymerase in the presence of deoxynucleotides and then subcloned into the SmaI site of M13 Janus. Sequencing was performed using standard protocols for stain-labeled M13 conventional primers and reverse primers, or working primers and stain-transcription termination factors. Passive sequencing reactions were performed using working primers and standard dideoxy-transcription termination factor chemistry (Sanger et al., Proc. Natl. Acad. Sci. USA, 74: 5463-5467 (1977)), ³³ P labeled α- dATP and Sequenase (Sequenase: United States Biochemical Corp., Cleveland, Ohio) were used to perform single stranded M13 DNA. DNA sequence combinations were performed with Sequencer V2.1b12 (Gene Codes Corporation, Ann Arbo, Mich.). Nucleotide and putative sequences of hML are provided in FIG. 1 (SEQ ID NO: 1).

Example 8

Isolation of the Human mpl Ligand (TPO) Gene

Using fragments corresponding to 3 'half of the human cDNA encoding the mpl ligand (from the BamHI site to the 3' end), the human genomic DNA clone of the TPO gene can be prepared under low or high constraint conditions (see Example 7). It was isolated by searching the human genome library in λ-Gem 12 with the oligonucleotide probe pR45. Two overlapping lambda clones up to 35 kb were isolated. Two overlapping fragments (BamHI and EcoRI) containing the complete TPO gene were subcloned and sequenced. The structure of the human gene consists of six exons within 7 kb of genomic DNA (14A, B and C). The boundaries of all exon / intron linkages coincide with the common motifs formed for mammalian genes (see Shapiro, MB et al. Nucl. Acids Res., 15: 7155 (1987)). Exon 1 and exon 2 comprise the 5 'untranslated sequence and the first four amino acids of the signal peptide. The remainder of the secretion signal and the first 26 amino acids of the mature protein are encoded in exon 3. The entire carboxyl domain and the untranslated portion of the 3 'and about 50 amino acids of the erythropoietins domain are encoded in exon 6. The four amino acids associated with the deletions observed in hML-2 (hTPO-2) are encoded at the 5 'end of exon 6.

Example 9

Transient expression of human mpl ligand (hML)

For subcloning the full length inserts contained in pDR2-FL2b, the plasmids were fully digested with XbaI and then partially digested with BamHI. DNA fragments corresponding to the insertion of 1.8 kb were gel purified and subcloned in pRK5 (pRK5-h mpl I) under the control of the initial promoter of cytomegalovirus (see US Pat. No. 5,258,287 on the construction of pRK5). ). DNA obtained from the pRK5-h mpl I construct was prepared by PEG method and modified in Dulbecco supplemented with F-12 nutrient mixture, 20 mM Hepes (pH 7.4) and 10% fetal bovine serum. Human embryonic kidney 293 cells stored in Eagle medium (DMEM) were transfected. Cells were prepared by the calcium phosphate method as described in Gorman's DNA Cloning: A Practical Approach (Edit by Glover, DM), Volume II, pp 143-190, IRL Press, Washington, DC. Transfection. After 36 hours of transfection, supernatants of the transfected cells were analyzed for activity in proliferation assays (see Example 1). Supernatants of 293 cells transfected with pRK vectors did not stimulate Ba / F3 or Ba / F3- mpl cells (see Figure 12 A). The supernatant of cells transfected with pRK5-h mpl I did not affect Ba / F3 cells, but greatly stimulated the proliferation of Ba / F3-mpl cells (see FIG. 12A), which indicated that the cDNA was functionally active. It encodes a human mpl ligand.

Example 10

Heterogeneity of human mpl ligands: hML2, hML3, and hML4

To identify differently spliced forms of hML, primers corresponding to each end of the coding sequence of hML were synthesized. These primers were used for RT-PCR to amplify human adult liver RNA. In addition, internal primers (see below) flanking the selected regions of interest were also constructed and used similarly. Direct sequencing of the ends of the PCR products revealed a single sequence that exactly corresponds to the sequence of cDNA isolated from the human fetal liver library (see SEQ ID NO: 1 in FIG. 1). However, the region near the C-terminus of the EPO-domain (middle portion of the PCR product) exhibited a complex sequence pattern suggesting the presence of several possible splices in that region. To isolate these various splice variants, the primers provided in Table 7 flanking the region were used for PCR as a template for human adult liver cDNA.

< Table 7>

PCR products were slowly subcloned into M13. Sequencing of the individual subclones revealed that there were at least three ML variants present. One of them, hML (or hML ₃₃₂ ) is the longest form and exactly matches the sequence isolated from the fetal liver library. The sequences of the four human mpl ligand variants, from the longest (hML) to the shortest (hML-4), are shown in Figure 11 (SEQ ID NOs: 6, 8, 9 and 10).

Example 11

Constitutive and transient expression of human mpl ligand variants and surrogate variants

hML2, hML2, and hML (R153A, R154A)

Heterologous hML2 and hML3, and surrogate heterologous hML (R153A, R154A) are described by Russell Higuchi in PCR Protocols, A guide to Methods and Application, Acad. Press, M.A. Innis, D. H. Gelfand, J.J. Sninsky & T.J. Reconstitution from hML was carried out using recombinant PCR techniques described in White Editors.

For all constructs, the "external" primers used are shown in Table 8 and the "overlapping" primers are shown in Table 9.

< Table 8>

< Table 9>

All PCR amplifications were performed with cloned Pfu DNA polymerase (Stratagene) using the following conditions:

The mold was first denatured at 94 ° C. for 7 minutes, then at 94 ° C. for 1 minute, at 55 ° C. for 1 minute, and at 72 ° C. for 30 minutes. The last denaturation was performed at 72 ° C. for an additional 10 minutes. The final PCR product was digested with ClaI-XbaI, gel purified and cloned in pRK5tkneo. 293 cells were transfected with the various constructs as above and the supernatants were analyzed using Ba / F3- mpl proliferation assay. hML-2 and hML-3 no longer detected activity in this assay, but the activity of hML (R153A, R154A) was similar to hML, indicating that treatment at this dibasic site is not required for activity (FIG. 13).

Example 12

Rat mpl ligand cDNA: mML, mML-2 and mML-3

Isolation of mML cDNA

DNA fragments corresponding to the entire coding region of the human mpl ligand were obtained by PCR, gel purified and labeled by random priming in the presence of ³² P-dATP and ³² P-dCTP. This probe was used to search for 10 ⁶ clones of the mouse liver cDNA library in λGT10 (Clontech cat # ML3001a). Two filters were hybridized overnight in 35% formamide, 5xSSC, 10xDenhardt's, 0.1% SDS, 0.05 M sodium phosphate (pH 6.5), 0.1% sodium pyrophosphate, 100 μg / ml sonicated salmon sperm DNA in the presence of a probe It was. The filter was washed with 2 × SSC and then washed once with 42 × 0.5 × SSC, 0.1% SDS. Hybridized phage were flake purified and cDNA insertions were subcloned into the Eco RI site of the Bluescript SK-plasmid. Clone “LD” with an insertion of 1.5 kb was selected for other analysis and double chains were sequenced as above for human ML cDNA. Nucleotide and putative amino acid sequences obtained from clone LD are provided in FIG. 14 (SEQ ID NO: 1 and 11). The estimated mature ML sequence obtained from the clone was 331 amino acid residues in length and was identified as mML ₃₃₁ (or mML-2 for the following reason). Significant identity in nucleotide and putative amino acid sequences was observed in these ML EPO-like domains. However, when aligning the putative amino acid sequences of human and mouse ML, the amino acid sequence of the mouse corresponds to the amino acid of the human corresponding to the 12 nucleotide deletions following the nucleotide position 618 appearing in the cDNA of human (see above) and pig (see below). Tetrapeptide appears between residues 111-114. Thus, additional clones were examined to detect possible ML variants of mice. One clone "L7" has a 1.4 kb insertion with a 335 amino acid putative sequence comprising the "missing" tetrapeptide LPLQ. This form is considered full length rat ML and is represented as mML or mML ₃₃₅ . Nucleotide and putative amino acid sequences for mML are shown in Figure 16 (SEQ ID NOs: 12 and 13). Finally, clone "L2" was isolated and sequenced. This clone was deleted with 116 nucleotides corresponding to hML3 and was named mML-3. A comparison of the two heterologous putative amino acid sequences is shown in FIG. 16.

Expression of Recombinant mML

Expression vectors for ML of mice were prepared essentially as described in Example 8. Clones encoding mML and mML-2 were subcloned into pRK5tkneo, a mammalian expression vector expressed under the control of the CMV promoter and SV40 polyadenylation signal. The resulting expression vectors, mMLpRKtkneo and mML2pRKtkneo, were transiently transfected into 293 cells using the calcium phosphate method. After transient transfection, the freshness of the medium was maintained for 5 days. Cells were stored in high glucose content DMEM medium supplemented with 10% fetal calf serum.

Expression of Rat mpl (mmpl) in Ba / F3 Cells

Suitable cell lines expressing c- mpl were obtained by transfection of m mpl pRKtkneo essentially as described for the human mpl of Example 1. Briefly, electroporation of an expression vector (20 μg: linearized) comprising the entire coding sequence of the rat mpl (see Skoda, RC et al. (EMBO J. 12: 2645-2653 (1993))) 5 × 10 ⁶ cells, 250 volts, 960 μF), were transfected with Ba / F3 cells and selected for neomycin resistance using 2 mg / ml G418. mpl expression was analyzed by flow cytometry using anti-rat mpl -IgG antiserum. Ba / F3 cells were stored in RPMI 1640 medium from WEHI-3B cells as a source of IL-3. Supernatants from 293 cells transiently transfected with mML and mML-2 were analyzed in BaF3 cells transfected with m mpl and h mpl as described in Example 1.

Example 13

Porcine mpl ligand cDNA: pML and pML-2

Porcine ML (pML) cDNA was isolated by RACE PCR. Briefly, oligo dT primers and two specific primers were designed based on the sequence of the porcine ML gene exon encoding the amino terminus of ML purified from aplastic anemia pig serum. CDNAs prepared from several aplastic pig tissues were obtained and amplified. 1342 bp of PCR cDNA product was found in the kidney and subcloned. Several clones were sequenced and found to encode mature porcine mpl ligands (not including complete secretion signal). cDNA was found to encode a 332 amino acid mature protein (pML ₃₃₂ ) having the sequence shown in Figure 18 (SEQ ID NOs: 9 and 16).

Way:

Isolation of the pML Gene and cDNA

Genomic clones of the porcine ML gene were isolated by searching the porcine genome library with pR45 in EMBL3 (Clontech Inc.). The library was searched essentially as described in Example 7. Several clones were isolated and sequenced exons encoding the same amino acid sequence as obtained from purified ML. Porcine ML cDNA was obtained using a modification of the RACE PCR protocol. Two specific ML primers were designed based on the sequence of the porcine ML gene. Polyadenylation mRNA was isolated essentially from kidney of aplastic anemia pigs as above. cDNA was prepared by reverse transcripting BamdT primers associated with polyadenosine tail of mRNA:

(BamdT: 5 'GACTCGAGGATCCATCGATTTTTTTTTTTTTTTTT 3')

(SEQ ID NO: 55)

The first amplification of PCR amplification (28 amplifications for 60 seconds at 95 ° C., 60 seconds at 58 ° C., and 90 seconds at 72 ° C.) was carried out at 100 ml using ML specific h-forward-1 primer and BAMAD primer. The reaction solution (50 mM KCl, 1.5 mM MgCl ₂ , 10 mM Tris, pH 8.0), 0.2 mM dNTPs and 0.05 U / ml Amplitaq polymerase (Perkin Elmer Inc.) was performed.

(h-forward-1: 5 'GCTAGCTCTAGAAATTGCTCCTCGTGGTCATGCTTCT 3')

(SEQ ID NO: 43)

(BAMAD: 5 'GACTCGAGGATCCATCG 3')

(SEQ ID NO: 56)

The PCR product was then digested with Cla 1, extracted with phenol-chloroform (1: 1), precipitated with ethanol, and then 0.1 mg of Bluescript SK-vector (Stratagene inc., Inc.) digested with Cla 1 and Kpn 1. Ligation). After 2 hours of incubation at room temperature, a quarter of the ligation mixture was used with a second ML specific forward-1 primer and T3-21 (an oligonucleotide that binds to a sequence adjacent to the polycloning region in the Bluescript SK-vector). It was directly added to the second amplification of PCR (22 times as described above).

(forward-1: 5 'CGTAGCTCTAGAAGCCCGGCTCCTCCTGCCTG 3')

(SEQ ID NO: 57)

(T3-21: 5 'CGAAATTAACCCTCACTAAAG 3')

(SEQ ID NO: 58)

The resulting PCR product was digested with XbaI and ClaI and subcloned with Bluescript SK-. Several clones obtained from independent PCR reactions were sequenced.

Again, type 2, designated pML-2, encoding a protein with four amino acid residue deletions was identified (see [SEQ ID NO: 21] in FIG. 21). Comparing the pML and pML-2 amino acid sequences, pML-2 is identical except that the tetrapeptide QLPP corresponding to residues 111-114 is deleted (see [SEQ ID NOs: 18 and 21] in FIG. 22). The four amino acid deletions observed in the ML cDNAs of rats, humans, and pigs appear exactly at the same position in the putative protein.

Example 14

Platelet Antigen GPII _b III _a  CMK analysis of thrombopoietin (TPO) induction of expression

CMK cells were stored in RMPI 1640 medium (Sigma) supplemented with 10% fetal bovine serum and 10 mM glutamine. When prepared for this assay, cells were collected, washed and 5 × 10 ⁵ cells / ml in GIF medium without serum supplemented with 5 mg / L bovine insulin, 10 mg / L apo-transferrin, 1 × trace element. Resuspend. In a 96-well flat bottom plate, TPO standard samples or experimental samples were appropriately diluted to 100 μl volume and added to each well. 100 μl of CMK cell suspension was added to each well and the plate was incubated for 48 hours in a 5% CO ₂ incubator at 37 ° C. After incubation, the plate was spun at 1000 rpm for 5 minutes at 4 ° C. The supernatant was decanted and 100 μl of FITC-conjugated GPII _b III _a monoclonal 2D2 antibody was added to each well. After incubation at 4 ° C. for 1 hour, the plate was spun again at 1000 rpm for 5 minutes. The supernatant containing unbound antibody was decanted and 200 μl of 0.1% BSA-PBS wash was added to each well. The 0.1% BSA-PBS wash step was repeated three times. Cells were then analyzed on FASCAN using standard one variable assay to measure relative fluorescence intensity.

Example 15

DAMI assay for thrombopoietin (TPO) by measuring the nuclear nuclear mitotic activity of DAMI cells on 96-well microtiter plates

DAMI cells were stored in IMDM + 10% horse serum (Gibco) supplemented with 10 mM glutamine, 100 ng / ml penicillin G and 50 μg / ml streptomycin. When prepared for this assay, cells were collected and washed and resuspended at 1 × 10 ⁶ cells / ml in IMDM + 1% horse serum. In a 96-well round bottom plate, 100 μl of TPO standard or experimental sample was added to the DAMI cell suspension. The cells were then incubated for 48 hours in a 5% CO ₂ incubator at 37 ° C. After incubation, the plates were spun in a Sorvall 6000B centrifuge at 1000 rpm for 5 minutes at 4 ° C. The supernatant was decanted and the 200 μl PBS-0.1% BSA wash step was repeated. 70% ethanol-PBS cooled with 200 μl of ice was added to fix the cells and resuspended by aspiration. After incubation at 4 ° C. for 15 minutes, the plate is spun again at 2000 rpm for 5 minutes and 150 μl of 1 mg / ml RNAse containing 0.1 mg / ml propidium iodide and 0.05% Tween-20 Each well was added. After incubation at 37 ° C. for 1 hour, the change in DNA content was measured by flow cytometry. Drainage was measured and quantified as follows:

TPO: (>% cells in G2 + M / <% cells in G2 + M)

Normalized Drainage Ratio (NPR) = ------------------------------------------ ------

Control: (>% cells in G2 + M / <% cells in G2 + M)

Example 16

In vivo analysis of thrombopoietin (TPO)

Platelet Peninsula Analysis in Rats

Of platelet production ³⁵ In vivo analysis for S determination

On day 1 C57BL6 mice (purchased from Charles River) were intraperitoneally injected with 1 ml goat anti-mouse platelet serum (6 amps) to cause thrombocytopenia. On days 5 and 6, mice received two intraperitoneal administrations of PBS for factor or control. On day 7, 30 μCi Na ₂ ³⁵ SO ₄ in 0.1 ml saline was injected intravenously and ³⁵ % incorporation of the solution injected into the circulating platelets was measured in blood samples obtained from treated and control mice. Platelets and leukocytes were counted simultaneously in blood obtained from orbital sinus.

Example 17

by measurement of mpl-Rse.gD chimeric receptor phosphorylation

KIRA ELISA for thrombopoietin (TPO)

Vigon et al., PNAS, USA 89: 5640-5644 (1992), disclose human mpl receptors. extracellular domain of mpl receptor (ECD) and membrane penetration (TM) and intracellular domain of Rse (ICD) (Mark et al., J. of Biol. Chem. 269 (14): 10720-10728 (1994) )] And chimeric receptors consisting of the carboxyl-terminal flag (ie, Rse.gD) polypeptide were prepared for use in the KIRA ELISA described herein (see Figures 30 and 31 for a schematic description of the assay).

(a) Preparation of Marker Substances

Monoclonal anti-gD (clone 5B6) was prepared for peptides obtained from Herpes simplex virus glycoprotein D (Paborsky et al., Protein Engineering 3 (6): 547-553 (1990). )] Reference). The purified concentrated preparation was adjusted to 3.0 mg / ml with phosphate buffered saline (PBS: pH 7.4) and 1.0 ml aliquots were stored at -20 ° C.

(b) Anti-phosphotyrosine antibody preparation

Monoclonal anti-phosphotyrosine (clone 4G10) was purchased from UBI (Lake Prasid, NY) and long-arm biotin-N-hydroxysuccinamide (Biotin-X-NHS, Research Organics, Biotinylated using Cleveland, OH).

(c) ligands

The mpl ligands were prepared using the recombinant techniques described herein. Purified mpl ligand was stored at 4 ° C. as a concentrate.

(d) Preparation of Rse.gD Nucleic Acids

Synthetic double-stranded oligonucleotides were used to reconstruct the coding sequence for the 10 amino acids (880-890) at the C-terminus of human Rse, and an additional 21 amino acids including the epitope and stop codons for antibody 5B6 were added. . Table 10 shows the final sequence of the synthetic portion of the fusion gene.

< Table 10>

Synthetic DNA was expressed at the PstI site and expression vector pSV17.ID starting at nucleotide 2644 of the published human Rse cDNA sequence (see Journal et al., Journal of Biological Chemistry 269 (14): 10720-10728 (1994)). The expression plasmid pSV.ID.Rse.gD was generated by ligation with cDNA encoding amino acids 1-880 of human Rse at the HindIII site in the polylinker of .LL (see SEQ ID NO: 22 in Figure 32A-L). . Briefly, the expression plasmid comprises a 2 citronic first transcription comprising a sequence encoding DHFR bound by a 5 'splice donor and a 3' splice acceptor intron splice site, followed by a sequence encoding Res.gD. do. The full length (unspliced length) message contains DHFR as the first open reading frame, thus producing a DHFR protein for selecting stable transformants.

(e) Preparation of mpl-Rse.gD Nucleic Acids

The expression plasmid pSV.ID.Rse.gD prepared as described above was modified to encode ECD of human mpl (amino acids 1-491) fused to the transmembrane and intracellular domains of Rse.gD (amino acids 429-911). A plasmid pSV.ID.M.tmRd6 was prepared comprising the sequence. Using synthetic oligonucleotides, Mark et al., Jl. Biol. Chem. 267: 26166-26171 (1992) linked a portion of the coding sequence of the extracellular domain of the human mpl to a portion of the Rse coding sequence by a two step PCR cloning reaction. Primers used in the first PCR reaction were M1 and M2 and mpl cDNA template, and R1 and R2 and Rse cDNA template.

(M1: 5'-TCTCGCTACCGTTTACAG-3 ')

(SEQ ID NO: 61)

(M2: 5'-CAGGTACCCACCAGGCGGTCTCGGT-3 ')

(SEQ ID NO: 62)

(R1: 5'-GGGCCATGACACTGTCAA-3 ')

(SEQ ID NO: 63)

(R2: 5'-GACCGCCACCGAGACCGCCTGGTGGGTACCTGTGGTCCTT-3 ')

(SEQ ID NO: 64)

The PvuII-SmaI portion of the fusion linkage was used for the construction of full length chimeric receptors.

(f) cell transformation

DP12.CHO cells (see European Patent No. 307,247 published March 15, 1989) were electroporated with linearized pSV.ID.M.tmRd6 at the only NotI site in the plasmid backbone. After extraction with phenol / chloroform, the DNA was ethanol precipitated and resuspended in 20 μl of 0.1 Tris EDTA. 10 μg of DNA was then incubated for 10 minutes with 10 ⁷ CHO DP12 cells in 1 ml PBS on ice before electroporation at 400 volts and 330 μf. Cells were recovered on ice for 10 minutes before being placed in non-selective medium. After 24 hours, cells were fed with nucleotide free medium to select stable DHFR + clones.

(g) Selection of transformed cells for use in KIRA ELISA

Clones expressing MPL / Rse.gD were confirmed by Western-blotting of total cell lysate postfractionation by SDS-PAGE using antibody 5B6 detecting gD epitope tag.

(h) badge

Cells were incubated in R12 / DMEM 50: 50 (Gibco / BRL, Life Technologies, Grand Island, NY). The medium was supplemented with 10% filtered FBS (Hyclone, Logan, Utah), 25 mM HEPES and 2 mM L-glutamine.

(i) KIRA ELISA

mpl -Rse.gD transformed DP12.CHO cells were seeded (3 × 10 ⁴ / well) in 100 μl of medium in wells of a flat bottom 96-well culture plate and overnight at 37 ° C. 5% CO ₂ . Incubated. The next morning the supernatant of the wells was decanted and the plate was pressed lightly on a paper towel. Then, 50 μl medium containing a test sample or 200, 50, 12.5, 3.12, 0.78, 0.19, 0.048 or 0 ng / ml mpl ligand was added to each well. Cells were stimulated at 37 ° C. for 30 minutes, the well supernatant was decanted and the plate was lightly pressed again on a paper towel. To lyse the cells and solubilize the chimeric receptor, 100 μl of lysis buffer was added to each well. Lysis buffers include 150 mM NaCl (Gibco), 0.5% Triton-X 100 (Gibco), 0.01% thimerosal, 30 KIU / ml aprotinin (ICN Biochemicals, Aurora, Ohio) containing 50 mM HEPES. ), 1 mM 4- (2-aminoethyl) -benzenesulfonyl fluoride HCl (AEBSF: ICN Biochemicals), 50 μM Rupeptin (ICN Biochemicals) and 2 mM sodium orthovanadate (NaVO: St. Missouri) Sigma Chemical Co of Lewis: pH 7.5). The plates were then gently stirred for 60 minutes on a plate shaker (Bellco Instruments, Vineland, NJ) at room temperature.

ELISA microtiter plates (Nunc Maxisorp, Inter Med) coated overnight at 4 ° C. with 5B6 monoclonal anti-gD antibody (5.0 μg / ml in 50 mM carbonate buffer, pH 9.6, 100 μl / well), solubilizing the cells. , Denmark), pressed on a paper towel, and 150 μl / well of Block Buffer [0.5% BSA (Intergen Company, Perchase, NJ) and 0.01% thimerosal for 60 minutes at room temperature with gentle stirring. Containing PBS]. After 60 minutes, the plate coated with anti-gD 5B6 was washed using an automated plate washer (ScanWasher 300 from Skatron Instruments, Inc., Sterling, VA) with wash buffer (0.05% Tween-20 and 0.01% thimerosal). Washing with PBS) six times.

Lysates containing solubilized MPL / Rse.gD obtained from cell-culture microtiter wells were coated with anti-gD 5B6, transferred to blocked ELISA wells and incubated for 2 hours at room temperature with gentle stirring. (PBS containing 0.5% BSA, 0.05% Tween -20, 5 mM EDTA, and 0.01% thimerosal) to the first removed by washing the unbound mpl -Rse.gD with wash buffer, and dilution buffer: 18 000 dilution One 100 μl biotinylated 4G10 (anti-phosphotyrosine) (ie 56 ng / ml) was added to each well. After incubation for 2 hours at room temperature, the plates were washed and 100 μl horseradish peroxidase (HRPO) -conjugated streptavidin (Zymed Laboratories, S., San Francisco, CA) diluted 1: 60000 with dilution buffer. .) Was added to each well. The plates were incubated for 30 minutes at room temperature with gentle stirring. Free avidin-conjugate was washed off and 100 μl of freshly prepared substrate solution (Tetramethyl benzidine [TMB]; two-component substrate kit; Kirkegaard and Perry, Guidersburg, Maryland) was added to each well. It was. After the reaction was allowed to proceed for 10 hours, color development was stopped by adding 100 μl / well of 1.0 MH ₃ PO ₄ . At 450 nm using a vmax plate reader (Molecular Devices, Palo Alto, Calif.) Controlled by Macintosh Centris 650 (Apple Computers, Cupertino, Calif.) And DeltaSoft software (BioMetallics, Inc., Princeton, NJ) The absorbance of was read at a comparative wavelength of 650 nm (ABS _450/650 ).

Stimulate dp12.trkA, B or C.gD cells with 200, 50, 12.5, 3.12, 0.78, 0.19, 0.048 or 0 ng / ml mpl ligand to create a standard curve and use the DeltaSoft program to ng / ml TPO vs. Mean ABS _450/650 ± sd. Interpolate the absorbance of the sample on a standard curve to obtain sample concentration, which is expressed as ng / ml TPO activity.

mpl it has been found that the ligand concentration-dependent, and can activate the mpl -Rse.gD chimeric receptor ligand-specific manner. Additionally, mpl be used to retrieve the patient and pK samples easy method -Rse.gD KIRA ELISA was found to be resistant up to 100% human serum (shown) or 100% plasma (not shown).

293-manufactured TPO ₃₃₂  Standard curve

TPO EC50 Summary

Example 18

ELISA based on receptors for thrombopoietin (TPO)

ELISA plates were coated with rabbit F (ab ') ₂ anti-human IgG in carbonate buffer at pH 9.6 overnight at 4 ° C. Plates were blocked with 0.5% bovine serum albumin in PBS for 1 hour at room temperature. Fermentor harvest containing chimeric receptor ( mpl- IgG) was added to the plate and incubated for 2 hours. 2-fold serial dilution (0.39-25 ng / ml) of standard sample (TPO ₃₃₂ produced in 293 cells with concentration measured by quantitative amino acid analysis) and serially diluted samples in 0.5% bovine serum albumin, 0.05% Tween 20 Was added to the plate and incubated for 2 hours. This combined TPO. Purified and biotinylated earthenware antibodies to Protein A against TPO ₁₅₅ produced in E. Coli (1 hour culture) followed by streptavidin-peroxidase (30 minute culture) and 3,3 ′ as substrate. Detection was performed using 5,5'-tetramethyl benzidine. Absorbance was measured at 450 nm. Plates were washed step by step. For data analysis, standard curves were fitted using a 4-variable curve fitting program by Kaleidagraph. The concentration of the sample was converted from the standard curve.

Example 19

TPO Expression and Purification from 293 Cells

1. Preparation of 293 Cell Expression Vectors

The cDNA corresponding to the TPO full open reading frame was obtained by PCR using the following oligonucleotides as primers.

< Table 11>

PRK5-h mpl I (described in Example 6) in the presence of pfu DNA polymerase (Stratagene) was used as template for the reaction. First denatured at 94 ° C. for 7 minutes followed by 25 amplifications (1 minute at 94 ° C., 1 minute at 55 ° C. and 1 minute at 72 ° C.). The last denaturation was extended for another 15 minutes at 72 ° C. The PCR product was purified and cloned between the ClaI and XbaI restriction sites of plasmid pRK5tkneo (vector derived from pRK5 modified to express neomycin resistance gene under thymidine kinase facilitation control) to obtain vector pRK5tkneo.ORF. The second construct corresponding to the EPO homogeneous domain was produced in the same way but using Cla.FL.F and the following reverse primer as forward primers:

Arg.STOP.Xba:

5 'TCT AGA TCT AGA TCA CCT GAC GCA GAG GGT GGA CC 3'

(SEQ ID NO: 66)

The final construct was named pRK5-tkneoEPO-D. The sequences of the two constructs were identified as described in Example 7.

2. Transfection of Human Embryonic Renal Cells

The two constructs were transfected into human embryonic kidney cells by the CaPO ₄ method as described in Example 9. Twenty four hours after transfection, selection of neomycin resistant clones started in the presence of 0.4 mg / ml of G418.10. After 10-15 days, individual colonies were transferred to 96-well plates and incubated until the incubator bottom was covered with cells. Ba / F3- mpl proliferation assay (described in Example 1) was used to measure the expression of ML ₁₅₃ or ML ₃₃₂ in controlled media from these clones.

3. Purification of rhML ₃₃₂

293-rhML ₃₃₂ conditioned medium was added to a Blue-Sepharose (Pharmacia) column equilibrated with 10 mM sodium phosphate (pH 7.4: Buffer A). The column was then washed with buffer A with 10-fold column volume of Buffer A and 2 M Urea, respectively. The column was then eluted with Buffer A containing 2 M urea and 1 M NaCl. The Blue-Sepharose elution pool was then added directly to the WGA-Sepharose column equilibrated with Buffer A. The WGA-Sepharose column was then washed with Buffer A with a 10-fold column capacity of 2 M urea and 1 M NaCl and eluted with the same buffer containing 0.5 M N-acetyl-D-glucosamine. WGA-Sepharose eluate was added to a C4-HPLC column (Synchrom, Inc.) equilibrated with 0.1% TFA. The C4-HPLC column was eluted using discrete propanol gradients (0-25%, 25-35%, 35-70%). It was found that rhML ₃₃₂ elutes in the 28-30% propanol region of the gradient. RhML ₃₃₂ purified by SDS-PAGE migrated as a broad band in the 68-80 kDa region of the gel (see FIG. 15).

4. Purification of rhML ₁₅₃

293-rhML ₁₅₃ conditioned media was analyzed on Blue-Sepharose as described for rhML ₃₃₂ . Blue-Sepharose eluate was added directly to the -affinity column as described above. rhML ₁₅₃ eluted from the mpl -affinity column was homogeneously purified using a C4-HPLC column run under the same conditions as described for rhML ₃₃₂ . RhML ₁₅₃ purified by SDS-PAGE was analyzed into two main bands and two subbands having a molecular weight ˜18,000-21,000 (see FIG. 15).

Example 20

TPO Expression and Purification from CHO

1. Definition of CHO Expression Vector

Expression vectors using the following electroporation protocols were as follows:

pSV15.ID.LL.MLORF (full length or hTPO ₃₃₂ ), and

pSV15.ID.LL.MLEPO-D (cut length or hTPO ₁₅₃ )

Suitable features of these plasmids are shown in FIGS. 23 and 24.

2. Preparation of CHO Expression Vectors

The cDNA corresponding to the hTPO full open reading frame was obtained by PCR using the oligonucleotide primers of Table 12.

< Table 12>

PRK5-h mpl I (described in Examples 7 and 9) in the presence of pfu DNA polymerase (Stratagene) was used as template for the reaction. First denatured at 94 ° C. for 7 minutes followed by 25 amplifications (1 minute at 94 ° C., 1 minute at 55 ° C. and 1 minute at 72 ° C.). The last denaturation extended for another 15 minutes at 72 ° C. The PCR product was purified and cloned between the restriction sites ClaI and Sal1 of plasmid pSV15.ID.LL to obtain vector pSV15.ID.LL.MLORF. The second construct corresponding to the EPO homogeneous domain was produced in the same manner but using Cla.FL.F2 and the following reverse primer as forward primers:

EPOD.Sal:

5 'AGT CGA CGT CGA CTC ACC TGA CGC AGA GGG TGG ACC 3'

(SEQ ID NO: 68)

The final construct was named pSV15.ID.LL.MLEPO-D. The sequences of the two constructs were identified as described in Examples 7 and 9.

In essence, coding sequences for ligands of full length and truncated length were introduced into the polyclonal region of the CHO expression vector pSV15.ID.LL. This vector is used to introduce the initial promoter / enhancer region of SV40, the modified splice unit comprising the DHFR cDNA of the mouse, the corresponding SV40 polyadenylation signal and the gene of origin of replication (in this case, the TPO sequence described). Beta-lactamase genes for plasmid selection and amplification in polycloning sites and bacteria.

3. Methods of forming stable CHO cell lines expressing recombinant human TPO ₃₃₂ and TPO ₁₅₃

a. Description of CHO blast line

The host Chinese Hamster Ovary (CHO) cell line used to express the TPO molecules described herein is known as CHO-DP12 (see European Patent No. 307,247, published March 15, 1989). The mammalian cell line was transfected with a parent cell line (CHO-K1 DUX-B11 (DHFR-)-obtained from Dr. Frand Lee of Stanford University with approval of Dr. L. Chasin, using a vector expressing preproinsulin). Clones were selected from to obtain clones with reduced insulin requirements. In addition, these cells are DHFR- and clones can be selected for the presence of the DHFR cDNA vector sequence by culturing on medium that is not supplemented with nucleosides (glycine, hypoxanthine, and thymidine). Such selection systems for stably expressing CHO cell lines are commonly used.

b. Transfection method (electroporation)

Cell lines expressing TPO ₃₃₂ and TPO ₁₅₃ were produced by transfection using pSV15.ID.LL.MLORF or pSV15.ID.LL.MLEPO-D plasmid linearized DP12 cells via electroporation, respectively. Three restriction enzyme reaction mixtures were prepared for each plasmid cleavage: enzyme NOTI and 10 μg, 25 μg and 50 μg vector by standard molecular biology methods. This restriction site is in the linearization region 3 'and only one site was found in a vector other than the TPO ligand transcriptional unit (see Figure 23). 100 μl of reaction was incubated overnight at 37 ° C. The next day, the mixture was extracted once with phenol-chloroform-isoamyl alcohol (50: 49: 1) and ethanol precipitated on dry ice for about 1 hour. The precipitate was then collected by microcentrifugation for 15 minutes and dried. Linearized DNA was resuspended in 50 μl of Ham's DMEM-F12 1: 1 medium supplemented with standard antibiotics and 2 mM glutamine.

Suspensions incubating DP12 cells were collected, washed once in medium described for DNA resuspension, and finally resuspended in the same medium at a concentration of 10 ⁷ cells per 750 μl. Cell aliquots (750 μL) and each linearized DNA mixture were incubated together at room temperature for 1 hour and then transferred to a BRL electroporation chamber. Each reaction mixture was then electroporated in a 350 volt standard BRL electroporator set at 330 μF and low volume. After electroporation, cells were left in the device for 5 minutes and incubated for an additional 10 minutes on ice. 60 mm cells containing 5 ml of electroporated cells supplemented with standard complete culture medium for CHO cells (1 × GHT, 2 mM glutamine and 5% fetal calf serum and glucose-free DMEM-F12 50:50) Transfer to a petri dish and incubate overnight in a 5% CO ₂ cell culture incubator.

c. Screening and Search Method

The next day, cells were removed by trypsin from the plate by standard methods, the DHFR selection medium (standard DHFR selection medium used supplemented with 2% or 5% of dialyzed fetal calf serum and glycine, hypoxanthine and thymidine at all). And transferred to a 150 mm tissue culture dish containing Ham's DMEM-F12, 1: 1 medium). Cells were then replated into 5/150 mm dishes from each 60 mm dish. Cells were then incubated for 10-15 days (changed medium once) at 37 ° C./5% CO ₂ until clones reached a size sufficient to transfer to a 96-well dish. Over 4-5 days the cell lines were transferred using sterile yellow tips on 50 ml pipet set. Cells were incubated until the bottom of the incubator was covered with cells (usually 3-5 days), then the trays were trypsinized and two copies of the original trays were reproduced. Two of these copies were stored in the freezer for a short time with the cells in each well diluted with 50 μl of 10% FCS in DMSO. After 5 days in a serum-free controlled medium, samples were quantified by activity assays based on Ba / F cells from wells covered with cells in the incubator bottom in a third tray for TPO expression. Based on this assay, the highest expressing clones were resuscitated from storage and doubled incubator bottoms with cells in a 150 mm T-flask for transfer to cell culture groups for suspension adaptation, reanalysis and banking.

d. Amplification protocol

Several of the highest quantitative cell lines obtained from the above selections were then produced with higher quantitative clones via standard methotrexate amplification schemes. CHO cell clones were expanded to play in 10 cm dishes at 4 concentrations of methotrexate (ie 50 nM, 100 nM, 200 nM and 400 nM) at 2 or 3 cell numbers (105, 5 × 105 and 106 cells / dish). Was put on. These cultures were then incubated at 37 ° C./5% CO to a sufficient degree that clones were formed and transferred to 96-well dishes for further analysis. Several high doses of clones from this screening are added back to higher concentrations of methotrexate (ie 600 nM, 800 nM, 1000 nM and 1200 nM), form resistant clones as before, and then transferred to 96-well dishes. Analyzed.

4. Recombinant human TPO ₃₃₂ and TPO ₁₅₃ expressing stable CHO cell lines

Banked cells were unpacked and cell populations were expanded by standard cell culture methods in serum free or serum containing media. After expansion to sufficient cell density, the cells were washed to remove spent cell culture medium. The cells are then incubated until at least 5% of the dissolved O ₂ content, 25-40 ° C., essentially secreted TPO is accumulated at any pH, by any standard method including batch, fed-batch or continuous culture. It was. The cell culture was then separated from the cells by mechanical methods such as centrifugation.

5. Purification of Recombinant Human TPO from CHO Culture

The collected cell culture (HCCF) was directly equilibrated with 0.01 M sodium phosphate (pH 7.4), 0.15 M NaCl at a ratio of about 100 l HCCF / l resin and a linear flow rate of about 300 ml / hr / cm 2 Blue Sepharose 6 Fast Flow It was added to the column (Pharmacia). The column was then washed with 3 to 5 times column volume of equilibration buffer, followed by 3 to 5 times column volume of 0.01 M sodium phosphate (pH 7.4), 2.0 M urea. TPO was then eluted with 0.01 M sodium phosphate (pH 7.4), 2.0 M urea, 1.0 M NaCl in a column volume of 3-5 times.

Equilibrate Blue Sepharose Pool containing TPO with 0.01 M sodium phosphate (pH 7.4), 2.0 M urea and 1.0 M NaCl at a ratio of 8 to 16 ml Blue Sepharose Pool / ml resin and a flow rate of about 50 ml / hr / cm 2 One Wheat Germ Lectin Sepharose 6MB column (Pharmacia) was added. The column was then washed with 2-3 column volume of equilibration buffer. TPO was eluted with 0.01 M sodium phosphate (pH 7.4), 2.0 M urea and 0.5 M N-acetyl-D-glucosamine in a 2-5 fold column volume.

Wheat Germ Lectin Pool was then adjusted to final concentrations of 0.04% C ₁₂ E ₈ and 0.1% trifluoroacetic acid (TFA). The resulting pool was added to a C ₄ reversed phase column (Vydac 214TP1022) equilibrated with 0.1% TFA, 0.04% C ₁₂ E ₈ with a drop of about 0.2-0.5 mg protein / ml resin and a flow rate of 157 ml / hr / cm 2. .

Proteins were eluted with a two-phase linear gradient of acetonitrile containing 0.1% TFA, 0.04% C ₁₂ E ₈ . The first phase consisted of a linear gradient of 0-30% acetonitrile within 15 minutes. The second phase consisted of a linear gradient of 30-60% acetonitrile in 60 minutes. TPO eluted with about 50% acetonitrit. Pools were prepared based on SDS-PAGE.

The C ₄ Pool is then diluted with a 2-fold volume of 0.01 M sodium phosphate (pH 7.4), 0.15 M NaCl, and about 6-fold volume 0.01 M on an ultrafiltration membrane such as Amicon YM having a 10,000-30,000 Dalton molecular weight. Sodium phosphate (pH 7.4), filtered off 0.15 M NaCl. The resulting filtrate was either treated directly or further concentrated by ultrafiltration. The filtrate / concentrate was adjusted to a final concentration of 0.01% Tween-80.

Sephacryl D-300 HR column equilibrated with all or part of the filtrate / concentrate corresponding to 2 to 5% of the calculated column volume with 0.01 M sodium phosphate (pH 7.4), 0.15 M NaCl, 0.01% Tween-80 (Pharmacia) ) Was chromatographed at a flow rate of about 17 mL / hr / cm 2. TPOs containing fractions without aggregates and proteolytic products were prepared from pools based on SDS-PAGE. The resulting pool was filtered on a 0.22 μ filter, Millex-GV and the like and stored at 2-8 ° C.

Example 21

this. Transformation and Induction of TPO Protein Synthesis in Collie

This Composition of the Coli TPO Expression Vector

Plasmids pMP21, pMP151, pMP41, pMP57 and pMP202 were all designed to express the first 155 amino acids downstream of the TPO of another small leader in different constructs. The leader mainly provides high translation initiation and rapid purification. Plasmids pMP210-1, T8, -21, -22, -24, -25 express the first 153 amino acids downstream of the TPO downstream of the initiating methionine and are designed to differ only in the codon usage of the first six amino acids of TPO Plasmid pMP251 was a derivative of pMP210-1 in which the carboxy terminus of TPO was extended by two amino acids. The plasmids all elicited with the tryptophan promoter. TPO was expressed intracellularly to a high degree in Collie (see Yansura, D.G. et al., Methods in Enzymology (Goeddel, D.V., Ed) 185: 54-60, Academic Press, San Diego (1990)). Plasmids pMP1 and pMP172 are intermediates of the TPO intracellular expression plasmid construct.

(a) plasmid pMP1

Plasmid pMP1 is a secretion vector for the first 155 amino acids of TPO and was constructed by ligation of the five DNA fragments shown in FIG. 33 together. The first of these was the vector pPho21 from which the small Mul-BamHI fragment was removed. pPho21 is a human growth hormone gene. Derivatives of phGH1 (see Gene 55: 189-196 (1987)) replacing the Collie's phoA gene and constructing the Mul restriction site as the coding sequence for the STII signal sequence at amino acids 20-21 to be.

The HinfI-PstI fragment of 258 base pairs of DNA obtained from pRK5-h mpl (Example 9) encoding two fragments, TPO amino acids 19-103, and the following synthetic DNA encoding amino acids 1-18 were After preliminary ligation with DNA ligase, digestion with PstI was made.

5 'CGCGTATGCCAGCCCGGCTCCTCCTGCTTGTGACCTCCGAGTCCTCAGTAAACTTCGTG

ATACGGTCGGGCCGAGGAGGACGAACACTGGAGGCTCAGGAGTCATTTGACGAAGCACTGA-5 '

(SEQ ID NO: 69)

(SEQ ID NO: 70)

The fourth fragment was a PstI-HaeIII fragment on 152 bases obtained from pRKhmplI encoding amino acids 104-155 of TPO. The last fragment was a 412 base pair Stul-BamHI fragment obtained from pdh108 including lambda in transcription termination factor as described above (see Scholtissek, S. et al., NAR 15: 3185 (1987)).

(b) plasmid pMP21

Plasmid pMP21 was designed to express the first 155 amino acids of TPO with the 13 amino acid leader construct of the STll signal sequence. It was constructed by ligating three DNA fragments together as shown in FIG. 34, where the first fragment was a vector pVEG31 from which a small XbaI-SphI fragment was removed. Vector pVEG31 has been described as pHGH207-1 (de Boer, HA et al. In Promoter Structure and Function (Rodriguez, RL and Chamberlain, MJ Ed.) 462, Praeger, replacing the gene of human growth hormone with the gene of vascular endothelial growth factor). New York (1982)] (same vector fragments can be obtained from the latter plasmid).

The second fragment in ligation was a synthetic DNA double strand of the sequence:

5'-CTAGAATTATGAAAAAGAATATCGCATTTCTTCTTAA

        TTAATACTTTTTCTTATAGCGTAAAGAAGAATTGCGC-5 '

(SEQ ID NO: 71)

(SEQ ID NO: 72)

The last fragment was a 1072 base pair MluI-SphI fragment obtained from pMP1 encoding 155 amino acids of TPO.

(c) plasmid pMP151

Plasmid pMP151 was designed to express the first 155 amino acids downstream of the leader's TPO consisting of 7 amino acids of the STII signal sequence, 8 histidines, and a factor Xa cleavage site. As shown in FIG. 35, pMP151 was constructed by ligating three DNA fragments together, and the first fragment was the vector pVEG31 from which a small XbaI-SphI fragment was removed. The second fragment was a synthetic DNA double chain of the following sequence:

5'-CTAGAATTATGAAAAAGAATATCGCATTTCATCACCATCACCATCACCATC

ACATCGAAGGTCGTAGCC

TTAATACTTTTTCTTATAGCGTAAAGTAGTGGTAGTGGTAGTGGTAG

TGTAGCTTCCAGCAT-5 '

(SEQ ID NO: 73)

(SEQ ID NO: 74)

The last fragment was a 1064 base pair BgII-SphI fragment obtained from pMP11 encoding 154 amino acids of TPO. Plasmid pMP11 was identical to pMP1 except for some codons in the STII signal sequence (this fragment can be obtained from pMP1).

(d) plasmid pMP202

Plasmid pMP202 was very similar to the expression vector pMP151 except that the factor Xa cleavage site of the leader was replaced with a thrombin cleavage site. As shown in FIG. 36, pMP202 was constructed by ligation of three DNA fragments together. The first fragment was the pVEG31 from which the small XbaI-SphI fragment was removed. The second fragment was a synthetic DNA double strand of the following sequence.

5'-CTAGAATTATGAAAAAGAATATCGCATTTCATCACCATCACCATCACCATCACATCGAACCACGTAGCC

TTAATACTTTTTCTTATAGCGTAAAGTAGTGGTAGTGGTAGTGGTAGTGTAGCTTGGTGCAT-5 '

(SEQ ID NO: 75)

(SEQ ID NO: 76)

The last fragment was BgII-SphI of 1064 base pairs obtained from the plasmid pMP11.

(e) plasmid pMP172

Plasmid pMP172 is a secretion vector for the first 153 amino acids of TPO and is an intermediate of the pMP210 construct. As shown in FIG. 37, pMP172 was prepared by ligation of three DNA fragments together, and the first fragment was a vector pLS32lamB with a small EcoRI-HindIII portion removed. The second fragment was an 946 base pair EcoRI-HgaI fragment obtained from the plasmid pMP11. The last fragment was a synthetic DNA double strand of the following sequence:

5'-TCCACCCTCTGCGTCAGGT (SEQ ID NO: 77)

GGACGCAGTCCATCGA-5 '(SEQ ID NO: 78)

(f) plasmid pMP210

Plasmid pMP210 was designed to express the first 153 amino acids of TPO after translational initiation methionine. This plasmid was prepared as a bank of plasmids, in which the first six codons of TPO were randomized at the third position of each codon, and constructed by ligating three DNA fragments as shown in FIG. The first fragment was the vector pVEG31 from which a small XbaI-SphI fragment was removed. The second fragment is first treated with DNA polymerase (Klenow) and then encoded the first six codons randomized of the starting methionine and TPO with the following synthetic DNA double strand digested with XbaI and HinfI:

5'-GCAGCAGTTCTAGAATTATGTCNCCNGCNCCNCCNGCNTGTGACCTCCGA

GTTCTCAGTAAA (SEQ ID NO: 79)

                                                    ACACTGGAGGCT

CAAGAGTCATTTGACGAAGCACTGAGGGTACAGGAAG-5 '(SEQ ID NO: 80)

The third fragment was a 890 base pair HinfI-SphI fragment obtained from pMP172 encoding amino acids 19-153 of TPO.

About 3700 clones of plasmid pMP210 banks were retransformed onto high concentrations of tetracycline (50 μg / ml) LB plates to screen high translation initiation clones (Yansura, DG et al. Methods: A Companion to Methods in Enzymology 4: 151-158 (1992). Of the eight colonies that appeared on high concentrations of tetracycline plates, five colonies with the best TPO expression were DNA sequenced and the results are shown in FIG. 39 (SEQ ID NOs: 23, 24, 25, 26, 27 and 28). ).

(g) plasmid pMP41

Plasmid pMP41 was designed to express the first 155 amino acids of the TPO fused to the leader consisting of seven amino acids of the STII signal sequence and then to the factor Xa cleavage site. The plasmid was constructed by ligating three DNA fragments together as shown in FIG. 40, and the first fragment was the vector pVEG31 from which a small XbaI-SphI fragment was removed. The second fragment was the following synthetic DNA double strand:

5'-CTAGAATTATGAAAAAGAATATCGCATTTATCGAAGGTCGTAGCC

(SEQ ID NO: 81)

TTAATACTTTTTCTTATAGCGTAAATAGCTTCCAGCAT-5 '

(SEQ ID NO: 82)

The final fragment of ligation was the 1064 base pair BgII-SphI fragment obtained from the plasmid pMP11.

(h) plasmid pMP57

Plasmid pMP57 expresses the first 155 amino acids downstream of the TPO downstream of the leader consisting of 9 amino acids of the STII signal sequence and the dibasic site Lys-Arg. This dibasic site provides a means to remove the leader with the protease ArgC. This plasmid was constructed by ligating three DNA fragments as shown in FIG. The first fragment was the pVEG31 from which the small XbaI-SphI fragment was removed. The second fragment was the following synthetic DNA double strand:

5'-CTAGAATTATGAAAAAGAATATCGCATTTCTTCTTAAACGTAGCC

(SEQ ID NO: 83)

TTAATACTTTTTCTTATAGCGTAAAGAAGAATTTGCAT-5 '

(SEQ ID NO: 84)

The last fragment of ligation was BgII-SphI of 1064 base pairs of the plasmid pMP11.

(i) plasmid pMP251

Plasmid pMP251 is a derivative of pMP210-1 comprising two additional amino acids of TPO on the carboxy terminus. As shown in FIG. 42, this plasmid was constructed by ligation of two DNA fragments together, the first fragment being the pMP21 with the small XbaI-ApaI fragment removed. The second fragment of ligation was a 316 base pair XbaI-ApaI fragment obtained from pMP210-1.

2. E. using TPO expression vector. Transformation and induction of collie

Using the TPO expression plasmid E. coli by the CaCl ₂ heat shock method. Coli strain 44C6 (w3110 tonA _Δ rpoH _ts lon _Δ clpP _Δ galE) was transformed. Transformed cells were first cultured in LB medium containing 50 μg / ml carbenicillin at 37 ° C. until the optical density (600 nm) of the culture reached about 2-3. The LB culture was then diluted 20 × with M9 medium containing 0.49 w / v% casamino acid and 50 μg / ml carbenicillin. After incubation for 1 hour at 30 ° C., indole-3-acrylic acid was added to a final concentration of 50 μg / ml. The culture was then continued for another 15 hours at 30 ° C. while venting the culture, and then cells were collected by centrifugation.

Example 22

this. TPO with Biological Activity in Collie (Met ^-One 1-153) production

The following procedure for the production of biologically active, refolded TPO (Met- ¹ 1-153) can be similarly applied for the recovery of other TPO variants, including forms with extended N and C termini (Examples 23).

A. Recovery of Undissolved TPO (Met- ¹ 1-153)

E. coli expressing TPO (Met- ¹ 1-153) encoded by plasmid pMP210-1. Coli was enzymatically treated as above. Typically, about 100 g of cells were resuspended in 1 L of cell disruption buffer using a Polytron homogenizer and cells were centrifuged at 5000 × g for 30 minutes. The washed cell pellet is resuspended again in 1 L of cell disruption buffer using a Polytron homogenizer, and the cell suspension is passed through LH Cell Disrupter (LH Inceltech, Inc.) or Microfluidizer (Microfluidics International) according to the manufacturer's instructions. I was. The suspension was centrifuged at 5,000 g for 30 minutes, resuspended, and then centrifuged twice to prepare washed refractile body pellets. The washed pellets were either used directly or stored frozen at -70 ° C.

B. Solubilization and Purification of Monomer TPO (Met- ¹ 1-153)

The pellets obtained above were resuspended in 6 mM M guanidine and 25 mM DTT (dithiothreitol) in 5 mM (weight) doses of 20 mM Tris and stirred at 4 ° C. for 1-3 hours or overnight to give TPO. Solubilization of the protein was performed. High concentrations (6-8 M) of urea are also useful, but typically have lower yields than guanidine. After solubilization, the solution was centrifuged at 30,000 × g for 30 minutes to obtain a clear supernatant containing denatured monomeric TPO protein. The supernatant was then chromatographed on a Superdex 200 gel filtration column (Pharmacia, 2.6 × 60 cm) at a flow rate of 2 ml / min, eluting the protein eluted with 20 mM sodium phosphate (pH 6.0) at 160-200 ml. Was prepared as a pool with 10 mM DTT containing denatured monomeric TPO protein. TPO protein was further purified on semipreliminary C4 reversed phase column (2 × 20 cm VYDAC). Samples were added to a column equilibrated with 0.1% TFA (trifluoroacetic acid) and 30% acetonitrile at a rate of 5 ml / min. The protein was eluted with a linear gradient of acetonitrile (30-60% in 60 minutes). Purified reducing protein was eluted with about 50% acetonitrile. This material was used for refolding to obtain TPO release with biological activity.

C. Production of Biologically Active TPO (Met- ¹ 1-153)

About 20 mg of reduced and denatured monomer TPO in 40 ml of 0.1% TFA / 50% acetonitrile was diluted with 360 ml of refolding buffer suitably containing the following reagents:

50 mM Tris

0.3 M NaCl

5 mM EDTA

2% CHAPS cleaner

25% Glycerol

5 mM oxidized glutathione

1 mM reduced glutathione

Adjust pH to 8.3

After mixing, the refolding buffer was gently stirred at 4 ° C. for 12-48 hours to obtain the maximum refolding yield of a moderate disulfide-bound form of TPO (see below). The solution was then acidified with TFA to a final concentration of 0.2%, filtered through a 0.45 or 0.22 micron filter, followed by addition of 1/10 volume of acetonitrile. This solution was pumped directly onto a C4 reversed phase column to elute purified and refolded TPO (Met- ¹ 1-153) with the same gradient program as above. Refolded biologically active TPO was eluted with about 45% acetonitrile under these conditions. Inappropriate disulfide-bound variants of TPO eluted first. Finally purified TPO (Met- ¹ 1-153) had a purity of at least 95% as determined by SDS gel and analytical C4 reversed phase chromatography. In animal studies, C4 purified material was dialyzed with a physiologically compatible buffer. An isotonic buffer (10 mM sodium acetate (pH 5.5), 10 mM sodium succinate (pH 5.5) or 10 mM sodium phosphate (pH 7.4)) containing 150 mM NaCl and 0.01% Tween 80 was used.

Because of the high potency of TPO in the Ba / F3 assay (maximum half stimulation is achieved at about 3 pg / ml), many other buffers, detergents and redox conditions can be used to obtain biologically active materials. However, under most conditions only small amounts (<10%) of properly folded material were obtained. In commercial production methods it is preferred that the refolding yield is at least 10%, more preferably at 30-50%, most preferably at least 505. Many other cleaners (Triton X-100, Dodecyl-Beta-Maltoside, CHAPS, CHAPSO, SDS, Sarcosyl, Tween 20 and Tween 80, Zwittergent 3-14 and others) for the effectiveness supporting high refolding yield Evaluated. Only CHAPSs (CHAPS and CHAPSO) of these cleaners have been found to be commonly useful for refolding reactions that limit protein aggregation and inadequate disulfide formation. CHAPS concentrations above 1% were very useful. NaCl with an optimal concentration of 0.1 M to 0.5 M was required to obtain high yields. The presence of EDTA (1-5 mM) limited the amount of metal catalyzed oxidation (and aggregation) observed in some preparations. Glycerol concentrations of at least 15% provided optimum refolding conditions. For maximum yields, oxidized glutathione and reduced glutathione or oxidized cysteine and reduced cysteine were necessary in pairs of redox reagents. Typically, higher yields were observed when the molar ratio of the oxidized reagent was the same as the reduced reagent of the redox pair, or in excess of the reduced reagent. PH values of 7.5 to about 9 were suitable for refolding these TPO releases. Organic solvents (eg ethanol, acetonitrile, methanol) were resistant at 10-15% or less. Higher concentrations of organic solvents increased the amount of improperly folded forms. Tris and phosphate buffers are commonly useful. Incubation at 4 ° C. also resulted in higher levels of properly folded TPO.

Refolding yields of 40-60% (based on the amount of reduced and denatured TPO used in the refolding reaction) are typical for the preparation of TPO purified first through the C4 step. Even if the yield is low due to extensive precipitation and interference of non-TPO proteins during the TPO refolding process, less active preparations can be obtained (eg, directly after a Superdex 200 column or initial R sieve extraction).

Since TPO (Met- ¹ 1-153) contains four cysteine residues, it is possible to produce three different disulfide variants of the protein:

Type 1: Disulfide between cysteine residues 1-4 and 2-3

Type 2: Disulfide between cysteine residues 1-2 and 3-4

Type 3: Disulfide between cysteine residues 1-3 and 2-4

During the initial investigation to determine the refolding conditions, several different peaks containing TPO protein were separated by C4 reversed phase chromatography. Only one peak of these had great biological activity as determined using the Ba / F3 assay. The refolding conditions were then optimized to selectively obtain this release. Under these conditions, the misfolded release was less than 10-20% of the total monomer TPO obtained.

Disulfide patterns of biologically active TPO by mass spectrometry and protein sequencing were determined to be 1-4 and 2-3 (ie, type 1). Aliquots (5-10 nmole) of various C4 assay peaks were digested with trypsin (molar ratio of trypsin to protein = 1: 25). The digestion mixtures were analyzed by laser desorption mass spectrometry with aid of the matrix before and after DTT reduction. After reduction, agglomerates corresponding to most of the larger trypsinic peptides of TPO were detected. In the unreduced sample, some of these masses were missing and new masses were observed. The chunks of new peaks that basically correspond to the sum of the individual tryptic peptides were associated with the disulfide pairs. Thus, disulfide patterns of refolded and biologically active recombinant TPO can be explicitly assigned to 1-4 and 2-3. This is consistent with known disulfide patterns of related erythropoietin molecules.

D. Biological Activity of Refolded Recombinant TPO (met 1-153)

Refolded and purified TPO (Met- ¹ 1-153) was active in both in vitro and in vivo assays. In the Ba / F3 assay, up to half stimulation of thymidine incorporated into Ba / F3 cells was achieved at 3.3 pg / ml (0.3 pM). For ELISA based on mpl receptor, maximal half activity was seen at 1.9 ng / ml (120 pM). In normal animals and myelosuppressive animals induced by nearly lethal X-irradiation, TPO (Met- ¹ 1-153) was very effective in stimulating the production of new platelets (activity at doses as low as 30 ng / mouse). Indicates).

Example 23

this. Production of TPO variants with different biological activities in Collie

this. Three different TPO variants, produced in Collie, purified and refolded in biologically active form are provided below.

(1) MLF-13 residues obtained from signal sequence STII derived from bacteria were fused to the N-terminal domain of TPO (residues 1-155). The resulting sequence is as follows, where the leader sequence is underlined, C… … C represents Cys ⁷ to Cys ¹⁵¹ :

MKKNIAFLLNAYA SPAPPAC… … CVRRA (SEQ ID NO: 85)

This variant was configured to provide a tyrosine for radioiodine addition of TPO for receptor and biological studies.

(2) Seven residues, eight histidine residues and the enzymatic cleavage sequence IEGR of factor Xa from the H8MLF-STII sequence were fused to the N-terminal domain (residues 1-155) of TPO. The sequence is as follows, where the leader sequence is underlined, C… … C represents Cys ⁷ to Cys ¹⁵¹ :

MKKNIAFHHHHHHHHIEGRSPAPPAC… … CVRRA (SEQ ID NO: 86)

When purified and refolded, the variants can be treated with enzyme factor Xa, which cleaves after the arginine residues of the sequence IEGR to yield 155 residues long TPO variants with native serine N-terminal amino acids.

(3) T-H8MLF-This is prepared as variant (2) above except that the thrombin sensitive sequence IEPR is fused to the N-terminal domain of TPO. The resulting sequence is as follows, where the leader sequence is underlined, C… … C represents Cys ⁷ to Cys ¹⁵¹ :

MKKNIAFHHHHHHHHIEPRSPAPPAC…. … CVRRA (SEQ ID NO: 87)

After purification and refolding, the variant can be treated with the enzyme thrombin to produce a native N-terminal variant of TPO having a length of 155 residues.

A. Recovery, Solubilization and Purification of Biologically Active Monomer TPO Releases (1), (2) and (3)

The variant is all this. Expressed in collie. Most of the variants were found in R form as observed in Example 22 for TPO (Met- ¹ 1-153). The same method as described in Example 22 was carried out for the recovery, solubilization and purification of the monomeric TPO release. The same conditions as used for TPO (Met- ¹ 1-153) were used with a total yield of 30-50%. After refolding, TPO release was purified by C4 reverse phase chromatography in 0.1% TFA using the acetonitrile gradient. All variants of TPO (unproteolytic form) were biologically active as analyzed by Ba / F3 assay and showed up to half activity at 2-5 pM.

B. Proteolytic digestion of variants (2) and (3) to produce certified N-terminal TPO (1-155)

The TPO variants (2) and (3) were designed to have enzymatically cleavable leader peptides prior to the normal N-terminal amino acid residues of TPO. After refolding and purifying such variants (2) and (3), each was digested with an appropriate enzyme. For each release, acetonitrile was removed from the C4 reverse phase step by blowing a moderated stream of nitrogen over the solution. The two variants were then treated with factor Xa or thrombin as follows.

In the TPO mold release (2), 1 M of Tris buffer (pH 8) was added to the solution without acetonitrile, the final concentration was 50 mM, and the pH was adjusted to 8 if necessary. NaCl and CaCl ₂ were added at 0.1 M and 2 mM, respectively. Factor Xa (New England Biolabs) was added to obtain a molar ratio of enzyme to heterozygotes of about 1:25 to 1: 100. Samples were incubated at room temperature for 1-2 hours to obtain maximal cleavage as measured by the change in migration on the SDS gel indicating loss of leader sequence. The reaction mixture was then purified by C4 reverse phase chromatography using the same gradients and conditions in the purification of the suitably folded release. Uncleaved release B was separated from the release 2 that was cut by the above conditions. The N-terminal amino acid was shown to be SPAPP, indicating that the removal of the N-terminal leader sequence was successful. Factor Xa also produced various amounts of internal cleavage in the TPO domain, and cleavage was observed following the arginine residue at position number 118, which produces an additional N-terminal sequence, TTAHKDP (SEQ ID NO: 88). As with cleavage on arginine 118, one band of about 17000 daltons appeared in the release cleaved with factor Xa on the unreduced SDS gel and two bands at molecular weights of about 12000 and 5000 daltons on the reducing gel. This observation also confirmed that two portions of the molecule were linked together by disulfide bonds between the first and fourth cysteine residues, as estimated in the trypsin digestion experiment. In the Ba / F3 biological assay, purified TPO (1-155) variants had a maximum half activity of 2-4 pmoles after removal and internal cleavage of the N-terminal leader sequence.

For variant (3), for the weight ratio of enzyme to TPO heterologous protein from 1:25 to 1:50, the digestion buffer is 50 mM Tris (pH 8), 2% CHAPS, 0.3 M NaCl, 5 mM EDTA and human or bovine Thrombin (Calbiochem). Digestion was performed at room temperature for 2-6 hours. Progress of digestion was measured by SDS gel as described above for the Factor Xa cleavage reaction. Typically, at least 90% leader sequence cleavage was achieved. The resulting TPO was purified on a C4 reversed phase column as above and found to have the desired N-terminus by amino phase sequencing. As observed above, only very small amounts (up to 5%) of internal cleavage were obtained by factor Xa for the same arginine-threonine binding. The resulting TPO protein had high biological activity with up to half response at 0.2-0.4 pmole protein in Ba / F3 assay. For ELISA based on mpl receptor, the protein had a maximum half response in 2-4 ng / ml purified protein (120-240 pmole), while free heterozygous containing the leader sequence was 5 in two assays. The effect was lower than -10 times. In animal studies, the cleaved protein purified by HPLC was 150 mM NaCl, 0.01% Tween 80 and 10 mM sodium succinate (pH 5.5), or 10 mM sodium acetate (pH 5.5), or 10 mM sodium phosphate (pH 7.4). Dialysis with physiologically acceptable buffer. Proteins purified by HPLC and SDS gels were found to be stable for several weeks when stored at 4 ° C. In normal mice and bone marrow suppressor mice, purified TPO with certified N-terminal sequences stimulated platelet production with high activity at doses lower than 30 ng / mouse.

Example 24

Synthetic mpl ligand

Although human mpl ligands (hML) are commonly prepared using recombinant methods, they can also be synthesized by enzymatic ligation of synthetic peptide fragments using the following methods. Non-natural amino acids or synthetic functional groups such as polyethylene glycol are incorporated to produce hML. Previously, subtiligase (S221C / P225A), a variant of the serine protease subtilisin BPN, was used to effectively ligate peptide esters in aqueous solutions (see Abrahmsen et al., Biochem. 30: 4151-4159 (1991)). . It is now known that synthetic peptides can be enzymatically ligated in a series of ways to produce long peptides and proteins with enzymatic activity (eg, ribonuclease A) (Jackson et al., Science (1994) ] Reference). The technique, described in more detail below, allows for the chemical synthesis of long proteins that previously could only be produced by recombinant DNA technology.

The overall scheme for the synthesis of hML ₁₅₃ using subtiligase is shown (Reaction 1). Starting with the fully deprotected peptide corresponding to the C-terminal fragment of the protein, the N-terminus was protected and the C-terminus was activated with the subtiligase. When the reaction was complete, the product was isolated by reverse phase HPLC and the protecting group was removed from the N-terminus. The peptide fragment was then ligated, deprotected and this process was repeated using continuous peptides until the entire protein length was obtained. This method is similar to the solid phase method in that the N-terminally protected and C-terminally activated peptide is ligated to the N-terminus of the preceding peptide to synthesize the protein in the C-> N direction. However, up to 50 residues are produced for each coupling, and the product is isolated after each ligation, allowing much longer and very pure proteins to be synthesized in suitable yields.

Scheme 1.Synthesis Scheme of hML Using Subtilisase

R-NH-peptide ₂ -CO-R '+ H ₂ N-peptide ₁ -CO ₂

↓ 1) Subtilase

R-NH-peptide ₂ -CO-NH-peptide ₁ -CO ₂

↓ 2) Zn / CH ₃ CO ₂ H

H ₂ N-peptide ₂ -CO-NH-peptide ₁ -CO ₂

↓ 3) Repeat 1 + 2

H ₂ N-peptide ₃ -CO-NH-peptide ₂ -CO-NH-peptide ₁ -CO ₂

Based on the sequence specificity of the subtiligase and the knowledge of the amino acid sequence of the "EPO-domain" with the biological activity of hML, we divided hML ₁₅₃ into seven fragments having an 18-25 residue length. Test ligation of tetrapeptide was synthesized to determine the appropriate ligation linkage for 18-25mer. Table 13 shows the results of the test ligation.

< Table 13>

hML Test Ligation: Donor and nucleophilic peptides were dissolved at a concentration of 10 mM in 100 mM Tricine pH 7.8 at 22 ° C. Ligase was added to prepare a final concentration of 10 μM from a 1.6 mg / mL concentrate (˜70 μM) and ligation was performed overnight. Yields are based on% ligation versus hydrolysis of the donor peptide.

part Donor (glc-K-NH ₂ ) Nucleophilic-NH ₂ % Hydrolysis  % Ligation 1 (23/24) HVLH (SEQ ID NO: 89) SRLS (SEQ ID NO: 90) 92 08   (22/23) SHVL (SEQ ID NO: 91) HSRL (SEQ ID NO: 92) 48 52 2 (46/47) AVDF (SEQ ID NO: 93) SLGE (SEQ ID NO: 94) 22 78 3 (69/70) AVTL (SEQ ID NO: 95) LLEG (SEQ ID NO: 96) 53 47 4 (89/90) LSSL (SEQ ID NO: 97) LGQL (SEQ ID NO: 98) 95 05   (88/89) C (acm) LSS (SEQ ID NO: 99) LLGQ (SEQ ID NO: 100) 00 00   (90/91) SSLL (SEQ ID NO: 101) GQLS (SEQ ID NO: 102) 45 55   (88/89) CLSS (SEQ ID NO: 103) LLGQ (SEQ ID NO: 100) 90 10 5 (107/108) LQSL (SEQ ID NO: 104) LGTQ (SEQ ID NO: 105) 99 01   (106/107) ALQS (SEQ ID NO: 106) LLGT (SEQ ID NO: 107) 70 30 6 (128/129) NAIF (SEQ ID NO: 108) LSFQ (SEQ ID NO: 109) 60 40

Based on the above experiments, the ligation peptides shown in Table 14 will be effectively ligated by subtiligase. A suitable protecting group was needed at the N-terminus of each donor ester peptide to prevent self ligation. We chose isonicotynyl (iNOC) protecting groups because they are water soluble, can be incorporated at the end of solid phase peptide synthesis, and are stable to deprotection and HF anhydrides used to cleave peptides from solid phase resins (Veber et al. See J. Org. Chem. 42: 3286-3289 (1977). In addition, it can be removed from the peptide after each ligation under mild reducing conditions (Zn / CH ₃ CO ₂ H) to provide the free N-terminus for the next ligation. Glycolate-lysyl-amide (glc-K-NH ₂ ) esters were used for C-terminal activation based on previous experiments showing effective acylation by subtilisase (Abrahmsen et al. Biochem. 30 4151-4159 (1991). Peptides protected with iNOC and activated with glc-K-NH ₂ can be synthesized using standard solid phase methods as outlined in Scheme 2. The peptide was then ligated until the entire protein was prepared and the final product was refolded in vitro. Similar to EPO, it is believed that disulfide pairs are formed between cysteine residues 7 and 151 and between 28 and 85. Oxidation of the disulfide can be achieved by simply stirring the reduced material for several hours under an oxygen atmosphere. The refolded material was then purified by HPLC, and fractions containing the active protein were made into pools and lyophilized. Alternatively, disulfides can be protected differently to control the successive oxidations between specific disulfide pairs. Only 28 and 85 will be oxidized with the protection of cysteines 7 and 151 with acetamidomethyl (acm) groups. The acm group can then be removed and residues 7 and 151 can be oxidized. In contrast, when continuous oxidation is required for proper folding, residues 28 and 85 are protected by acm and can be oxidized. Optionally, cysteines 28 and 85 can be substituted with natural or unnatural residues other than Cys for proper oxidation of cysteines 7 and 151.

< Table 14>

Peptide ligation was performed in 100 mM tricine at 25 ° C. (pH 8: freshly prepared and degassed by vacuum filtration through a 5 μM filter). Typically, the C-terminal fragment is dissolved in buffer (2-5 mM peptide) and 10 × concentrate of subtilisase (1 mg / ml in 100 mM trisine, pH 8) is added to a final of ˜5 μM. Enzyme concentration was obtained. Excess 3-5 molar glc-K-NH ₂ activated donor peptide was added as a solid to dissolve and the mixture was left at 25 ° C. Ligation was monitored by reversed phase C18 HPLC (gradient of 0.1% TFA and CH ₃ CN / H ₂ O) analysis. The ligation product was purified by preparative HPLC and lyophilized. Deprotection of isicotinyl (iNOC) was performed by stirring the zinc powder activated with HCl and the protected peptide in acetic acid. Zinc powder was removed by filtration and acetic acid was evaporated under vacuum. The resulting peptides could be used directly for the next ligation and this method was repeated. Synthetic hML ₁₅₃ can be ligated in a manner similar to that described above for synthetic or recombinant hML _154-332 to produce the full length of synthetic or semisynthetic hML.

Synthetic hML has many advantages over recombinant hML. Non-natural side chains can be introduced to improve potency or specificity. Incorporation of polymeric functional groups, such as polyethylene glycol, can improve the action time. For example, polyethylene glycol can be bound to the lysine residues of the individual fragments (Table 14) before or after performing one or more ligation steps. In vivo stability can be improved by removing or changing protease sensitive peptide bonds. In addition, a heavy atom derivative may be synthesized and used to determine the structure.

Reactivity 2. Solid Phase Synthesis of Peptide Fragments for Fragment Ligation

a) Lysyl-paramethylbenzhydrylamine (MBHA) Resin 1 (0.63 meq./qm., Advanced ChemTech) was subjected to bromoacetic acid (5 eq.) in dimethylacetamide (DMA) at 25 ° C. for 1 hour and It was stirred with diisopropyl carbodiimide (5 eq.) To obtain bromoacetyl derivative 2.

b) The resin is washed extensively with DMA and the individual Boc protected amino acids (3 eq., Bachem) are stirred with sodium bicarbonate (6 eq.) in dimethylformamide (DMF) at 50 ° C. for 24 hours. By esterification, the corresponding glycolate-phenylalanyl-amide-resin 3 was obtained. The amino acetylated Resin 3 was washed with DMF (3 ×) and dichloromethane (CH ₂ Cl ₂ : 3 ×) and could be stored at room temperature for several months. Resin 3 was then loaded into an automated peptide synthesizer (Applied Biosystems 430 A) and the peptides could be extended using standard solid phase methods.

c) N-α-Boc groups were removed with a 45% trifluoroacetic acid solution in CH ₂ Cl ₂ .

d) The resulting Boc protected amino acid (5 eq.) was converted to benzotriazol-1-yl-oxy-tris- (dimethylamino) phosphonium hexafluorophosphate (BOP, 4 eq.) and N-methyl in DMA. Pre-activated with porpoline (NMM, 10 eq.) And bound for 1-2 hours.

e) removal of the final N-α-Boc group to give (TFA / CH ₂ Cl ₂ ) 4, wherein the isonicotinyl (iNOC) protecting group is 4-isonicotinyl-2,4-di in DMA at 25 ° C. for 24 h It was introduced as (4) above by stirring with nitrophenyl carbonate (3 eq.) And NMM (6 eq.).

f) cleavage and deprotection of the peptide by treatment with HF anhydride (5% anisole / 5% ethylmethyl sulfide) at 0 ° C. for 1 hour to obtain peptide 5 protected with iNOC and activated with glycolate-lysyl-amide This was purified by reverse phase C18 HPLC (CH ₃ CN / H ₂ O gradient in 0.1% TFA). Identification of all substrates was confirmed by mass spectrometry.

Supplementary material

As claimed, the present invention may be consistent with the above specification, and comparative and starting materials may be readily available. Nevertheless, Applicants have deposited the following cell lines with the American Type Culture Collection, Rockville, Maryland:

Escherichia coli, DH10B-pBSK-h mpl I 4.8: ATCC Intestine No. CRL 69575, deposited February 24, 1994.

Plasmid, pSV15.ID.LL.MLORF: ATCC Intestine No. CRL 75958, deposited 2 December 1994.

CHO DP-12 cells, ML 1/50 MCB (labeled # 1594): ATCC Intestine No. CRL 11770, deposited December 6, 1994.

The deposit was made under the provisions and rules of the Butafest Treaty for the International Approval of Microbial Deposits for the purpose of the patent procedure (Budapest Treaty). This maintains a live culture for 30 years from the date of deposit. The organisms will be obtained by the ATCC under the Budapest Treaty, and become available without limitation in the granting of valid US patents with the consent of the applicant and ATCC. The utility of deposited strains is not to be construed as a patent for practicing the present invention in violation of any rights granted under governmental authority under the Patent Act.

The present invention has been described in connection with preferred embodiments and specific working examples, if necessary, and after reading the above specification, a person of ordinary skill in the art will be able to replace various changes and equivalents of the contents described herein without departing from the spirit and scope of the present invention. And changes may be made. That is, the present invention can be carried out by methods other than those specifically described herein. Accordingly, the protection afforded by the patent here will only be limited by the appended claims and equivalents thereof.

All references mentioned herein are hereby expressly incorporated by reference.

Sequence list

(1) General Information:

     (i) Applicant: Genentech, Inc.

                 Eaton, Don L.

                 De Sauvage, Frederick Jay.

     (ii) Name of the invention: thrombopoietin

     (iii) number of sequences: 144

     (iv) address:

(A) Name: Genentech, Inc.

        (B) A: Point San Bruno Boulevard 460

        (C) City: South San Francisco

        (D) State: California

(E) Country: United States

        (F) ZIP Code (ZIP): 94080

     (v) computer readable form:

(A) Medium type: 5.25 inch, 360 kb floppy disk

(B) Computer: IBM PC compatible

(C) operating system: PC-DOS / MS-DOS

(D) Software: patin (Genentech)

     (vi) Current application data:

(A) Application number:

(B) filing date:

        (C) Classification:

     (vii) prior application data:

(A) Application number: 08/176553

(B) Application date: January 3, 1994

     (vii) prior application data:

(A) Application number: 08/348657

(B) Application date: December 2, 1994

     (vii) prior application data:

(A) Application number: 08/185607

(B) Application date: January 21, 1994

     (vii) prior application data:

(A) Application number: 08/348658

(B) Application date: December 2, 1994

     (vii) prior application data:

(A) Application number: 08/196689

(B) Application date: February 15, 1994

     (vii) prior application data:

(A) Application number: 08/223263

(B) Application date: April 4, 1994

     (vii) prior application data:

(A) Application number: 08/249376

(B) filing date: May 25, 1994

    (viii) Attorney / Agent Information:

(A) Name: Winter, Darryl.

(B) registration number: 32,637

(C) Reference / minor number: 871P5PCT

    (ix) Communications Information:

        (A) Phone number: 415 / 225-1249

        (B) Telefax: 415 / 952-9881

        (C) Telex: 910 / 371-7168

(2) Information about SEQ ID NO: 1:

     (i) sequence properties:

(A) Length: 353 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 1

(2) Information about SEQ ID NO: 2:

     (i) sequence properties:

(A) Length: 1795 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 2

(2) Information about SEQ ID NO: 3:

     (i) sequence properties:

(A) Length: 42 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 3

(2) Information about SEQ ID NO: 4:

     (i) sequence properties:

(A) Length: 390 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 4

(2) Information about SEQ ID NO: 5:

     (i) sequence properties:

(A) Length: 390 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 5

(2) Information about SEQ ID NO: 6:

     (i) sequence properties:

(A) Length: 332 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 6

(2) Information about SEQ ID NO: 7:

     (i) sequence properties:

(A) Length: 166 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 7

(2) Information about SEQ ID NO: 8:

     (i) sequence properties:

(A) Length: 328 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 8

(2) Information about SEQ ID NO: 9:

     (i) sequence properties:

(A) Length: 265 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 9

(2) Information about SEQ ID NO: 10:

     (i) sequence properties:

(A) Length: 261 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 10

(2) Information about SEQ ID NO: 11:

     (i) sequence properties:

(A) Length: 7849 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 11

(2) Information about SEQ ID NO: 12:

     (i) sequence properties:

(A) Length: 1443 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 12

(2) Information about SEQ ID NO: 13:

     (i) sequence properties:

(A) Length: 352 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 13

(2) Information about SEQ ID NO: 14:

     (i) sequence properties:

(A) Length: 1536 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 14

(2) Information about SEQ ID NO: 15:

     (i) sequence properties:

(A) Length: 356 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 15

(2) Information about SEQ ID NO: 16:

     (i) sequence properties:

(A) Length: 241 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 16

(2) Information about SEQ ID NO: 17:

     (i) sequence properties:

(A) Length: 335 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 17

(2) Information about SEQ ID NO: 18:

     (i) sequence properties:

(A) Length: 332 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 18

(2) Information about SEQ ID NO: 19:

     (i) sequence properties:

(A) Length: 1026 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 19

(2) Information about SEQ ID NO: 20:

     (i) sequence properties:

(A) Length: 1014 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 20

(2) Information about SEQ ID NO: 21:

     (i) sequence properties:

(A) Length: 328 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 21

(2) Information about SEQ ID NO: 22:

     (i) sequence properties:

(A) Length: 5141 bases

(B) Type: nucleic acid

(C) Helix structure: double helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 22

(2) Information about SEQ ID NO: 23:

     (i) sequence properties:

(A) Length: 21 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 23

(2) Information about SEQ ID NO: 24:

     (i) sequence properties:

(A) Length: 21 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 24

(2) Information about SEQ ID NO: 25:

     (i) sequence properties:

(A) Length: 21 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 25

(2) Information about SEQ ID NO: 26:

     (i) sequence properties:

(A) Length: 21 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 26

(2) Information about SEQ ID NO: 27:

     (i) sequence properties:

(A) Length: 21 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 27

(2) Information about SEQ ID NO: 28:

     (i) sequence properties:

(A) Length: 21 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 28

(2) Information about SEQ ID NO: 29:

     (i) sequence properties:

(A) Length: 25 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 29

(2) Information about SEQ ID NO: 30:

     (i) sequence properties:

(A) Length: 26 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 30

(2) Information about SEQ ID NO: 31:

     (i) sequence properties:

(A) Length: 25 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 31

(2) Information about SEQ ID NO: 32:

     (i) sequence properties:

(A) Length: 14 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 32

(2) Information about SEQ ID NO: 33:

     (i) sequence properties:

(A) Length: 9 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 33

(2) Information about SEQ ID NO: 34:

     (i) sequence properties:

(A) Length: 45 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 34

(2) Information about SEQ ID NO: 35:

     (i) sequence properties:

(A) Length: 20 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 35

(2) Information about SEQ ID NO: 36:

     (i) sequence properties:

(A) Length: 21 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 36

(2) Information about SEQ ID NO: 37:

     (i) sequence properties:

(A) Length: 69 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 37

(2) Information about SEQ ID NO: 38:

     (i) sequence properties:

(A) Length: 69 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 38

(2) Information about SEQ ID NO: 39:

     (i) sequence properties:

(A) Length: 69 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 39

(2) Information about SEQ ID NO: 40:

     (i) sequence properties:

(A) Length: 69 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 40

(2) Information about SEQ ID NO: 41:

     (i) sequence properties:

(A) Length: 69 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 41

(2) Information about SEQ ID NO: 42:

     (i) sequence properties:

(A) Length: 69 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 42

(2) Information about SEQ ID NO: 43:

     (i) sequence properties:

(A) Length: 37 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 43

(2) Information about SEQ ID NO: 44:

     (i) sequence properties:

(A) Length: 22 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 44

(2) Information about SEQ ID NO: 45:

     (i) sequence properties:

(A) Length: 24 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 45

(2) Information about SEQ ID NO: 46:

     (i) sequence properties:

(A) Length: 22 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 46

(2) Information about SEQ ID NO: 47:

     (i) sequence properties:

(A) Length: 31 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 47

(2) Information about SEQ ID NO: 48:

     (i) sequence properties:

(A) Length: 36 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 48

(2) Information about SEQ ID NO: 49:

     (i) sequence properties:

(A) Length: 24 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 49

(2) Information about SEQ ID NO: 50:

     (i) sequence properties:

(A) Length: 24 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 50

(2) Information about SEQ ID NO: 51:

     (i) sequence properties:

(A) Length: 27 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 51

(2) Information about SEQ ID NO: 52:

     (i) sequence properties:

(A) Length: 27 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 52

(2) Information about SEQ ID NO: 53:

     (i) sequence properties:

(A) Length: 28 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 53

(2) Information about SEQ ID NO: 54:

     (i) sequence properties:

(A) Length: 28 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 54

(2) Information about SEQ ID NO: 55:

     (i) sequence properties:

(A) Length: 35 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 55

(2) Information about SEQ ID NO: 56:

     (i) sequence properties:

(A) Length: 17 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 56

(2) Information about SEQ ID NO: 57:

     (i) sequence properties:

(A) Length: 32 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 57

(2) Information about SEQ ID NO: 58:

     (i) sequence properties:

(A) Length: 21 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 58

(2) Information about SEQ ID NO: 59:

     (i) sequence properties:

(A) Length: 103 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 59

(2) Information about SEQ ID NO: 60:

     (i) sequence properties:

(A) Length: 103 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 60

(2) Information about SEQ ID NO: 61:

     (i) sequence properties:

(A) Length: 18 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 61

(2) Information about SEQ ID NO: 62:

     (i) sequence properties:

(A) Length: 25 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 62

(2) Information about SEQ ID NO: 63:

     (i) sequence properties:

(A) Length: 18 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 63

(2) Information about SEQ ID NO: 64:

     (i) sequence properties:

(A) Length: 40 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 64

(2) Information about SEQ ID NO: 65:

     (i) sequence properties:

(A) Length: 32 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 65

(2) Information about SEQ ID NO: 66:

     (i) sequence properties:

(A) Length: 35 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 66

(2) Information about SEQ ID NO: 67:

     (i) sequence properties:

(A) Length: 33 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 67

(2) Information about SEQ ID NO: 68:

     (i) sequence properties:

(A) Length: 36 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 68

(2) Information about SEQ ID NO: 69:

     (i) sequence properties:

(A) Length: 62 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 69

(2) Information about SEQ ID NO: 70:

     (i) sequence properties:

(A) Length: 61 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 70

(2) Information about SEQ ID NO: 71:

     (i) sequence properties:

(A) Length: 37 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 71

(2) Information about SEQ ID NO: 72:

     (i) sequence properties:

(A) Length: 37 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 72

(2) Information about SEQ ID NO: 73:

     (i) sequence properties:

(A) Length: 69 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 73

(2) Information about SEQ ID NO: 74:

     (i) sequence properties:

(A) Length: 62 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 74

(2) Information about SEQ ID NO: 75:

     (i) sequence properties:

(A) Length: 69 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 75

(2) Information about SEQ ID NO: 76:

     (i) sequence properties:

(A) Length: 62 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 76

(2) Information about SEQ ID NO: 77:

     (i) sequence properties:

(A) Length: 19 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 77

(2) Information about SEQ ID NO: 78:

     (i) sequence properties:

(A) Length: 18 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 78

(2) Information about SEQ ID NO: 79:

     (i) sequence properties:

(A) Length: 62 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 79

(2) Information about SEQ ID NO: 80:

     (i) sequence properties:

(A) Length: 49 base

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 80

(2) Information about SEQ ID NO: 81:

     (i) sequence properties:

(A) Length: 45 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 81

(2) Information about SEQ ID NO: 82:

     (i) sequence properties:

(A) Length: 38 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 82

(2) Information about SEQ ID NO: 83:

     (i) sequence properties:

(A) Length: 45 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 83

(2) Information about SEQ ID NO: 84:

     (i) sequence properties:

(A) Length: 38 bases

(B) Type: nucleic acid

(C) Helix structure: single helix

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 84

(2) Information about SEQ ID NO: 85:

     (i) sequence properties:

(A) Length: 25 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 85

(2) Information about SEQ ID NO: 86:

     (i) sequence properties:

(A) Length: 31 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 86

(2) Information about SEQ ID NO: 87:

     (i) sequence properties:

(A) Length: 31 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 87

(2) Information about SEQ ID NO: 88:

     (i) sequence properties:

(A) Length: 7 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 88

(2) Information about SEQ ID NO: 89:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 89

(2) Information about SEQ ID NO: 90:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 90

(2) Information about SEQ ID NO: 91:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 91

(2) Information about SEQ ID NO: 92:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 92

(2) Information about SEQ ID NO: 93:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 93

(2) Information about SEQ ID NO: 94:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 94

(2) Information about SEQ ID NO: 95:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 95

(2) Information about SEQ ID NO: 96:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 96

(2) Information about SEQ ID NO: 97:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 97

(2) Information about SEQ ID NO: 98:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 98

(2) Information about SEQ ID NO: 99:

     (i) sequence properties:

(A) Length: 5 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 99

(2) Information about SEQ ID NO: 100:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 100

(2) Information about SEQ ID NO: 101:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 101

(2) Information about SEQ ID NO: 102:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 102

(2) Information about SEQ ID NO: 103:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 103

(2) Information about SEQ ID NO: 104:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 104

(2) Information about SEQ ID NO: 105:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 105

(2) Information about SEQ ID NO: 106:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 106

(2) Information about SEQ ID NO: 107:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 107

(2) Information about SEQ ID NO: 108:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 108

(2) Information about SEQ ID NO: 109:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 109

(2) Information about SEQ ID NO: 110:

     (i) sequence properties:

(A) Length: 22 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 110

(2) Information about SEQ ID NO: 111:

     (i) sequence properties:

(A) Length: 24 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 111

(2) Information about SEQ ID NO: 112:

     (i) sequence properties:

(A) Length: 23 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 112

(2) Information about SEQ ID NO: 113:

     (i) sequence properties:

(A) Length: 21 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 113

(2) Information about SEQ ID NO: 114:

     (i) sequence properties:

(A) Length: 16 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 114

(2) Information about SEQ ID NO: 115:

     (i) sequence properties:

(A) Length: 22 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 115

(2) Information about SEQ ID NO: 116:

     (i) sequence properties:

(A) Length: 25 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 116

(2) Information about SEQ ID NO: 117:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 117

(2) Information about SEQ ID NO: 118:

     (i) sequence properties:

(A) Length: 5 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 118

(2) Information about SEQ ID NO: 119:

     (i) sequence properties:

(A) Length: 6 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 119

(2) Information about SEQ ID NO: 120:

     (i) sequence properties:

(A) Length: 7 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 120

(2) Information about SEQ ID NO: 121:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 121

(2) Information about SEQ ID NO: 122:

     (i) sequence properties:

(A) Length: 5 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 122

(2) Information about SEQ ID NO: 123:

     (i) sequence properties:

(A) Length: 6 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 123

(2) Information about SEQ ID NO: 124:

     (i) sequence properties:

(A) Length: 4 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 124

(2) Information about SEQ ID NO: 125:

     (i) sequence properties:

(A) Length: 5 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 125

(2) Information about SEQ ID NO: 126:

     (i) sequence properties:

(A) Length: 6 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 126

(2) Information about SEQ ID NO: 127:

     (i) sequence properties:

(A) Length: 7 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 127

(2) Information about SEQ ID NO: 128:

     (i) sequence properties:

(A) Length: 8 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 128

(2) Information about SEQ ID NO: 129:

     (i) sequence properties:

(A) Length: 9 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 129

(2) Information about SEQ ID NO: 130:

     (i) sequence properties:

(A) Length: 10 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 130

(2) Information about SEQ ID NO: 131:

     (i) sequence properties:

(A) Length: 11 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 131

(2) Information about SEQ ID NO: 132:

     (i) sequence properties:

(A) Length: 12 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 132

(2) Information about SEQ ID NO: 133:

     (i) sequence properties:

(A) Length: 13 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 133

(2) Information about SEQ ID NO: 134:

     (i) sequence properties:

(A) Length: 14 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 134

(2) Information about SEQ ID NO: 135:

     (i) sequence properties:

(A) Length: 15 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 135

(2) Information about SEQ ID NO: 136:

     (i) sequence properties:

(A) Length: 16 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 136

(2) Information about SEQ ID NO: 137:

     (i) sequence properties:

(A) Length: 17 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 137

(2) Information about SEQ ID NO: 138:

     (i) sequence properties:

(A) Length: 18 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 138

(2) Information about SEQ ID NO: 139:

     (i) sequence properties:

(A) Length: 19 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 139

(2) Information about SEQ ID NO: 140:

     (i) sequence properties:

(A) Length: 20 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 140

(2) Information about SEQ ID NO: 141:

     (i) sequence properties:

(A) Length: 21 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 141

(2) Information about SEQ ID NO: 142:

     (i) sequence properties:

(A) Length: 22 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 142

(2) Information about SEQ ID NO: 143:

     (i) sequence properties:

(A) Length: 23 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 143

(2) Information about SEQ ID NO: 144:

     (i) sequence properties:

(A) Length: 24 amino acids

(B) type: amino acid

(D) topology: linear

     (xi) sequence description: SEQ ID NO: 144

Claims (22)

An isolated porcine mpl ligand having the amino acid sequence of SEQ ID 18 (ID NO: 18). Isolated mouse mpl ligand having the amino acid sequence of SEQ ID 17 (ID NO: 17). A fragment of a human mpl ligand selected from the group consisting of hML (1-153), hML (7-151), hML (1-191), hML (1-205) or hML (1-217). 4. The fragment of human mpl ligand of claim 3, having an N-terminal methionine. A fused mpl ligand polypeptide having the amino acid sequence of SEQ ID NO: 85, 86 or 87. An isolated nucleic acid molecule encoding a polypeptide of any one of claims 1 to 5. The nucleic acid molecule of claim 6 operably linked to a promoter. An expression vector comprising the nucleic acid of claim 6. An expression vector comprising the nucleic acid of claim 7. A host cell transformed with the expression vector of claim 8. A method for preparing a mpl ligand comprising expressing the nucleic acid of claim 6 in an appropriate host cell. A method for producing a mpl ligand comprising expressing the nucleic acid of claim 7 in an appropriate host cell. The method of claim 11, wherein the mpl ligand polypeptide is recovered from a host cell or culture medium of the host cell. The method of claim 13, wherein the host cell is a CHO cell line. An antibody capable of binding to the mpl ligand polypeptide of any one of claims 1 to 5. The antibody of claim 15, wherein said antibody is a monoclonal antibody. A pharmaceutical composition for treating or preventing thrombocytopenia comprising the mpl ligand polypeptide of any one of claims 1 to 5 and a pharmaceutically acceptable carrier. The mpl ligand polypeptide of any one of claims 1 to 5 bound to a non-proteinaceous polymer. 19. The mpl ligand polypeptide of claim 18, wherein said polymer is polyethylene glycol, polypropylene glycol or polyoxyalkylene. E. Deposited under ATCC Collection No. CRL69575. Escherichia coli, DH10B-pBSK-hmpl 11.8. Plasmid deposited with ATCC accession no. CRL75958, pSVI5.ID.LL.MLORF. CHO DP-12 cells deposited with ATCC accession no. CRL11770, ML1 / 50 MCB.