JPH07173194A - Human m-csf - Google Patents

Abstract

PURPOSE:To provide a human M-CSF acting on bone marrow cells to produce a macrophage differential multiplication-stimulating activity, exhibiting a leukopenia-reducing action, a leukocyte function-stimulating action, etc., and useful for medicines for preventing and treating various infectious diseases, agents for treating myelocytic leukemia, etc. CONSTITUTION:The cultured established cell of human T-cell is cultured in a medium containing a 10% neonatal calf serum at 37 deg.C for 72 hrs, and the whole RNA is extracted from the cultured cells by a guanidine thiocyanate method and subsequently applied to an oligo(alphaT)-cellulose column for separating mRNA. The separated mRNA is used as a template to synthesize a cDNA library by a conventional method, and the cDNA library is subjected to a screening treatment in the presence of a synthesized probe coding for a part of the amino acid sequence of human M type colony-stimulating factor (human M-CSF). The screened DNA is recovered from a positive clone, treated with a restriction enzyme, ligated to a vector, introduced into a host and subsequently expressed to efficiently obtain the objective human M-CSF comprising the sequence of 554 amino acids and useful for the therapy of infectious diseases, myelocytic leukemia, etc.

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION The present invention relates to human colony-stimulating factor (CS) useful as a medicine.
F).

[0002]

2. Description of the Related Art Generally, specific growth and differentiation factors are required for the growth and differentiation of hematopoietic cells, and eventually various mature blood cells such as erythrocytes, granulocytes, macrophages, eosinophils and platelets. , Until it becomes lymphocytes,
Many differentiation and growth factors are involved [Kyosada Miura,
Blood Stem Cell, Chugai Medical Co., 1983]. Among them, proliferation of granulocyte-based progenitor cells and macrophage-based progenitor cells,
CSF is known as a substance that stimulates differentiation, and such CSF has G-type (G
-CSF), an M type specific to the formation of macrophages (M
-CSF) and the GM type (GM-CSF), which promotes the formation of both granulocytes and macrophages. In addition, as a CSF that acts on pluripotent stem cells, multi-CS
F (Multi-CSF: IL-3) is also known.

Based on its biological activity, the above-mentioned CSF is believed to reduce the white blood cell loss, which is a common drawback during cancer chemotherapy and radiation therapy, and clinical studies have been conducted from this viewpoint.

It is known that the above-mentioned CSF has an action of promoting the function of white blood cells [Lopez et al.
opez, AF et al.), J. Immunol., 131, 2983 (1983), Handam et al. (Handam, E. et al.) 122, 1134 (1979) and Vadas et al. (Vadas, MA et al.), 130, 795 (1983)], and thus, its effectiveness as a preventive and therapeutic drug for various infectious diseases has been confirmed.

Furthermore, the differentiation-inducing action of CSF [Metcalf, D. et al., Int. J. Cancer, 30 , 773 (19
82)], the CSF is recognized as effective as a therapeutic agent for myelogenous leukemia.

However, CSF has been found to have activity in, for example, a culture medium of fetal cells, splenocytes, human urine, culture medium of various cell lines, and the like, and is isolated and used as the active fraction. However, in any of the origins, the mixture of a large amount of similar contaminants derived from the origin and the low concentration of CSF itself becomes an obstacle, leaving a problem in the production side, and the homogeneity, yield, operation In view of the above, a means for continuously obtaining CSF as a medicine industrially has not been found yet.

The present inventors have previously established "AGR-ON", which is a cultured cell line derived from human leukemia T cells, which is capable of producing a large amount of CSF in a constantly homogeneous state. He applied for a patent for the invention (Japanese Patent Laid-Open No. 59-1694).
No. 89). In addition, the inventors of the present invention have made the above AGR-ON
As a result of further purification of the CSF produced by
A method for obtaining the CSF in a pure form easily and in a high yield was developed, and the structural and biochemical characteristics of the CSF thus obtained were clarified.
Has completed the invention of the invention and filed a patent application (JP-A-62-1).
69799).

The CSF according to the above invention is an M-CS.
F, that is, a glycoprotein having an activity of acting on normal bone marrow cells to promote the differentiation and proliferation of macrophages, which is characterized in having the following physicochemical properties, and is referred to as "AGR-ON-CSF". Was called.

A) Molecular weight: 33,000-430 by SDS polyacrylamide gel electrophoresis under non-reducing conditions.
It is 00 daltons, and is 23,000 to 40,000 daltons by gel filtration in the presence of SDS under non-reducing conditions. B) N-terminal amino acid sequence of protein part: It has a sequence represented by the following primary structural formula.

Val-Ser-Glu-Tyr-Cys-Ser-His-Met-Ile-Gl
y-Ser-Gly-His-Leu-Gln-Ser-Leu-Gln-Arg-Leu-Ile-Asp-
Ser-Gln-Met-Glu-Thr

[0011]

An object of the present invention is to provide a new recombinant human M-CSF which can be easily produced and supplied in a large amount by a genetic engineering technique.

In the subsequent studies, the present inventors extracted messenger RNA (mRNA) from AGR-ON, which is a cell from which AGR-ON.CSF was derived,
Prepare its complementary DNA (cDNA) from NA, and
A cDNA encoding a desired M-CSF is selected based on the amino acid sequence information of GR-ON.CSF, and the cDNA is selected.
A vector containing A was introduced, the vector was introduced into a host cell to produce a transformant, and the transformant was cultured to confirm the production of M-CSF having a desired biological activity. Was completed.

[0013]

That is, according to the present invention, based on the amino acid sequence information of the following formula (1), a novel human M-CSF molecule having biological activity, particularly from the 33rd position Glu to the 37th position Glu Either one as the N-terminal amino acid,
It relates to human M-CSF which is composed of a sequence having a C-terminal amino acid at any of positions Glu to 185 and Thr and acts on bone marrow cells to promote differentiation and proliferation of macrophages.

Formula (1): Met-Thr-Ala-Pro-Gly-Ala-Ala-Gly-Arg-Cys-Pro-Pro-Th
r-Thr-Trp-Leu-Gly-Ser-Leu-Leu-Leu-Leu-Val-Cys-Leu-
Leu-Ala-Ser-Arg-Ser-Ile-Thr-Glu-Glu-Val-Ser-Glu-Ty
r-Cys-Ser-His-Met-Ile-Gly-Ser-Gly-His-Leu-Gln-Ser-
Leu-Gln-Arg-Leu-Ile-Asp-Ser-Gln-Met-Glu-Thr-Ser-Cy
s-Gln-Ile-Thr-Phe-Glu-Phe-Val-Asp-Gln-Glu-Gln-Leu-
Lys-Asp-Pro-Val-Cys-Tyr-Leu-Lys-Lys-Ala-Phe-Leu-Le
u-Val-Gln-X -Ile-Met-Glu-Asp-Thr-Met-Arg-Phe-Arg-A
sp-Asn-Thr-Pro-Asn-Ala-Ile-Ala-Ile-Val-Gln-Leu-Gln
-Glu-Leu-Ser-Leu-Arg-Leu-Lys-Ser-Cys-Phe-Thr-Lys-A
sp-Tyr-Glu-Glu-His-Asp-Lys-Ala-Cys-Val-Arg-Thr-Phe
-Tyr-Glu-Thr-Pro-Leu-Gln-Leu-Leu-Glu-Lys-Val-Lys-A
sn-Val-Phe-Asn-Glu-Thr-Lys-Asn-Leu-Leu-Asp-Lys-Asp
-Trp-Asn-Ile-Phe-Ser-Lys-Asn-Cys-Asn-Asn-Ser-Phe-A
la-Glu-Cys-Ser-Ser-Gln-Asp-Val-Val-Thr-Lys-Pro-Asp
-Cys-Asn-Cys-Leu-Tyr-Pro-Lys-Ala-Ile-Pro-Ser-Ser-A
sp-Pro-Ala-Ser-Val-Ser-Pro-His-Gln-Pro-Leu-Ala-Pro
-Ser-Met-Ala-Pro-Val-Ala-Gly-Leu-Thr-Trp-Glu-Asp-S
er-Glu-Gly-Thr-Glu-Gly-Ser-Ser-Leu-Leu-Pro-Gly-Glu
-Gln-Pro-Leu-His-Thr-Val-Asp-Pro-Gly-Ser-Ala-Lys-G
ln-Arg-Pro-Pro-Arg-Ser-Thr-Cys-Gln-Ser-Phe-Glu-Pro
-Pro-Glu-Thr-Pro-Val-Val-Lys-Asp-Ser-Thr-Ile-Gly-G
ly-Ser-Pro-Gln-Pro-Arg-Pro-Ser-Val-Gly-Ala-Phe-Asn
-Pro-Gly-Met-Glu-Asp-Ile-Leu-Asp-Ser-Ala-Met-Gly-T
hr-Asn-Trp-Val-Pro-Glu-Glu-Ala-Ser-Gly-Glu-Ala-Ser
-Glu-Ile-Pro-Val-Pro-Gln-Gly-Thr-Glu-Leu-Ser-Pro-S
er-Arg-Pro-Gly-Gly-Gly-Ser-Met-Gln-Thr-Glu-Pro-Ala
-Arg-Pro-Ser-Asn-Phe-Leu-Ser-Ala-Ser-Ser-Pro-Leu-P
ro-Ala-Ser-Ala-Lys-Gly-Gln-Gln-Pro-Ala-Asp-Val-Thr
-Gly-Thr-Ala-Leu-Pro-Arg-Val-Gly-Pro-Val-Arg-Pro-T
hr-Gly-Gln-Asp-Trp-Asn-His-Thr-Pro-Gln-Lys-Thr-Asp
-His-Pro-ser-Ala-Leu-Leu-Arg-Asp-Pro-Pro-Glu-Pro-G
ly-Ser-Pro-Arg-Ile-Ser-Ser-Pro-Arg-Pro-Gln-Gly-Leu
-Ser-Asn-Pro-Ser-Thr-Leu-Ser-Ala-Gln-Pro-Gln-Leu-S
er-Arg-Ser-His-Ser-Ser-Gly-Ser-Val-Leu-Pro-Leu-Gly
-Glu-Leu-Glu-Gly-Arg-Arg-Ser-Thr-Arg-Asp-Arg-Arg-S
er-Pro-Ala-Glu-Pro-Glu-Gly-Gly-Pro-Ala-Ser-Glu-Gly
-Ala-Ala-Arg-Pro-Leu-Pro-Arg-Phe-Asn-Ser-Val-Pro-L
eu-Thr-Asp-Thr-Gly-His-Glu-Arg-Gln-Ser-Glu-Gly-Ser
-Ser-Ser-Pro-Gln-Leu-Gln-Glu-Ser-Val-Phe-His-Leu-L
eu-Val-Pro-Ser-Val-Ile-Leu-Val-Leu-Leu-Ala-Val-Gly
-Gly-Leu-Leu-Phe-Tyr-Arg-Trp-Arg-Arg-Arg-Ser-His-G
ln-Glu-Pro-Gln-Arg-Ala-Asp-Ser-Pro-Leu-Glu-Gln-Pro
-Glu-Gly-Ser-Pro-Leu-Thr-Gln-Asp-Asp-Arg-Gln-Val-G
lu-Leu-Pro-Val [In the formula, X represents Tyr or Asp. In the present specification, peptides and amino acids are represented by I
Abbreviations in the amino acid nomenclature adopted by UPAC or those commonly used in the art shall be followed, and the same shall apply to the representation of DNA base sequences and nucleic acids.

The human M-CSF of the present invention can be easily produced in a large amount by a genetic engineering method using a gene encoding the same (hereinafter referred to as "the gene of the present invention"). On the basis of its biological activity, for example, as a prophylactic and therapeutic agent for diseases or conditions associated with leukopenia, as an adjunct to bone marrow transplantation, as a prophylactic and therapeutic agent for various infectious diseases, as an anticancer agent, etc., especially in the pharmaceutical field. It is useful.

The gene of the present invention will be described in detail below.

The gene of the present invention is, for example, a human cell having the ability to produce M-CSF, more specifically and preferably the above AGR.
Prepared from mRNA separated from -ON. Less than,
The details of this preparation will be described using AGR-ON, but the same applies to other cells. AG used as the origin cell
R-ON is a human cultured cell line derived from human leukemia T cells having the characteristics described in JP-A-59-169489, which is American Type Culture.
Collection (ATCC) "ATCC trust No. CRL
-8199 ".

The separation of mRNA from the above AGR-ON is basically carried out according to a usual extraction procedure. More specifically, the AGR-ON is first prepared by, for example, CEM medium, CMRL-1066 medium, DM-160 medium, Eagle's minimum essential medium (Eagle's MEM), Fisher's medium (Fisher's Medium), F-10 medium, and F-medium. 12 medium, L-15 medium, NCTC-109 medium, RPMI-
1640 medium, etc., or fetal calf serum (FCS) as required
In the above medium to which serum components such as serum and albumin are added, in a concentration range of about 1 × 10 ⁴ to 1 × 10 ⁷ cells / ml,
According to a usual culture method such as carbon dioxide culture method, about 30 to
Culture is performed at about 40 ° C., preferably about 37 ° C. for 1 to 5 days. Then, in the culture supernatant, AGR-ONCS
At the time when F is produced and accumulated, the cultured cells are treated with an appropriate detergent such as SDS, NP-40, Triton X10.
0, deoxycholic acid or the like, or by a method using a homogenizer or a physical method such as freeze-thawing, after partially or completely disrupting and solubilizing the chromosomal DNA,
Using a mixer such as a Polytron or a syringe, the sample is sheared to some extent, and then the protein and the nucleic acid fraction are separated to extract total RNA. For this operation, the CsCl multi-layer method [Chirgwin, JM, et al., Biochemistry, 18 , 5294 (1979)] using phenol / chloroform extraction or ultracentrifugation is generally used.

In each of the above methods, in order to prevent RNA degradation by RNase, an RNase inhibitor,
For example, heparin, polyvinyl sulfate, diethylpyrocarbonate, vanadium complex, bentonite, macaloid, etc. may be added and used.

Isolation and purification of mRNA from RNA obtained according to the above extraction procedure can be performed, for example, by oligo dT-cellulose [Collaborative Research].
search Inc.], Poly U-Sepharose [Falmatia]
(Pharmacia), Sepharose 2B [Falmacia] and the like by an adsorption column method or a batch method.

Purification, concentration and identification of the mRNA for the target M-CSF from the thus obtained mRNA are fractionated by, for example, sucrose density gradient centrifugation, and the translation of the protein is carried out for the fraction. System, for example, injection into oocytes of Xenopus laevis or translation into a protein in a cell-free system such as rabbit reticulocyte lysate or wheat germ, and the M-CSF activity of the protein can be examined. Can be confirmed. Furthermore, the confirmation of the target mRNA can be confirmed by the above M-CSF.
In place of measuring the activity of the above, an immunization method using an antibody against M-CSF can also be performed.

Since the purified mRNA obtained as described above is usually unstable, it is converted into a stable cDNA and connected to a replicon derived from a microorganism in order to enable amplification of a target gene. CD of the above mRNA in vitro
Conversion to NA, that is, synthesis of the gene of the present invention can be generally performed as follows.

That is, first, oligo dT is used as a primer (this primer may be either free oligo dT or oligo dT already added to the vector primer), and mRNA is used as a template for dNTPs (dATP, dG).
In the presence of TP, dCTP or dTTP), single-stranded cDNA complementary thereto is synthesized from mRNA using reverse transcriptase. The next step differs as follows depending on whether the free oligo dT or the oligo dT added to the vector primer was used in the above.

In the former case, mRNA used as a template is decomposed and removed by alkali treatment or the like, and then double-stranded DNA is prepared using single-stranded DNA as a template and reverse transcriptase or DNA polymerase. Next, both ends of the obtained double-stranded DNA are treated with exonuclease, and a plurality of bases in a suitable linker DNA or an annealable combination is added to each of them, and this is added to a suitable vector, for example, EK-based plasmid vector or λgt-based system. Incorporate into phage vector etc.

In the latter case, an open circular plasmid having a linker similar to that described above and a linker DNA (often a region capable of autonomous replication in an animal cell and a transcription promoter region of mRNA) with the mRNA used as a template remaining. (A DNA fragment containing it is used) to form a closed circle, and then RNase and D are added in the presence of dTNP.
By coexisting with NA polymerase and substituting the DNA strand for mRNA, complete plasmid DNA can be prepared.

The DNA obtained as described above is a vector host such as Escherichia coli.
chia coli), Bacillus subtilis (Bacillus subti)
lis), Saccharomyces cerevisiae (Saccharomyces
cerevisiae) and the like, and can be transformed into by introducing into a suitable host. As a method for introducing this DNA into a host and transforming it by this, a generally used method, for example, collecting cells mainly in the logarithmic growth phase and treating with CaCl ₂ to make it easy to take up DNA naturally, A method of incorporating a plasmid can be adopted. In the above method, in order to further improve the transformation efficiency, it is generally known that MgCl ₂ or Rb
Cl can also be allowed to coexist. Alternatively, a method of transforming host cells into spheroplasts or protoplasts and then transforming them can also be used.

As a method for selecting a strain having the desired M-CSF cDNA from the transformants obtained above, the following various methods can be adopted.

(1) Screening Method Using Synthetic Oligonucleotide Probe All or part of the amino acid sequence of the target protein has been elucidated (if the sequence is a plurality of continuous specific sequences,
In the case of any region of the target protein), an oligonucleotide corresponding to the amino acid is synthesized (in this case, it may be either a base sequence derived using the frequency of codon usage or a plurality of possible combinations of base sequences). In the latter case, inosine can also be included to reduce its type), and this is used as a probe (labeled with ³² P or ³⁵ S) for hybridization with a nitrocellulose filter denatured and immobilized on the DNA of the transformant strain. Then, the obtained positive strain is searched and selected.

(2) Method for Producing M-CSF in Animal Cells and Screening The transformed strain is cultured, the gene is amplified, and the gene is transfected into the animal cell (in this case, self-renewable and mRNA transcription is possible). It may be either a plasmid containing a promoter region or a plasmid that integrates into the chromosome of an animal cell), a protein encoded by the gene is produced, and the culture supernatant or cell extract of M-
By measuring the CSF activity or detecting M-CSF using an antibody against M-CSF, a strain having a cDNA encoding the target M-CSF is selected from the original transformants.

(3) Method of selecting using an antibody against M-CSF The cDNA was previously incorporated into a vector capable of expressing the protein in the transformant strain, and the protein was produced in the transformant strain.
Using the antibody against -CSF and the second antibody against the antibody, the M-CSF producing strain is detected to obtain the target strain.

(4) Method Using Selective Hybridization Translation System cDNA obtained from the transformant was blotted on a nitrocellulose filter or the like to hybridize mRNA from M-CSF producing cells. Later, the cDNA
The mRNA corresponding to is recovered. Whether the recovered mRNA is translated into a protein by a protein translation system, for example, injection into Xenopus oocytes or a cell-free system such as rabbit reticulocyte lysate or wheat germ, and the M-CSF activity of the protein is examined, Alternatively, the strain of interest is obtained by detection using an antibody against M-CSF.

From the obtained transformant of interest, M-CSF was obtained.
The method for collecting the DNA encoding the can be carried out according to a known method. For example, it can be carried out by separating a fraction corresponding to plasmid DNA from cells and cutting out a cDNA region from the plasmid DNA.

The DNA thus obtained is one specific example of the gene of the present invention, and is a human M-CSF precursor specified by the amino acid sequence of 372 shown in FIG. 3 or the amino acid sequence of 554 shown in FIG. Coding the body.

However, in order for the substance obtained by the genetic engineering method utilizing the gene of the present invention to express the biological activity of human M-CSF, the gene is not necessarily the above-mentioned D.
It is not necessary to have NA, ie, a DNA sequence that encodes the entire amino acid sequence of the human M-CSF precursor, eg, a partial sequence thereof, which is human M-CS.
Those DNAs are also included in the gene of the present invention as long as they enable expression of biological activity of F.

The fact that the entire amino acid sequence represented by the above-mentioned formula (1) is not always necessary for the expression of the biological activity of human M-CSF is because one of the precursors has its 372nd amino acid (Pro) at the C-terminal. AGR-ON · CSF uses the 35th amino acid (Val) as the N-terminal amino acid, or AGR-O
As a by-product (minor component) during N / CSF manufacturing,
Biologically active M having 33rd amino acid (Glu) or 37th amino acid (Glu) as the N-terminal amino acid
-It is also clear from the fact that CSF can be obtained. From the finding of the similarities in the primary structure between other hemopoietins,
MC with the 7th amino acid (Ala) as the N-terminal amino acid
SF is considered to exist naturally [JW Schrader, et
al., Proc. Natl. Acad. Sci., USA, Vol.83, pp.2458-
2462 (1986)].

As shown in Examples described later, the C-terminal amino acid sequence after the 178th amino acid (Cys) in the amino acid sequence represented by the above formula (1) is human M-
It is also confirmed that it is not always necessary for the biological activity expression of CSF.

Therefore, the gene of the present invention is a biologically active human M-based on the amino acid sequence information shown in formula (1).
It is characterized by having a novel DNA sequence encoding a CSF molecule. More specifically, in addition to the DNA encoding the entire amino acid sequence represented by formula (1), a part of the N-terminal side amino acid sequence, for example, amino acid numbers 1-26, 1-32, 1-34, And each of the sequences 1 to 36, and / or each DN encoding each amino acid sequence lacking a part of the amino acid sequence on the C-terminal side thereof, for example, all or part of the sequence starting from amino acid number 178.
A DNA substantially equivalent to A and the like is included.

Based on the above information, the gene of the present invention can be obtained, for example, by the phosphite triester method [Nature, 31
0, 105 (1984)] and the like, and can also be produced by chemical synthesis of nucleic acid, and 372 shown in FIG.
Or the DNA of 554 shown in FIG. 5 which encodes a polypeptide consisting of an amino acid sequence can be used as a starting material and can be produced according to a usual method. In particular, the latter method is simple and suitable.

In the method using as a raw material the DNA encoding the polypeptide having the amino acid sequence of 372 or 554, an enzymatic treatment for the purpose of chemically synthesizing a part of DNA or cutting, deleting, adding or binding of a DNA chain or Various operations and means such as isolation, purification or replication, and selection of DNA can be carried out in accordance with ordinary methods, and various methods well known in the art for genes or DNA chains other than the gene of the present invention can be used. Can be adopted. For example, the isolation and purification of the above-mentioned DNA can be carried out according to agarose gel electrophoresis etc., and the modification of a part of the codon of the nucleic acid sequence can be carried out by site-specific mutagenesis.
ic Mutagenesis) 〔Proc. Natl. Acad.Sci., 81 , 5662-
5666 (1984)] etc. The selection of the genetic code corresponding to the desired amino acid in the above is not particularly limited, and can be determined according to a conventional method in consideration of the codon usage frequency of the host cell to be used and the like.

The determination and confirmation of the DNA sequence of the gene of the present invention obtained according to the above method can be carried out, for example, by Maxam-Gilbert, Meth. Enzym.
65 , 499-560 (1980)] and the dideoxynucleotide chain termination method using M13 phage [Messing, J. and Vieira,
J., Gene, 19 , 269-276 (1982)] and the like.

By using the thus obtained gene of the present invention, human M-CSF can be easily produced and obtained in a large amount by a gene recombination technique.

This method for producing human M-CSF is different from the above-mentioned specific gene (DNA) of the present invention except that
Conventionally known general gene recombination techniques can be followed [Science, 224 , 1431 (1984); Biochem. Biophys.
Res. Comm., 130, 692 (1985) ； Proc. Natl. Acad. Sc
i., USA, 80 , 5990 (1983); EP Patent Publication No. 18799.
No. 1, JP, Molecular Cloning, by T. Maniatis et al.,
Cold Spring Harbor Laboratory (1982) etc.].

More specifically, a recombinant DNA capable of expressing the gene of the present invention in a host cell is prepared, introduced into a host cell for transformation, and the transformed strain is cultured.

As the host cell, either a eukaryote or a prokaryote can be used. The eukaryotic cells include cells such as vertebrates and yeasts, and examples of the vertebrate cells include COS cells that are monkey cells [Y.
Gluzman, Cell, 23 , 175-182 (1981)] and Chinese
Dihydrofolate reductase-deficient strain of hamster ovary cells [G. Urlaub and LA Chasin, Proc. Natl. Acad. Sci.,
USA, 77 , 4216-4220 (1980)] and the like are often used, but not limited to these. As a vertebrate cell expression vector, a vector having a promoter located upstream of the gene to be expressed, an RNA splice site, a polyadenylation site, a transcription termination sequence and the like can be used. May be owned. As an example of the expression vector, pSV2dhfr [S. Sabramani, which carries an early promoter of SV40,
R. Mulligan and P. Berg, Mol. Cell. Biol., 1, 854-7
64] and the like, but the invention is not limited thereto.

Yeast is generally used as a eukaryotic microorganism, and among them, Saccharomyces yeast can be advantageously used. Examples of expression vectors for eukaryotic microorganisms such as yeast include pAM82 [A. Miyanohara et al, Pr having a promoter for the acid phosphatase gene].
oc. Natl. Acad. Sci., USA, 80 , 1-5 (1983)] and the like can be preferably used.

Escherichia coli and Bacillus subtilis are commonly used as prokaryotic hosts. In the present invention, for example, a plasmid vector capable of replicating in the host bacterium is used, and a promoter and an SD (Shine and Dalgarno) nucleotide sequence are provided upstream of the gene so that the gene of the present invention can be expressed in the vector, and further, protein synthesis. Expression plasmids with the ATG required for initiation can be used. As Escherichia coli as the above-mentioned host bacterium, Escherichia coli (Escherichia coli)
coli) K12 strain and the like are often used, and pBR322 is generally often used as a vector, but not limited to these, and various known strains and vectors can be used. Examples of the promoter include tryptophan
Promoter, P _L promoter, lac promoter,
An lpp promoter or the like can be used, and in any case, the gene of the present invention can be expressed.

Taking the case of using COS cells as the host cells, the expression vector has an SV40 origin of replication and is capable of autonomous growth in COS cells. Furthermore, a transcription promoter, transcription termination signal and RN are used.
It is possible to use the one having an A splice site,
For example, in the case of using the plasmid pcDE described in the Examples below, the target expression plasmid can be obtained by ligating the gene of the present invention to the restriction enzyme EcoRI site located downstream of the SV40 early gene promoter.

As a method for introducing the desired recombinant DNA thus obtained into a host cell and for transforming the host cell, a generally used method can be adopted. For example, an expression plasmid in which the target gene is inserted into the above plasmid pcDE. Can be incorporated into COS cells by the DEAE-dextran method, calcium phosphate-DNA coprecipitation method, etc. Thus, desired transformed cells can be easily obtained.

The desired transformant thus obtained can be cultured according to a conventional method, and the biologically active human M-CSF is produced and accumulated by the culture. As the medium used for the culturing, various kinds of medium commonly used can be appropriately selected according to the adopted host cell. For example, in the case of the above COS cells, RPMI-1640 medium, Dulbecco's modified Eagle minimum essential medium (Dulbecco's modified) Eagle's MEM
) Etc. to which a serum component such as fetal calf serum (FCS) is added, if necessary, can be used.

As described above, the M-CSF produced inside or outside the transformant can be subjected to various separation operations utilizing the physical properties, chemical properties, etc. of the M-CSF (see "Biochemical Data Book"). II ", pp. 1175 to 1259, 1st edition, 1st printing, June 23, 1980, published by Tokyo Kagaku Dojin Co., Ltd.). Specific examples of the method include treatment with a conventional protein precipitant, ultrafiltration, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography (HPLC). ) Etc., various liquid chromatography, dialysis method, etc. can be exemplified.

In a particularly preferred separation method, the desired substance is first partially purified from the culture supernatant. This partial purification is carried out, for example, with ammonium sulfate, sodium sulfate,
It is carried out by a treatment using a salting-out agent such as sodium phosphate and / or an ultrafiltration treatment using a dialysis membrane, a flat plate membrane, a hollow fiber membrane or the like. The operations and conditions of each process may be the same as those of the ordinary method of this kind.

Then, the crude product obtained above is subjected to adsorption chromatography, affinity chromatography,
By subjecting it to gel filtration, ion exchange chromatography, reverse phase chromatography, etc., or by a combination of the above operations, a fraction in which the activity of the target substance is recognized can be obtained, thus isolating the target substance as a homogeneous substance. can do.

The above adsorption chromatography can be carried out using, for example, phenyl-sepharose, octyl-sepharose or the like as a carrier.

Affinity chromatography can be optionally carried out by chromatography using a carrier such as ConA-Sepharose, Lentillectin-Sepharose (manufactured by Pharmacia).

The gel filtration can be carried out using, for example, dextran gel, polyacrylamide gel, agarose gel, polyacrylamide-agarose gel, gel made of cellulose or the like. Specific examples of the gel filtration agent include Sephadex G type, Sepharose type,
Cef Acrylic type (above, manufactured by Pharmacia), Cellulofine (manufactured by Chisso), Biogel P type, A
Type (made by Bio-Rad), Ultrogel AcA (LK
Commercial products such as B company) and TSK gel SW type (manufactured by Toyo Soda Co., Ltd.) can be exemplified.

Ion exchange chromatography can be carried out by chromatography using an anion exchanger having diethylaminoethyl (DEAE) or the like as an exchange group.

Reversed phase chromatography can be performed, for example, by C ₁ ,
It can be carried out using a carrier in which a functional group such as an alkyl group such as C ₃ or C ₄ or a cyanopropyl group or a phenyl group is bonded to a substrate such as silica gel. More specifically, for example, using a C ₄ hypopore reverse-phase HPLC column (RP-304, manufactured by Bio-Rad) and using a mixed solvent of acetonitrile, trifluoroacetic acid (TFA), water and the like as a mobile phase. it can.

By the above method, the desired human M-CSF of the present invention can be easily produced in high yield and high purity on an industrial scale.

When the M-CSF obtained above is used as a medicine, it is prepared in the form of a pharmaceutical composition containing an effective amount thereof together with a conventional pharmacologically acceptable non-toxic carrier, and is put into the form. It is administered by various routes depending on the administration. As the formulation form, a liquid form such as a solution, suspension, emulsion or the like is usually adopted, and these are generally administered orally, intravenously, subcutaneously, intradermally, intramuscularly, etc. Also, the M-CSF is not limited to a particular administration route, and can be prepared into various formulation forms suitable for other commonly adopted oral or parenteral administration, and by adding an appropriate carrier before use. It can also be a dried product that can be made into a liquid form. The dosage of the drug product in various forms is appropriately determined according to the desired pharmacological effect, the type of disease, the age of the patient, the sex, the degree of the disease, etc., but is not particularly limited, but usually M-CSF as an active ingredient is The amount of protein is about 0.001 to 1 mg / kg / day, which is 1
The dose may be administered once to several times a day.

[0060]

EXAMPLES The production of the human M-CSF of the present invention by the production of the gene of the present invention and its use, its characteristics and the like will be described in more detail below with reference to Examples.

The CSF activity of the samples obtained in each example shall be measured by the following method.

<Method for measuring CSF activity> Fetal bovine serum (FC
S) 20 ml, α-medium 30 ml and 2 times concentration α-medium 20 ml were mixed, and the resulting solution was kept warm at 37 ° C.
23.3 ml of the mixture is mixed with 10 ml of a 1% agar (manufactured by Difco) solution which has been kept warm at 50 ° C. and kept warm at 37 ° C.

On the other hand, bone marrow cells (BMC) collected from the femur of BALB / C mouse were washed twice with Hank's solution,
The cell concentration was adjusted to 10 ⁷ cells / ml in α-medium, 1 ml of which was added to the agar medium kept at 37 ° C., mixed well, then kept at 37 ° C., and then 0 0.5 ml is added to a well (tissue culture cluster 12, manufactured by Coster) in which 50 μl of a sample to be tested has been previously added, and the mixture is quickly mixed and allowed to stand at room temperature. After waiting for the agar in each well to solidify, the wells are transferred to a carbon dioxide gas incubator and further cultured at 37 ° C. for 7 days.

The number of colonies thus generated is measured using a stereoscopic microscope and used as an index of CSF activity. The colonies formed above were macrophage colonies as a result of morphological and enzymatic chemistry observations.

[0065]

Example 1 Production of Genes of the Present Invention a) Culturing of AGR-ON cells Human T cell culture established cell line AGR-ON (ATCC Contract N
o.CRL-8199) with 10% neonatal calf serum (NC
S), 20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), 100
μg / ml streptomycin, 100 units / ml penicillin G, 50 μg / ml gentamicin, 5 × 10 ⁻⁵
The cells were prepared in RPMI-1640 medium [manufactured by Flow Laboratories] containing M2-mercaptoethanol and 1 mM glutamine to a cell concentration of about 10 ⁵ cells / ml.
1 l thereof was cultivated at 37 ° C. for 72 hours in five 200 ml tissue-culture flasks (manufactured by Corning).

B) Extraction of mRNA About 5 × 10 ⁸ cells of AGR-ON cells obtained in the above a) were
4M-guanidine thiocyanate solution [4M-guanidine isothiocyanate, 50 mM Tris.HCl (pH
7.6), 10 mM EDTA, 2% sarcosyl (Sar
kosyl), 140 mM 2-mercaptoethanol] 5
After dissolving in 0 ml, the DNA was sheared using a 50 ml syringe equipped with a G18G injection needle while heating at 60 ° C.

To this solution, an equal amount of phenol heated to 60 ° C., ½ volume of 100 mM sodium acetate (pH
5.2) -10 mM Tris.HCl (pH 7.4) -1
A mMEDTA solution and an equal amount of a mixture of chloroform-isoamyl alcohol (24: 1) were added, and the mixture was shaken in a water bath at 60 ° C for 10 minutes, and then centrifuged at 3000 rpm for 15 minutes at 4 ° C. The aqueous layer was taken, phenol-chloroform extraction was performed twice, and chloroform extraction was further performed twice. Then, 2 volumes of cold ethanol was added, and the mixture was kept at -20 ° C for 60 minutes. Centrifuge at 3000 rpm for 20 minutes at 4 ° C., and precipitate the RNA pellet with 100 mM Tris.HCl.
(PH 7.4) -50 mM NaCl-10 mM ED
After dissolution in 50 ml of TA-0.2% SDS solution, proteinase K [proteinase K, manufactured by Merck] was added at 200 μg /
It was added at a concentration of ml and reacted at 37 ° C. for 60 minutes. 6
After phenol-chloroform extraction twice and chloroform extraction twice at 0 ° C., 1/10 volume of 3M
Sodium acetate (pH 5.2) and 2 volumes of cold ethanol were added, and the mixture was left at -70 ° C for 60 minutes. 3 at 4 ° C
After centrifugation at 000 rpm for 20 minutes, the precipitated RNA pellet was washed with cold 70% ethanol and then dissolved in a TE solution [10 mM Tris.HCl (pH 7.5) and 1 mM EDTA].

Thus, about 5 mg of total RNA was obtained from 5 × 10 ⁸ cells of AGR-ON cells.

Then, from the total RNA obtained above, mR
In order to obtain NA, column chromatography was performed using oligo (dT) -cellulose [Collaborative Research]. Adsorption of mRNA is 10
mM Tris / HCl (pH 7.5) -1 mM EDTA
-0.5 M NaCl solution was used, and the column and the same solution were used and 10 mM Tris-HCl (pH 7.5) -1 m.
After washing with M EDTA-0.1M NaCl solution, 10
RNA was eluted with mM Tris.HCl (pH 7.5) -1 mM EDTA.

From the above, about 110 μg of mRNA was obtained.

C) Preparation of cDNA library From 5 μg of the mRNA obtained in the above-mentioned b), cDNA was cD
It was synthesized using the NA synthesis system [manufactured by Amersham].

About 0.6 μg of the obtained cDNA was dried under reduced pressure, and then 50 mM Tris.HCl (pH 7.5) -1.
0 mM EDTA-50 mM DTT-40 μM S-
Dissolve in 20 μl of adenosyl-L-methionine solution,
16 units of coRI methylase [New England Biolabs] was added and reacted at 37 ° C. for 15 minutes.

This reaction solution was heated at 70 ° C. for 10 minutes to stop the reaction, followed by phenol-chloroform extraction, and the extract solution was diluted with 1/10 volume of 3M sodium acetate (pH
5.2) and 2.5 volumes of ethanol were added and left at -70 ° C for 15 minutes. Centrifuge at 15,000 rpm for 15 minutes at 4 ° C., and precipitate the DNA pellet with 50 mM Tris.HCl (pH 7.5) -10 mM MgCl ₂ -1.
0 mM DTT-1 mM ATP-100 μg / ml E
coRI linker [manufactured by Takara Shuzo, 5'-GGAATTCC
-3 ′] solution was dissolved in 10 μl of solution, and then 350 units of T4 DNA ligase [Takara Shuzo] was added thereto, and the mixture was mixed at 14 ° C. for 16 hours.
Reacted for hours.

The obtained reaction solution was heated at 70 ° C. for 10 minutes to stop the reaction, and then 100 mM NaCl-50 mM
Tris · HCl (pH 7.5) -7 mM MgCl ₂ −
16 μl of 10 mM DTT solution and EcoRI restriction enzyme
40 units of [Takara Shuzo] was added and digested at 37 ° C. for 3 hours.

0.5M EDTA (pH 8.
0) 0.8 μl was added to stop the reaction, and then the excess EcoRI linker was removed by Biogel A50m [Bio-Rad] column chromatography. cDN
Fraction A was digested with restriction enzyme EcoRI, and then 5'-phosphate group was removed with alkaline phosphatase to obtain λgt11.
1 μg of DNA [Protoclone GT, manufactured by Promega Biotech], 1/10 volume of 3M sodium acetate (pH 5.2) and 2.5 volumes of ethanol were added, and the mixture was allowed to stand at −70 ° C. for 30 minutes. 1 at 4 ° C
After centrifuging at 5000 rpm for 15 minutes, the precipitated DNA pellet was washed with 70% ethanol and dried under reduced pressure.
It was dissolved in 1.

Next, 500 mM Tris.HCl (pH
7.5) Add ₂ μl of 100 mM MgCl ₂ solution,
After incubating at 42 ℃ for 15 minutes, return to room temperature and 100m
M DTT 1 μl, 10 mM ATP 1 μl and T4D
175 units of NA ligase was added, and the mixture was kept at 14 ° C. for 16 hours.

Next, λ phage packaging extract [Packagene system, manufactured by Promega Biotech, Inc.] was added to 10 μl of this reaction solution, and the recombinant phage DNA was packaged in vitro by incubating at 22 ° C. for 2 hours. It was Phage dilution buffer to the solution [100 mM NaCl-10 mM Tris _{· HCl (pH7.9) -10mM MgSO 4} · 7H
₂ O] 0.5 ml and chloroform 25 μl were added at 4 ° C.
Saved in.

D) Screening of cDNA library d) -1. Preparation of synthetic probe AGR-ON extracted and isolated from AGR-ON culture supernatant
-Based on the information on the amino acid sequence of CSF (27 residues from the N-terminal), the following base sequence was used as a synthetic probe.

Val-Ser-Glu-Tyr-Cys-Ser-His 5'GTG TCG GAG TAC TGT AGC CAC 3'3'CAC AGC CTC ATG ACA TCG GTG 5'A complementary base to the base sequence shown in the above formula. The sequence (shown in the bottom row) was synthesized by the following method in order to be used as a probe for selecting a recombinant phage having a cDNA encoding M-CSF.

That is, a solid phase phosphite triester method using an N, N-dialkylmethyl phosphoramidide derivative as a condensation unit [Nature, 310,
105 (1984)] using an automatic synthesizer [380A DNA synthesizer, manufactured by Applied Biosystems] to synthesize the desired completely protected DNA. Subsequently, the completely protected DNA is treated with 28% ammonia water at 55 ° C. for 10 hours to thereby protect the 5′-terminal OH group with a protecting group (A, G) other than DMTr (dimethoxytrityl) group. , C representing the acyl group of the amino group) was deprotected to obtain a partially protected DNA (referred to as DMTr body). Next, this DMTr body was subjected to reverse phase high performance liquid chromatography (H) using ODS (manufactured by Yamamura Chemical Laboratory) as a carrier.
After purification by PLC), 20% at room temperature with 80% acetic acid
Treatment for minutes provided the crude oligonucleotide. This is O
Further purification by reverse phase HPLC using DS as a carrier gave the desired oligonucleotide.

0.8 μg of the DNA obtained above was added to 100 μg
1 reaction solution [50 mM Tris.HCl (pH 7.6),
T in 10 mM MgCl ₂ , 10 mM 2-mercaptoethanol, 200 μCi [γ- ³² P] -ATP).
4 polynucleotide kinase [Takara Shuzo] 18 units and 3
7 reacted for 1 hour at ° C., was labeled at the 5 'end of the DNA with ³² P. Unreacted [γ- ³² P] AT with labeled DNA
In order to separate P, gel filtration was performed using Biogel P-30 [manufactured by Bio-Rad]. Labeled DNA fractions were pooled and stored at -20 ° C.

The specific activity of the obtained probe was 10 ^8.
It was more than cpm / μg DNA.

D) -2. Plaque Hybridization Escherichia coli Y1090 strain was added to 40 ml of LB medium [Bactotryptone 10 g, Bacto yeast extract 5 g and NaCl 5 g / l] containing 50 μg / ml ampicillin and 0.2% maltose. The cells were inoculated and cultured with shaking in a 300 ml flask overnight at 37 ° C. 3000 at 4 ° C
The cells were collected by centrifugation at rpm for 15 minutes, and the pellet of the cells was added to 20 ml of SM medium [100 mM NaCl-50m].
M Tris.HCl (pH 7.5) -10 mM MgSO
₄ · 7H ₂ O-0.01% gelatin], and the suspension, 4 ° C.
Saved in.

Next, to 0.3 ml of the above-mentioned bacterial solution, the recombinant phage particle solution obtained in (c) above was added to SM medium at 3.5 × 10 ⁵ pfu (plaque forming unit).
Add 0.1 ml diluted to 1 ml / ml and add at 37 ° C for 1
Incubated for 5 minutes. Then, LB soft agar medium preliminarily kept at 47 ° C. [Bactotryptone 10 g, Bacto yeast extract 5 g, NaCl 5 g, agarose 7 g / l].
After adding 7.5 ml and mixing, an LB agar plate [Bacto Trypton 10
g, Bacto yeast extract 5 g, NaCl 5 g, Bacto agar 15 g / l], and cultured at 42 ° C. overnight.
The same operation was performed on a total of 20 petri dishes.

On the agar plate where the plaque appeared, a nylon filter [BNRG132, 132 mm in diameter]
[Manufactured by Pall Co.] was mounted to prepare a replica filter. The agar plate was stored at 4 ° C as a master plate.

The filter was replaced with 0.5 M NaOH-1.
5M NaCl, 0.5M Tris.HCl (pH 7.
5) -1.5M NaCl and 0.3M NaCl-
0.02M NaH ₂ PO ₄ (pH 7.4) -0.00
It was sequentially treated with 2M EDTA (pH 7.4), air-dried, and baked under vacuum at 80 ° C. for 1 hour.

Bake the filter with 0.75
M NaCl-0.075M sodium citrate-1m
g / ml Ficoll-1 mg / ml polyvinylpyrrolidone-1 mg / ml BSA-10 mM sodium phosphate (pH 6.5) -0.2% SDS-0.1 mg / ml Salmon Sperm DNA solution 50 ml
Incubation was carried out at 42 ° C. for 6 hours with gentle shaking in it. Next, the filter was transferred to the same solution to which a probe was added at a concentration of 10 ⁶ cpm / ml, and hybridization was carried out while gently shaking at 42 ° C. for 20 hours.

The filter after hybridization was taken out, washed with 0.9 M NaCl-0.09 M sodium citrate three times at room temperature, and then at 56 ° C.
It was washed with the same solution for 5 minutes.

After air-drying the filter, an intensifying screen was used to apply an X-ray film [XR5, manufactured by Kodak Co.] at -70 ° C. for 2 hours.
Autoradiography was performed for a day.

After developing the film, plaques corresponding to the signal region were scraped from the master plate, and the above method was repeated to purify plaques having a positive signal. Finally, a representative positive clone λ was prepared.
cM5 and λcM11 were isolated.

(E) Structural analysis of clones A restriction enzyme map of λcM5 cDNA was prepared. The results are shown in FIG.

From FIG. 1, the cDNA has a total length of about 2.5 kilobases (kb), among which BstEII [New England Biolabs], NcoI [Takara Shuzo], Sma.
I [Takara Shuzo], KpnI [Takara Shuzo], EcoRI [Takara Shuzo] and NdeI [New England Biolabs]
Each one is cut by ScaI
It was confirmed that there were two places each cut by [Takara Shuzo], StuI [Takara Shuzo] and BamHI [Takara Shuzo].

Next, the nucleotide sequence of the above cDNA was determined by the Maxam-Gilbert chemical modification method and the dideoxynucleotide chain termination method using M13 phage. The results are shown in FIG. 2 (FIG. 2-1 to FIG. 2-4).

From FIG. 2, a region complementary to the synthetic probe was present at the 227th to 247th positions from the 5'end (underlined in the figure).

Also, when the longest reading frame in the cDNA of λcM5 was searched, it was found to be in the region 125 to 1240 from the 5'end, and the 227th to the 227th frame depending on the codon frame.
The amino acid sequence corresponding to the 307th base sequence is AG
It was completely identical to the N-terminal 27 amino acids of R-ON.CSF. This means that the cDNA of λcM5 is M-CSF.
It is shown that this is a cDNA encoding a precursor protein.

From the above results, the determined protein primary structure of the M-CSF precursor protein encoded by λcM5 was determined as the third structure.
It is shown in the drawings (FIG. 3-1 to FIG. 3-2).

ΛcM1 determined in the same manner as above
The base sequence of 1 cDNA is shown in Fig. 4 (Figs. 4-1 to 4
4) shows the protein primary structure of the encoded M-CSF precursor protein in FIG. 5 (FIG. 5-1 to FIG. 3), respectively.

[0098]

Example 2 Recombinant M-CSF (r-MCSF) in COS cells
Production of COS-1 cells used in this example was the starting point of proliferation (O
ri) A TV-positive cell that expresses the SV40 early gene by transforming monkey kidney cell CV1 with defective SV40 DNA [Cel (Cel
l), 23 , 175-182 (1981)].

A) Preparation of COS cell expression vector pcDE First, plasmid pcDV1 [H. Okayama, et al.
P.Berg, Mol.Cell.Biol., 3 , 280-289 (1983)] was digested with a restriction enzyme KpnI, and then the 5'-end and 3'-end overhangs were blunted with T4 DNA polymerase [BRL]. It was the end.

On the other hand, EcoRI linker (5'-GGAA
The 5'end of TTCC-3 ') [Takara Shuzo] was phosphorylated with T4 polynucleotide kinase and ligated to a DNA fragment having this blunt end using T4 DNA ligase. The ligation product was digested with the restriction enzyme EcoRI, further digested with the restriction enzyme HindIII, and the resulting reaction product was subjected to agarose gel electrophoresis to isolate and purify the 2590 base pair (bp) EcoRI-HindIII DNA fragment. did.

On the other hand, plasmid pL1 [Okayama et al.
(H.Okayama, P. Berg, Mol. Cell. Biol., 3, 280-289 (19
83)] is cleaved with the restriction enzyme PstI [Takara Shuzo] to obtain 5 '
The ends and 3'ends were made blunt using T4 DNA polymerase, and this DNA fragment was treated with Eco plasmid in the same manner as above.
RI linker was ligated, the obtained DNA fragment was cleaved with restriction enzyme Hind III, and the reaction product was subjected to agarose gel electrophoresis to give 580 bp EcoRI-Hind IIID.
The NA fragment was isolated and purified.

Obtained DNA fragment and EcoR prepared above
The I-Hind III DNA fragment was ligated with T4 DNA ligase to obtain the desired plasmid pcDE.

The above outline is shown in FIG.

B) M-CSF expression plasmid pcDM
-Preparation of CSF λcM5DNA is partially digested with restriction enzyme EcoRI,
The resulting reaction product was subjected to agarose gel electrophoresis and cD
The NA portion (about 2.5 kb) was isolated and purified as an EcoRI partially digested fragment.

The COS cell expression vector pcDE obtained in b) above was cleaved with the restriction enzyme EcoRI and ligated to the cDNA fragment prepared above using T4 DNA ligase to obtain the desired plasmid pcDM.CSF. .

The thus obtained plasmid was transformed into the Escherichia coli HB101 strain, and the desired transformant was subjected to the alkaline lysis method [T. Maniatis et al. Molecular Cloning, pp9
0, Cold Spring Harvor Laboratory (1982)], and selected by restriction enzyme analysis of the obtained plasmid DNA.

The above outline is shown in FIG.

C) Production of r-MCSF The pcDM.CSF obtained in the above step b) was added to COS-1 cells by the DEAE-dextran method [Proc. Natl. Acad. Sc.
i. USA, Vol. 81, p1070 (1984)], and the production of r-MCSF in the cells was tested as follows.

That is, first, COS-1 cells were prepared in RPMI-1640 medium containing 10% fetal calf serum (FCS) to a cell concentration of about 2.5 × 10 ⁵ cells / ml, and this was used as a tissue culture cluster. 6 [made by Coaster]
Each well was placed in a volume of 2 ml and cultured at 37 ° C. overnight in a carbon dioxide gas incubator.

The medium was then removed and RPMI-1640
After washing the cells twice with, the pcDM
1 ml of RPMI-1640 medium containing 10 μg of CSF
[50 mM Tris-HCl (pH 7.4) and 400μ
g / ml DEAE Dextran (Pharmacia)
] Was added and the mixture was allowed to stand in a carbon dioxide gas incubator for 4 hours. After further removing the medium, RPMI-1640
The cells were washed twice with, and 3 ml of RPMI-1640 medium containing 150 μM chloroquine [manufactured by Sigma] was added thereto, and the cells were cultured for 3 hours. The medium is then removed and the cells are RP
RPM containing 10% FCS after cleaning with MI-1640
I-1640 medium was cultured at 37 ° C. for 72 hours in a carbon dioxide gas incubator.

The culture supernatant and its extract were collected from the cell culture thus obtained, and the CSF activity at each dilution ratio was measured.

The results obtained are shown in Table 1 below. Table 1
In place of pcDM / CSF as a control,
The results of performing the same operation as above using pcDE are also shown. Further, each activity measurement test was carried out twice for the same sample.

[0113]

[Table 1]

The numerical values in Table 1 indicate the number of colonies per plate (average value). The same applies to subsequent tables showing CSF activity.

D) M-CSF expression plasmid pcDM
-Preparation of CSF-185 Using the plasmid pcDM-CSF obtained in the above (b), site-specific mutagenesis (Si
te-Specific Mutagenesis) [Proc. Natl. Acad. Sc
i., 81 , 5662-5666 (1984)], the codon (AAG) encoding the amino acid (Lys) of amino acid No. 186 in FIG. 3 is replaced with a stop codon (TAG), and FIG. A desired M-CSF expression plasmid pcDM.CSF-185 having the amino acid (Thr) of amino acid No. 185 in 3 above as the C-terminal amino acid was obtained.

The details are as follows.

That is, first, an EcoRI-EcoRI DNA fragment (size 1.8 kb) was cut out from the plasmid pcDM.CSF, and this was cut into E of M13mp11 phage (RF).
cloned into the restriction enzyme sites of coRI and EcoRI,
From this, single-stranded (ss) DNA (M13-CSF) was obtained,
This was used as a template for mutagenesis.

On the other hand, the synthetic oligonucleotide [5'-G
TGGTGACCTAGCCTGATT-3 '(primer)] was phosphorylated with T4 polynucleotide kinase, and then hybridized with the above ssDNA (M13-CSF), and after annealing, in the presence of dNTPs, DN
Each was treated with A polymerase I (Klenow fragment) and T4 DNA ligase and incubated at 15 ° C. for 18 hours.

The obtained DNA was transformed into JM105 competent cells, and 50 colonies of the resulting colonies were inoculated on an agar plate and cultured at 37 ° C. for 18 hours. The filter containing the grown colonies was alkali-denatured by a usual method, dried and then baked at 80 ° C. for 2 hours. After the filters were prehybridized, and this one, the 5 'end of the primer ^32
32 P-probe labeled with P-r-ATP was hybridized at room temperature. The hybridized filter was washed with 6 × ssc (saline sodium citrate) at room temperature for 10 minutes and then at 56 ° C. for 4 minutes, dried, and then autoradiographed at −70 ° C. for 18 hours.

From among the mutated clones, M13-CS
F-185 was selected, and this was infected with JM105 and cultured to prepare ssDNA and RF DNA.

The mutation of the desired gene was confirmed by the M13 dideoxynucleotide chain termination method of the ssDNA obtained above.

RF D grown in JM105 described above
An EcoRI-EcoRI fragment was prepared from NA and incorporated into an expression plasmid in the same manner as in (b) above to obtain the desired plasmid pcDM.CSF-185.

Using this plasmid, r-MCSF was expressed in COS-1 cells in the same manner as in (c) above.
The results are shown in Table 2 below.

[0124]

[Table 2]

E) M-CSF expression plasmid pcDM
-Preparation of CSF-177 5'-GCTGAATGATCCAG as a primer
Using CCAA-3 ', in the same manner as in 2) above, the third
A desired M- having the codon (TGC) encoding the amino acid (Cys) of amino acid number 178 in the figure replaced with a stop codon (TGA) and the amino acid (Glu) of amino acid number 177 in FIG. 3 as the C-terminal amino acid A CSF expression plasmid pcDM.CSF-177 was obtained.

The results of expressing r-MCSF in COS-1 cells using this plasmid in the same manner as in (c) above are shown in Table 3 below.

[0127]

[Table 3]

From the results shown in Tables 2 and 3 above, the plasmid pcDM.CSF-185 carrying the gene of the present invention was obtained.
It can be seen that the desired r-MCSF exhibiting the biological activity of M-CSF can be expressed by using the same and pcDM.CSF-177.

From this, at least the amino acid sequence on the C-terminal side after amino acid number 178 in the amino acid sequence shown in FIG. 3 has M-CS having the desired biological activity.
It is clear that it has virtually no effect on the expression of the F molecule.

F) In the above (b), λcM5cDN
Using λcM11 cDNA instead of A, a plasmid pcDM.CSF11 was obtained. Using the plasmid,
R-MCSF was produced according to the above (c), and substantially the same result was obtained.

That is, λcM11DNA was digested with the restriction enzyme Eco.
After partial digestion with RI, the resulting reaction product was subjected to agarose gel electrophoresis, and the cDNA portion (about 2.5 kb) was EcoR
It was isolated and purified as a partially digested fragment I.

The COS cell expression vector pcDE obtained in b) above was cleaved with the restriction enzyme EcoRI and ligated to the cDNA fragment prepared above using T4 DNA ligase to obtain the desired plasmid pcDM.CSF11. .

The thus obtained plasmid was transformed into the Escherichia coli HB101 strain, and the desired transformant was subjected to an alkaline lysis method [T. Maniatis et al. Molecular Cloning, pp9
0, Cold Spring Harvor Laboratory (1982)], and selected by restriction enzyme analysis of the obtained plasmid DNA.

Further, the cDNA of λcM11 DNA described above
(EcoRI partial digestion fragment) to cloning vector p
It was inserted into the EcoRI cloning site of UC19DNA (Takara Shuzo) to obtain the plasmid pUCMCCSF.11.
The transformant obtained by transforming the plasmid into the Escherichia coli HB101 strain was Escherichia coli.
HB101 / pUCMCCSF / 11, 198
It was deposited on July 16th, 7th, at the Institute for Microbial Industry of the Agency of Industrial Science and Technology, as Micro Engineering Research Article No. 1409 (FERM BP-1409).

G) The plasmid pcDM.CSF11 was digested with restriction enzymes EcoRI and BstEII to give about 670 bp.
The EcoRI-BstEII DNA fragment of was isolated and purified.

On the BstEII cleavage side of this DNA fragment,
The following synthetic DNA linker phosphorylated at the 5'end with T4 polynucleotide kinase; DNA fragment obtained by ligating 5'-GTGACCTGATAAGGATCCG-3 '3'-GACTATTCCTAGGCTTAA-5' and EcoRI digestion of the above plasmid pcDE. The product was ligated with T4 DNA ligase to obtain the desired plasmid pcDM.CSF11-
185 was obtained. The plasmid has a translation termination codon TGATAA at the above-mentioned synthetic linker site, and therefore, in the polypeptide shown in FIG. 5 encoded by the plasmid pcDM.CSF11, its 185th amino acid (T
hr) is the C-terminal amino acid and encodes M-CSF.

The above outline is shown in FIG.

The results of expression using the plasmid in the same manner as in (c) above are shown in Table 4 below.

[0139]

[Table 4]

H) The plasmid pcDM obtained in G) above
Using CSF11-185, the codon (TGC) encoding the amino acid (Cys) of amino acid No. 178 in FIG. 5 was replaced with a stop codon (TGA) according to the above (e), and the 177th amino acid in FIG. 5 ( Glu) is the desired M-CSF expression plasmid p with the C-terminal amino acid
cDM.CSF11-177 was obtained. The results of expression using the plasmid in the same manner as in (c) above are shown in Table 5 below.

[0141]

[Table 5]

Re) Plasmid pcDM.CSF11-
185 DNA was digested with EcoRI and BamHI to give E
The coRI-BamHI DNA fragment (about 680 bp) was isolated and purified, and this was secreted expression vector pIN-III-Om.
pA3 [EMBO J., 3 , 2437-2442 (19
84)] of the plasmid pIN-III-OmpA3-MC into the EcoRI and BamHI cloning sites.
SF11-185 was obtained.

The plasmid DNA was digested with XbaI and BamHI.
Digested with XbaI-BamHI DNA fragment (about 770b
p) was isolated and purified, and Xba of cloning vector pUC118DNA [Takara Shuzo] for preparing single-stranded DNA was prepared.
I and BamHI cloning sites were inserted to obtain plasmid pUC118-OmpA3-MCSF11-185.

Using the plasmid, OmpA was prepared according to the method for cytospecific mutagenesis.
The codon (GCC) encoding the C-terminal amino acid (Ala) of the signal peptide contains 3 of the polypeptide shown in FIG.
Codon (GT) encoding the fifth amino acid (Val)
G) was modified so that it is located in ligation and plasmid p
UC118-OmpA-MCSF11-NV151 was obtained.

That is, the plasmid pUC118-OmpA
E. coli JM105 transformed with 3-MCSF11-185 DNA was added to helper phage K07.
Infected with [Takara Shuzo] and cultured with shaking at 37 ° C for 14 hours.
Single-stranded (ss) pUC118-OmpA3-MCSF11
-185 DNA was obtained and used as a template for mutagenesis, and 5'-TACGT was used as a primer.
AGCGCAGGCCGTGTCGGAGTACTGT
Using AGC-3 ', the desired plasmid pUC118-OmpA-MCSF11-NV was obtained in the same manner as in (d) above.
151 was obtained.

The plasmid DNA was digested with XbaI and BamHI.
Digested with XbaI-BamHI DNA fragment (about 540b
p) was isolated and purified, and the expression vector pIN-III
(Lpp ^p -5) -A3 was inserted into the XbaI-BamHI site, and the desired secretory form for expressing a polypeptide consisting of the 35th amino acid (Val) to the 185th amino acid (Thr) in FIG. Expression plasmid pIN-II
I (lpp ^p -5) -OmpA-MCSF11-NV15
Got 1.

The above outline is shown in FIGS.

The amino acid sequence encoded by the above secretory expression plasmid is shown in FIG. In FIG. 10, the underlined sequence represents the OmpA signal peptide, and ▼ represents the processing site.

N) pIN-III (lp
p ^p -5) the -OmpA-MCSF11-NV151 performs secretory production was transformed into E. coli HB101 and JM109, the supernatant was recovered indicating the CSF activity as the periplasmic fraction.

That is, the strain carrying the above M-CSF secretory expression vector was added to a 2 l flask to give 50 μg / m 2.
37 in 500 ml of LB medium containing 1 ampicillin
After culturing with shaking at 14 ° C for 14 hours, centrifugation (5000 rpm, 5
The cells were pelletized for 1 minute at room temperature).

This bacterial cell pellet was treated with 50 mM Tris.H.
Cl (pH 8.0) -25% sucrose solution 50 m
resuspended in 250 mM EDTA (pH 8.
After the addition of 1.25 ml of 0), the mixture was left at room temperature for 30 minutes with gentle shaking. Similarly, the bacterial cell pellet obtained by centrifugation was resuspended in 25 ml of ice-cooled distilled water, ice-cooled for 30 minutes while gently shaking, and then kept at 4 ° C. for 10 minutes.
The supernatant was collected as a periplasmic fraction by centrifugation at 000 rpm for 5 minutes.

Le) In the above re), pcDM.CS
PcDM-CSF11-177 instead of F11-185
By using, 35th amino acid (Val) from the desired M-CSF secretory expression plasmid for polypeptide expression consisting to the same 177 amino acid (Glu) in FIG. 5, pIN-III (lpp ^p - 5) -Omp
A-MCSF11-NV143 was obtained.

The amino acid sequence encoded by the plasmid is shown in FIG. In Fig. 11, the underlined sequence is O.
The mpA signal peptide and ▼ represent the processing site. The plasmid was transformed into Escherichia coli in the same manner as the above-mentioned n) to obtain a supernatant showing CSF activity as a periplasmic fraction from the E. coli.

W) Each supernatant obtained in the above f), g), j) and g) was subjected to HPLC under the following conditions.

Column: TSK gel G3000SW (60
cm × 7.5 mm diameter, Toyo Soda Co., Ltd.) Eluent: 0.005% polyethylene glycol and
15M NaCl-containing PBS Flow rate: 0.8 ml / min Fraction volume: 0.8 ml / tube / min Molecular weight markers (glutamate dehydrogenase: 290,000, lactate dehydrogenase: 142,000, enolase: 60,000, adenyl Acid kinase: 32,000, cytochrome C: 1.24
The following results were obtained for each sample based on the standard

Sample: 4 of the culture supernatant obtained in (f) above
About 15 ml with Centricon-10 (Amicon)
Concentrated to 0 μl.

CSF activity was observed in the elution fraction in the range corresponding to a molecular weight of 32 to 700,000 (average of 480,000).

-Sample: 4 m of the culture supernatant obtained in (g) above
l treated in the same manner as above.

Molecular weight of 66,000 to 86,000 (average of 7.6)
CSF activity was observed in the elution fraction in the range corresponding to (10,000).

-Sample: 4 m of the culture supernatant obtained in the above (i)
l treated in the same manner as above.

Molecular weight 52,000 to 86,000 (average 6.7)
CSF activity was observed in the elution fraction in the range corresponding to (10,000).

Sample: 2 ml of the supernatant of the periplasmic fraction obtained in the above step (2) was concentrated to about 110 μl in the same manner as above.

CSF activity was observed at a position corresponding to a molecular weight of 30,000 to 40,000 (average of 35,000).

[0164] wa) wherein f), g) or 10ml of the culture supernatant obtained in H), it was subjected to a column packed with ConA- Sepharose 1 ^ml, PBS - washed with (5 ml), 0. 5M methyl-.alpha.-D-mannoside containing PBS ^-
It was eluted with (10 ml). 4 ml of the obtained eluate was concentrated with Centricon-10, and this was mixed with SDS-P below.
The sample was used for AGE.

Further, the supernatant of the periplasmic fraction obtained in the above step 3) was used as it was as the same sample.

The detection of M-CSF was carried out by subjecting the gel after SDS-PAGE to Western blotting and using a rabbit antiserum to M-CSF produced according to a conventional method.

That is, SDS-PAGE is carried out according to the method of Laemmli [Laemmli, UK, Nature, 277 , 680 (1970)].
A mini slab (15% gel concentration) was used, and Western blotting was performed using a trans-blot cell manufactured by Bio-Rad. Transportation nitrocellulose membranes with 1% bovine serum albumin-containing PBS ^- After blocking with, reacted with the rabbit antiserum against M-CSF, to act further peroxidase-labeled goat anti-rabbit antibody (Bio-Rad) It was The detection of the M-CSF band was carried out by reacting the thus obtained nitrocellulose membrane with a 4-chloro-1-naphthol solution which is a chromogenic substrate.

The results are shown in Table 6 below.

[0169]

[Table 6]

F) Plasmid pSV2-dhfr [Mol. C
ell. Biol., 1, 854 (1981)] with the restriction enzyme Hind II.
The fragment containing the dihydrofolate reductase (DHFR) gene was isolated and purified by cutting into two fragments with I and BamHI.

Next, the plasmid pRSV-CAT [Pro
c. Natl. Acad. Sci., USA, 79 , 6777 (1981)] was similarly digested with HindIII and BamHI to isolate and purify a fragment containing the LTR (long terminal repeat) portion of Rous sarcoma virus (RSV). did.

The two fragments thus purified were treated with T4DN
Ligation was performed by reacting A ligase.

This reaction product was transformed into Escherichia coli HB101 competent cells (Takara Shuzo), and plasmid DNA was prepared from the obtained ampicillin-resistant colonies, and a restriction enzyme map was prepared to obtain the desired plasmid pR.
SV-dhfr was obtained.

The plasmid is the LTR portion of RSV, DH
It contains an FR gene, an intervening sequence derived from SV40 and a polyA addition signal, a replication origin derived from Escherichia coli plasmid pBR322 and an ampicillin resistance gene, and DHF under the control of a promoter contained in the LTR part.
It expresses R.

This plasmid pRSV-dhfr was cut into two fragments with NdeI and BamHI, and the fragment containing the DHFR gene was isolated and purified. The obtained DNA fragment is DN
Both ends were made blunt by treatment with A polymerase I (Klenow fragment).

On the other hand, the plasmid pcDM obtained in (f) above
-After CSF11 was digested with SalI, this digestion site was similarly treated with DNA polymerase I to make a blunt end.

Both fragments thus obtained were transformed into T4DNA.
The reaction product was ligated using ligase, and this reaction product was used for E. coli JM1.
It was transformed into 09 competent cells. From the obtained colonies showing resistance to ampicillin, plasmid DN
A is prepared, a restriction enzyme map is prepared, and the target M-CS is prepared.
Expression plasmid pcDM / C for both F and DHFR genes
SF11-dhfr was obtained.

The plasmid contains the SV40-derived early promoter portion involved in M-CSF expression, an intervening sequence, and M-CSF.
It contains a CSF gene, a polyA addition signal, the LTR part of RSV involved in DHFR expression, a DHFR gene, an intervening sequence derived from SV40, a polyA addition signal, and further contains a replication origin derived from E. coli plasmid pBR322 and an ampicillin resistance gene.

The above outline is shown in FIGS.

(Yo) The plasmid pcDM.C obtained above
Using SF11-dhfr and following c), r-MC
SF was manufactured.

As a result, the CSF activity of the culture supernatant was 68 as colony number (average value) per plate (the control using the plasmid pcDE was 0).

(A) Chinese hamster ovary dhfr-deficient cells [CHO-Dukdhfr ^- cells: Proc. Natl. Acad.] Cultured in a 75 cm ² culture flask (manufactured by Coster).
Sci., USA., 77 , 4216 (1980)] was treated with trypsin (manufactured by Flow Laboratories) according to a conventional method, and Dulbecco's modified minimum essential medium (DMEM medium, containing 10% dialyzed fetal bovine serum (manufactured by GIBCO)). The cells were suspended in GIBCO), the cells were washed with the same medium, and then the medium was removed.

The cells were treated with DNA injection solution (0.25M
Mannitol-0.1 mM CaCl ₂ · 2H ₂ O-
_{0.1mM MgSO 4 · 7H 2 O-} 0.2mM Tris HCl, pH 7.2, and suspended in Wako Pure Chemical Industries, Ltd.).

The M-CSF expression plasmid pcDM.CSF11-dhfr obtained in (a) was cleaved with ClaI,
After linearization, it was dissolved in the DNA injection solution.

200 μl of the above cell suspension (2 × 10 ⁶
Cells) and 200 μl (30 μg DNA) of the DNA solution are mixed, placed in a fusion chamber CH-2 (manufactured by Shimadzu Corporation), connected to an electrofusion device SSH-1 (manufactured by Shimadzu Corporation), and 4.2 KV / cm ² The pulse was repeated twice at 1 second intervals to electrically introduce the DNA into the cells.

The cells into which the DNA has been introduced are suspended in 10% dialyzed fetal bovine serum-1% non-essential amino acid solution (manufactured by Flow Laboratories) -2% HT solution (manufactured by the same company) -DMEM medium to prepare a 24-well plate ( Culturing was performed by Costar.

After culturing for 48 hours, the medium was selected (10%
DM containing dialyzed fetal bovine serum and 1% non-essential amino acid solution
EM medium), and then the medium was replaced with a fresh one every 3 to 4 days.

About 200 obtained by culturing for 10 to 14 days
Fifty clones were selected from the transformed cells of the clones, treated with trypsin in a conventional manner, and transferred to a new 24-well plate.

Amplification of the DHFR gene confers resistance to high concentrations of methotrexate (MTX) [JBC,
253, 1357 (1978)], co-transformed contiguous genes show amplification by MTX.

Transformed cells of the above 50 clones were
After culturing in a selective medium containing nM MTX, the grown resistant clones were treated with trypsin, followed by 50 nM MT.
Culture was performed by suspending in a selective medium containing X. Similarly grown resistant clones were continued to grow in selective medium containing 100 nM MTX and finally 400 nM MTX.
A clone resistant to X was obtained.

CSF of the culture supernatants of these resistant clones
The activity is shown in Table 7 below.

[0192]

[Table 7]

The CHO cell culture supernatant obtained above was used as it was as a sample of SDS-PAGE, and the molecular weight was examined by SDS-PAGE in the same manner as in (a).

As a result, an M-CSF band was detected at positions corresponding to 90,000 under non-reducing conditions and 44,000 under reducing conditions.

[Brief description of drawings]

FIG. 1 shows a restriction map of λcM5 cDNA.

FIG. 2 (FIG. 2-1 to FIG. 4-4) shows the nucleotide sequence of the above cDNA determined by Maxam-Gilbert chemical modification method and dideoxynucleotide chain termination method using M13 phage. Show.

FIG. 3 (FIG. 2-1 to FIG. 2-4) shows the nucleotide sequences of the above cDNAs determined by the Maxam-Gilbert chemical modification method and the dideoxynucleotide chain termination method using M13 phage. Show.

FIG. 2 (FIGS. 2-1 to 2-4) shows the nucleotide sequences of the above cDNAs determined by the Maxam-Gilbert chemical modification method and the dideoxynucleotide chain termination method using M13 phage. Show.

FIG. 2 (FIGS. 2-1 to 2-4) shows the nucleotide sequences of the above cDNAs determined by the Maxam-Gilbert chemical modification method and the dideoxynucleotide chain termination method using M13 phage. Show.

[Fig. 6] Fig. 3 (Fig. 3-1 to Fig. 3-2) shows the above c.
1 shows the protein primary structure of the M-CSF precursor protein encoded by DNA.

FIG. 7 (FIG. 3-1 to FIG. 3-2) shows the above c
1 shows the protein primary structure of the M-CSF precursor protein encoded by DNA.

FIG. 8 (FIGS. 4-1 to 4-4) shows λcM.
11 shows the nucleotide sequence of 11 cDNAs.

FIG. 4 (FIGS. 4-1 to 4-4) shows λcM.
11 shows the nucleotide sequence of 11 cDNAs.

FIG. 10 is a graph of λc shown in FIGS. 4-1 to 4-4.
The nucleotide sequence of the M11 cDNA is shown.

11] FIG. 4 (FIG. 4-1 to FIG. 4-4) shows λc.
The nucleotide sequence of the M11 cDNA is shown.

FIG. 12 (FIG. 5-1 to FIG. 3) shows λc.
1 shows the protein primary structure of the M-CSF precursor protein encoded by the M11 cDNA.

13 is a graph of FIG. 5 (FIG. 5-1 to FIG. 5-3);
1 shows the protein primary structure of the M-CSF precursor protein encoded by the M11 cDNA.

14] FIG. 5 (FIG. 5-1 to FIG. 5-3) shows λc.
1 shows the protein primary structure of the M-CSF precursor protein encoded by the M11 cDNA.

FIG. 6 is a COS cell expression vector pcDE.
The schematic diagram of the production of is shown.

FIG. 16 shows M-CSF expression plasmid pcD.
The schematic diagram of manufacture of M * CSF is shown.

FIG. 8 shows the M-CSF expression plasmid pcD.
The schematic diagram of manufacture of M * CSF11-185 is shown.

FIG. 18 is a schematic diagram of FIG. 9 (FIG. 9-1 to FIG. 9-3);
CSF expression plasmid ^{pIN-III (lpp p -5)} -
FIG. 6 shows a schematic diagram of the production of OmpA-MCSF11-NV151.

FIG. 19 shows M- in FIG. 9 (FIGS. 9-1 to 9-3).
CSF expression plasmid ^{pIN-III (lpp p -5)} -
FIG. 6 shows a schematic diagram of the production of OmpA-MCSF11-NV151.

FIG. 20 shows M- in FIG. 9 (FIG. 9-1 to FIG. 9-3).
CSF expression plasmid ^{pIN-III (lpp p -5)} -
FIG. 6 shows a schematic diagram of the production of OmpA-MCSF11-NV151.

FIG. 21. M-CSF expression plasmid pI
N-III (lpp ^p -5) -OmpA-MCSF11-
1 shows the amino acid sequence encoded by NV151.

FIG. 22. M-CSF expression plasmid pI.
N-III (lpp ^p -5) -OmpA-MCSF11-
1 shows the amino acid sequence encoded by NV143.

FIG. 23: FIG. 12 (FIG. 12-1 and FIG. 2-2)
Is an M-CSF expression plasmid pcDM.CSF11-
A schematic diagram of the production of dhfr is shown.

FIG. 24: FIG. 12 (FIGS. 12-1 and 12-2)
Is an M-CSF expression plasmid pcDM.CSF11-
A schematic diagram of the production of dhfr is shown.

Continuation of the front page (51) Int.Cl. ⁶ Identification number Reference number within the agency FI Technical indication C12N 5/10 15/09 ZNA C12P 21/02 K 9282-4B (C12N 5/10 C12R 1:91) (C12P 21/02 C12R 1:91) 7729-4B C12N 5/00 B 9281-4B 15/00 ZNA A (C12N 5/00 B C12R 1:91) (72) Inventor Naomi Kono Sako Hachibancho, Tokushima City, Tokushima Prefecture 8-17 Hachibancho River Heights No. 404 (72) Inventor Yoshikatsu Hirai 5-49 Ekogawa Shinkirai, Kitajima-cho, Itano-gun, Tokushima Prefecture

Claims (2)

[Claims] 1. From the sequence of the amino acid sequence represented by the following formula (1), wherein any of 33-Glu to 37-Glu is an N-terminal amino acid and one of 177-Glu to 185-Thr is a C-terminal amino acid. Human M-CSF, which has the activity of acting on bone marrow cells to promote differentiation and proliferation of macrophages. Formula (1): Met-Thr-Ala-Pro-Gly-Ala-Ala-Gly-Arg-Cys-Pro-Pro-Th
r-Thr-Trp-Leu-Gly-Ser-Leu-Leu-Leu-Leu-Val-Cys-Leu-
Leu-Ala-Ser-Arg-Ser-Ile-Thr-Glu-Glu-Val-Ser-Glu-Ty
r-Cys-Ser-His-Met-Ile-Gly-Ser-Gly-His-Leu-Gln-Ser-
Leu-Gln-Arg-Leu-Ile-Asp-Ser-Gln-Met-Glu-Thr-Ser-Cy
s-Gln-Ile-Thr-Phe-Glu-Phe-Val-Asp-Gln-Glu-Gln-Leu-
Lys-Asp-Pro-Val-Cys-Tyr-Leu-Lys-Lys-Ala-Phe-Leu-Le
u-Val-Gln-X -Ile-Met-Glu-Asp-Thr-Met-Arg-Phe-Arg-A
sp-Asn-Thr-Pro-Asn-Ala-Ile-Ala-Ile-Val-Gln-Leu-Gln
-Glu-Leu-Ser-Leu-Arg-Leu-Lys-Ser-Cys-Phe-Thr-Lys-A
sp-Tyr-Glu-Glu-His-Asp-Lys-Ala-Cys-Val-Arg-Thr-Phe
-Tyr-Glu-Thr-Pro-Leu-Gln-Leu-Leu-Glu-Lys-Val-Lys-A
sn-Val-Phe-Asn-Glu-Thr-Lys-Asn-Leu-Leu-Asp-Lys-Asp
-Trp-Asn-Ile-Phe-Ser-Lys-Asn-Cys-Asn-Asn-Ser-Phe-A
la-Glu-Cys-Ser-Ser-Gln-Asp-Val-Val-Thr-Lys-Pro-Asp
-Cys-Asn-Cys-Leu-Tyr-Pro-Lys-Ala-Ile-Pro-Ser-Ser-A
sp-Pro-Ala-Ser-Val-Ser-Pro-His-Gln-Pro-Leu-Ala-Pro
-Ser-Met-Ala-Pro-Val-Ala-Gly-Leu-Thr-Trp-Glu-Asp-S
er-Glu-Gly-Thr-Glu-Gly-Ser-Ser-Leu-Leu-Pro-Gly-Glu
-Gln-Pro-Leu-His-Thr-Val-Asp-Pro-Gly-Ser-Ala-Lys-G
ln-Arg-Pro-Pro-Arg-Ser-Thr-Cys-Gln-Ser-Phe-Glu-Pro
-Pro-Glu-Thr-Pro-Val-Val-Lys-Asp-Ser-Thr-Ile-Gly-G
ly-Ser-Pro-Gln-Pro-Arg-Pro-Ser-Val-Gly-Ala-Phe-Asn
-Pro-Gly-Met-Glu-Asp-Ile-Leu-Asp-Ser-Ala-Met-Gly-T
hr-Asn-Trp-Val-Pro-Glu-Glu-Ala-Ser-Gly-Glu-Ala-Ser
-Glu-Ile-Pro-Val-Pro-Gln-Gly-Thr-Glu-Leu-Ser-Pro-S
er-Arg-Pro-Gly-Gly-Gly-Ser-Met-Gln-Thr-Glu-Pro-Ala
-Arg-Pro-Ser-Asn-Phe-Leu-Ser-Ala-Ser-Ser-Pro-Leu-P
ro-Ala-Ser-Ala-Lys-Gly-Gln-Gln-Pro-Ala-Asp-Val-Thr
-Gly-Thr-Ala-Leu-Pro-Arg-Val-Gly-Pro-Val-Arg-Pro-T
hr-Gly-Gln-Asp-Trp-Asn-His-Thr-Pro-Gln-Lys-Thr-Asp
-His-Pro-ser-Ala-Leu-Leu-Arg-Asp-Pro-Pro-Glu-Pro-G
ly-Ser-Pro-Arg-Ile-Ser-Ser-Pro-Arg-Pro-Gln-Gly-Leu
-Ser-Asn-Pro-Ser-Thr-Leu-Ser-Ala-Gln-Pro-Gln-Leu-S
er-Arg-Ser-His-Ser-Ser-Gly-Ser-Val-Leu-Pro-Leu-Gly
-Glu-Leu-Glu-Gly-Arg-Arg-Ser-Thr-Arg-Asp-Arg-Arg-S
er-Pro-Ala-Glu-Pro-Glu-Gly-Gly-Pro-Ala-Ser-Glu-Gly
-Ala-Ala-Arg-Pro-Leu-Pro-Arg-Phe-Asn-Ser-Val-Pro-L
eu-Thr-Asp-Thr-Gly-His-Glu-Arg-Gln-Ser-Glu-Gly-Ser
-Ser-Ser-Pro-Gln-Leu-Gln-Glu-Ser-Val-Phe-His-Leu-L
eu-Val-Pro-Ser-Val-Ile-Leu-Val-Leu-Leu-Ala-Val-Gly
-Gly-Leu-Leu-Phe-Tyr-Arg-Trp-Arg-Arg-Arg-Ser-His-G
ln-Glu-Pro-Gln-Arg-Ala-Asp-Ser-Pro-Leu-Glu-Gln-Pro
-Glu-Gly-Ser-Pro-Leu-Thr-Gln-Asp-Asp-Arg-Gln-Val-G
lu-Leu-Pro-Val [In the formula, X represents Tyr or Asp. ] 2. The human M-CSF according to claim 1, wherein Thr at position 185 is the C-terminal amino acid.