JPH022391A - Human m-csf and production thereof - Google Patents

Abstract

PURPOSE:To enable the production of a type-M colony stimulation factor specific to macrophage-formation and useful as a preventive and remedy for diseases accompanying leukopenia and as an assistant agent for bone marrow transplantation by carrying out the recombination with a gene coding a specific amino acid sequence. CONSTITUTION:A type-M colony stimulation factor(M-CSF) is produced by culturing a transformant containing an M-CSF coding the amino acid sequence of formula or a sequence depleted with a part of the amino acid sequence and containing an expression plasmid capable of expressing human M-CSF having biological activity. The expression of the human M-CSF is preferably carried out by 2.cistron process.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of Industrial Application The present invention relates to human colony-stimulating factor (
Co! ony-8 stimulating factor
SCSF), particularly recombinant human M-CSF and its production method.

Conventional technology In general, specific proliferation and differentiation factors are required for the proliferation and differentiation of hematopoietic cells, and ultimately various types of mature blood cells, such as red blood cells, granulocytes, macrophages, eosinophils, platelets, and lymphocytes, are required for the proliferation and differentiation of hematopoietic cells. Before it becomes a sphere etc., there are many differentiations,
Growth factors are involved [Kyosada Miura, Blood Stem Cells, Chugai Igakusha, 1983]. Among these, CSF is known to stimulate the proliferation and differentiation of granulocytic progenitor cells and macrophage progenitor cells, and such CSF includes:
G type (G-CSF), which is specific for the formation of granulocytes, M type (M-CSF), which is specific for the formation of macrophages, and GM type (GM-CSF), which promotes the formation of both granulocytes and macrophages. It has been known. Furthermore, as a CSF that acts on pluripotent stem cells, multi-CSF (Multi-CSF)
-CSF:IL-3) is also known.

Based on its biological activity, the above-mentioned CSF is thought to alleviate the decrease in white blood cells, which is a common drawback during cancer chemotherapy and radiation therapy, and clinical research is being conducted from this point of view.

In addition, it is known that bipedal CSF acts to promote the function of leukocytes [Robets et al.
A, P, et al.), J, 1mmuno1. , 1
31°2983 (1983), Handam et al.
am, E, ctal, ), 122.1134 (1
979) and Vadas, M.A. et al.
At, ), 130, 795 (1983)) From this, its effectiveness as a prophylactic and therapeutic agent for various infectious diseases has been confirmed.

Furthermore, CSF has its differentiation-inducing effect [Metcuff et al.
ctcalf, D,et at,, Int,J,C
ancedr, 30°773 (1982)'), its efficacy as a therapeutic agent for myeloid leukemia has been recognized.

However, the activity of CSF has been found in, for example, culture fluids of fetal cells, larvae cells, human urine, culture fluids of various cultured cell lines, etc., and it has been isolated and used as an active fraction. However, the production of CSF remains problematic due to the presence of a large amount of similar contaminants originating from the same source and the low concentration of CSF itself, resulting in problems in terms of homogeneity, yield, handling, etc. Therefore, a means to continuously obtain CSF as a medicine has not yet been found.

The present inventors previously established rAG R-ONJ, a cultured cell line derived from human leukemia T cells, which can constantly produce large amounts of CSF in a homogeneous state, and developed the invention related to this cell. A patent application was filed (Japanese Unexamined Patent Publication No. 169489/1989). Furthermore, as a result of further purification of the CSF produced by bipedal AGR-ON, the present inventors found that the CSF
Developed a method for obtaining F in pure form easily and in high yield, elucidated the structural and biochemical characteristics of the CSF obtained in this way, and completed an invention related to CSF as such a substance, Patent application filed (Japanese Unexamined Patent Publication No. 62-1697)
No. 99).

The CSF related to the above-mentioned optical invention is M-CSF.

That is, it is a glycoprotein that has the activity of acting on normal bone marrow cells to promote the differentiation and proliferation of macrophages, and is characterized by having the following physical and chemical properties, and was called rAGR-ON-CSFJ.

a) Molecular weight: 33,000-43,000 Daltons by SDS polyacrylamide gel electrophoresis under non-reducing conditions; 2,300 Daltons by gel filtration under non-edge conditions and in the presence of SDS.
b) N-terminal amino acid sequence of protein portion: It has a sequence represented by the following primary structural formula.

Val-Ser-Glu-Tyr-Cys-Ser-H
ls-Met-l 1e-Gly-8cr-Gly-1
1is-Leu-Gln-Ser-Leu-Gln-A
rg-Leu-11e-Asp-Ser-G I n-
Problems to be Solved by the Met-G l u-Thr Invention The main objects of the present invention are a technology for producing biologically active human M-CSF using genetic engineering techniques, and a method for producing biologically active human M-CSF by using this technology. Novel human M that is particularly useful as a medicine
- To provide CSF.

Means for Solving the Problems According to the present invention, a recombinant human M produced using a gene encoding a biologically active human open-CSF molecule based on the amino acid sequence information of the following formula (1) -C5F is provided.

Pro-Pro-Thr-Thr-Trp-Lcu-
Gly-Ser-Leu-Leu-Lcu-Leu
-Va 1-Cys-Leu-Leu-AI a-S
er-Arg-Ser-11e-Thr-Glu-Gl
u-Val-Ser-Glu-Tyr-Cys-Ser
-Hls-Met-l 1e-Gly-Ser-GIy
-1fis-Leu-GI n-Ser-Ln-Ser
-Leu-Gin-Ar 1e-Asp-Ser-Gl
n-Met-5ru-Thr-8cr-Cys-Gln
-11e-Thr-Phe-Glu-Phe-Val-
Tyr-Leu-Lys-Lys-Ala-Phe-L
eu-Leu-Val-C1n-Asp-Asn-Th
r-Pro-Asn-Ala-11cmAla-11e
-Val-Ser-Cys-Phe-Thr-Lys-
Asp-Tyr-Glu-Glu-Hls-yS-L
eU-1yr-Pro-LyS-8Ia-118-t'
rO-Ser-'Ser-Lcu-Val-Pro
-Ser-Va I-11e-Leu-Va I-Lc
u-Leu-A l a-Va l-G ly-G
ly-Leu-Leu-Phe-Tyr-Arg-Tr
p-Arg-Arg-Arg-Ser-Hls-Gln
-Glu-Pro-Gln-Arg-Alia-As
p-Ser-Pro-Leu-G l u-G I
n-Pro-G l u-G I y-Scr-Pro
-Lcu-Thr-Gln-Asp-Asp-Arg-
Gln-Val- [wherein X represents Tyr or Asp.

] In this specification, peptides and amino acids are indicated as
The abbreviations in the amino acid nomenclature adopted by I UPAC and those commonly used in the field shall be followed, and the same shall apply to the representation of DNA base sequences and nucleic acids.

As described above, human M-CSF of the present invention can be used as a prophylactic and therapeutic agent for diseases or pathological conditions accompanied by leukopenia, for example, as an adjuvant for bone marrow transplantation, as a prophylactic and therapeutic agent for various infectious diseases, based on its biological activity. Furthermore, it is useful in the medical field as an anticancer agent and the like.

In particular, the human M-CSF of the present invention is a recombinant M-CSF produced by genetic engineering techniques, and is particularly useful in the above fields due to its homogeneity.

The human l-M-CSF of the present invention utilizes the gene encoding it (hereinafter abbreviated as "the gene of the present invention") to create a recombinant λDNA in which the gene is expressed in a host cell, It is produced by introducing this into a host cell, transforming it, and culturing the transformed strain.

Hereinafter, the gene of the present invention used for producing the human M-CSF of the present invention will be described in detail.

The gene of the present invention is prepared, for example, from human cells capable of producing M-CSF, more specifically and preferably from mRNA isolated from the AGR-ON. The details of this preparation will be explained below using AGR-ON, but the same applies to other cells.

AGR-ON used as the source cell was disclosed in Japanese Patent Application Laid-open No. 1983
This is a human cultured cell line derived from human leukemia T cells having the characteristics described in Publication No.
It has been deposited with rATCC Accession No. CRL-8199J.

The separation of mRNA from AGR-ON is basically carried out according to a conventional extraction procedure. More specifically, the above AGR-ON is first cultured in, for example, CEM medium, CMRL-1
066 medium, DM-160 medium, Eagle's minimum essential medium (Eagle "SMEM"), Fisher's medium (
F1sher's Medium), F-10 medium, F-12 medium, L-15 medium, NCTC-109 medium, RPMI-1640 medium, etc., or serum such as fetal calf serum (FCS), albumin, etc. as necessary. With the above medium supplemented with serum components, approximately I X 10' to I X 107
About 30 to 40 degrees Celsius, preferably about 37 degrees Celsius, according to a normal culture method such as carbon dioxide gas culture method, within a concentration range of
Culture takes 1 to 5 days before and after C.

Next, at the time when AGR-ON-CSF is produced and accumulated in the culture supernatant, the cultured cells are treated with a suitable surfactant such as SDS, NP-40, Triton X100, deoxycholic acid, etc., or with a homogenizer. After the chromosomal DNA is partially or completely destroyed and solubilized by a physical method such as freezing and thawing, the chromosomal DNA is
)OLYTRON.

The mixture is sheared to some extent using a mixer such as Kinematica 5wltzerland) or a syringe, and then the protein and nucleic acid fractions are separated and total RNA is extracted. For this extraction operation, the guanidinium/cesium chloride method [Guanidinium/Cesium chloride method] is used.
m Chloridemethod, T, Mania
tis, E., F., Pr1tsch and J.

Sambrook, Mo1ecular Cloni
ng, p 194-196 (Cold Spring
1larbor Laboratory), 19
82) or the C5CQ overlay method using ultracentrifugation [Chirgwln et al.
Biochemistry,
18. 5294 (1979)) etc. are generally used.

In addition, in each of the above methods, RNA
In order to prevent the decomposition of RN aSf3, an inhibitor such as heparin, polyvinyl sulfate, diethylpyrocarbonate, vanadium complex, etc. can be added.

Separation and purification of mRNA from RNA obtained according to the above extraction procedure can be carried out using, for example, oligo dT-cellulose [Collaborative Research, Inc.
This can be carried out by an adsorption column method or a batch method using Research Inc., Polyvi-Sepharose (Pharmacia Co., Ltd.), or the like.

In addition, purification, concentration, and identification of mRNA for M-CSF of interest can be carried out, for example, by fractionating the obtained mRNA by sucrose density gradient centrifugation, etc., and using the protein translation system, such as African frog egg, for the fraction. This can be carried out by injecting into mother cells or translating into a protein in a cell-free system such as rabbit reticulocyte lysate or wheat germ, and examining the M-CSF activity of the protein. In this way, the presence of the target mRNA can be confirmed. Furthermore, to confirm the target mRNA, instead of measuring the M-CSF activity described above, M-CSF
It can also be carried out by an immunization method using antibodies against.

Since the purified mRNA obtained above is usually unstable, it is converted into stable cDNA and connected to a replicon derived from a microorganism to enable amplification of the target gene. The in vitro conversion of mRNA into cDNA, that is, the synthesis of the target gene of the present invention, can be carried out using a conventional method, such as the Okayama Berg method (H, Okayama Berg method).
nd P, Berg, Mo1ecularand C.
e1lural Biology, vol.B,
p 280 (, 1983)) and the Doubler-Hoffman method [V
, Gublerand B, J., IIoffman,
Gene, vol, 25. p 263-269
(1983') E et al. For more details,
First, oligo dT is used as a primer, and this primer may be a vector primer with poly dT added)
, dNTP (dATP, dG
Complementary single-stranded cDNA is extracted from mRNA using reverse transcriptase in the presence of TPS (dCTP or dTTP).
Synthesize A. The next step is to use the oligo d
Depending on whether T or vector primers were used,
They differ as follows.

In the former case, mRNA used as a template is decomposed and removed by alkaline treatment or the like, and then double-stranded DNA is created using reverse transcriptase or DNA polymerase using double-stranded DNA as a template. Next, both ends of the double-stranded DNA obtained are treated with exonuclease, and an appropriate linker DNA or a plurality of bases in an annealing-enabled combination are added to each of them, and this is transferred to an appropriate vector, such as an EK-based plasmid vector or Incorporate into a λgt-based phage vector, etc.

In the latter case, an open circular plasmid with multiple annealing-capable combinations of bases added to it while leaving the mRNA as a template, and a linker DNA, often with a region that can autonomously replicate in animal cells, are used. A DNA fragment containing the transcription promoter region of mRNA is used).
After annealing to form a closed circle, RNAscH and DNA polymerase ■ are allowed to coexist in the presence of dTNP to replace the mRNA with a DNA strand, creating a complete plasmid DNA.
A can be created.

The DNA obtained as described above is transferred to a vector host, such as Escherichia coli.
a colt), Bacillus subtilis
lus 5ubtilis), Saccharomyces cerevisiae (Saccharomyces cere)
visiae) and transform the host. As a method for introducing this DNA into a host and for transformation using the same, there are commonly used methods, such as collecting cells mainly in the logarithmic growth phase, treating them with CaCQ2 to make them easy to naturally take up DNA, and using the plasmid. It is possible to adopt methods such as incorporating In the above method, in order to further improve the efficiency of transformation, as is generally known, MgCQ2 and Rb
CQ can also coexist. It is also possible to adopt a method in which host cells are transformed into spheroplasts or protoplasts and then transformed.

From the transformed strain obtained above, the desired M-CS
In order to select a strain having the F cDNA, the following weighing methods can be used, for example.

(1) Screening method using synthetic oligonucleotide probes All or part of the amino acid sequence of the target protein has been elucidated (if the sequence is a specific sequence consisting of multiple contiguous sequences,
(It may be from any region of the target protein), an oligonucleotide corresponding to the amino acid is synthesized. In this case, it may be either a base sequence derived using codon usage frequency or a plurality of possible combinations of base sequences, In the latter case, the number of types can be reduced by including inosine), and this is used as a probe (labeled with 32P or 35S) to hybridize with a nitrocellulose filter on which the DNA of the transformed strain has been denatured and fixed. Search for positive stocks that have been identified and select them.

(2) Method for producing and screening M-CSF in animal cells Cultivate a transformed strain, amplify the gene, and transfect the gene into animal cells (in this case, the gene can be self-replicated and the mRNA transcription promoter (A plasmid containing the region or a plasmid that infects animal cell chromosomes may be used.) to produce the protein encoded by the gene, and to produce the culture supernatant or cell extract.
- Select a strain having a cDNA encoding the desired M-CSF from the original transformed strain by measuring CSF activity or detecting M-CSF using an antibody against M-CSF.

(3) Method of selection using an antibody against M-CSF In advance, cDNA is integrated into a vector that can express the protein in the transformed strain, the protein is produced in the transformed strain,
-Using an antibody against CSF and a second antibody against the antibody, detect the ~1-CSF producing strain to obtain the target strain.

(4) Method using selective hybridization/translation system The cDNA obtained from the transformed strain is plotted on a nitrocellulose filter, etc., and m
After hybridization of RNA, cDNA
Collect mRNA corresponding to A. Recovered mRNA
is translated into protein using a protein translation system, such as injection into African frog oocytes or a cell-free system such as rabbit reticulocyte lysate or wheat germ, and the protein is converted into M-CSF.
The desired strain is obtained by testing for activity or by detection using an antibody against M-CSF.

DNA encoding M-CSF can be collected from the obtained transformed strain of interest according to known methods. For example, this can be carried out by separating a fraction corresponding to plasmid DNA from cells and excising the cDNA region from the plasmid DNA.

The DNA thus obtained is a specific example of the gene of the present invention, and has the 372 amino acid sequence shown in FIG.
It encodes the human M-CSF precursor identified by the 554 amino acid sequence shown in the figure.

Therefore, in order for a substance obtained by genetic engineering using the gene of the present invention to express the biological activity of human M-CSF, the gene does not necessarily have to contain the above-mentioned DNA, that is, the amino acid of the human M-CSF precursor. It is not necessary that the DNA sequence encodes the entire sequence; for example, a partial sequence thereof, as long as it enables expression of the biological activity of human M-CSF, those DNAs can also be used in the gene of the present invention. Included.

h) Expression of the biological activity of M-CSF does not necessarily require the expression (1)
) The fact that the entire amino acid sequence shown in
ro) as the C-terminal amino acid, or the AG
R-ON-CSF has its 35th amino acid (Val
) as the N-terminal amino acid, AGR-ON-
3 as a by-product (minor component) during CSF production.
This is clear from the fact that biologically active M-CSF having the third amino acid (Glu) or the 37th amino acid (Glu) as the N-terminal amino acid can be obtained. Furthermore, based on the knowledge of primary structural similarities between other hemopoietins, it is thought that M-CSF with the same 27th amino acid (Ala) as the N-terminal amino acid also exists in nature [J, W, 5
chradcr, et at, Proc.

Natl, Acad, Sc1. ,U,S,A,, ,Vol.
, 83, p. 2458-2462 (1986)
).

Furthermore, as shown in the Examples described later, the 164th amino acid (T rp
It has also been confirmed that the C-terminal amino acid sequence following ) is not necessarily necessary for the expression of biological activity of human) M-CSF.

Therefore, the gene of the present invention is characterized by having a novel NA sequence encoding a biologically active M-CSF molecule based on the amino acid sequence information shown in formula (1). More specifically, in addition to DNA encoding the entire amino acid sequence shown in formula (1), a part of the N-terminal amino acid sequence, such as amino acid numbers 1 to 26.1, is included.
~32. Any of the sequences 1 to 34 and 1 to 36, and/or a part of the C-terminal amino acid sequence thereof, for example, each amino acid sequence that lacks all or part of the sequence after amino acid number 164 Included are each DNA that encodes and NA that is substantially equivalent to the same.

Such a gene of the present invention can be produced by, for example, the phosphite triester method CNature based on the above information.

310.105 (1984)), etc., by chemical synthesis of nucleic acids, and polypeptides consisting of the amino acid sequence of 372 shown in FIG. 3 or 554 shown in FIG. It can also be produced using a DNA encoding as a raw material according to a conventional method, and the latter method is particularly convenient and suitable.

In this method using DNA encoding a polypeptide consisting of 372 or 554 amino acid sequences as a raw material,
Various operations and means such as chemical synthesis of a portion of DNA, enzymatic treatment for the purpose of cutting, deleting, adding, or joining DNA strands, isolation, purification, reproduction, and selection of DNA can all be carried out in accordance with conventional methods. Genes other than the genes of the present invention or D
Any of the various methods well known in the art for NA chains can be employed. For example, the above-mentioned DNA isolation and purification can be carried out by agarose gel electrophoresis, etc., and modification of a part of the codon of the nucleic acid sequence can be carried out by site-specific mutadiensis (Site-8peci).
fic Mutagcncsis) [Proc.

Natl, Acad, Sci, 81. 5662-
5666 (1984) 3 etc. still,"
The selection of the genetic code corresponding to the desired amino acid in the bipod is not particularly limited, and can be determined according to a conventional method, taking into consideration the codon usage frequency of the host cell to be used.

Furthermore, the determination and confirmation of the DNA sequence of the gene of the present invention obtained according to the above method can be carried out using, for example, Maxam Gilbert (Ma
xam-Gilbert) chemical modification method (Meth.

Enzym, 65.499-560 (1980)
] and dideoxynucleotide chain termination method using M13 phage (Messing, J. and Vieira
, J., Gcnc, 19°269-276 (198
2) ] etc.

By utilizing the thus obtained gene of the present invention, human M-CSF can be easily produced and obtained in large quantities by genetic recombination technology.

This method for producing human M-CSF requires the use of the above-mentioned specific gene (DNA) of the present invention, and can basically follow genetic recombination technology [5cienc
e, 224.1431 (1984); Biochem
, B4ophys, Res, Comm, y 1
30. 692 (1985); Proc, Nat.
l, Acad, Sci,, USA.

80.5990 (1983), EP Patent Publication No. 187
No. 991, Molecular Cloning.

T, Maniatis at a! ,,Co1d
Spring 1larborLaborator
(1982) etc.].

More specifically, a recombinant DNA that allows the gene of the present invention to be expressed in a host cell may be prepared, the recombinant DNA may be introduced into the host cell for transformation, and the transformed strain may be cultured.

As the host cell, both eukaryotes and prokaryotes can be used. The eukaryotic cells include cells of vertebrates, yeast, etc., and examples of quasi-animal cells include COS cells (Y, GIuzm), which are monkey cells.
an, Ce1l, 23. 175182 (1981
)) and a dihydrofolate reductase-deficient strain of Chinese hamster ovary cells [G, Urlaub and L
, A., Chasin, Proc., Natl., Acad.

Set,, U, S, A,, 77, 4216-4
220 (1980): 1 etc. is often used, but it is not limited thereto. As expression vectors for vertebrate cells, vectors containing a promoter, an RNA splice site, a polyadenylation site, a transcription termination sequence, etc., which are normally located upstream of the gene to be expressed, can be used. It may also hold a starting point. An example of the expression vector is pSV2dhfr (S,S
abramani, R. Mul Iiganand.
P, Bcrg, Mo1. Ce11. Biol,, 1
, 854864 (1981)), but is not limited thereto.

Furthermore, yeasts are commonly used as eukaryotic microorganisms, and among them, yeasts of the genus Satucharomyces can be used effectively. Examples of expression vectors for eukaryotic microorganisms such as yeast include pAM82 (A, Miyan
ohara et al., Proc., Natl.

Acad, Sci,, U, S, A,, 80. 1-5
(1983)) etc. can be preferably used.

Escherichia coli and Bacillus subtilis are commonly used as prokaryotic hosts. In the present invention, for example, a plasmid vector that can be replicated in the host bacteria is used, and in order to express the gene of the present invention in this vector, a promoter and an SD (Shine and Dalchino) base sequence are added to the first stream of the gene, and Initiation codons necessary for protein synthesis initiation (e.g. A
TG) can be used. ” -Escherichia coli as a host bacterium is Eschrichia colt K
12 strains etc. are often used, and the vector is generally p.
Although BR322 is often used, the present invention is not limited thereto, and any of various known strains and vectors can be used.

Examples of promoters include tryptophan (trp
)・promoter, Ipp promoter, Iac promoter, PL promoter, etc. can be used, and the gene of the present invention can be expressed in any case.

One preferred method for producing human M-CSF using the gene of the present invention is to use COS as a host cell.
Examples include methods using cells.

In this method, the expression vector contains the SV40 replication origin, is capable of autonomous proliferation in COS cells, and is capable of transcription promoter, transcription termination signal and R
A plasmid having an NA splice site, etc., such as plasmid pcDE shown in Examples below, can be used. In this case, the desired expression plasmid can be obtained by ligating the gene of the present invention to the restriction enzyme EcoRI site located downstream of the SV40 early gene promoter. Various commonly used methods can be used to introduce the thus obtained desired recombinant DNA into a host cell and transform it. DEAE-dextran method and calcium phosphate method
It can be incorporated into COS cells by DNA co-precipitation, and thus desired transformed cells can be easily obtained.

Another preferred method for producing human M-CSF using the gene of the present invention is a method using Chinese hamster ovary cells lacking dihydrofolate reductase [CHO-Dukdhfr] as host cells.

Another preferred method for producing M-CSF using the gene of the present invention is to use a prokaryotic organism such as Escherichia coli as a host cell, and use a signal peptide to transport the desired M-CSF outside the cytoplasmic membrane. The following is an example of a method for secreting and expressing the protein. The signal peptides used here include various known ones, such as Lpp, OmpA, On+
pP, circle] Outer membrane proteins such as oE, PhoA, Bla
, any of the periplasmic proteins such as PstS (
, particularly OmpA.

Furthermore, another preferred method for producing M-CSF using the gene of the present invention is to use a prokaryotic organism such as Escherichia coli as a host cell, and to produce M-CSF by the 2-cistron method.
A method for expressing SF can be exemplified. This method is a gene expression system consisting of two consecutive cistrons, which allows the target M-CSF to be stably produced and accumulated in host cells in large quantities.

To explain in detail the production of M-CSF of the present invention according to the method, first cistron
n) and a gene encoding a suitable polypeptide as a second cistron (second cistron).
) to create an expression plasmid containing two cistrons and the gene of the present invention. The plasmid also has a promoter and an sD sequence arranged upstream of the first cistron for the expression of the gene, and an SD sequence for the expression of the second cistron downstream thereof and upstream of the second cistron. It is important that a synthetic linker is placed that includes the 't% stop codon of the first cistron and the start codon of the second cistron, in this order.

As long as the gene as the first cistron mentioned above can be expressed by the host,
It may be a synthetic gene or one derived from a natural product, but considering that its expression produces a polypeptide different from the M-CSF of the present invention within the same system, and it is necessary to continuously separate the polypeptide, The polypeptide is hydrophobic and preferably has a molecular weight that is sufficiently different from the M-CSF of the present invention. Preferably, the first cistron encodes such a polypeptide. Specific examples include r L-2, IFN-
Preferably, genes encoding α, -β, -γ, etc. and fragments thereof encode about 50 to 100 amino acid residues.

As the promoter and the SD sequence placed upstream of the first cistron, various conventionally known promoters can be used, and examples of the promoter include the trp promoter, tac promoter, P promoter, and P promoter.
R promoter, lpp promoter, OmpA promoter, Iac promoter, etc., particularly preferably trp
Promoter Pt.

Promoter PR promoter etc. can be exemplified.

In addition, the SD sequence is the 3′ of 168 rRNA of prokaryotic cells.
Examples of sequences of 3 to 9 base pairs that can form a hydrogen bond with the terminal end include AG, AGGA, etc. for G.

Furthermore, the initiation codon and termination codon in the synthetic linker interposed between the first cistron and the second cistron may be any of those that exist in nature.

Each of these does not have to be used in its complete form, such as TGA and ATG, but can also be used in a partially overlapping form, such as TGATG, 5TAATG, etc.

Construction of the expression plasmid used in the bipedal 2-cistron method can be carried out according to conventional methods [Y.

5aito et at, J, Biochem,,
101. 1281-1288 (1987);
B, S, 5choner Ot al.

Proc, Natl, Aead, Sci, USA, 8
3, 8506-8510 (1986), etc.].

According to one particularly preferred method, first, the M-C of the present invention
The plasmid containing the SF gene is cut with an appropriate restriction enzyme, and the fragment containing the M-CSF gene is isolated and purified according to a conventional method, while the synthetic linker described above is synthesized according to a conventional method using, for example, a DNA synthesizer. Then, the linker was added to the upstream side of the M-CSF gene of the fragment obtained above.
The resulting DNA is ligated using NA ligase etc.
An example of a method for integrating the A fragment into a predetermined position of a plasmid containing the first cistron and capable of expressing it can be exemplified. Alternatively, the first cistron can be linked in advance to the DNA fragment obtained by the above method, in which the second cistron and the synthetic linker are linked, and then this DNA fragment can be incorporated into a plasmid having an appropriate protein expression system. Expression plasmids suitable for the desired bicistronic method can be obtained.

By introducing the plasmid obtained above into an appropriate host cell and transforming it, a desired transformant can be obtained by the 2-cistron method, and by using the transformant, it is possible to obtain a transformant related to the first cistron. The protein and the desired M-CSF associated with the second cistron can be expressed separately, using conventional methods such as SDS-
Analysis by PAGE, Western blotting, etc.
They can be confirmed, and separated and purified by various methods described below.

The desired transformant thus obtained can be cultured according to a conventional method, and the culture produces biologically active human M-CSF.
Accumulated. As the culture medium used for the culture, various commonly used media can be appropriately selected depending on the host cell employed. For example, for culturing transformants using Escherichia coli etc. as host cells, for example, LB medium, E medium, M9 medium,
M63 medium etc. can be used, and if necessary, various commonly known carbon sources, nitrogen sources, inorganic salts, vitamins, natural product extracts, physiologically active substances, etc. can be added to the secondary medium. can. Transformants using COS cells as hosts can be prepared using RPMI-1640 medium, Dulbecco's modified Eagle's minimum essential medium (Dulbccco's modified Eagle's minimum essential medium).
Culture can be carried out using a medium such as Ed Eagle's HEM) to which serum components such as fetal bovine serum (FCS') are added as necessary.

As the culture conditions for the transformant mentioned above, conditions suitable for the growth of the host cell can be adopted.
°C1 Preferably, 37 °C or around 37 °C can be adopted.

1, the desired M-CSF of the present invention is produced, accumulated, or secreted into or outside the cells of the transformant. The M-CSF has been subjected to various separation operations using its physical properties, chemical properties, etc.
Pages 5-1259, 1st edition, 1st printing, June 23, 1980, published by Tokyo Kagaku Dojin Co., Ltd.; Biochemist
ry, vol, 25. No.

25.8274-8277 (1986); Eur, J.
, 13iochem, , 163, 313-321 (1
987) etc.). Specifically, the method includes, for example, ordinary reconstitution treatment, treatment with a protein precipitant, centrifugation, osmotic shock method, ultrasonic disruption, ultrafiltration, molecular sieve chromatography (gel filtration).
Examples include various liquid chromatography dialysis methods such as , adsorption chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography (HPLC), and combinations thereof.

In a particularly preferred separation method, the target substance is first partially purified from the culture supernatant. This partial purification is
For example, this may be carried out by a treatment using a salting-out agent such as ammonium sulfate or sodium sulfate, and/or an ultrafiltration treatment using a dialysis membrane, flat plate membrane, hollow fiber membrane, or the like. The operations and conditions for each of these treatments may be the same as those for ordinary methods of this type.

Next, the crude product obtained above is subjected to adsorption chromatography, affinity chromatography, Kel filtration, ion exchange chromatography, reversed phase chromatography, etc., or by a combination of these operations, the target substance is isolated. Both components in which activity is observed are obtained, and thus the target substance can be isolated as a homogeneous substance.

The above adsorption chromatography can be carried out using, for example, phenyl-Sepharose, octyl-Sepharose, or the like as a carrier.

Affinity chromatography can also be carried out, depending on the case, by chromatography using a carrier such as ConA-Sepharose or Lentil Lectin-Sepharose (manufactured by Pharmacia).

Gel filtration can be carried out using, for example, dextran gel, polyacrylamide gel, agarose gel, polyacrylamide-agarose gel, cellulose, or the like as a material. Specific examples of the Kell filtration agents mentioned above include Sephadex G type, Sepharose type, Sephacryl type (
(manufactured by Pharmacia), Cellulofine (manufactured by Chisso), Biokel P type, Biokel A type (manufactured by BioRad), Ultrogel AcA (manufactured by LKB), TSK-
Examples include commercially available products such as G type (manufactured by Toso Corporation).

Ion exchange chromatography can be performed, for example, by chromatography using an anion exchanger having diethylaminoethyl (DEAE) or the like as an exchange group.

Reversed phase chromatography can be carried out using a carrier in which a functional group such as an alkyl group such as C, C3,04, a cyanopropyl group, or a phenyl group is bonded to a substrate such as silica gel. More specifically, for example, C4 high bore - reverse phase HP
Using an LC column (RP304, manufactured by Bio-Rad),
Acetonitrile, trifluoroacetic acid (T
It can be carried out using a mixed solvent of F A), water, etc., and the like.

By the above method, desired MCSF can be easily produced in high yield and high purity on an industrial scale.

The thus-obtained M-CSF of the present invention has different N-terminal amino acid sequences, molecular weights, etc. depending on the gene used for its production and the type of expression system for expressing the gene.
Although their isoelectric points are slightly different, they all have CSF activity in common. Particularly preferred among these M-CSFs are those obtained in the Examples described below.

When using the above-obtained M-CSF as a medicine, it is prepared in the form of a pharmaceutical composition containing an effective amount thereof together with a normal pharmacologically acceptable non-toxic carrier. Administered by route of administration. Liquid forms such as solutions, suspensions, emulsions, etc. are generally adopted as the formulation form, and these are generally administered orally, intravenously, subcutaneously, intradermally, or intramuscularly, but in particular, these forms are used. And without being limited to the route of administration, the M-CSF can be administered by other commonly used oral,
It can be prepared into various formulations suitable for parenteral administration, or it can be made into a dry product that can be made into a liquid by adding an appropriate carrier before use. The dosage of various forms of preparations is determined as appropriate depending on the desired pharmacological effect, type of disease, patient's age, sex, degree of disease, etc., and is not particularly limited. Approximately 0 protein content
．． It may be administered in an amount of 0.001 to 1 mg/kg/mouth in 1 to 10 divided doses.

Examples Below, production of the gene of the present invention and M-CS by its use
The production of F, its characteristics, etc. will be further explained in detail by citing examples.

The CSF activity of the samples obtained in the six cases shall be measured by the following method.

<Method for measuring CSF activity> A solution obtained by mixing 20 mQ of fetal bovine serum (Fe2), 30 mQ of α-medium, and 20 mQ of α-medium made of 2 foils at 37°C.
23.3 mQ of the mixture was mixed with 10 mQ of 1% agar (manufactured by Difco) solution previously kept at 50°C.
Keep warm at 7℃.

On the other hand, myelinated cells (BMC) collected from the femur of BAL B/C mouse mice were washed twice with Hank's solution and adjusted to a cell concentration of 107 cells/peng in α-medium. Peng was added to the above-mentioned agar medium kept at 37°C, mixed well, kept at 37°C, and then incubated at 0.5°C.
5 mQ was placed in a well (in which 50 μQ of test sample was previously placed).
Tissue Culture Cluster 12, manufactured by Costa Co.)
Mix quickly and leave at room temperature. Wait for the agar in each well to solidify, then transfer to a carbon dioxide incubator and further culture at 37°C for 7 days.

The number of colonies thus generated is counted using a stereomicroscope and is used as an index of CSF activity. Also, the unit of CSF activity (U
/rrvQ) was calculated using the following formula (a) from the number of colonies described in 1.

CSF activity unit (U/+1112) = (number of colonies)
×(dilution ratio) ÷1. 5 (a) As a result of morphological and enzymatic chemical observation, almost all of the colonies generated above were macrophage colonies.

Example 1 Production of the gene of the present invention ■ Culture of AGR-ON cells Human T+ (II cell cultured cell line AGR-ON (ATCC
Accession No. CRL-8199) was mixed with 10% newborn calf serum (NC3), 20mM N-2-hydroquine ethylpiperazine-N'-2-ethanesulfonic acid (HEPE).
S), 100 μg/ll1f2 streptomycin, 100 units/Il′I12 penicillin G150 μg/
RPMI-16 with +uQ Gentamicin, 5X10-5M 2-mercaptoethanol and 1mM Glutamine
40 medium [manufactured by Flow Laboratory Co., Ltd.] to a cell concentration of about 105 cells/threshold. The IQ was measured using a 200-capacity tissue culture flask [Corning Co., Ltd. 35
The cells were cultured at 37°C for 72 hours.

■ Extraction of mRNA Approximately 5 x 108 AGR-ON cells obtained in the above
M-guanidine thiocyanate solution [4M-guanidinium isothiocyanate, 50mM Tris.HCQ (p
H7,6), 10mM EDTA, 2% Zarconlu (S
arkosyl), 140mM 2-mercaptoethanol] After dissolving in 50 whales, 18G while heating to 60℃
DNA was sheared using a 50 mm syringe fitted with a syringe needle.

To this solution was added an equal amount of phenol heated to 60°C, 1/
2 volumes of 100mM sodium acetate (pH 5,2)-1
0mM Tris H (1! (pH 7,4) 1mM
A mixture of EDTA solution and an equal volume of chloroform isoamyl alcohol (24:1) was added, shaken for 10 min in a 60 °C water bath, and then incubated at 3000 rpm at 4 °C for 1 hour.
Centrifuged for 5 minutes. The aqueous layer was extracted with phenol-chloroform twice and then with chloroform twice, and then 2 volumes of cold ethanol was added and the mixture was heated at -20°C for 60 hours.
Hold for minutes. Centrifuge at 3000 ppm for 20 minutes at 4°C, and precipitate the RNA pellet with 100 mM)
HCQ (pH7,4)-50mM NaCR10m
After dissolving in 50 volumes of M EDTA-0.2% SDS78 solution, proteinase K [Proteinase K, manufactured by Merck & Co., Ltd.] was added at a concentration of 200 μg/mA, and the mixture was incubated at 37°
The reaction was carried out at C for 60 minutes. After performing phenol-chloroform extraction twice and then chloroform extraction twice at 60°C, 1/10 volume of 3M sodium acetate (pH 5,
2) and 2 volumes of cold ethanol at -70°C.
It was left for 0 minutes. Centrifugation was performed at 3000 rpm for 20 minutes at 4°C, and the precipitated RNA pellet was washed with cold 70% ethanol, followed by TE solution [10mM! -Squirrel HC (2(p)
H7,5) and 1mM EDTA].

Thus total RNA from 5 x 108 AGR-ON cells
5 mg of target was obtained.

Next, in order to obtain mRNA from the total RNA obtained above, column chromatography was performed using oligo(dT)-cellulose [manufactured by Collaborative Tip Research Co., Ltd.]. Adsorption of mRNA was performed using 10mM Tris-HCQ (pH 7,5), 1mM EDTA-0,
A 5M NaCQ solution was used and the column was washed with the same solution and 10mM Tris-HCQ (pH 7,5)-1mM
After washing with EDTAO, LM NaCQ solution, 1
0mM 1-Lisu・HCQ (pH 7,5) -1mM
RNA was eluted using EDTA.

Approximately 110 μg of mRNA was obtained as described above.

■ Preparation of cDNA and A library mRNA5. cDNA from czg, c
Synthesis was performed using a DNA synthesis system [manufactured by AmaJam Co., Ltd.].

Approximately 0.6 μg of the obtained cDNA was dried under reduced pressure, and then
0mM Tris-HCQ (pH 7,5) - 10mM
E, DTA-50mM DTT-40μMS-adenosyl-methionine solution dissolved in 20μQ, EcoR
I methylase [manufactured by New England Biolab]
16 units were added and reacted at 37°C for 15 minutes.

After heating this reaction solution at 70°C for 10 minutes to stop the reaction, phenol-chloroform extraction was performed, and the extract was mixed with 1/10 volume of 3M sodium acetate (pH 5,2) and 2.5 volumes of ethanol. was added and left at -70°C for 15 minutes. 15000 rl at 4°C) 15 at ffl
After centrifugation for 1 minute, the precipitated DNA pellet was diluted with 50 mM Tris-HCQ (pH 7,5) 10 mM
g CQ2 10mM DTT-1mM AT
P-100μg/ITIQEcoRI linker [manufactured by Takara Shuzo Co., Ltd., 5'-GGAATTCC-3'] solution 10μ
After dissolving in Q, add 74 DNA ligase [manufactured by Takara Shuzo Co., Ltd.]
350 units were added and reacted at 14°C for 16 hours.

The obtained reaction solution was heated at 70°C for 10 minutes to stop the reaction, and then 100mM NaCNaC9-5Olis・HCQ (pH 7,5)-7mM g CQ 2
Add 16 μR of 10 mM DTT solution and 140 units of restriction enzyme EcoRI [manufactured by Takara Shuzo Co., Ltd.] and heat at 37°C.
Digested for 3 hours.

0.5M EDTA (pH 8,0) 0.8 to the reaction solution
After adding μΩ to stop the reaction, Biogel A30m
[Excess EcoRI linker was removed by Cocolumn chromatography manufactured by Bio-Rad. The cDNA fraction was digested with the restriction enzyme EcoRI, and then the 5'-phosphate group was removed with alkaline phosphatase.
NA [protoclone G T (protoclone
GT), manufactured by Promega Biotic] 1 μg, 1/1
0 volume of 3M sodium acetate (pH 5,2) and 2.
Added 5 volumes of ethanol and left at -70°C for 30 minutes. The DNA pellet was centrifuged at 15,000 rpm for 15 minutes at 4° C., and the precipitated DNA pellet was washed with 70% ethanol, dried under reduced pressure, and dissolved in 7 μQ of water.

Next, 500mM Tris H (1! (pH 7,5)
Add 2 uQ of 100 m M M g CQ 2 solution and incubate at 42 °C for 15 minutes, then return to room temperature and incubate for 10 min.
Add 1μQ of 0mM DTT, 1μQ of 10mM ATP and 175 units of T4 DNA ligase and incubate at 14°C.
It was kept warm for 6 hours.

Next, 10 μQ of this reaction solution was added with λ Phage packaging extract [Packagene system
.

Recombinant phage DNA was packaged in vitro by adding Promega Biotik Co., Ltd.] and incubating at 22°C for 2 hours. This solution was added with phage dilution buffer [100mM NaCQ-10mM Tris-HCQ (pH 7,9) 10mM MgSO4.7
H20] 0.5 mQ and 25 μQ of chloroform were added and stored at 4°C.

■ Screening of cDNA library -11
Preparation of synthetic probe AGR,-ON AGR-O extracted and isolated from culture supernatant
Based on the information on the amino acid sequence of NφCSF (27 residues from the N-terminus), the following base sequence was used as a synthetic probe.

Val-Ser-Glu-Tyr-C
ys5' GTG TCG GAG TACT
GT3' CACAGCCTCATG ACASc
r-His AGCCAC3' TCG GTG 5' A complementary base sequence to the base sequence shown in the above formula (shown at the bottom) is used as a probe for selection of recombinant phage having cDNA encoding M-CSF. Therefore, it was synthesized using the following method.

That is, a solid phase phosphite triester method using an N,N-dialkylmethyl phosphoroamidide derivative as a condensation unit [Nature, 31
0. 105 (1984)], an automatic synthesizer [3
80A DNA Synthesizer (manufactured by Applied Biosystems)], the target fully protected DNA was synthesized. Subsequently, the fully protected DNA was treated with 28% aqueous ammonia at 55°C for 10 hours to remove OH at the 5' end.
Protective groups other than the DMTr (dimethoxytrityl) group bonded to the group (A, refers to the acyl group of the amino group of GSC) are deprotected, and the partially protected DNA (DMT
The r-body) was obtained. Next, this DMTr body was subjected to ODS
After purification by reverse-phase high performance liquid chromatography (HPLC) using <Yamamura Kagaku Kenkyujo Co., Ltd.) as a carrier, the crude oligonucleotide was treated with 80% acetic acid at room temperature for 20 minutes. This was further purified by reverse phase HPLC using ODS as a carrier to obtain the desired oligonucleotide.

0.8 μg of the DNA obtained above was added to the reaction solution [50 mM Tris-HCQ (pH 7,6), 10 mM Mg CQ
2.10mM 2-mercaptoethanol, 200μ
Ci(γP)-ATP was reacted with 18 units of T4 polynucleotide kinase [Takara Shuzo Co., Ltd.] at 37°C for 1 hour in 100μQ of Ci(γP)-ATP to convert the 5' end of the DNA into 3
Labeled with 2P. Labeled DNA and unreacted [γ
P) In order to separate ATP, gel purification was performed using Biogel P-30 (manufactured by Bio-Rad). Label DN
A fractions were pooled and stored at -20°C.

The specific radioactivity of the obtained probe was 1108 cp/μg
It was more than DNA.

■-2, Plaque hybridization Escherichia coli Y1090 strain was grown in LB medium containing 50 Mg/Kai ampicillin and 0.2% maltose [Bactodrypton 10g/Q, Bactoyst extract 5g/R and NaC
R5g/Q] Inoculated into 40 liters and removed from 300 flasks.
The culture was incubated overnight at 7°C with shaking. 3000 rp at 4°C
Cells were collected by centrifugation for 15 minutes at
~1 Tris HCR (pH 7,5) -10mM MgS
Suspend in O4.7H20-0.01% gelatin, 4
Stored at °C.

Next, 3.5 x 105 p of the recombinant phage particle solution obtained in the above ① was added to 0.3 of the above bacterial solution in an 8M medium.
fu (plaque forming unit) / 1T
0.2 diluted to II2. Add 1rrIQ and heat to 37℃
The mixture was kept warm for 15 minutes. Subsequently, LB soft agar medium [Bactodributon 10 g/
After adding Q, yeast extract 5 g/Q, NaCQ 5 g/Q, agarose 7 g/Q core, and 5 precepts and mixing, LB agar plate made in a 15 cm diameter chassis [Bactodrypton 10 g/Q, Bacto Yeast 5g extract
/LNaCQ5g/R and Bacto agar 15g/2] and cultured at 42°C overnight. Incidentally, the same operation was performed on a total of 20 Petri dishes.

On the agar plate where the plaque appeared, a diameter of 1B2+n
A replica filter was prepared by mounting a nylon filter [BNRG132, manufactured by Pall Co., Ltd.]. Use this as a master plate for the agar plate at 4°C.
Saved to.

Filters were treated with 0, 5 M NaOH-1,
5M NaCQ, 0.5M) Lith-HCΩ (pH 7,
5) 1.5M NaCQ and 0.3M NaCQO
,02M NaH2POa (pH7,4)-0,
After sequential treatment with 002M EDTA (pH 7, 4) and air drying, baking was performed at 80° C. for 1 hour under vacuum.

The baked filter was heated to 0.75M NaCΩ-
0,075M Sodium Citrate-1.0mg/De-Ficoll-1.0mg/De-polyvinylpyrrolidone-1.0
mg/IIIQBSA-10mM Sodium Phosphate (p
H6,5) - 0,2% SDS - 0,1 mg/mQ SalmonSperm DNA solution was removed and kept at 42°C for 6 hours with gentle shaking. Next, the filter was transferred to the same solution containing the probe at a concentration of 1106 cp/d, and hybridization was performed at 42°C for 20 hours with gentle shaking.

After hybridization, the filter was taken out and washed three times with 0.9M NaCQ-0.09M sodium citrate at room temperature, and then washed with the same solution at 56°C for 5 minutes.

After air-drying the filter, use an intensifying screen to transfer X-ray film [X
R5, manufactured by Kodak Company], autoradiography was performed at -70°C for 20 minutes.

After developing the film, scrape off the plaques corresponding to the signal region from the master plate, repeat the above method to purify the plaques with positive signals,
Finally, representative positive clones λcM5 and λ
c M 11 was isolated.

■ Structural analysis of clones A restriction enzyme map of the cDNA of λcM5 was created.

The results are shown in FIG.

From Figure 1, the cDNA has a total length of 2.5 kilobases (kb
), including BstEII [New England Biolab], NcoI [Takara Shuzo], and SmaI [
Takara Shuzo Co., KpnI [Takara Shuzo Co.], EcoRI [Takara Shuzo Co.], and NdeI [New England Biolab Co.] cut at one location each, and 5c
aI [Takara Shuzo Co., Ltd., 5tuI [Takara Shuzo Co., Ltd.] and BamH
It was confirmed that there were two places where each part was cut by I [Takara Shuzosha].

Next, the base sequence of the cDNA was determined by the Maxam-Gilbert chemical modification method and the dideoxynucleotide chain termination method using M13 phage.

The results are shown in Figure 2 (Figure 2-1 to Figure 2-4).

From FIG. 2, regions complementary to the synthetic probe were present at positions 227 to 247 from the 5' end (indicated by underlining in the figure).

In addition, when we searched for the longest reading frame (readfng frame) in the cDNA of λcM5, we found that it extends from position 125 to position 12402 from the 5' end.
The amino acid sequence located at position 40 and corresponding to the 227th to 307th base sequence according to the codon frame is:
It was completely identical to the N-terminal 27 amino acids of AGR-ONφCSF. This means that the cDNA of λc M5 is M
-It is shown to be a cDNA encoding a CSF precursor protein.

From the above results, M− coded by the determined λcM5
The protein-level structure of the CSF precursor protein is shown in Figure 3 (Figure 3-
1 to 3-2).

In addition, λcMll cDNA determined in the same manner as in 1.
The base sequence of the M-CSF precursor protein is shown in Figure 4 (Figures 4-1 to 4-4), and the protein diagram of the M-CSF precursor protein encoded by it is shown in Figure 5 (Figures 5-1 to 5-5). They are shown in Figure 3).

Example 2 Production of recombinant M-CSF (r-MCS F)■
Preparation of COS cell expression vector pcDE The C08-1 cells used in this example are 5 cells lacking the proliferation initiation site COri).
Expressing the SV40 early gene by transforming monkey kidney cells CV1 with V40 DNA,
Cells that have become T antigen positive [Cell,
23. 175-182 (1981)].

First, plasmid pcDV1 [Okayama et al. (11° Okayama, P., Berg, Mo1. Ce11.
Biol, 3. 280-289 (1983))
was cut with the restriction enzyme KpnI, and then the protruding portion at the 3' end was shaved off with T4 DNA polymerase (BRL) to make blunt ends.

On the other hand, EcoRI linker (5'-GGAATTCC-
3') The 5' end of Takara Shuzo Co. was phosphorylated with T4 polynucleotide kinase and ligated to the blunt-ended DNA fragment using T4 DNA nogase. The ligation was cleaved with restriction enzyme EeoRI and further with restriction enzyme HindIII, and the resulting reaction product was subjected to agarose gel electrophoresis to obtain 2590 base pairs (bp).
The EcoRIHind mRNA fragment was isolated and purified.

On the other hand, plasmid pL1 (Okayama et al. (II).

Okayama, P., Bcrg, Mo1. Ccll,
Biol, 3. 280-289 (1983))
was cut with the restriction enzyme PstI [Takara Shuzo Co., Ltd.], the 3' end was made blunt using T4 DNA polymerase, and an EcoRI linker was added to this DNA fragment in the same manner as above.
and the resulting DNA fragment was digested with the restriction enzyme H1ndI.
II, and the reaction product was subjected to agarose gel electrophoresis to obtain 580bp EcoRT-HindllDN.
The A fragment was isolated and purified.

The obtained DNA fragment and the previously prepared EcoRIHind
III DNA fragment was ligated using T4 DNA ligase to obtain the desired plasmid pcDE.

The outline of this process is shown in FIG.

■ Preparation of M-CSF expression plasmid pCDM-CSF λc M 5 DNA was partially digested with restriction enzyme EcoRI, the resulting reaction product was subjected to agarose gel electrophoresis, and the cDNA portion (approximately 2.5 kb) was digested with EcoR. ■
It was isolated and purified as a partially digested fragment.

The COS cell expression vector pcDE obtained in step ① above was digested with the restriction enzyme EcoRI, and this was used as the cD vector prepared above.
The NA fragments were ligated using T4 DNA ligase to obtain the desired plasmid pcDM-CSF.

The thus obtained plasmid was transformed into Escherichia coli H.
B101 strain was transformed, and the desired transformant was obtained using the alkaline lysis method [Maniatis (T
, Maniatis at al., Molecule
rCloning, p90, Cold Sp
ring l1arvorLaboratory (
(1982)) by restriction enzyme analysis of the resulting plasmid DNA.

An outline of the above is shown in FIG.

■ Production of r-MCS F The pcDM-CSF obtained in step (■) above was processed using the DEAE dextran method CProc, Natl, Acad, Sci.
USA.

Vol, 81. p1070 (1984)] cO
8-1 cells, and r-
Production of MC5F was tested as follows.

That is, first, C08-1 cells were treated with 10% tallow serum (Fe
2) in RPMI-1640 medium containing approximately 2.5X10
The cell concentration was adjusted to 5 cells/-, and the cells were placed in Tissue Culture Cluster 6 [manufactured by Coaster Co., Ltd.] in an amount of 2 m12 per well, and cultured at 37°C overnight in a carbon dioxide gas incubator.

Then, the medium was removed and the cells were incubated with RPMI-1640 for 2 hours.
After washing twice, μg of pcDM/CSFIO prepared in ① above
1 ml of RPMI-1640 medium containing [50 mM] Squirrel HCQ (pH 7,4) and 400 μg/mQ
DEAE dextran (manufactured by Pharmacia)] was added thereto, and the mixture was left in a carbon dioxide gas incubator for 4 hours. After further removing the medium, the cells were washed twice with RPMI-1640, and RPMI-1640 medium containing 150 μM chloroquine [Sigma Co., Ltd.
was added and cultured for 3 hours. Then remove the medium and R
RPM containing 10% FC8 after washing with PM11640
The cells were cultured in I-1640 medium at 37°C for 72 hours in a carbon dioxide incubator.

The culture supernatant and its extract were collected from the cell culture thus obtained, and C.
SF activity was measured.

The results obtained are shown in Table 1 below.

In addition, Table 1 shows pcDM/CSF as a control.
Instead, the results of performing the same -L'φ production as in Section 1 using pcDE are also listed. Moreover, each activity measurement test was conducted twice for the same sample.

Table 1 The numerical values in Table 1 indicate the number of colonies (average value) per plate. The same applies to the following tables showing CSF activity unless otherwise specified.

■ M-CSF expression plasmid pCDM-CSF-18
Preparation of step 5 Using the plasmid pcDM-CSF obtained in step ① above,
Site-specific mutagenesis (Sit)
e-8specific Mutagcncsis)
[Proc.

Natl, Acad, Sci, 81. 5662-
5666 (1984)), the codon (AAG) encoding the amino acid (Lys) at amino acid number 186 in FIG. (
The desired M-CSF expression plasmid pcDM-CSF-185 having Thr) as the C-terminal amino acid was obtained.

The details are as follows.

That is, first, EeoRI was extracted from plasmid pcDM-CSF.
- Excise the EcoRI DNA fragment (size 1.8 kb) and insert it into M13mall phage (RF) EcoRI DNA fragment (size 1.8 kb).
Cloned into the RI and EcoRI restriction enzyme sites,
From this, a single-stranded (ss) DNA (M13-CSF) was obtained and used as a template for mutagenesis.

On the other hand, synthetic oligonucleotide [5'-GTGGTG
ACCTAGCCTGATT-3' (primer)
After non-oxidation with T4 polynucleotide kinase, hybridization and annealing with the above 5sDNA (M13-CSF), DNA was performed in the presence of dNTPs.
The cells were treated with polymerase I (Klenow fragment) and T4 DNA ligase, respectively, and incubated at 15° C. for 18 hours.

The obtained DNA was transformed into JM105 competent cells, and 50 of the resulting colonies were inoculated onto an agar plate and cultured at 37°C for 18 hours. The filter containing grown colonies was denatured with alkali using a conventional method, dried, and then baked at 80° C. for 2 hours. After prehybridizing this filter, the 5' end of this and the above-mentioned brimer was combined with "2P-r-ATP".
32P-Brobe labeled with 32P-Brobe was hybridized at room temperature. 6 hybridized filters
x S S C (saline sodium cit)
After washing at room temperature for 10 minutes and then at 56°C for 4 minutes and drying, autoradiography was performed at -70°C for 18 hours.

Select M13-CSF-185 from among the mutated clones, infect JM105 with it and culture it to obtain ssD.
NA and RF DNA were prepared.

The mutation in the gene of interest was confirmed by the M13 dideoxynucleotide chain termination method of the 5sDNA obtained above.

Furthermore, from the RF DNA grown in JM105,
A coRI-EcoRI fragment was prepared and incorporated into an expression plasmid in the same manner as in (1) above to obtain the desired plasmid pcDM-csF-185.

Using this plasmid, CO3
r-MCSF was expressed in -1 cells.

The results are shown in Table 2.

Table 2 Table 3 ■ M-CSF expression plasmid pcDM-CSF1
Preparation of 5'-GCTGAATGATCCA as a brimer of 77
Using GCCAA-3', the third
The desired M- CSF
Expression plasmid pcDM-CSF-177 was obtained.

Using this plasmid, C08
The results of expressing r-MCSF in -1 cells are similarly shown in Table 3.

From the results shown in Tables 2 and 3 above, plasmids pcDM-CSF-185 and plasmids carrying the gene of the present invention
According to the use of cDM-CSF-177, M-
It can be seen that desired r-MCSF can be expressed that exhibits the biological activity of CSF.

From this, at least the C-terminal amino acid sequence after amino acid number 178 in the amino acid sequence shown in formula (1) does not substantially affect the expression of the M-C5F molecule having the desired biological activity. That is clear.

■Preparation of M-CSF expression plasmid pcDM-csFll In Step 2, plasmid pcM11 cDNA was used instead of λcM5cDNA.
DM-CSF11 was obtained. Using this plasmid, r-MCSF was produced according to the above procedure (1), and almost the same results were obtained.

That is, λcM11 DNA was partially digested with the restriction enzyme EcoRI, the resulting reaction product was subjected to agarose gel electrophoresis, and the cDNA portion (approximately 2.5 kb) was isolated and purified as an EcoRI partially digested fragment.

The COS cell expression vector pcDE obtained in ① above was cut with the restriction enzyme EeoRr, and this
Ligate the DNA fragments using T4 DNA ligase,
The desired plasmid pcDM/CSFII was obtained.

(The resulting plasmid was transformed into Escherichia coli H
8101 strain was transformed, and the desired transformant was selected by restriction enzyme analysis of the plasmid DNA obtained by the alkaline lysis method.

In addition, c DNA of the above λcM11 DNA (EcoRI
partially digested fragment) into the cloning vector pUc19D
It was inserted into the EcoRI cloning site of NA (Takara Shuzo) to obtain plasmid pUCMCSF-11. The transformant obtained by transforming the plasmid into Escherichia coli H8101 strain is Escherichia colt HB1.
July 1987 under the name 01/pUCMCSF・11
It was deposited as FERMBP-1409 at the Institute of Microbial Technology, Agency of Industrial Science and Technology on May 160, 2015.

■ M-CSF expression plasmid pcDM-csFll-
Preparation of 185 Plasmid pcDM-CSF11 was digested with restriction enzyme EcoRI.
and BstEII, resulting in approximately 670 bp of EcoRI
-BstE II DNA fragment was isolated and purified.

The 5' end of this DNA fragment was cut with T.
Synthetic N phosphorylated with 4 polynucleotide kinase
A clinker; Table 4 5-GTGACCTGATAAGGATCCG-33-
The DNA fragment obtained by ligating GACTATTCCTAGGCTTAA-5 and the EcoRI digest of plasmid pcDE described above were ligated using T4 DNA ligase to obtain the desired plasmid pcDM-csF11-185. The plasmid has a translation stop codon TGATAA at the site of the synthetic linker, and therefore the plasmid pcD
In the polypeptide shown in FIG. 5 encoded by M.CSF11, the 185th amino acid (T hr)
coat with M-CSF having the C-terminal amino acid.

An outline of the above-L is shown in FIG.

Table 4 shows the results of expression using the plasmid in the same manner as in Section 1.

■ M-CSF expression plasmid pCDM-CSF11-
Preparation of 177 Plasmid pCDM-CSF11-185 obtained in ① above
using amino acid number 1 in Figure 5 according to the above
Codon (TGC) encoding 78 amino acids (Cys)
) is replaced with a stop codon (TGA), and the 177th amino acid (Glu) in FIG. 5 is the C-terminal amino acid.
-177 was obtained. Table 5 shows the results of expression using this plasmid in the same manner as in ① above.

Table 5 ■ M-CSF expression plasmid pcDM-csFll-
Preparation of 163 Using the plasmid pcDM-csF11185 obtained in ① above, 5'-AAGGACTGAA was used as a primer.
Using ATATTTTC-3', the amino acid number 164 in Figure 5 (T
rp) encoding codon (TGG) and the stop codon (
TGA), amino acid number 16 in FIG.
Desired M-CSF expression plasmid pcDM-csFll-1 with amino acid No. 3 (A sp) as the C-terminal amino acid
I got 63.

Using this plasmid, CO3
As a result of expressing r-MCSF in -1 cells, the CSF activity of the supernatant was 12 colonies/plate.

From these results, at least the C-terminal amino acid sequence after amino acid number 164 in the amino acid sequence shown in formula (1) does not substantially affect the expression of the M-CSF molecule that achieves the desired biological activity. That is clear.

[Strain] M-CSF secretion expression plasmid p I N-m
(lppp-5)-0mpA-MCSF11-NV15
1. Preparation of plasmid pcDM fist CSF11-185 DNA, E
EcoRI-Bam by digestion with coRI and BamHI
Isolate and purify the HI DNA fragment (approximately 680 bp),
This was converted into a secretory expression vector plN-III-OmpA3.
(EMBOJ,, 3.2437-2442 (198
4) ] into the EcoRI SBamH1 cloning site to create plasmid pIN-III-OmpA3.
-MCSF11-185 was obtained.

The plasmid DNA was digested with XbaI and BamHI to obtain an XbaI-BamHI DNA fragment (approximately 770 bp).
) was isolated and purified, and this was used as the cloning vector pUc118DNA [Takara Shuzo] for the preparation of double-stranded DNA.
Insert into ISBamHI cloning site, plasmid pUc118-OmpA3-MCSFII-18
Got 5.

Using this plasmid, the 35th amino acid (V Plasmid pUC1 was modified so that the codon (GTG) encoding a
18-OmpA-MCS F 11-NV 151 was obtained.

That is, plasmid pUc118-○m pA 3-M
Escherichia coli JM105 transformed with CSFII-185 DNA was infected with helper phage 07 [Takara Shuzo Co., Ltd.] and cultured with shaking at 37°C for 14 hours.
ss) pUc118-OmpA3-MCSFII-18
5 DNA was obtained and used as a template for mutagenesis, and 5'-TACCGTAG was used as a primer.
CGCAGGCCGTGTCGGAGTACTGTAG
Using C3', create the desired blasumi in the same manner as in ① above.
pUc118-OmpA-MCSFII-N
I got V151.

The plasmid DNA was digested with XbaI and BamHI to obtain an XbaI-BamHI DNA fragment (approximately 540 bp).
) was isolated and purified, and this was transformed into the expression vector pIN-m (l
pp p-5) -A 3 (Nucl, Ac1ds
Res, 13°3101-3110 (1985))
The desired secreted expression plasmid for expressing a polypeptide consisting of amino acid 35 (Val) to amino acid 18585 (Thr) in FIG. 5 was obtained by inserting it into the XbaI-BamHI site of . PiN this
-m (Ipp p-5) -OmpA-MCSF 1
It is called 1NV151.

An outline of the above is shown in Figures 9-1, 2 and 3.

Furthermore, the amino acid sequence encoded by the above-mentioned secretory expression plasmid is shown in FIG. In FIG. 10, the underlined sequence represents the OmpA signal peptide, and ↓ represents the processing site.

■ Secretory expression of M-CSF pIN-III (lpI) p5) obtained above [phase] -
OmpA-MCSFII-NV151 was transformed into E. coli HB1
01 and JM109 for secretory production, and the supernatant showing CSF activity was collected as a periplasmic fraction.

That is, the strain carrying the above-mentioned M-CSF secretory expression vector was grown in a 22-volume flask at 37°C in LB medium 5001TII2 containing 50 μg/deampicillin.
After culturing with shaking for an hour, the cells were centrifuged (5000 rpm, 5 minutes, room temperature) to pellet the bacterial cells.

This bacterial pellet was mixed with 50rnM) Squirrel H (1 (pH
8,0) - resuspended in 25% sucrose solution for 50 minutes and added 250 mM EDTA (pH 8,0) for 1 hour.
After adding 25 mQ, bring to room temperature with gentle shaking for 30 mQ.
I dressed up for a minute. The bacterial pellet obtained by centrifugation in the same manner was
Resuspend in ice-cold distilled water 25 or cool in water for 30 minutes with gentle shaking, and incubate at 4°C.
The supernatant was collected as the periplasmic fraction by centrifugation for rp min.

@M-CSF secreted expression plasmid pIN-III (l
pp p-5) - Preparation of OmpA-MCSF11NV143 In the above [phase], by using pcDM-CSFII-177 instead of pCDM-CSF11185, the amino acids from the 35th amino acid (Val) to the 177th amino acid in FIG. A desired M-CSF secretory expression plasmid for expressing a polypeptide consisting of up to amino acids (Glu),
pIN-III(lpp p-5) -0mp'A-M
CSF 11-NV143 was obtained.

The amino acid sequence encoded by the plasmid is shown in FIG. In FIG. 11, the underlined sequence represents the OmpA signal peptide, and ↓ represents the processing site. The plasmid was transformed into E. coli in the same manner as in (1) above, and a supernatant exhibiting CSF activity was obtained as a periplasmic fraction from the E. coli.

HPLC of CM-CSF Each of the supernatants obtained in the above
It was subjected to LC.

Column: TSK gel G3000SW (60cmX7
．． 5 mm diameter, manufactured by Toso Corporation) Eluent: 0.005% polyethylene glycol and 0.005% polyethylene glycol.
15M Na (1! Contains BS- Flow rate = 0.8 tubes/min Fraction volume: 0.8 tubes/min Molecular weight markers (glutamic acid membrane hydrogenase = 290,000, lactate dehydrogenase: 142,000, The following results were obtained for each sample based on enolase: 67,000, adenylate kinase: 32,000, and cytochrome C: 12,400.

Sample 0: The culture supernatant obtained in step ① was concentrated to about 150 μQ using Centricon-10 (manufactured by Amicon).

CSF activity was observed in the elution fractions in the range corresponding to molecular weights of 320,000 to 700,000 (average 480,000).

○ Sample: The culture supernatant obtained in ① above was treated in the same manner as above.

CSF activity was observed in the elution fractions corresponding to the molecular weight range of 66,000 to 860,000 (average 760,000).

Sample 0 Sample 2: Culture supernatant 4 obtained in ① above was treated in the same manner as above.

CSF activity was observed in elution fractions corresponding to molecular weights ranging from 52,000 to 86,000 (average 67,000).

Sample 0: 2 threshold supernatant of the periplasmic fraction obtained in ① above was concentrated to about 110 μQ in the same manner as above.

CS at the position corresponding to the molecular weight of 30,000 to 40,000 (average 35,000)
F activity was observed.

o M-CSF (7) SDS-PAGE After applying the 10 samples of the culture supernatant obtained in ①, ② or ① to a column packed with ConA-Sepharose, PBS-(5%)
After washing with 0.5M methyl-α-D-mannoside
Elution was performed with PBS-(10+nQ). 4 ml of the obtained eluate was concentrated using Centricon-10, and this was used as the sample for SDS-PAGE described below.

In addition, the supernatant of the periplasmic fraction obtained in the above ① was used as the same sample as it was.

For detection of M-CSF, the gel after SDS-PAGE was subjected to Western blotting, and M-CSF prepared according to a conventional method was detected.
This was done by using rabbit antiserum against CSF.

That is, SDS-PAGE is a Lemurization method (Nature, 277.680 (197
0)) using a mini-slab (gel concentration 15%),
Further, Western blotting was performed using Bio-Rad's Transplot cell. The transferred nitrocellulose membrane was coated with P containing 1% bovine serum albumin.
After blocking with BS-, it was reacted with the above rabbit antiserum against M-CSF, and further reacted with a peroxidase-labeled goat anti-rabbit antibody (manufactured by Bio-Rad). M
The -CSF band was detected by reacting the nitrocellulose membrane thus obtained with a 4-chloro-1-naphthol solution as a coloring substrate.

The results are shown in Table 6.

Table 6 @M-CSF expression plasmid pcDM-CSF11-d
Production of hfr Plasmid pSV2-dhfr [Mo1. Ce
11. Biol.

1.854 (1981)) with the restriction enzyme H1ndII
The fragment was cut into two fragments with I and BamHI, and a fragment containing the dihydrofolate reductase (DHFR) gene was isolated and purified.

Next, plasmid pRS V -CAT (Proc
, Natl.

Acad, Sci, USA, 79. 6777
(1981) ), the same < HindIIr and BamH
I and L of Rous sarcoma virus (RSV)
A fragment containing a long terminal repeat (TR) portion was isolated and purified.

The two types of fragments purified above were ligated by reacting with T4 DNA ligase.

This reaction product was transformed into Escherichia coli HBIOI competent cells (Takara Shuzo), plasmid DNA was prepared from the resulting ampicillin-resistant colonies, a restriction enzyme map was created, and the desired plasmid pR8V-dhf
I got r.

The plasmid i, 1R8V (7) LTR part, DHFR
The DHF gene contains an intervening sequence derived from SV40 and a polyA addition signal, as well as a replication origin derived from E. coli plasmid pBR322 and an ampicillin resistance gene, and under the control of the promoter contained in the above LTR region.
It expresses R.

This plasmid pRS V-dhfr was cut into two fragments with NdeI' and BamHI, and the fragment containing the DHFR gene was isolated and purified. The obtained DNA fragment,
Both ends were made blunt by treatment with DNA polymerase (Flenow Fragment).

On the other hand, the plasmid pcDM/CSFII obtained in the above (2) was cut with 5alI, and the cut site was similarly treated with DNA polymerase to make blunt ends.

Both fragments obtained above were ligated using T4 DNA ligase, and the reaction product was transformed into E. coli JM109 competent cells.

Plasmid DNA was prepared from the resulting ampicillin-resistant colonies, a restriction enzyme map was created, and the desired M
- CSF (!=expression plasmid p for both genes of DHFR)
cDM-CSF 11-dhfr was obtained.

The plasmid contains a part of the SV40-derived early promoter (SV40 early) involved in M-CSF expression, an intervening sequence (SV401ntron), the M-CSF gene, and a polyA addition signal (SV40 poly
A), LTR part of R8V involved in DHF R expression (R8V-LTIin), DHFR gene (dhfr),
Intervening sequence derived from SV40 (SV401ntron), p
The olyA addition signal (SV40 poly A) was doweled, and the replication origin (Ori) derived from E. coli plasmid pBR322 and the ampicillin resistance gene (A+np
r). The plasmid was transformed into Escherichia coli H
The transformant transformed into the 8101 strain was E.
scherichia coli HB 101/p
c DM-CS F 11-dhfr',
FERMBP-222
It has been deposited as 4).

An outline of the above is shown in FIGS. 12-1 and 12-2.

[Phase] Production of r-MCSF Plasmid pcDM-CSF11-dhfr obtained above
r-MCSF was produced using the following procedure (1) above.

As a result, the CSF activity of the culture supernatant was 68 colonies per plate (average value) (plasmid pcDE
The control using was 0).

@ Expression of pcDM◆CSF11-dhfr by CHO cells Using a 750 m2 culture flask (manufactured by Costa), 10
% fetal bovine serum, 10mM sodium pyruvate 10rr
I! Q, non-essential amino acids 101rlQ, penicillin G1
00,000 units, streptomycin 200 mg, gentamicin 80 mg and 7% sodium bicarbonate 53%
Approximately 2 x 10 Chinese hamster ovary dhrr-deficient cells (CHO-
Duk dhfr-cell: Proc.

Natl, Acad, Sei,, USA,, 77.4
216 (1980)) for 6 to 8 days, the cell culture supernatant was collected to prepare a CHO culture supernatant.

In addition, the above CHO-Duk dhfr- cells were treated with trypsin (manufactured by Flow Laboratory), suspended in the same DMEM medium, washed, and the culture medium was removed.
Infusion solution (0.25M mannitol 0.1mM Ca
C92kai2H200, 1mM MgSO4・7H20
-0.2mM Tris HCQ, pH 7.2, manufactured by Wako Pure Chemical Industries, Ltd.).

M-CSF expression plasmid pcDM- obtained in the above [phase]
CSFI 1-dhfr was cleaved with CIaI, linearized, and then dissolved in DNA injection solution.

200μQ of the above cell suspension (2X106 cells) and D
Mix 200 μQ of NA solution (30 μg DNA), put it in a fusion chamber CH-2 (manufactured by Shimabara Seisakusho Co., Ltd.), connect it to an electrofusion device 5SH-1 (manufactured by Shimabara Seisakusho Co., Ltd.),
．． A 2KV/cm2 pulse was repeated twice at 1 second intervals to electrically introduce DNA into the cells.

Cells into which DNA has been introduced are dialyzed with 10% tallow serum-1% non-essential amino acid solution (manufactured by Flow Laboratories) 2
96HT solution (manufactured by the same company) - suspended in DMEM medium,
The cells were cultured in a 24-well plate (manufactured by Costa).

After 48 hours of culture, the medium was changed to selective medium (DMEM medium containing 10% dialyzed tallow serum and 1% non-essential amino acid solution), and then the medium was replaced with fresh every 3 to 40 hours.

50 clones were selected from about 200 clones of transformed cells obtained by culturing for 10 to 14 days, and after treatment with trypsin,
Transferred to a new 24-well plate.

Amplification of the DHFR gene is induced by high concentrations of methotrexate (
MTX) (J, B.

C, 253, 1357 (1978)), and adjacent genes transformed at the same time show amplification by MTX (J, Mo1. Biol, 159.601 (198
2)).

The above-mentioned 50 clones of transformed cells were continuously cultured in a selective medium containing 20 membranes of MMTX, and resistant clones that had grown were treated with trypsin, and then cultured in a selective medium containing 50 membranes of MMTX. Resistant clones that similarly proliferated were continued to be cultured in a selective medium containing 1100nMTX, and finally 400nM MTX! ,: A clone showing resistance was obtained.

The CSF activities of the culture supernatants of these resistant clones are shown in Table 7 below.

Table 7: The CHO cell culture obtained above was transferred directly to SDS.
-As a PAGE sample, S
The molecular weight was examined by DS-PAGE.

As a result, an M-CSF band was detected at a position corresponding to 90,000 under non-reducing conditions and 44,000 under reducing conditions.

(Separation and purification of JCHOΦM-CSF 10 membrane fetal bovine serum, 100 mM sodium pyruvate, 10 units of non-essential amino acids, 10,000 units of peninrin GIO, 200 mg of streptomycin.

Gentamicin 80 mg and 7% sodium bicarbonate 5
Dulbecco's improved minimum essential medium (DMEM medium, manufactured by GIBCO) containing BITl12 in IQ was prepared, and 75c
In an m2 culture flask (manufactured by Corning), add the CHO cell clone No. 2°3-8 obtained in step ① above at a ratio of about 2 x 106 cells to 40 cells of the medium, and add 6 to 8 cells.
Cultured for 1 day.

From the culture supernatant thus obtained, the desired homogeneous human M-CSF (CHOΦM-CSF) was obtained through the following purification process.

In the following steps, the target protein was detected according to the Western blotting method described above.

(1) ConA-Sepharose affinity taromadography For 650 m of the CHO cell culture supernatant prepared above, 1, OM Na CQ a'k 50 m
M sodium borate buffer (pH 8,0) 650mQ
Add and stir to prepare a sample solution.

On the other hand, sample solutions marked - and L were applied to a 5 x 60 cm column pre-filled with ConA-Sepharose gel (gel volume 350 mQ) and equilibrated with a 5-pot containing 0.5 to i NaCQ, and added to the same buffer. After washing thoroughly with
．． Elution was performed with the same buffer containing 5-1 methyl-(Z-D-mannoside).

From the obtained elution pattern, all CHO-M-CSF was detected in the elution area.

(2) DEAE-5PW ion exchange high performance liquid chromatography The 0.5M methyl-α-D-mannonde elution fraction obtained in (1) above was concentrated by ultraslide using a YM-10 membrane, and
Dialysis was performed against mM sodium borate buffer (pH 8.0), and anion-exchange fast-wave chromatography was performed on four separate occasions under the following conditions.

Column: TSK Gelkel AE-5PW (21.5mm
1. D. OM 50mM sodium borate buffer containing NaCQ and 5% methanol (pH 8,0) Flow rate: 3.0/min Fraction volume: 6rrvQ/tube/2min Concentration gradient: Time (min) %B As a result of the above elution, CHO-M, -CSF is fraction No. 34-38 (0.23-0.25M NaCQ)
was eluted. These were collected, pooled, and subjected to the following method. Note that fractionation was started immediately after sample injection.

(3) Gel filtration high performance liquid chromatography (2) above
The CHO·M-CSF portion obtained in 1 was concentrated by ultrafiltration using a YM-10 membrane, and then subjected to gel filtration high performance liquid chromatography in 6 batches under the following conditions.

Column: TSK Gel G3000SW (60cmX2
1.5 mm1. D., manufactured by Toso Corporation) Eluent: 0
．． 50mM sodium phosphate buffer (pH 6,8) containing 3M NaC (2) Flow rate: 3.0m12/min Fraction volume: 61T112/tube/2min - As a result of the above, CHO-M-CSF is fraction No. 2
It was eluted from 3 to 26.

In addition, in the above, from the elution position of the standard protein for gel filtration HPLC (manufactured by Oriental Yeast Co., Ltd.), CHO-M-CS
The molecular weight of F was estimated to be 114,000.

(4) Reverse phase high performance liquid chromatography (RP-HPLC) - The CHO-M-CSF eluted portion obtained in (3) was concentrated by ultrafiltration using a YM-10 membrane, and then RP-HPLC was performed under the following conditions. HPLC was performed.

Column; C4 high-bore reverse phase column (RP304, manufactured by Bio-Rad, 4.6 mm1, D, X 250 [1
1 [[+] Eluent A: 0.1% TFA Eluent B Niacetonitrile: 1% TFA (9: Flow rate:
1 desorption/min fraction volume = 2 desorption/tube/2 min l Agricultural gradient:
Time (min) %B As a result of the above C4RP-HPLC, CHO-M-CSF was eluted in fractions No. 31 and 32 (52-53% B). This was collected, neutralized by adding 200 mM sodium borate buffer (pH 8,0), and then concentrated under reduced pressure using a concentrator (manufactured by Tomy Seiko Co., Ltd.).

(5) TSK GELKEL AE-5PW ion exchange high performance liquid chromatography The CHO-M-CSF fraction obtained in (4) above was subjected to TSK GELKEL AE-5PW ion exchange high performance liquid chromatography under the following conditions.

Column: TSK Gelkel AE-5PW (7.5mm1
．． D, X 75mm, Toso Corporation) Eluent A: 5
% methanol-containing 5-wood eluent B: 1. OM N
50mM sodium borate buffer (pH 8.0) containing aCQ and 5% methanol Flow rate: 1.0ml/min Fraction volume = 1 tube/min Concentration gradient 2
Time (minutes) %B 1 The elution results are shown in Figure 13.

In the figure, the vertical axis is the protein absorbance at 28Or+m (
A28o) and NaCQ concentration (M), and the horizontal axis shows fraction No. shows. In addition, in the figure, the horizontal arrow (-) indicates CHO-M- detected by Western blotting.
CSF elution position is shown.

From the figure, CHO-M-CSF is fraction no. 3
9 and 40 and detected.

This eluted portion was fractionated, concentrated under reduced pressure in a concentrator, and then subjected to SDS-PAGE, whereupon a single protein band was detected, which corresponded to the band position in the Western blotting described above, and thus CHO-
Isolation and purification of M-CSF was confirmed.

(6) N-terminal acid amino acid sequence of CHO-M-CSF The N-terminal acid amino acid sequence of CHO-M-C5F obtained above was determined using a gas phase sequencer (manufactured by Applied Biosystems).

As a result, the N-terminal 10 amino acid sequence of CHO-M-CSF was confirmed to be as follows.

Glu-Glu-Val-Ser
- G Iu - Tyr - X'S Cr - H
is-Met-The amino acid (X') in cycle 7 could not be identified and was presumed to be Cys based on the gene structure.

(7) SDS-PAGE of CHO-M-CSF Laemmli's method (Laemmli. U., Nature.
2 7 7.

680 (1970)], CH obtained in the above (5)
The OM-CSF concentrate was added to Laemmli's sample buffer [containing 2-mercaptoethanol (2-ME+)].
and (2-ME-)] and heat-treated at 95° C. for 5 minutes, and then subjected to SDS-PAGE electrophoresis under the following conditions.

Gel: 12% polyacrylamide gel with a thickness of 1.5 mm was used.

Electrophoresis device Nibrothian (manufactured by Bio-Rad Laboratories) Electrophoresis conditions: Electrophoresis is carried out at constant current of 20 mA for stacking gel and 30 mA for separating gel for about 4 hours.

Use dyeing Nisil Burst kit (manufactured by Wako Tsumugi Pharmaceutical Co., Ltd.).

Molecular weight marker: Pre-tint marker (manufactured by Bio-Rad) was used.

SDS-PAGE (7) results above), CHO-M
~ CSF has a molecular weight of about 76,000 in the 2-ME- state, 2
In the -ME+ state, the molecular weight was estimated to be about 38,000, and it migrated as a single band at this position.

(8) Isoelectric point of CHO-M-CSF Using the partially purified product obtained in (2) above, CHO-M-CSF
The ff1l determination of the isoelectric point of M-CSF was performed as follows.

That is, using a gel for pH 3.5 to 9.5 (LBK Ampholine PAG gel) as a gel, 100 μQ of the partially purified product described in "1" was applied and electrophoresed at 10W for 12 hours.

After electrophoresis, the gel was cut out at 5 mm intervals, placed in 50 mM sodium borate (pH 8,0) lrrvQ, elution was performed for 24 hours, and the activity was measured. In addition, the pH is 1c [
The gel was cut at 11 intervals, left in 500 μQ of distilled water for 24 hours, and then measured.

The above results are shown in FIG. In the figure, the vertical axis is pH
and comprehensiveness (U), the horizontal axis is the distance from the cathode (cm)
) is shown.

From the figure, the isoelectric point of CHO・M-CSF is pH 4.55.
It turns out that.

@r M-CSF expression plasmid pcDM conflict csF1
Production of 1-185-dhfr Plasmid pcDM/CS produced by the above [phase]
FII-dhfr was cut into two fragments using the restriction enzyme XhoI, and the fragment containing the DHFR gene was isolated and purified.

Separately, the plasmid pCDM-C produced by the above
SFI 1-185 was cut into two fragments using the restriction enzyme XhoI, and the fragment containing M-CSFI1185 cDNA was isolated and purified.

- The two fragments obtained above were ligated using T4 DNA ligase, and the reaction product was transferred to E. coli HBIOI.
The cells were transformed into competent cells (Takara Shuzo).

Plasmid DNA was prepared from the obtained colony exhibiting ampicillin resistance, and a restriction enzyme map was prepared to obtain the target plasmid pcDM-CSF11-185-dhfr.

In this plasmid, the M-CSF11 DNA of the pcDM-csFll-dhfr plasmid is M-CSF1.1-1.
This is a plasmid converted into 85 DNA, and other than that, it is completely identical to the pcDM-CSF11dhfr.

A transformant obtained by transforming the plasmid into Escherichia coli HB 101 strain is Escherichia coli HB101.
hia colt HB 101/pc DM
- CSF 11-185-dhfr, 19
On December 26, 1988, the Institute of Microbiological Technology, Agency of Industrial Science and Technology submitted the FERM BP-222 No. 2223 (FERM BP-222
It has been deposited as 3).

[Phase] Expression in CHO cells - Plasmid pcDM-CSF11185 obtained in Section 0
-dhfr to CHO-D according to the method shown in @ above.
The cells were introduced into uk dhfr- cells, the introduced cells were cultured, and finally 50 clones showing resistance to 400 nM MTX were obtained.

Six clones were selected from among these resistant clones, and the CSF activity of their culture supernatants was measured.

The results are shown in Table 8 below.

Table 8 However, the CSF activity unit (U/Peng) was calculated using the above formula (a).

The CHO cells (clone No. 4-12) obtained above were cultured in the same manner as in ① above, and purified (Con A-Sepharose chromatography, TSK Gelkel AE-5
PW ion exchange HPLC, gel filtration HPLC1 reverse phase HP
LC and TSK Gelkel AE-5PW HPLC).

In addition, M-C, which is the target protein in each of the above purification steps,
SF was detected by the Western blotting method described above.

Regarding the M-CSF fraction obtained in the final step of the above purification,
After SDS-PAGE was performed in the same manner as in ① above, the molecular weight was examined by Western blotting.

In addition, after performing isoelectric focusing in the same manner as in (8) above, a staining method using Coomassie Brilliant Bull R250 and a Western blotting method using a 1% acetic acid solution containing 10% methanol as a transfer buffer were performed. MCSF was detected by

As a result, the molecular weight of the M-CSF was 4 under non-reducing conditions.
2000.46000 and 39 as a minor component
000 molecular species were also observed. Under reducing conditions, the molecular weights of the main components were 22,000 and 27,000, and a band at 16,000 was also detected as a minor component.

In addition, the isoelectric point (pi) of the M-CSF is 3.5 to 4.6
It was confirmed that it mainly consists of five types of molecular species.

■ M-CSF expression plasmid pR8VS-MCS F
1. Preparation of 11-dhfr DHFR expression plasmid pR8Vdh obtained above
The DHFR gene portion was removed by cutting fr with restriction enzymes HindIII and Bgll, and both ends of the resulting fragment were converted to 5all ends using a 5alI linker (Takara Shuzo Co., Ltd.), and then ligated with 74 DNA ligase. Plasmid pR8V-8 was obtained.

Next, the obtained plasmid pR8V-8 was treated with restriction enzyme Ba.
After cutting with mHI, the ends were made blunt with DNA polymerase, and further cut with restriction enzyme NdcI to create R5.
A DNA fragment containing V-LTR was isolated and purified.

On the other hand, plasmid pSV2-dhfr (Mo1
．． Ce1l.

Biol, 1,854 (1981)) was digested with the restriction enzyme EcoRI, and a CIaI cleavage site was added using a CIaI linker (Takara Shuzo Co., Ltd.) to create the plasmid pS.
V2-dhfr-EC was produced, the plasmid was cut with restriction enzymes NdeI and PvuII, and a DNA fragment containing the DHFR gene was isolated and purified.

The two DNA fragments purified above were ligated using T4 DNA ligase to create plasmid p.
RS V S dhfr was obtained.

In addition, the plasmid pcDM separately prepared in the above [phase]
- CSFII-dhfr is cut with the restriction enzyme EcoRI to isolate the M-CSF gene, and both ends are 5a
The plasmid pRS V 5-d obtained above was converted into a Sat■ end using an lI linker (Takara Shuzo Co., Ltd.).
It was ligated to the 5alI site of hfr using T4 DNA ligase, and the ligated product was transformed into E. coli HB101 (Takara Shuzo Co., Ltd.).

The thus obtained M-CSF expression plasmid pR3VS
-MCSF 11-dhfr was mapped with restriction enzymes and confirmed to be the desired plasmid.

Its structure is shown in FIG.

As shown in Figure 22, the above plasmid contains the LTR portion of R8v (R3V-LTI?) involved in M-CSF expression,
M-CS F I1 Yuko ('M-C8I'), S V
40-derived intervening sequence (SV401ntron), po
IyA addition signal (SV40 polyA), DHF
Bad Hatsutomo 7' related to R expression.

Motor part (SV40 early), DHFR gene (dhfr), SV40-derived intervening sequence (SV401
ntron), polyA addition signal (SV40 p
olyA) and further contains the E. coli plasmid pBR32
Contains a bivalent origin of replication (pBR322ori) and an ampicillin resistance gene (Apr).

Φ M-CSF expression plasmid psV2sMCS F
1. Preparation of 11-dhfr DHFR expression vector pSV2-dh prepared in ① above
fr-EC was treated with restriction enzymes H1ndIff and BglII.
After removing the DHFR gene and making both ends into 5alI ends using a 5alI linker, T
4 using DNA ligase to create plasmid pS.
V2-8 was obtained.

On the other hand, plasmid pRS V -dhfr was cut with restriction enzyme NdeI, both ends were made into BamHI ends with BamHE linker (Takara Shuzo Co., Ltd.), and restriction enzyme B
DNA containing the DHFR gene cut with amHT
The fragment was isolated and purified.

The obtained DNA fragment was inserted into B of the above plasmid psV2-8.
The amHI site was ligated using 74 DNA ligase to create plasmid pSV2S-dhfr.

Separately, the M-CSF expression plasmid pcDM life CSFII-dhfr was cut with the restriction enzyme EcoRI to isolate the M-CSF gene, and both ends of the 5a
Use a lI linker to create a 5alI end, and add T4 to the 5alI site of the above plasmid pSV2S-dhfr.
．． The ligation was performed using DNA ligase and the ligation was transformed into E. coli HBIOI.

The resulting plasmid was transformed into the target plasmid psV2s-MCS F by restriction enzyme mapping.
It was confirmed that it was 11-dhfr.

Its structure is shown in FIG.

As shown in FIG. 22, the above plasmid contains a portion of the SV40-derived early promoter (SV40 early), M
-CSF Shoden (M-CSF), SV 40 Yamato intervening sequence (SV401ntron), polyA addition signal (SV40polyA), R3V LTR portion (R8V-LTR), DHFR gene (dhfr), S
Intervening sequence derived from V40 (SV401ntron), p
It contains the olyA addition signal (SV40 polyA), and further contains the replication origin of the E. coli plasmid pBR322 (pBR322ori) and the ampicillin resistance gene (Ap').

■ M-C5F expression plasmid pCDM-CSF11-
Preparation of dhfrRO The DHFR expression vector pRS V -dhfr was cut with the restriction enzyme BamHI, the cleavage site was made into a 5alI end using a 5aiI linker, and then the restriction enzyme NdcI
and the cleavage site was replaced with C1aI linker.
1aI end, plasmid pR8Vdhfr-C
S was produced.

This plasmid was cut with restriction enzymes C1aI and 5alI, and a DNA fragment containing the DHFR gene was isolated and purified.

Separately, M-CSF expression plasmid pcDM・CSFI
I was cut with restriction enzymes C1aI and 5alI to obtain M
- Isolate and purify the DNA fragment containing the CSF gene, and add the DNA fragment containing the DHFR gene obtained above to it.
4 DNA ligase, and the ligated product was transformed into E. coli H.
It was transformed into B101.

From the thus obtained plasmid, it was confirmed by restriction enzyme mapping that the transcription directions of the M-CSF gene and the DHFR gene were opposite, and the target plasmid p
cDM-csF11-dhfrRO was obtained.

Its structure is shown in FIG.

As shown in Figure 22, the above plasmid contains a portion of the SV40-derived early promoter (SV40 early), an intervening sequence (SV401ntron), the M-CSF gene (M-CSF), and a polyA addition signal (SV
40 polyA) and the LTR portion of R8V (R8V-LTR), DHF with the transcription direction opposite to these.
R gene (dhfr), intervening sequence derived from SV40 (SV
401ntron), polyA addition signal (SV
40 polyA), and the replication origin of E. coli plasmid pBR322 Yamaki (pBR322or
i) and an ampicillin resistance gene (Apr).

[Phase] Introduction of M-CSF expression plasmid into CHO cells and expression of M-CSF Introduce each M-CSF expression plasmid prepared in [Phase], ■, ■, ■, and [Phase] above into CHO cells. to express M-CSF.

The CHO cells used as hosts were CHO-dhfr-DG.
44 cells (Somatic Cell and Mo1
ecularGenetics, 12 (6), 5
55 (1986)).

The methods of plasmid introduction, CHO cell culture, and gene amplification using MTX were as described in @ above.

Cells introduced with each plasmid were incubated with 400 n MMT.
Resistant clones obtained by culturing in a selective medium containing X,
Subsequently, the cells were cultured in the same medium containing 1 μM MTX, and the cell lines that were observed to grow in this medium were further cultured in the same medium containing 3 μM MTX to obtain resistant clones.

The 3 μM MTX resistant clone thus obtained was
The cells were cultured in a 4-well plate (manufactured by Coaster), and when the cells proliferated over the entire culture surface, the cells were collected, and 115 volumes of the cell suspension was added with 10% beef tallow serum without MTX. The cells were newly inoculated into a 24-well plate containing 1 volume of DMEM medium containing 1 volume of DMEM, and after culturing for 6 days, the culture fluid was collected.

All of the obtained culture supernatants were examined for the presence or absence of M-CSF production by Western blotting.
- CSF was investigated by molecular weight measurement, and the activity of M-CSF was measured for specimens in which a significant amount of M-CSF was found to be produced.

The results are shown in Table 9 below.

All the M-CSF expression plasmids used in Table 9 showed expression of M-CSF in CHO cells.

In addition, M
-All molecular weights of CSF are CHO-D as described in @ above.
M- obtained when using uk dhfr- cells as hosts
It was equivalent to that of CSF (CHO・M-CSF).

Example 3 2. Recombinant M-CSF (rMCS) by cistron method
F) Production ■ M-CSF expression plasmid ptrplL-2X・M
-Preparation of CSFIOI Plasmid pcDM/CSFI obtained in Example 2 above
1-185 was digested with restriction enzymes 5caI and BamHI to obtain a ScaI-BamHi DNA fragment (approximately 450
bp) was isolated and purified by agarose gel electrophoresis.

Next, the following synthetic linker (I) was ligated to the 5caI cut end of the obtained DNA fragment using T4 DNA ligase to create an XbaI-BamHI DNA fragment (approximately 480
bp) was obtained.

Synthetic linker (I): 2nd SD terba 1 tart (Box) GAA T -3° The thus obtained DNA fragment was transformed into a human IL-2 expression plasmid ptrp IL-2D8Δ (Japanese Patent Laid-open No. 63-12
958) into the XbaI and BamHI cleavage sites to create the desired plasmid ptrpIL-2X-M.
- CSFIOI was obtained.

The transformant obtained by transforming the plasmid into Escherichia coli HBIOI strain was
ia coli HB 101/ptrp IL-
Under the name 2X-M-CSFIOI, it was submitted to the Institute of Microbial Technology, Agency of Industrial Science and Technology on December 26, 1988 as FERMB P-2226.
It has been deposited as.

The thus obtained plasmid p trp IL-2
In X.M-CSF 101, two types of polypeptides are encoded within the transcription unit under the control of the E. coli tryptophan promoter. One of them is methionine at the initiation of translation, 60 amino acids on the amino terminal side of human IL-27, and interdystronic (intcrcistron).
ic) is a 65-amino acid polypeptide consisting of 4 amino acids encoded by the sequence; the other one is methionine at the start of translation and the 35th amino acid (V a
151 from l) to the 185th amino acid (Thr)
It is a polypeptide with a total of 152 amino acids consisting of the amino acid human M-CSF.

In such a two-cistron expression system, the second cistrone (2nd cistrone)
Translation of stron) is initiated by liposome binding to a second SD sequence placed within the interdystronic sequence.

First, we will outline the structure of the two-cistronic expression system.
It is shown in Figure 5.

■ M-CSF expression plasmid ptrp IL-2X・
Preparation of M-CSF102 The following linker (
The desired plasmid ptrpI, which differs only in the intagystronic sequence, is prepared in the same manner except that ptrpI) is used.
L-2X-M-CSF102 was obtained.

The above structure is shown in FIG.

Synthetic linker (■): Synthetic linker (■): 2nd 5D ter ter 5tart (Box) 2nd SD ter ■ M-CSF expression plasmid ptrplL-2X・M
-In the preparation of CSF 103, the following linker (
The desired plasmid ptrp IL-2X MφCSF103 was obtained in the same manner except that III) was used.

(BOX) GTA TCA AA T-3 CAT AGT CTT A ea I The plasmid has methionine at the start of translation and the 33rd amino acid (in Figure 5) in its second cistron.
It is characterized by encoding a polypeptide with a total of 154 amino acids consisting of 153 amino acids of human M-CSF from the 185th amino acid (Glu) to the 185th amino acid (Thr).

-The above structure is shown in FIG.

■ M-C5F expression plasmid ptrplL-2X-M
-CSF104, same ptrp IL-2X・M-CSF
105 and the same ptrp IL-2X-M-CSF106
Preparation of plasmid pcDM・C'5FI in the above ■ to ■
The following desired plasmids were obtained in the same manner using the plasmid pcDM-CSF-185 obtained in step 1 of Example 2 above in place of I-185.

0 plasmid ptrp IL-2X MφCSF10
4 [Linker (I) was used as a synthetic linker.

Its structure is shown in Figure 18], ○ plasmid ptrp
IL-2X-M-CSF105 [Linker (II) was used as a synthetic linker. The structure is shown in Figure 19] and O plasmid ptrp IL-2X-M-CSF
106 [Linker (m) was used as a synthetic linker. Its structure is shown in FIG. 20].

+Z plasmid ptrp I L-2X-M-CS
The transformant obtained by transforming F104 into Escherichia coli H8101 strain is E5chcrichi.
aco11/ptrp IL-2X-M-CSF104
On December 260, 1988, the Institute of Microbiological Technology, Agency of Industrial Science and Technology submitted the FERM
BP'-2225).

■ Introduction of M-CSF expression plasmid into E. coli and culturing of transformants Each of the plasmids obtained in steps (1) to (2) above was incubated with E. coli strain 5G21058 (J, Bactcriol, 16
4゜1124-1135 (1985)) by the transformation method, and the produced protein was subjected to SDSPAGE.
and analyzed by Western blotting method.

That is, E. coli 5G2105 carrying each of the above plasmids
8 in a 300 volume flask, 1% casamino acid, 0.4
% glucose, 5 μg/threshold thiamine hydrochloride, 20 μg/m
After culturing with shaking at 37°C for 8 hours in M9 medium 50ml supplemented with QL-cysteine and 50 μg/rrvQ ampicillin, the cells were collected by centrifugation (5000 rpm, 5 minutes, room temperature), and the produced protein was recovered. An analysis was conducted.

Note that detection of M-CSF by SDSPAGE and Western blotting was performed according to 0 of Example 2 above.

In the case of culturing E. coli transformed with the plasmid described in - (2), significant production of polypeptides with molecular weights of 8 kd and 17 kd was confirmed in CBB staining images of SDS-PAGE under reducing conditions. These two types of polypeptides are
The former is the first cistron.
), the latter matched the expected molecular weight of the polypeptide encoded by the second cistron, respectively.

Analysis by Western blotting using an anti-human IL-2 antibody and an anti-human M-CSF antibody revealed that the 8 kd polypeptide is a first cistron translation product containing the N-terminal 60 amino acids of IL-2, Same 1
The 7kd polypeptide was confirmed to be a second cistronic translation product containing M-CSF.

In addition, as a result of analyzing E. coli cultures transformed with each of the plasmids ① to ① above in the same manner as above, all of them were found to be second cistronic translation products (M-CSF).
) generation was confirmed.

(2) Isolation and purification of M-CSF (1) Preparation of M-CSF fraction from E. coli 1.5 g (wet weight) of E. coli carrying the plasmid ptrp IL-2X-M・CSFIOI obtained in (1) above was added with 0.0 g of E. coli (wet weight). 50mM Tris-HCl buffer containing 5M sucrose (pH 7.0) 50r
WQ was added and thoroughly stirred. Next, 2 mg of lysozyme
/mf2 6 precepts, followed by 0.14M EDTA4mQ
was added, stirred at 4℃ for 15 minutes, and after treatment, 1000
Centrifugation was performed for 20 minutes at 0 revolutions/min.

The supernatant was discarded, and the precipitate was added to the same buffer (containing 0.5M sucrose).
0mM) Liss hydrochloric acid, pH 7,0) and the same <
Centrifugation was performed at 10,000 rpm for 20 minutes to obtain sphnyloplasts as a precipitate. Then add 50 to this
Add 50 mQ of Lith-HCl (mM) Lith-HCl (pH 7,0) to suspend, perform ultrasonication at 20 KHz for 10 minutes, then centrifuge at 10,000 rpm for 20 minutes, and add the same buffer (50 mM) Li-HCl, pH 7. After washing with ,0),
Centrifuge again under the same conditions to obtain M-CS as a precipitate.
F fraction was obtained.

(2) Reconstitution of M-CSF from M-CSF fractions (
7.0 M
50mM) lithium hydrochloride (pH 7.0 containing guanidine hydrochloride)
100% of the solution was added and stirred with a stirrer at 4° C. for 1 hour to dissolve. This solution was gradually added dropwise into a beaker (stirred with a stirrer) containing 300% of 10mM Tris-HCl (pH 8,5), and after the addition was completed, 4°C was added to 10mM Tris-HCl (pH 8,5). The mixture was thoroughly dialyzed at C.C., and then centrifuged at 10,000 rpm for 20 minutes to remove the precipitate and obtain a supernatant.

Reconstituted M-CSF is present in the supernatant thus obtained.

(3) Purification of M-CSF The M-CSF obtained in step (2) was purified as follows according to the method shown in [Phase] of Example 2 above.

(3-1) Gel filtration high performance liquid chromatography The centrifuged supernatant obtained in (2) above was filtered using an ultrafilter (manufactured by Amicon,
Membrane: YM-10 membrane (manufactured by Amicon) was used for concentration, and the concentrated solution was passed through a 0.45 μm Millipore filter, followed by gel filtration high performance liquid chromatography under the following conditions.

Column: TSK Gel G3000SW (60 membranes x 2
1, 5+nm1. D., manufactured by Toso Corporation) Eluent: 0.
50mM sodium phosphate buffer containing 3M NaCQ (pH 6,8) Flow rate = 3.0 threshold/min Fraction volume: 6+11Q/tube/2 min In the above, standard protein for gel filtration HPLC (manufactured by Oriental Yeast Co., Ltd.) Judging from each elution position, namely glutamate debydrogenase (molecular weight 290,000), lactate debydrogenase (molecular weight 142,000), enolase (molecular weight 67,000) and adenylate kinase (molecular weight 32,000), the molecular weight of M-CSF is 32,000. It was estimated that

The active portion was separated and solvent exchanged with 40 mM sodium borate (pH 8,0) using the ultrafilter.

(3-2) TSK gel DEAE-5PW ion exchange high performance liquid chromatography The active elution fraction obtained in (3-1) above was subjected to TSK gel DEAE-5PW under the following conditions.
It was subjected to SK Gelkel AE-5PW ion exchange high performance liquid chromatography.

Column: TSK Gelkel AE-5PW (7.5mm1
．． D, X75mm, Toso Corporation) Eluent A: 5%
Methanol-containing 4-containing 4-small eluent B: 1. OM Na
40mM sodium borate buffer containing CQ and 5% methanol (pH 8.0) Flow rate = 1.0/min Fraction volume: 1.0m12/1f/min Concentration gradient 2 hours (min) %B TSK Gelkel AE above -5PW ion exchange high performance liquid chromatography results (elution pattern) are shown in FIG. In the figure, the vertical axis shows protein absorbance (A28o) and NaCQ concentration (M) at 280 nm, and the horizontal axis shows fraction no. shows.

In addition, the horizontal arrow (-) in the figure indicates M-CSF activity.

” From the bipedal diagram, fraction no. 42-43 (0.2
The peak observed at a concentration of 3 to 0.25 M NaCQ corresponds to M-CSF.

M-CSF was obtained from E. coli by collecting the peaks.

(3-3) N-terminal acid amino acid sequence of M-CSF In the same manner as in (6) of [phase] of Example 2 above, the M-CSF obtained above
-The N-terminal acid amino acid sequence of CSF was determined.

As a result, the following was confirmed.

Met-Val-Ser-GIu
- Tyr - (4) SDS-PAGE of M-CSF According to Laemmli's method, the MCSF concentrate obtained in (3-2) above was added to Laemmli's sample buffer [both 2-ME+ and 2-ME-]. Dissolve in each and incubate at 95°C for 5 minutes.
After heat treatment for a minute, SDS-PAGE was performed under the following conditions.

Gel: 12% polyacrylamide gel with a thickness of 1.5 mm was used.

Electrophoresis device Nibrothian (manufactured by Bio-Rad Laboratories) Electrophoresis conditions: Stacking gel at constant current of 20 mA.

Approximately at 30mA of separating gel Run for 4 hours.

Use dyeing Nisil Burst kit (manufactured by Wako Tsumugi Pharmaceutical Co., Ltd.).

Molecular weight marker: Electrophoresis calibration kit (
(manufactured by Pharmacia) was used.

From the above SDS-PAGE results, M-CSI, t
2-M E-state Teha molecular weight approximately 29500, 2-M E
In the + state, the molecular weight was estimated to be 17,400, and each of these positions migrated as a single band.

(5) Reconstitution of M-CSF Plasmid ptrp obtained in ① above IL-2X-M・C
0 to 7.5 g (wet weight) of E. coli harboring SF101.
．． 50mM Tris-HCl buffer (pH 7) containing 5M sucrose
, 0) was added to make a threshold of 100, and the mixture was thoroughly stirred. Next, lysozyme 24mg/+nQ for 6 thresholds, followed by 0.14M
Add EDTA4 and stir at 4°C for 15 minutes.
After the treatment, centrifugation was performed at 10,000 rpm for 20 minutes.

The supernatant was discarded, and the precipitate was added to the same buffer (containing 0.5M sucrose).
0mM)-Lis-HCl, pH 7,0) and the same <
Centrifuge at 10,000 rpm for 20 minutes,
Sufu upper mouth plast was obtained as a sediment.

This was then added with 50mM) lithium-hydrochloric acid (pH 7,0) 10
01TII2 was added, suspended, and ultrasonicated (200K).
Hz, 2 minutes, 200W), then 1000W
Centrifugation was performed for 20 minutes at 0 revolutions/min. The resulting precipitate was thoroughly washed with 50mM Lis-HCl (pH 7.5) containing 2% Triton X-100, and centrifuged again under the same conditions to obtain an M-CSF fraction as a precipitate.

The M-CSF fraction obtained in this way was added with 50mM guanidine hydrochloride and 25mM mercaptoethanol
20 thresholds of M Tris-HCl (pH 7,5) was added and stirred at room temperature for 4 hours to reduce, denature, and dissolve the protein. This solution was mixed with 0.5mM reduced glutathione, 0.1mM
40mM Tris-HCl (pH 8.5) containing oxidized glutathione and 2mM urea was gradually added dropwise to 100ml while stirring with a stirrer.
Diluted twice. After completion of the dropwise addition, the mixture was left to stand at 4° C. for 1 to 2 days to obtain reconstituted M-CSF.

(6) Isoelectric focusing of M-CSF The isoelectric point of M-CSF obtained in (5) above was measured as follows.

That is, as a gel, the pH is 3.5 to 9. Gel for 0 (LKB
100 μQ of M-CSF was applied using Ampholine PA Gel (manufactured by Ampholine PA Gel), electrophoresis was started with IW per 1 cm gel width, and after the current became constant, electrophoresis was continued for an additional 30 minutes. Humidity during electrophoresis is controlled by a cooler (Cool Flow CFT-2)
5, Neslab) was maintained at 10°C.

After the above electrophoresis, the gel was cut out at 5 mm intervals, placed in 1 mQ of 50 mM sodium borate (pH 8,0), elution was performed for 24 hours, and the CSF activity of the eluate was measured.

In addition, cut the above gel into 1cm intervals, and add 1rrlQ of distilled water.
After shaking for 24 hours, the pH was measured using a pH meter.

The above results confirmed that the isoelectric point of M-CSF was pH 4.8.

Brief description of the drawing FIG. 1 shows a restriction enzyme map of the cDNA of λcM5.

Figure 2 (Figure 2-1 to Figure 2-4) shows the above λc M determined by the Maxam-Gilbert chemical modification method and the dideoxynucleotide chain termination method using M13 phage.
The base sequence of cDNA No. 5 is shown.

Figure 3 (Figure 3-1 to Figure 3-2) shows the M-CSF precursor protein encoded by the above cDNA.
The following structure is shown.

Figure 4 (Figure 4-1 to Figure 4-4) shows the c of λcM11.
The DNA base sequence is shown.

Figure 5 (Figure 5-1 to Figure 5-3) shows the c of λcM11.
The protein structure of the M-CSF precursor protein encoded by DNA is shown.

Figure 6 shows a schematic diagram of the construction of the COS cell expression vector pcDE.

Figure 7 shows the M-CSF expression plasmid pcDM・CSF.
A schematic diagram of the fabrication is shown.

Figure 8 shows the M-CSF expression plasmid pcDM・CSF.
A schematic diagram of the preparation of II-185 is shown.

Figure 9 (Figure 9-1 to Figure 9-3) shows the M-CSF expression plasmid p I N-m (lpp''-5)-O
A schematic diagram of the production of mpA-MCSF1i NV151 is shown.

Figure 10 shows the M-CSF expression plasmid pIN-m (
lpl) p-5)-OmpA-MCSF11-NV1
51 is shown.

FIG. 11 shows the M-CSF expression plasmid pIN-mc
lpp p-5) -OmpA-MCSF i 1-N
The amino acid sequence encoded by V143 is shown.

Figure 12 (Figure 12-1 and Figure 12-2) shows the CSF
A schematic diagram of the construction of the expression plasmid pcDM-csFll-ahrr is shown.

Figure 13 shows CHO・M-CS obtained by TSK Gerkel AE-5PW ion exchange high performance liquid chromatography.
The elution pattern of F is shown.

FIG. 14 is a graph showing the isoelectric point measurement results of CHO-M-CSF.

15 to 20 show the structures of bicistronic expression systems according to Example 3 (1) to (3), respectively.

FIG. 21 shows the elution pattern of MCSF by TSK Gelkel AE-5PW ion exchange high performance liquid chromatography.

Figure 22 shows M-CSF expression plasmid pcDMφC
SF 11-dhfrRO, pSV2S-MCS
F 11-dhfr and pR8VS-MCSF11-
Each structure of dhfr is shown.

(That's all) Figure 2-1 ATGGGGTTTCGGTAGGGATCGTCAC
TGGGCCGGAGACAGA GGGGAGTA
GT Figure 2-2 TTCGGτGAGG AGCCCGCACG A
CGGGAACCCCTCGACCTCCCGTCCT
CCTCCACCAGGGAT CGGAGGAGCC
CCGCAGAGCCAGAAGGAGGA CCAG
CMGTGGTGGTCCCτA GCCTCCTCG
G GGCGTCτCGG TCTTCCTCCT
GGTCGTTCACFigure 2-5 Eva C7A Moshi ATCGGGAGGGTCACACCGGGGACGTGTA, 8CTA CTC
ACGGACG Figure 2-4 ATATAGTTAA ACGTGAATTT TTT
TTTTTTTT TTTTTTTTFigure 3-2Figure 3-1Arg-Thr-Phe-Tyr-Glu-τhr-P
ro-Leu-Gln-Leu-Leu-Glu-Ly
s-Val-Lys-Leu-Ala-Pro-5e
r-Meshi-Ala-Pro-Val-Ala-Gly
-LeIJ-Thr-Trp-Glu-Asp-4th-
Figure 1 ATGGGGTTTCGGTAGGGATCGTCAC
TGGGCCGGAGACAGA MolaGGAGTA
G-dou No. 4-2 TCCTCCτCGT GGTCCCTAGCCTC
CTCGGGG CGTCTCGljTCT'l'U
UT1. ;U'AuuFigure 4-4 AACCGATTAT CATATAGTTA A
ACGTGAATT TTTTT'! -1'TTT
'L°'L"K'↓TT'L-に'LFigure 4-3 CT, AATTCTGT CATCTCCGTA GC
CCTCCCAG TTGTGCCTCCTGACA
TTGAGAτTAAGACA GTAGAGGCAT
CGGGAG to GTCMCACGGAGG ACGT
GT product CT Figure 5-1Le+q-Ala-Pro-5et-Meshi-Ala-
Pro-Va top-ha↓a-G engineeringy-Leu-'rnr-
Trp-Gfu-ASp-Figure 5-2Figure 5-3Figure 5et-pro-Leu-Thr-Gin-Asp-A
sp-Ar9-tJ on n-Vaf-(jfu-4,l!
u- to 'rO-'/aQ----5e r-Ala-
Leu-Leu-Arg-As p-P ro-P r
o-Gl u-P ro-Gly-5e t-P r
o-Arg-Ile-TCA, TCA, CC
G, CGC, CCC, CAG, GGC, CTC, AGC
, AAC, CCC, TCC, ACC, CTC, TCT.

Ser-Ser-Pr o-A rq
-P I:O-G l n -G I Y -Le
u -Se r -A Sn -P r O-Se r
-Th r -L e u -S e r -r'
r O-L eu -G I Y -G 1. u
-L eu -G lu -G ly-A r
q -A r 9- S e r -T h r -A
r 9- A Sp-A r q -A r 9-
Figure A Figure 10 Figure 11 Gly-Ser-Gly-Hi 5-Leu-G 1
n-9e r-Leu-Gl n-Arg-Leu-I
1e-Asp-5e r-Gln-Me t-G
1u-Thr-! lie r-Cys-Gln-X 1
e-Th r-Pl'+e-G nu-Phe-Va
l-Asp-Gln-Glu-G 1 n-Leu-
Lys-Asp-Pro-Va 1-Cys-Tyr
-Leu-Lys-Lys-Ala-Phe-Leu-
Leu-Val-Gln-Asp(le-MeSeG
lu-Asp-Thr-Me7-Arg-Phe-Ar
g-Asp-Asn-Thr-Pro-Asn-Al
a-X 1e-Ala -X 1e-Va 1-Gin
-Leu-GI II-Glu-Leu-4je r-
Leu-Arg-Leu-Lys-5e r-Cys-
Phe-Thr-Lys-Asp-Tyr-Glu
-Glu -HLs-Asp-Lys-Ala -Cy
s -Val-Arg-Thr-Ph e-Ty
r-Glu-Thr-Pro-Leu-Gln
-Leu-Leu-G 1u-Lys -%'al
-Ly 5-As n-Va 1-Ph e-As n
-G 1u-Thr-Ly 5-Asn-Leu-Le
u-As p-LyS -As p-Tr p-As
n -11e-Phe-5e r-Lys-As n
-Cys-As n-As n-5e r-Phe-A
la-Glu-cis-9er-5er-Gln-
Asp-Val-Val-ThrGly-6er-Gl
y-Hls-Leu-Gin-Ser-Leu-Gin
-Arg-Leu-11e-A'ip-5er-Gln
-MeHe Glu-Thr-5e r-Cy s-G
ln-X le-Th r-Phe-Glu-Ph
e-Va 1-Asp-G 1n-G l u -G
ln-Leu-Lys-Asp-Pro-Val
-Cys-Tyr-Leu-Lys-Lys-Ala-
Ph e-Le u-Leu -Val-Gln-A
sp-11e-MeGlu-Asp-Thr-Me
t-Arg-Phe-Arg-Asp-Asn-Thr
-Pro-Asn-Ala-11e-Ala-Ile-
Val-Gin-Leu-Gln-Glu-Leu-5
er-Leu-Arg-Leu-Lys-5er-Cy
s-Phe-Thr-Lys-Asp-Tyr-Glu
-Glu-His-Asp-Lys-81a-Cy 5
-Val-Ar g-Th r-Phe-Tyr-G
l u-Th r-P r o-Leu-Gin-L
eu-Leu-G l u-Lys ・-Val-Ly
s-Asn-Val-Phe-Asn-Glu-Thr
-Lys-Asn-Leu-Leu-Asp-Lys-
Asp-Trp-85n-Xle-Phe-5er-L
ys-Asn-Cys-Asn-Asn-5er-Ph
e-Ala-Glu-Fig. 12-1 Distance of cathode 5 (cm) Fig. ATG, GCJLCCT+ AAT, GTC-TTT, AAT, GAA, ACA, A
AG, AAT, CTC, CTT, GAC-AAG-GA
C, TGG, AAT-GLn-Asp-Val-Val
-T! 'Ir 辷er ｜ｲﾞｲﾞｲﾞｲﾞｲﾞｲﾞﾞﾞﾞﾞﾞﾞﾞﾞﾞ
er ter eup-CSF -4 19th tu-eup-1:':F -1inch- ATG +GCA +CCT+

Claims (1)

[Scope of Claims] 1. A biologically active recombinant human M-CSF gene that is obtained by expressing a human M-CSF gene encoding the entire amino acid sequence of the following formula (1) or a partial amino acid sequence lacking a portion thereof.
C.S.F. Formula (1): [There is a gene sequence] [There is a gene sequence] [In the formula, X represents Tyr or Asp. ] (2) The recombinant human M-CSF according to claim (1), which has the following physicochemical properties. B. Molecular weight: Approximately 38,000 in the presence of 2-mercaptoethanol and approximately 760 in the absence of 2-mercaptoethanol by SDS-PAGE
It is 00. B. Isoelectric point: pH 4.55. C. Amino acid sequence of amino terminal region: Glu-Glu-Val-Ser-Glu-Tyr-. (3) The recombinant human M-CSF according to claim (1), which has the following physicochemical properties. B. Molecular weight: According to SDS-PAGE, it is about 22,000 and about 27,000 in the presence of 2-mercaptoethanol, and about 42,000 and 46,000 in its absence. b. Isoelectric point: pH 3.5 to 4.6. C. Amino acid sequence of amino terminal region: Glu-Glu-Val-Ser-Glu-Tyr-. (4) The recombinant human M-CSF according to claim 1, which has the following physicochemical properties. B. Molecular weight: Approximately 17,000 in the presence of 2-mercaptoethanol and approximately 300 in the absence of 2-mercaptoethanol by SDS-PAGE.
It is 00. B. Isoelectric point: pH 4.8. C. Amino acid sequence of the amino terminal region: (Met)-Val-Ser-Glu-Tyr- [including cases where (Met) is deleted]. (5) Human M-CSF produced by culturing a transformant carrying an expression plasmid containing the human M-CSF gene according to claim (1) and capable of expressing biologically active human M-CSF.
A method for producing recombinant human M-CSF by collecting CSF. (6) The method according to claim (5), wherein the transformant uses a CHO cell as a host. (7) The method according to claim (5), wherein the transformant uses a COS cell as a host. (8) The method according to claim (5), wherein the transformant uses E. coli as a host. (9) The method according to claim (8), wherein the expression of human M-CSF is by the 2-cistron method.