WO2002006491A1

WO2002006491A1 - Isopentenyl pyrophosphate isomerase

Info

Publication number: WO2002006491A1
Application number: PCT/JP2001/006120
Authority: WO
Inventors: Haruo Seto; Tomohisa Kuzuyama; Kazuhide Kaneda
Original assignee: Center For Advanced Science And Technology Incubation, Ltd.
Priority date: 2000-07-18
Filing date: 2001-07-16
Publication date: 2002-01-24
Also published as: JPWO2002006491A1; AU2001269527A1

Abstract

A novel isopentenyl pyrophosphate isomerase; and a gene coding for the same. An enzyme protein having the following physicochemical properties and having an isopentenyl pyrophosphate isomerase activity is provided. Function: It isomerizes isopentenyl pyrophosphate (IPP) to yield dimethylallyl pyrophosphate (DMAPP). It isomerizes DMAPP to yield IPP. Substrate specificity: It acts on isopentenyl pyrophosphate (IPP) as a substrate. It acts also on DMAPP as a substrate. Reaction conditions: A divalent metal ion, FMN, and NADPH are essential to the isopentenyl pyrophosphate (IPP) isomerase activity.

Description

Specification

Isopentenyl diphosphate isomerase Technical Field

The present invention relates to a novel isopentenyl diphosphate isomerase. More specifically, the present invention relates to isopentenyl diphosphate isomerase having the activity of isomerizing isopentenyl diphosphate (IPP) to form dimethylaryl diphosphate (DMAPP). Background art

There are two pathways for isopentenyl diphosphate (IPP) synthesis in vivo, the mevalonate pathway and the non-mevalonate pathway. Humans use only the mevalonate pathway. Many eubacteria use only the non-mevalonate pathway, while Staphylococcus aureus and others use the mevalonate pathway.

A series of compounds in which a plurality of IPPs are sequentially condensed with DMAPP is called isoprenoid. Examples include carotenoids and steroids.

In prokaryotes, the reactions of the non-mevalonate pathway and all the enzymes involved in it have not yet been elucidated. In prokaryotes, if all the reactions of the non-mevalonate pathway and the enzymes involved in them can be elucidated, there is a possibility that new and useful antibacterial agents can be developed by searching for drugs that inhibit them. Disclosure of the invention

The present inventors have previously obtained a DNA fragment containing a gene cluster encoding a group of enzymes of the mevalonate pathway from Streptomyces sp. Strain CL190 of Streptomyces. Specific names of these enzymes are mevalonate kinase, diphosphomevalonate decarboxylase, phosphomevalonate kinase, HMG-CoA reductase, and HG-CoA synthase. These five enzymes combine IPP from the body substance acetoacetyl CoA. (Japanese Patent Application No. 1 1- 3 4 8 3 7 5). However, it was found that the DNA fragment containing the gene cluster further contained one gene of unknown function.

The problem to be solved by the present invention is to elucidate the functions of the above-mentioned unknown genes in the gene class encoding a group of enzymes of the mevalonate pathway isolated from Streptomyces sp. Strain CL190. It is.

Another problem to be solved by the present invention is to obtain a novel isopentenyl diphosphate isomerase and a gene encoding the same.

Yet another object of the present invention is to provide a novel method for producing dimethylaryl 2-phosphate and IPP using an enzyme obtained by expressing a large amount of a gene encoding isopentenyl diphosphate isomerase. It is to be.

The present inventors have conducted various studies to clarify the functions of the above-mentioned genes whose functions are unknown. As a result, this gene encodes a novel IPP isomerase having the following properties. I found that. The present invention has been completed based on these findings.

The gene sequence encoding the IPP isomerase of the present invention does not show any homology with the gene sequence of a known IPP isomerase. Further, the amino acid sequence of the IPP isomerase of the present invention does not show any homology to the amino acid sequence of the known IPP isomerase. In addition, the IPP isomerase of the present invention does not proceed under known IPP isomerase reaction conditions, and produces DMAPP in a buffer containing divalent metal ions such as magnesium ions, FMN and DPH. I understood.

That is, according to the present invention, there is provided an enzyme protein having isopentenyl diphosphate isomerase activity having the following physicochemical properties.

(1) Action:

Isomerize isopentenyl diphosphate (IPP) to produce dimethylaryl diphosphate (DMAPP). It also catalyzes the reverse reaction of isomerizing DMAPP to produce IPP.

(2) Substrate specificity: Isopentenyl diphosphate (IPP) is used as a substrate. DMAPP is also used as a substrate.

(3) Reaction conditions:

Isopentenyl diphosphate (IPP) Isomerase activity requires divalent metal ions, FM and NADPH.

Preferably, the enzyme protein of the present invention is a protein derived from bacteria or protozoa.

Preferably, the enzyme protein of the present invention exhibits a molecular weight of about 37-4 lkDa as measured by SDS-PAGE. Preferably, the enzyme protein of the present invention has an optimum temperature of 37 ° C. and an optimum pH of 7.0.

Preferably, according to the present invention, there is provided an enzyme protein having isopentenyl diphosphate isomerase activity having any of the following amino acid sequences.

(A) the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13;

(B) in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13, one to several amino acids are deleted, substituted, added and / or An inserted amino acid sequence having isopentenyl diphosphate isomerase activity; or

(C) an amino acid sequence having 60% or more homology with the amino acid sequence described in SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, or SEQ ID NO: 13, Amino acid sequence having isopentenyl diphosphate isomerase activity.

According to another aspect of the present invention, there is provided a DNA encoding the protein described above.

Preferably, a DNA encoding a protein having isopentenyl diphosphate isomerase activity having any one of the following base sequences is provided.

(A) the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14;

(B) SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12 or A base sequence in which one to several bases are deleted, substituted, added, Z- or inserted in SEQ ID NO: 14, wherein the base sequence encodes a protein having isopentenyl diphosphate isomerase activity; Or

(C) a nucleotide sequence that can hybridize with the nucleotide sequence described in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14 under stringent conditions A base sequence encoding a protein having isopentenyl diphosphate isomerase activity.

According to still another aspect of the present invention, there is provided a recombinant vector containing the above-described DNA of the present invention.

According to still another aspect of the present invention, there is provided a transformant having the above-described recombinant vector of the present invention.

According to still another aspect of the present invention, a step of culturing a transformant produced by transforming the above-described vector containing the DNA of the present invention into a host to produce isopentenyl diphosphate isomerase And a method for producing isopentenyl diphosphate isomerase, comprising the steps of: collecting isopentenyl diphosphate isomerase from a culture.

According to still another aspect of the present invention, there is provided an enzyme protein having isopentenyl diphosphate isomerase activity of the present invention as described above, characterized by using dimethylaryl diphosphate (DMAPP) and IPP. A manufacturing method is provided.

According to still another aspect of the present invention, there is provided a method for screening a substance that inhibits the growth of an organism, comprising a step of searching for a substance that inhibits isopentenyl diphosphate isomerase activity. According to still another aspect of the present invention, there is provided a biological growth inhibitor comprising an inhibitor of isopentenyl diphosphate isomerase. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, embodiments and a method of implementing the present invention will be described in detail. (1) Description of an embodiment of the present invention

In the present specification, "1 to several bases are deleted, substituted, added and / or inserted" means, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10 More preferably, 1 to 5 arbitrary numbers of bases are deleted, substituted, added and / or inserted.

In the present specification, "1 to several amino acids are deleted, substituted, added and / or inserted" means, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10 More preferably, 1 to 5 amino acids are deleted, substituted, added and / or inserted.

As used herein, "can be hybridized under stringent conditions" means that DNA can be used as a probe, colony-hybridization method, plaque-hybridization method, or Southern plot. DNA obtained by using the hybridization method or the like.Specifically, DNA using colonies or plaque-derived DNA or a fragment obtained by immobilizing a fragment of the DNA is used. After performing hybridization at 65 ° C in the presence of 7 to 1.0 M NaCl, 0.1 to 2 times the SSC solution (The composition of the 1 times concentrated SSC solution is 15 OmM sodium chloride, 15 mM DNA that can be identified by washing the filter at 65 ° C with sodium citrate) can be given. Hypridization is described in Molecular Cloning: A laboratory Mannual, ED., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY., 1989. It can be done according to the method.

Examples of DNA that can be hybridized under stringent conditions include DNA having a certain degree of homology with the nucleotide sequence of DNA used as a probe.The homology is, for example, 60% or more, preferably 70% or more. % Or more, more preferably 80% or more, further preferably 90% or more, particularly preferably 95% or more, and most preferably 98% or more. One embodiment of the present invention relates to an amino acid sequence having 60% or more homology with the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, or SEQ ID NO: 13. And an enzyme protein having an amino acid sequence having isopentenyl diphosphate isomerase activity. The homology with the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13 is not particularly limited as long as it is 60% or more. It is at least 0%, preferably at least 70%, more preferably at least 80%, further preferably at least 90%, particularly preferably at least 95%, most preferably at least 98%.

One aspect of the present invention relates to a novel enzyme protein having isopentenyl diphosphate isomerase activity. As used herein, “isopentenyl diphosphate isomerase activity” refers to a reaction that isomerizes isopentenyl diphosphate (IPP) as a substrate to produce dimethylaryl diphosphate (DMAPP) and the reverse reaction. Broadly refers to catalytic activity.

The present invention also provides (A) a nucleotide sequence according to SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14;

(B) SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12 or SEQ ID NO: 14 with deletion, substitution, addition and / or insertion of one to several bases A nucleotide sequence encoding a protein having isopentenyl diphosphate isomerase activity; or

(C) a nucleotide sequence capable of hybridizing under stringent conditions with the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14 A nucleotide sequence encoding a protein having isopentenyl diphosphate isomerase activity;

A DNA having an isopentenyl diphosphate isomerase activity is used as a DNA encoding a protein having an isopentenyl diphosphate isomerase activity; for example, a protein having an isopentenyl diphosphate isomerase activity using the above DNA It also relates to the production of (2) Method for obtaining DNA encoding isopentenyl diphosphate isomerase The present inventors have previously described an enzyme that catalyzes one reaction on the mevalonate pathway from Streptomyces sp. The gene (hmgr) encoding hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase has been cloned (J. Bacteriol. 181: 1256, 1999). Encodes isopentenyl diphosphate isomerase of the invention: DNA is present in a gene class that encodes a group of enzymes in the actinomycete mevalonate pathway, while DNA is present in actinomycete mevalon. A gene class encoding a group of enzymes in the acid pathway can be obtained by using the hmgr gene described above as a probe. Specifically, the following method can be used.

Actinomycetes, for example Streptomyces sp. And CL190 strain suitable medium, for example GPY medium (1% glucose, 0.4% polypeptone, 0.4% yeast E custo _{Lactobacillus, 0. 5% MgS0 4 · 7H} 2 0, 0. 1 % K ₂ HP0 ₄₎ at a suitable temperature (e.g., cultured for several days at 3 0 ° C). After culturing, cells are obtained from the obtained culture by centrifugation, and chromosomal DNA is isolated and purified from the cells according to a standard method (Molecular Cloning, 2nd edition). The obtained chromosomal DNA is digested with an appropriate restriction enzyme (for example, SnaBI), and then subjected to Southern hybridization (molecular cleaning second edition) using the hmgr gene as a probe. Southern hybridization-the result of the probe is that the probe is located at a specific location (for example, 6.7 kb when SnaBI is used as a restriction enzyme for digestion of chromosomal DNA). A signal is detected.

Next, the chromosomal DNA of Streptomyces sp. CL190 strain was cut again with the same restriction enzymes (for example, SnaBI) as described above, followed by agarose gel electrophoresis, and the position where the signal was detected as a result of Southern hybridization (as a restriction enzyme). When SnaBI is used, the DNA fragment corresponding to (6.7 kb position) is extracted and recovered from the agaguchi-sgel. This recovered DNA fragment is used for T4 DNA polymerase (Treasure (Purchased from Sake Brewery), blunt ends, and insert into an appropriate plasmid (for example, pUC118) to produce a chromosomal DNA library of Streptomyces sp. CL190 strain. Using this chromosomal DNA library, a suitable host (for example, E. coli JM109 strain) is transformed according to a standard method (Molecular Cloning, 2nd edition), and the transformant is transformed into a plasmid using the hmgr gene as a probe. A transformant of Escherichia coli having a plasmid containing the hmgr gene can be isolated by screening by the hybridization method. Plasmids were extracted from the isolated transformants in a conventional manner to obtain a DNA fragment containing the hmgr gene, that is, a DNA fragment containing a gene cluster encoding a group of enzymes of the actinomycete mevalonate pathway. Can be released.

The DNA of the present invention (isopentenyl diphosphate isomerase gene) is present in a DNA fragment containing a gene cluster encoding a group of enzymes of the mevalonate pathway of actinomycetes, which can be isolated by the above-mentioned method. Things.

Given the nucleotide sequence of SEQ ID NO: 2 in the present specification, those skilled in the art can appropriately design a primer for PCR and perform PCR using actinomycete chromosome: DNA as type III. The actinomycetes isopentenyl diphosphate isomerase gene can be isolated. Specifically, using the chromosomal DNA of Streptomyces sp.CL190 strain as type I, PCR was performed using primers having the nucleotide sequences of SEQ ID NO: 3 (GGGGATCCACCAGGGCCGAACGGAAGGACG) and SEQ ID NO: 4 (GGGGATCCTCGTGTGCTTCCCGTCGTCTGG) and Taq DNA polymerase. By performing the above, the isopentable diphosphate isomerase gene of the present invention can be amplified.

PCR conditions can be appropriately set by those skilled in the art, for example, 95 ° C. for 30 seconds, 60 ° C. for 30 seconds, and 72. Conditions include a reaction step consisting of 2 minutes at C, 25 cycles as one cycle, and a reaction at 72 ° C for 10 minutes. The DNA fragment amplified by PCR can be cloned into an appropriate vector according to a standard method as described below.

Similarly, given the nucleotide sequence of SEQ ID NO: 6 herein, If so, the primers for PCR can be appropriately designed and the chromosomal DNA of Pseudomonas aeruginosa can be used to perform PCR to isolate the isopentenyl diphosphate isomerase gene of Pseudomonas aeruginosa. . Specifically, the chromosomal DNA of Staphylococcus aureus is designated as type I, and SEQ ID NO: 15 (

5, -GGGATCCAGTGATTTTCAAAGAGAACAGAG-3 ⁵ ) and SEQ ID NO: 16 (

5'-GGGATCCTCCTCGATGTATATTCAAGTTACG-3 ⁵ ) Primer having the nucleotide sequence described in ⁵ )

The isopentenyl diphosphate isomerase gene of the present invention can be amplified by performing PCR using-and Taq DNA polymerase. PCR conditions and the like can be appropriately set in the same manner as described above.

Protozoan isopentenyl diphosphate isomerase gene can also be isolated according to the above method.

The isopentenyl diphosphate isomerase gene of the present invention (hereinafter, also referred to as DNA of the present invention) can be cloned into a suitable vector that can be amplified in a suitable host (for example, Escherichia coli). Cloning is performed in the usual manner, for example, in Molecular Cloning, 2nd edition, Current Protocols in Molecular Biology, Supplement 1-38, John Wiley & Sons (1987-1997) (hereinafter, `` Current Protocols in 'Molecular ? 'Bruno ¹ abbreviated as Ioroji one), DNA Cloning 1: CoreTechniques, a Practical Approach, Second Edition, Oxford University Press (1995) serial mounting methods in such or commercially available kits, for example, Superscript Plasmid System for cD NA Synthesis and Plasmid Cloning (manufactured by Life Technologies Inc.) or ZAP-cDNA Synthesis Kit (manufactured by Stratagene).

As the cloning vector, any phage vector or plasmid vector can be used as long as it can autonomously replicate in the host. Escherichia coli expression vectors may be used as the cloning vector. Specifically, ZAP Express (Strata Gene, Strategies, 5, 58 (1992)), pBluescrlpt II SK (+) CNuclelc Acids Research, 17, 9494 (1989)), Lambda ZAP II (Stratagene) AgtlO, Agtll CD NA Cloning, A Practical Approach, 1, 49 (1985)), LTriplEx (Clontech), AExCell (Pharmacia), pT7T318U (Pharmacia), pcD2 CMol. Cen. Biol., 3, 280 (1983)), pMW218 (manufactured by Wako Pure Chemical Industries), pUC118 (manufactured by Takara Shuzo), pEG400 CJ.Bac, 172, 2392 (1990)), pQE-30 (manufactured by QIAGEN), etc. Can be.

From the obtained transformant, a plasmid containing the target DNA can be obtained by a conventional method, for example, Molecular Cloning, 2nd edition, Current 'Protocols in', Molecular nucleic acid, DNA, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, can be obtained by the method described in Oxford University Press (1995) and the like.

An example of the amino acid sequence of the actinomycete isopentenyl diphosphate isomerase enzyme of the present invention is shown in SEQ ID NO: 1; An example of the nucleotide sequence of NA is shown in SEQ ID NO: 2. Also, an example of the amino acid sequence of the isopentenyl diphosphate isomerase enzyme of Staphylococcus aureus of the present invention is shown in SEQ ID NO: 5, and an example of the nucleotide sequence of DNA encoding the enzyme is shown in SEQ ID NO: 6.

However, these are merely examples, and mutant enzymes and mutant DNAs having mutations in these sequences are also included in the scope of the present invention, as long as they maintain isopentenyl diphosphate isomerase activity. Such mutant enzymes and mutant DNAs can be produced by any method known to those skilled in the art, such as chemical synthesis, genetic engineering techniques, and mutagenesis. Specifically, a mutant DNA can be obtained by using a DNA having the nucleotide sequence of SEQ ID NO: 2 and introducing a mutation into these DNAs. For example, the method can be carried out using a method in which DNA having the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 6 is brought into contact with a mutagenic agent, a method of irradiating ultraviolet rays, a genetic engineering technique, or the like. Site-directed mutagenesis, which is one of the genetic engineering techniques, is useful because it is a technique that can introduce a specific mutation at a specific position. Molecular Cloning 2nd Edition, Current 'Protocols' In 'Molecular Biology I, Nucleic Acids Research, 10, 6487, 1982, Nucleic Acids Research, 12, 9441, 1984, Nucleic Acids Research, 13, 4431, 1985, Nucleic Acids Research, 13, 8749, 1985, Proc. Natl. Acad. Sci. USA, 79, 6409, 1982, Proc. Natl. Acad. Sci. USA, 82, 488, 1985, Gene, 34, 315, 1985, Gene, 102, 67, 1991 and the like.

(3) Construction of a transformant having DNA encoding isopentenyl diphosphate isomerase and expression of the protein of the enzyme

In order to express the DNA obtained as described above in a host cell, first, the DNA fragment of interest is digested with a restriction enzyme or a DNA degrading enzyme to obtain an appropriate length of DNA containing the gene. After fragmentation, the fragment is inserted downstream of the promoter in the expression vector, and the expression vector into which the DNA has been inserted is then introduced into a host cell suitable for the expression vector.

Any host cell that can express the gene of interest can be used. For example, bacteria belonging to the genera Escherichia, Serratia, Corynebacterium, Brevibacterium, Pseudomonas, Bacillus, Microbacterium, etc .; Yeasts, animal cells, insect cells, etc. belonging to the genus, Trichosporonus, Schizinomyces and the like.

As the expression vector, those which are capable of autonomous replication in the above-mentioned host cells or capable of being integrated into a chromosome, and which contain a promoter at a position where the above-mentioned DNA can be transcribed are used.

When a bacterium or the like is used as a host cell, an expression vector for expressing the DNA is capable of autonomous replication in the bacterium, and is composed of a promoter, a ribosome binding sequence, the DNA and a transcription termination sequence. It is preferably a recombinant vector. A gene that controls the promoter overnight may be included.

Examples of expression vectors include, for example, pBTrP2, pBTacl, pBTac2 (all commercially available from Peringa-Imannheim), PKK233-2 (Pharmacia), pSE280 (Invitrogen), pGEMEX-l (manufactured by Promega), pQE-8 (manufactured by QIAGEN), pQE-30 (manufactured by QIAGEN), pKYPIO (Japanese Patent Laid-Open No. 58-110600), pKYP200 (Agrc. Biol. Chem., 48, 669 ( 1984)), PLSAl (Agrc. Biol. Cem., 53, 277 (1989)), pGELl (Proc. Natl. Acad. Sci. USA, 82, 4306 (1985)), pBluescrlptll SK +, pBluescriptll SK (-) (Stratagene), pTrS30 (FERMBP-5407), pTrS32 (FERM BP-5408), pGEX (Pharmacia), pET-3 (Novagen), Term2 (US468619K US4939094, US5160735), pSupex, pUBHO, pTP5 PUC194, pUC18 Gene, 33, 103 (1985)), pUC19 (Gene, 33, 103 (1985)), pSTV28 (Takara Shuzo), pSTV29 (Takara Shuzo), pUC118 (Takara Shuzo), ρΡΑ1 63-233798), pEG400 [J. Bacteriol., 172, 2392 (1990) 3, p (JE-30 (manufactured by JIAGEN), and the like.

Any promoter can be used as long as it can be expressed in the host cell. For example, trp promoter (P trp), lac pro乇Isseki one (P lac), P _L promoter Isseki one, P _H promoter evening one, such as P _SE promoter, promoters one derived from Escherichia coli or phage, such as, SP01 Promo One Night, SP02 Promo One Night, penP Promo One Night, etc. Also, use a Promo One Night that is artificially designed and modified, such as a Promo One One that has two P trps in series (P trpX2), a tac promoter, a Letl Promo One, and a lacT7 Promo One. Can be.

The liposome binding sequence may be any as long as it can be expressed in the host cell, but an appropriate distance (for example, 6 to 18 bases) between the Shine-Dalgamo sequence and the initiation codon It is preferable to use a plasmid adjusted to the above. Although a transcription termination sequence is not necessarily required for expression of a desired DNA, it is desirable to arrange a transcription termination sequence immediately below a structural gene.

Host cells include Escherichia, Corynebacterium, Brevibacterium, Bacillus, Microbacterium, Serratia, Pseudomonas, Agrobacterium, Alicyciobaculus, Anabaen, Anacystis, Arthrobacter, Azobacter, Chromatium, Erwinia Methylobacterium, Phormidium, Rhodobacter, Rhodopseudomonas, Rhodospirilium, Scenedesmun, Streptomyces Microorganisms belonging to the genus, Synnecoccus, Z momonas and the like can be mentioned, preferably Escherichia, Corynebacterium, Brevibacterium, Bacillus, Pseudomonas, Agrobacterium, Alicyclobacillus, Anaoaenaena Anacystis, Examples include microorganisms belonging to the genera Arthrobacter, Azobacter, Chromatium, Erwinia, Methylobacterium, Phormidium, Rhodooacter, Rhodopseuaomonas, Rhodospirilium Scenedesmun, Streptomyces, Synnecoccus, Z momonas, and the like.

Specific examples of the microorganism include, for example, Escherichia coli XL1-Blue, Escherichia coli XL2-Blue, Escherichia coli DH1, Escherichia coli cc, Escherichia coli MC1000, Escherichia coli KY3276, Escherichia coli W1485, Escherichia coli JMIO ^ Escherichia HIO Escherichia coli No49, Escherichia coli W3110, Escherichia coli NY49, Escherichia coli MP347, Escherichia coli NM522, Bacillus subtil is Bacillus ajayloliquefacines s Brevibacterium ammoniagenes, Brevibacterium immariophilum ATCC14068 s Brevibacterium saccharolyticum ATCC1 shelf 6, Brevibacterium flavum ATCC14067, Brevibacterium lactofermentum ATCC13869 S Corynebacterium glutamicum ATCC13032 , Corynebacteriim glutamicum ATCC14297 _s Corynebacteriim acetoacidophilum ATCC13870, Microbacterium ammoniaphilum ATCC15354, Serratia ficaria, Serratia fonticola, Serratia liquefacienss Serratia marcescens, Pseudomonas sp.D-0110, Agrobacterium radiobacter, Agrobacterium radiobacter _{bacterium rubi, Anabaena cylindrical Anabaenadoliolum s Anabaena} f losaquae Arthrobacter aurescens s Arthrobacter citreus, Arthrobacter globformis, Arthrobacter hydrocarboglutamicus s Arthrobacter mysorens, Arthrobacter nicotianae, Arthrobacter paraff ineus, Arthrobacter protophormiae, Arthrobacter roseoparaffinus, Arthrobacter sulfureus, Arthrobacter ureafaciens, Chromatium buderi, Chromatium tepidum s Chromatium vinosum, Chromatium warmingiis Chromatium fluviatile, Erwinia uredovora, Erwinia carotovora, Er inia ananasヽErwnia herbicola, Erwinia punctataヽErwinia terreusヽMethylobacterium rhodesianum, Methylobacterium extorquens, Phormidium sp . ATCC29409, Rhodobacter capsulatus, Rhodobacter sphaeroides, Rhodopseudomonas blastica, Rhodopseudomonas marina, Rhodopseudomonas palustrisヽ_{Rhodospir ilium rubrum, Rhodospirillum salexigens s Rhodospir} ilium sal inarum _{_{N Streptomyces ambofaciens s Streptomyces aureofaciens, Streptomyces}} aureus, Streptomyces fungicidicus, Streptomyces griseochromogenes, Streptomyces griseus, Streptomyces lividans, Streptomyces olivogriseus, it is possible to increase the Streptomyces rameusヽStreptomyces tanashiensis _s Streptomyces vinaceus _N Zymomonas mobilis and the like.

Any method for introducing the recombinant vector can be used as long as it is a method for introducing DNA into the above host cells. For example, a method using calcium ions [Proc. Natl. Acad. SCI. USA, 69 , 2110 (1972)], the protoplast method (Japanese Patent Application No. 63-2483942), or the method described in Gene, 17, 107 (1982) or Molecular & General Genetics, 168, 111 (1979).

When yeast is used as a host cell, examples of expression vectors include YEpl3 (ATCC37115) s YEp24 (ATCC37051), Ycp50 (ATCC37419), pHS19, and pHS15.

Any type of promoter can be used as long as it can be expressed in yeast. For example, PH05 Promoter, PGK Promoter, GAP Promoter, ADH Promoter, gall Promoter One night, gallO promoter, heat shock protein promoter, MF al promoter, CUP1 promoter, etc.

Examples of host cells include Saccharomyces cerevisae, Schizosaccharomyces pombe, Kluyveromyces lactis, Trichosporon pullulans, and Schocharomyces cerevisae. Schwanniomyces alluvius) Can be _P

As a method for introducing a recombinant vector, any method can be used as long as it is a method for introducing DNA into yeast. For example, electroporation (Methods.Enzymol, 194, 182 (1990)), spheroplast Acad. Sci. USA, 75, 1929 (1978)], lithium acetate method [J. Bacteriol., 153, 163 (1983)], or Proc. Natl. Acad. Sci. USA, 75, 1929 (1978). When an animal cell is used as a host cell, as an expression vector, for example, pcDNAK pcDM8 (commercially available from Funakoshi), pAGE107 (JP-A-3-22979; Cytotechnology, 3, 133, (1990)), pAS3-3 (Japanese Patent Laid-Open No. 2-227075), pCDM8 (Nature, 329, 840, (1987)), pcDNAI / AmP (manufactured by Invitrogen), pREP4 (manufactured by Invitrogen), pAGE103 (J. Blochem., 101, 1307 (1987)) ], PAGE210 and the like.

Any promoter can be used as long as it can be expressed in animal cells. For example, the promoter of the IE (i-employed ediate early) gene of cytomegalovirus (human CMV) and the promoter of SV40 can be used. Initial Promo, Retrovirus Promo, Meta-mouth Jionein Promo, Heatshock Promo, SRo: Promo

—I can give you the evening. Alternatively, the enhancer of the IE gene of human CMV may be used together with the oral motor. Examples of the host cell include Namalva cell, HBT5637 (Japanese Patent Publication 63-299), C0S1 cell, C0S7 cell, CH0 cell and the like.

As a method for introducing the recombinant vector into animal cells, any method that can introduce DNA into animal cells can be used. For example, electoral poration method CCytotechnology, 3, 133 (1990)], calcium phosphate method Natl. Acad. Sci USA, 84, 7413 (1987)), virology, 52, 456 (1973), and the like. The transformant can be obtained and cultured according to the method described in JP-A-2-227075 or JP-A-2-257891.

When insect cells are used as hosts, for example, baculovirus expression ヅ夕ぺ, Laboratory 夕夕夕ラボラボラボマニュアルマニュアルぺぺぺぺぺぺぺぺぺぺぺぺぺぺぺぺぺぺぺぺぺぺThe protein can be expressed by the described method.

That is, the recombinant gene transfer vector and baculovirus were co-transfected into insect cells to obtain the recombinant virus in the supernatant of the insect cell culture, and then the recombinant virus was infected into the insect cells. The protein can be expressed.

Examples of gene transfer kits used in the method include, for example, pVL1392, PVL1393, pBlueBacII I (all manufactured by Invitrogen) and the like. As the baculovirus, for example, Autographa cal if ornica nuclear polyhedrosis virus j, which is a virus infecting insects of the night roth moth family, such as Autographa californica nuclear polyhedrosis virus j can be used. Are Spodoptera frugiperda ovarian cells Sf9, Sf21 [baculovirus expression 'vectors, a laboratory', 'manual', double '' h 'freeman' and 'campa' (WH Freeman and Company) New York, (1992)], and High5 (manufactured by Invitrogen), which is an ovarian cell of Trichoplusia ni, can be used.

Methods for co-transferring the above-described recombinant gene transfer vector and the baculovirus into insect cells to prepare a recombinant virus include, for example, the calcium phosphate method (Japanese Patent Laid-Open No. 2-227075), the lipofection method [Proc. Natl. Acad. Sci. USA, 84, 7413 (1987)].

As a method for expressing the gene, secretory production, fusion protein expression, and the like can be performed according to the method described in Molecular Cloning, 2nd edition, etc., in addition to direct expression.

A transformant having the recombinant DNA having the DNA incorporated therein is cultured in a medium, isopentenyl diphosphate isomerase is produced and accumulated in the culture, and the enzyme protein is collected from the culture to obtain Pentenyl diphosphate isomerase Can be isolated.

The method of culturing the transformant carrying DNA of the present invention in a medium can be performed according to a usual method used for culturing a host.

When the transformant of the present invention is a prokaryote such as Escherichia coli or a eukaryote such as yeast, the culture medium for culturing these microorganisms contains a carbon source, a nitrogen source, inorganic salts, and the like which can be utilized by the microorganism. However, either a natural medium or a synthetic medium may be used as long as the medium can efficiently culture the transformant.

Any carbon source can be used as long as each microorganism can assimilate it. Darcose, fructoses, sucrose, molasses containing these, carbohydrates such as starch or starch hydrolysate, acetic acid, propionic acid And organic acids such as ethanol and alcohols such as propanol.

Nitrogen sources include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium phosphate, etc., ammonium salts of various inorganic and organic acids, other nitrogen-containing compounds, peptone, meat extract, yeast extract, corn starch, etc. Plyka, casein hydrolyzate, soybean meal and soybean meal hydrolyzate, various fermented cells and digests thereof are used.

As the inorganic substance, potassium phosphate monobasic, potassium phosphate dibasic, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate and the like are used.

The culture is performed under aerobic conditions such as shaking culture or deep aeration stirring culture. The culture temperature is preferably 15 to 40 ° C, and the culture time is usually 16 hours to 7 days. During the culture, the pH is maintained at 3.0 to 9.0. The pH is adjusted using inorganic or organic acids, alkaline solutions, urea, calcium carbonate, ammonia and the like.

If necessary, an antibiotic such as ampicillin / tetracycline may be added to the medium during the culture.

When culturing a microorganism transformed with an expression vector using an inducible promoter as a promoter, it is possible to add an induser to the medium if necessary. Good. For example, when culturing a microorganism transformed with an expression vector using the lac promoter, isopropyl-1 /?-1 D-thiogalactopyranoside (IPTG) can be transformed with an expression vector using the trp promoter. When culturing the isolated microorganism, indoleacrylic acid (IAA) or the like may be added to the medium.

As a medium for culturing transformants obtained using animal cells as host cells, commonly used RPM11640 medium [The Journal of the American Medical Association, 199, 519 (1967)], Eagle's MEM medium [Science , 122, 501 (1952)), MEM medium CVirology, 8, 396 (1959)), 199 medium (Proceeding of the Society for the Biological Medicine, 73, 1 (1950)), or fetal bovine serum etc. A culture medium or the like added is used.

Culture is carried out usually pH6~8, 30~40 ° C, 5% C0 2 present 1 to 7 days under conditions such as lower. If necessary, antibiotics such as kanamycin and penicillin may be added to the medium during the culture.

As a culture medium for culturing a transformant obtained by using an insect cell as a host cell, generally used TNM-FH medium (Pharmingen), Sf-900 II SFM medium (Gibco BRL), ExCel 1400 , ExCel 1405 (all manufactured by JRH Biosciences), Grace ⁵ s Insect Medium (Grace, TCC, Nature, 195, 788 (1962)), etc. Culture is usually performed at pH 6 to 7, 25 to 30 °. Perform 1-5 days under conditions such as C.

If necessary, an antibiotic such as genyumycin may be added to the medium during the culture.

In order to isolate and purify isopentenyl diphosphate isomerase from the culture of the transformant of the present invention, an ordinary enzyme isolation and purification method may be used.

For example, when the enzyme protein of the present invention is expressed in a dissolved state in cells, the cells are recovered by centrifugation after cell culture, suspended in an aqueous buffer, and then sonicated with a crusher, French press, Mentongaulin. Crush cells with a homogenizer, Dynomill, etc. to obtain a cell-free extract. From the supernatant obtained by centrifuging the cell-free extract, a normal enzyme isolation and purification method, that is, a solvent extraction method, a salting-out method using ammonium sulfate or the like, Desalting method, precipitation method with organic solvent, anion exchange chromatography using resin such as getylaminoethyl (DEAE) Sepharose, DIAION HPA-75 (manufactured by Mitsubishi Chemical), S-Sepharose FF (Pharmacia) Cation exchange chromatography using resin such as Ni-NTA agarose, butyl sepharose, phenylsepharose, etc .; hydrophobic chromatography using resin such as Ni-NTA agarose, phenylsepharose; gel filtration using molecular sieve; A purified product can be obtained by using alone or in combination of electrophoresis methods such as two-tray chromatography, chromatofocusing, and isoelectric focusing.

When the protein is expressed in an insoluble form in the cells, the cells are similarly recovered, crushed, and the protein is recovered by a usual method from the precipitate fraction obtained by centrifugation. Thereafter, the insoluble form of the protein is solubilized with a protein denaturant. After diluting or dialyzing the solubilized solution to a solution containing no protein denaturing agent or a diluting concentration of the protein denaturing agent such that the protein is not denatured, the protein is formed into a normal three-dimensional structure. A purified sample can be obtained by the same isolation and purification method.

When the enzyme protein of the present invention or a derivative thereof such as a modified sugar thereof is secreted extracellularly, a derivative such as the protein or a sugar chain adduct thereof can be recovered in the culture supernatant. That is, a soluble fraction is obtained by treating the culture by a method such as centrifugation as described above, and a purified sample is obtained from the soluble fraction by using the same isolation and purification method as described above. be able to.

The enzyme protein of the present invention can also be produced by a chemical synthesis method such as the Fmoc method (fluorenylmethyloxycarbonyl method) and the tBoc method (t-butyloxycarbonyl method). Also, Kuwawa Trading (US Advanced Chem Tech), Perkin-El Marjaban (US Perkin-Elmer), Pharmacia Biotech (Sweden PharmaciaBiotech), Aroca (US ProteinTechnology Instrument), Kurabo ( Synthecel Vega, USA), Perceptive II Limited (US PerSeptive), Shimadzu Corporation, etc. You.

(4) Measurement of isopentenyl diphosphate isomerase activity

The measurement of isopentenyl diphosphate isomerase activity can be carried out according to a conventional enzyme activity measurement method.

That is, the pH of the buffer used for the reaction solution for measuring the activity may be within a pH range that does not inhibit the target enzyme activity, and is preferably in a range including the optimum pH.

For example, in the case of isopentenyl diphosphate isomerase, the pH is 5 to 9, preferably 6 to 8, and particularly preferably 7.

As the buffer, any buffer can be used as long as it does not inhibit the enzyme activity and can achieve the above pH. As the buffer, a Tris-HCl buffer, a phosphate buffer, a borate buffer, a HEPES buffer, a MOPS buffer, a bicarbonate buffer, and the like can be used, and a HEPS buffer is preferable.

The buffer can be used at any concentration as long as the enzyme activity is not inhibited, but is preferably 1πιΜ to: LM.

Further, divalent metal ions (eg, Mg ²⁺ , Mn ² \ Ca ²⁺ ) are added to the reaction solution. These metal ions can be added as metal salts, and can be added as chlorides, sulfates, carbonates, phosphates and the like. The concentration of the metal ion may be any concentration as long as it does not inhibit the reaction, but is generally 0.01 mM to 100 mM, and preferably 0.01 ImM to: LomM.

Add FMN and NADPH to the reaction mixture. The concentration of FMN in the reaction solution may be any concentration as long as it does not inhibit the reaction, but is generally from 0.1 M to lmM, preferably from 1 to 10. The concentration of NADPH in the reaction solution may be any concentration as long as it does not inhibit the reaction, but is generally 0.01 mM to 50 mM, preferably 0.1 lmM to 5 mM.

Isopentenyl diphosphate (IPP) is added to the reaction solution as a substrate for the enzyme. The concentration of the substrate can be any concentration as long as it does not interfere with the reaction. More preferably, it is in the range of 0.1 mM to 0.2M.

The concentration of the enzyme used in the reaction is not particularly limited, but the reaction is usually performed in a concentration range of 0.01 mg / ml to 10 Omg / ml. The enzyme used does not necessarily have to be purified to a single level, and it is sufficient that the enzyme has a purity that does not inhibit the reaction. A cell extract containing isopentenyl diphosphate isomerase activity or a cell having the enzyme activity can also be used.

The reaction temperature may be within a temperature range that does not inhibit isopentenyl diphosphate isomerase activity, and is preferably in a range including the optimum temperature. The reaction temperature is usually 10 ° C .; to 60 ° C., preferably 30 to 40 ° C., particularly preferably 37 ° C. The activity can be detected by a method capable of measuring the amount of the substrate or the reaction product by reducing the substrate or increasing the reaction product accompanying the reaction.

Examples of the method include a method of separating and quantifying a target substance by high performance liquid chromatography (HPLC) if necessary.

(5) Biological growth inhibitor comprising an inhibitor of isopentenyl diphosphate isomerase The present invention relates to a method for inhibiting the growth of an organism, which comprises searching for a substance that inhibits isopentenyl diphosphate isomerase activity. The present invention also relates to a screening method, and a biological growth inhibitor comprising an inhibitor of isopentenyl diphosphate isomerase. The organism mentioned here is preferably a bacterium or a protozoan, and the biological growth inhibitor of the present invention can be used as an antibacterial agent or an antiprotozoal agent. Bacteria include archaea and gram-positive bacteria. Specific examples of bacteria include staphylococci (eg, methicillin-resistant Staphylococcus aureus), enterococci, pneumococci, group A hemolytic streptococci, and Lyme disease bacteria, but are not limited thereto. Not necessarily. Specific examples of protozoa include the genus Leishmania.

Isopentenyl diphosphate isomerase activity means the activity of isomerizing isopentenyl diphosphate (IPP) to produce dimethylaryl diphosphate (DMAPP), and the activity of catalyzing the reverse reaction. By searching for substances that inhibit And substances that inhibit the growth of organisms such as parasites.

It should be noted that the presence of a gene corresponding to the gene encoding isopentenyl diphosphate isomerase of the present invention also exists in Staphylococcus aureus in the gene database of Staphylococcus aureus (http: @ ww.tigr.org). We know from a search using. The amino acid sequence of isopentenyl diphosphate isomerase of yellow budding staphylococci and the nucleotide sequence of DNA encoding it are shown in SEQ ID NO: 5 and SEQ ID NO: 6 in the sequence listing.

The isopentenyl diphosphate isomerase of the present invention is also present in Enterococcus faecalis, and its amino acid sequence and DNA sequence are shown in SEQ ID NO: 7 and SEQ ID NO: 8.

Further, the isomerase of the present invention is also present in Streptococcus pneumoniae, and its amino acid sequence and DNA sequence are shown in SEQ ID NO: 9 and SEQ ID NO: 10.

Furthermore, the isopentenyl diphosphate isomerase of the present invention is also present in Streptococcus pyrogenes, and its amino acid sequence and DNA sequence are shown in SEQ ID NOS: 11 and 12.

Furthermore, the isopentenyl diphosphate isomerase of the present invention is also present in Lyme disease bacteria (Borrelia burgdorferi), and its amino acid sequence and D.NA sequence are shown in SEQ ID NO: 13 and SEQ ID NO: 14.

In addition to the above, homologues of isopentenyl diphosphate isomerase of the present invention include E. herbicol a, Synechocystis sp.Strain PCC6803 _S Methanococcus jannaschii _s Sulfolobus solfataricus _N Rickettsia prowazekii, B. subtil is _s Deinococcus radiodurans, Halobacterium sp. , Methanobacterium the rmoautotrophicum _N Archaeoglobus fuigidus, Aeropyrum pernix, Pyrococcus abyss is, Leishmania major, etc., have been found by homology search.

The search for a substance that inhibits isopentenyl diphosphate isomerase activity was performed by adding the test substance to the enzyme activity measurement system described above in this specification and performing the same enzymatic reaction, but without adding the test substance. Substances that reduce the amount of substrate loss more than This can be done by screening for a substance that suppresses the production of the reaction product.

Screening methods include tracking the amount of decrease in substrate or increase in reaction product over time, and measuring the amount of decrease in substrate or increase in reaction product after a certain period of reaction. And the like.

In a method that tracks the amount of decrease in substrate or increase in reaction product over time, measure the amount of decrease in substrate or increase in reaction product at intervals of about 15 seconds to 20 minutes during the reaction. It is preferable to measure at intervals of 1 to 3 minutes.

In a method for measuring the amount of decrease in the substrate or the amount of increase in the reaction product after reacting for a certain period of time, the reaction time is preferably 15 minutes to 1 day, more preferably 30 minutes to 2 hours.

Isopentenyl diphosphate isomerase (IPP isomerase) can be classified into two types, typel and type2, depending on the properties of the enzyme. Human IPP isomerase is a type 1 enzyme that can generate DMAPP from IPP and IPP from DMAPP if Mg ²⁺ is available, whereas Bacillus subtilis and Streptomyces sp. The IPP isomerase of the strain and Staphylococcus aureus is a type 2 enzyme capable of producing DMAPP from IPP and IPP from DMAPP in the presence of Mg ²⁺ , FMN and NADPH.

Therefore, a substance that inhibits type 2 IPP isomerase and does not inhibit type 1 IPP isomerase can be a substance that selectively inhibits the growth of Bacillus subtilis, Streptomyces sp. CL190 strain, and Staphylococcus aureus, Staphylococcus aureus. That is, the inhibitor can inhibit the growth of an organism utilizing type 2 IPP isomerase.

Organisms utilizing type 2 IPP isomerase can be identified by homology search or the like based on the amino acid sequence of IPP isomerase of Bacillus subtilis, Streptomyces sp. CL190 strain, Staphylococcus aureus of Staphylococcus aureus. For example, Bacillus subtilis, actinomycetes, and Staphylococcus aureus utilize type 2 IPP isomerase. According to one embodiment of the screening method of the present invention, there is provided a method for screening for a specific inhibitor of type 2 IPP isomerase using B. subtilis. Hereinafter, this screening method will be described.

B. subtilis utilizes type 2 IPP isomerase. There are two distinct pathways for IPP synthesis, the mevalonate pathway and the non-mevalonate pathway. Mevalonic acid (MVA) is converted to IPP in the mevalonate pathway by MVAkinase, phosphomevalonate (PMVA) kinase and diphosphomevalonate (DPMVA) decarboxylase.

Therefore, first, the mevalonate pathway can be utilized by introducing a plasmid containing mevalonate kinase, diphosphomevalonate decarboxylase, and phosphomevalonate kinase into the wild-type B. subtilis 168 strain. Create a recombinant Bacillus subtilis that can be produced. This recombinant Bacillus subtilis can convert MVA added to the medium into IPP by mevalonate kinase, diphosphomevalonate decarboxylase and phosphomevalonate kinase induced by IPTG. In addition, since Bacillus subtilis has its own IPP isomerase, it produces DMAPP from IPP, so it can grow using the mevalonate pathway. In addition, since the Bacillus subtilis wild strain has a non-mevalonate pathway, IPP and DMAPP can be produced by the non-mevalonate pathway. That is, the above-mentioned recombinant Bacillus subtilis can produce IPP in both the mevalonate pathway and the non-mevalonate pathway.

Next, the non-mevalonate pathway of the recombinant B. subtilis is disrupted. Disruption of the non-mevalonic acid pathway is performed by disrupting the gene of the enzyme involved in the pathway (eg, DXP reductoisomerase gene). Disruption of the target enzyme gene can be performed by a method known to those skilled in the art, such as homologous recombination. For example, the Bacillus subtilis yluB gene encodes the DXP reductoisomerase gene (Proc. Natl. Acad. Sci. USA., 95, 9879, 1998). Using the following primers specific to the yluB gene, the full length of the yluB gene is amplified by PCR and cloned in the kit. Next, an erythromycin resistance gene is obtained and inserted into the yluB gene of the vector containing the yluB gene obtained above. This converts the yluB gene into an erythromycin resistance gene Thus, a fragmented plasmid is obtained. This plasmid is used to transform a recombinant Bacillus subtilis having a mevalonate pathway, and erythromycin-resistant strains are selected to obtain strains in which the genomic yluB gene has been disrupted by the erythromycin-resistant gene as a result of homologous recombination. can do. The disruption of the yluB gene of the obtained erythromycin-resistant strain can be confirmed by a conventional method such as Southern hybridization. This DXP reductoisomerase (yluB) gene-disrupted strain can convert MVA added to the culture medium into IPP by IPTG-induced mevalonate kinase, diphosphomevalonate decarboxylase, and phosphomevalonate kinase, and has its own intrinsic properties. Because IPP isomerase can generate DMAPP from IPP, it can grow. That is, this strain can grow only in the presence of MVA and IPTG, depending only on the mevalonate pathway.

The substance that disrupts the non-mevalonate pathway and inhibits the growth of Bacillus subtilis having only the mevalonate pathway, but not the growth of the mevalonate pathway and the non-mevalonate pathway does not It is a compound that inhibits mevalonate kinase or diphosphomevalonate decarboxylase or phosphomebaquinate kinase or IPP isomerase. By determining whether or not the candidate substance thus selected inhibits IPP isomerase activity, a type 2 IPP isomerase inhibitor can be screened. The measurement of the IPP isomerase activity is as described above in this specification, and the enzyme activity measurement system was similarly added to the test candidate substance and allowed to carry out the same enzymatic reaction. The screening can be performed by screening a substance that suppresses the reduction of the amount of the substrate or a substance that suppresses the amount of the reaction product generated.

The present invention is specifically illustrated by the following examples, but the present invention is not limited by these examples. Example Example 1: Construction of an expression vector containing the orfD gene

An expression vector containing orfD, which is a gene existing in the gene class encoding the mevalonate pathway enzyme group, was constructed as follows.

A sense primer having the sequence shown in SEQ ID NO: 3 and an antisense primer having the sequence shown in SEQ ID NO: 4 were purchased (Amersham Pharmacia Biotech).

Sense primer; 5, -G6GGATCCACCAGCGCCCAACGCAAGGACG (SEQ ID NO: 3) Antisense primer: 5, -GGGGGATCCTCGTGTGCTTCCCGTCGTCTGG (SEQ ID NO: 4) BamHI restriction enzyme sites are located at the 5 and 5 ends of the sense primer and antisense primer, respectively. Added.

Using the chromosomal DNA of Streptomyces sp. Strain CL190 as type III, orfD was amplified by PCR using these primers and Taq MA polymerase (manufactured by Boehriger) with a DNA Thermal Cycler (manufactured by MJ Research). .

The PCIU was performed under the conditions that a reaction process consisting of 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 2 minutes was performed for 1 cycle and 25 cycles, followed by reaction at 72 ° C for 10 minutes. .

After the amplified DNA fragment and PUC118 (Takara Shuzo) were digested with the restriction enzyme BamHI (Takara Shuzo), each DNA fragment was purified by agarose gel electrophoresis.

After mixing these purified fragments, ethanol precipitation was performed. The obtained DNA precipitate was dissolved in 5/1 distilled water, and a recombinant DM was obtained by performing a Reigeshon reaction.

After confirming that the recombinant DNA is orfD by determining the DM sequence, a plasmid was extracted from the recombinant, digested with restriction enzyme BaII (manufactured by Takara Shuzo), and then subjected to agarose gel electrophoresis. Then, a BajnHI-treated orfD-containing DNA fragment was obtained.

After digesting PQE30 (manufactured by QIAGEN) with the restriction enzyme BamHI, agarose gel electrophoresis was performed to obtain a BaQ (manufactured by Takara Shuzo) -treated PQE30 fragment.

After mixing the BajnHI-treated orfD-containing DNA fragment obtained above with the BamHI-digested pQE30 fragment, ethanol precipitation is performed, and the obtained DM precipitate is dissolved in 51 distilled water, and Recombinant MA was obtained by performing a gating reaction and named pQEORFD. Example 2: Activity measurement of protein encoded by orfD gene

Since orfD is present in the gene class that encodes a group of enzymes in the mevalonate pathway, orfD encodes an enzyme that uses IPP, the final product of those enzymes, as a substrate. I expected. Therefore, the protein encoded by the orfD gene was purified, and it was examined whether or not the protein was an enzyme utilizing IPP as a substrate.

(1) Purification of protein encoded by orfD gene

The PQEORFD prepared in Example 1 was introduced into an E. coli M15 strain (manufactured by QIAGEN) having pREP4 by a conventional method, and E. coli M15 (resistant to 200 μg / ml of ampicillin and 25 μg / ml of kanamycin) ( p 麵, pQEORFD) strain was obtained.

E. coli M15 (pREP4, pQEORFD) strain was cultured in LB liquid medium containing 200 μg / ml ampicillin and 25 g / ml kanamycin; 1001111 at 37 ° (turbidity of 660 nm reached 0.6 At this time, IPTG was added to a final concentration of 0.1 mM, and the cells were further cultured at 18 ° C. for 5 hours, and then the culture supernatant was removed by centrifugation (3,000 rpm, 10 minutes). The suspension was suspended in 6 ml of Tris-HCl buffer (pH 8.0) and crushed with an ultrasonic crusher (BRANSON) while cooling on ice.The obtained cell lysate was centrifuged (10,000 rpm, 20 minutes) The supernatant of the cell extract was passed through a Ni-NTA agarose resin column (manufactured by QIAGEN), and 20 ml of a washing buffer [100 m Tris-HCl (pH 8.0), 50 mM Washed with imidazole, 0.5% Tween 20. Then, passed through elution buffer [100 mM Tris-HCl (pH 8.0), 200 m imidazole] lOmM, The eluate was fractionated by lml.

The protein amount of each fraction was measured using a protein amount kit (manufactured by BioRad), and the protein-containing fraction was used as a purified protein fraction.

The protein encoded by the purified orfD gene had a yellow-green color, and was a typical flavin-containing protein because it had absorption maxima in the 374 and 454 dishes of the visible region. (2) Measurement of enzyme activity of protein encoded by orfD gene

lOO mM HEPES (pH 7.0), 5 mM MgCl ₂ , 2 mM DTT, 17.9 nMFM (Sigma), 142.8 nM NADPH (Sigma), and a reaction solution 50/1 containing 0.5 μg of the protein encoded by the orfD gene described above. 0.4 mM IPP and 40〃M ^{[1- 14 C] IPP (l} . llkBq) while handling (Muromachi Yakuhin), and incubated at 37 ° C 10 min. After the reaction, 0.2 ml of a 25% hydrochloric acid methanol solution and 0.5 ml of water were added, and the mixture was incubated at 37 ° C. for another 10 minutes. Next, NaCl was added to the enzyme reaction solution to saturate the mixture, and 0.5 ml of toluene was added thereto, followed by liquid phase partition. The toluene layer (upper layer) was collected, and anhydrous Na ₂ SO ₄ was added. A 300 zl toluene layer was added to an lml emulsified cocktail (manufactured by Dojindo Laboratories) to solubilize it, and the radioactivity in the toluene layer was measured with a liquid scintillation counter (Beckman). This radioactivity indicates the amount of DMAPP generated by the enzymatic reaction.

(3) Structural analysis of reaction products

The structural analysis of the reaction product was performed by the following method. 100 mM phosphate buffer (pH 7.0) s 5 mM MgCl ₂ , 2 mM DTT ヽ 17.9〃M FMN (Sigma), 142.8 M NADPH (Sigma), and 10 ml of reaction solution containing 0.5 g of the protein encoded by the orfD gene Was added with 0.5 mM IPP and incubated at 37 ° C for 12 hours. After freeze-drying the enzyme reaction solution, the whole amount was solubilized in 0.5 ml of heavy water, and-structural analysis was performed using a nuclear magnetic resonance analyzer (manufactured by JEOL). As a control, an enzyme reaction solution containing no protein encoded by the orfD gene was prepared and reacted similarly. The newly appearing peak was prayed as a reaction product compared to the control. Substrate IPP:

-Marauder (500 MHz): 3.88 (dt, J = 1.8 ₅ 6.9 Hz, H-la), 3.87 (dt, J = 1.5, 6. Hz, H-lb), 2.21 (t, J = 6.4 Hz, H -2), 4.68 (s, H-4a), 4.65 (s, H-4b), 1.58 (s, 5-Me). Reaction products: -Thigh (500 MHz): 4.27 (d, J = 7.0 Hz, H-la), 4.26 (d, J = 6.7 Hz, H-2b) ₃ 5.25 (t, J = 6.9 Hz, 7.6 Hz, H-2 ), 1.57 (s, 5-Me). From these spectral data, the structure of the reaction product was determined to be dimethylaryl diphosphate (DMAPP). From the above, the protein encoded by the orfD gene was identified as a type of IPP isomerase completely different from the known isopentenyl diphosphate isomerase. That is, isopentenyl diphosphate isomerase is present in humans, but human isopentenyl diphosphate isomerase does not require F band and NADPH. Therefore, the protein encoded by the orfD gene of the present invention is different from known human isopentenyl diphosphate isomerase.

It was also confirmed that IPP was generated under the above reaction conditions even when DMAPP was used as a substrate. '

(4) Properties of enzymes

Hereinafter, properties of the isopentenyl diphosphate isomerase of the present invention will be described.

(i) Analysis of the purified IPP isomerase by SDS-PAGE showed a molecular weight of 41 kDa. A single band was observed at 150 kDa in Native PAGE, indicating that tetramer was formed.

(ii) Divalent metal ions are essential for the IPP isomerase reaction. Among them, Mg ²⁺ and Mn ² \ Ca ²⁺ showed high enzyme activity. When the IPP Isomera Ichizekatsu of when adding Mg ²⁺ and 100%, was added to Mn ²⁺ in place of Mg ^2+, a 71% Ca ²⁺ instead of Mg ²⁺ Was 91%.

In addition, FMN and NADPH are essential for the reaction of IPP isomerase.

(iii) The optimal concentration of FMN added to the enzyme reaction solution was 1/8 to 1/4 that of IPP isomerase. Also, the concentration of NADPH added during the enzymatic reaction depends on IPP isomerase. A concentration twice that of was optimal.

(iv) The optimal temperature is 37 degrees. The optimum pH was 7.0.

() The DMAPP ratio between the substrate IPP and the reaction product was calculated from the amount of DMPP produced. This enzyme required 2 hours for the enzyme reaction to reach steady state. Therefore, when the IPP: DMAPP ratio was calculated from the amount of DMAPP generated two hours later, it was clarified that the ratio was 1.6: 1. In one known IPP isomerase, the IPP isomerase has an IPP: DMAPP ratio of 1: 13.3 (J. Biol. Chem. 235, 326, 1960). Example 3 Cloning, Expression, Purification, and Characterization of Recombinant IPP Isomerase from S. aureus

The sequence showing homology with the amino acid sequence of the IPP isomerase of Streptomyces sp. CU90 strain obtained in Example 1 was analyzed using the FASTA program to determine the sequence of Staphylococcus aureus (ttp: // www Sanger · ac. Uk / Projects / S—aureus extracted from H. This homologous sequence is considered to be an IPP isomerase of Staphylococcus aureus ATCC25923.Based on the obtained sequence, a Ba II restriction site (underlined) was added. The following two types of oligonucleotide primers were synthesized.

5, -GGGATCCAGTGATTTTCAAAGAGAACAGAG-3, (SEQ ID NO: 15) (5 'side of orfD homolog of S. aureus)

5, -6GGATCCTCCTC6ATGTATATTCAAGTTACG-3 ⁵ (SEQ ID NO: 16) (3, side of orfD homolog of S. aureus)

PCR was performed using these two primers and total DNA derived from S. aureus ATCC 25923 to amplify the IPP isomerase gene. Cloning, expression and purification of the recombinant IPP isomerase derived from S. aureus were performed by constructing an expression vector containing the orfD gene derived from Streptomyces sp. Strain CL190 described in Example 1, and in Example 2 (1). The purification was performed in the same manner as in the purification of the protein encoded by the orfD gene described above. That is, the DNA fragment amplified by PCR was ligated to the expression vector pQE30D BamHI site to obtain a recombinant DNA, which was named pQSAU39. Was.

The molecular weight of the recombinant I.sub.PP a isomerase derived from S. aureus obtained above was measured by SDS-PAGE, and the result showed a subunit molecular weight of 39 kDa. In addition, the native PAGE gel showed a single protein band with a mobility corresponding to 15 OkDa. Gel filtration (using a Superdex 200 (1.6 x 60 cm) column (Amersham Pharmacia) equilibrated with 2 OmM sodium phosphate buffer (PH 7.1) containing 0.15 M NaCl) In this case, the apparent molecular weight was 155 kDa. From these results, it was found that S. aureus-derived IPP isomerase was likely to be a tetramer.

In addition, the enzymatic activity of S. aureus-derived IPP isomerase was measured in the same manner as in Example 2 (2) for measuring the enzymatic activity of the protein encoded by the orfD gene. As a result, it was confirmed that S. aureus-derived IPP isomerase also catalyzes the reaction of isomerizing IPP to generate DMAPP in the presence of FMN and NADPH. In addition, divalent metal ions were essential for the expression of the activity of S. aureus-derived IPP isomerase, and Mg ²⁺ exhibited the highest activity. Example 4: Comparison of enzyme activities of various IPP isomerases

The reaction rate parameters of the IPP isomerase derived from Streptomyces prepared in Example 1 and the IPP isomerase derived from S. aureus prepared in Example 3 were calculated, and E. coli, S. cerevisiae, and human It was compared to the parameters of the FMN- and NADPH-independent IPP isomerases derived from them. The results are shown in Table 1 below.

Comparison of enzymatic properties of IPP isomerase

Monomer Km * Kcat * Kcat / Km Bivalent FMN NAD (P) H kDa uM S— ¹ M— ¹ · s— ¹ Cation dependence Dependence

Streptomyces sp.Ch 丄 90 41 450 0.70 1.6X10 ³ Mg ²⁺ + +

S. aireus 39 19 1.3 6.8X10 ⁴ Mg ²⁺ + +

E. coli 25 7.9 0.33 4.2X10 ⁴ Mg 2 ⁺ -

S. cerevisiae 26 43 8.0 1.9X10 ⁵ Mg ²⁺

Human 39 33 1.8 5.5X10 ⁴ M¾ 2 ⁺ one

*: For IPP As can be seen from the results in Table 1, K of IPP isomerase from Streptomyces. _at was 0.70, which was lower than the activity of human ゃ S. cerevisiae IPP isomerase (K. _at , 1.8 and 8.0, respectively). The activity of IPP isomerase from Streptomyces was almost equivalent to that of E. coli IPP isomerase. However, K _m values for the IPP IPP Isomera Ichize from Streptomyces is 450 / M, was 10 to 50 times higher than other Isomera over zero.

The catalytic efficiency (K _cat / K _m ) of S. aureus-derived IPP isomerase is 6.8 x 10 ⁴ M- ¹ · s _ ¹ , which is independent of the three FMN- and NADPH- tested. It was almost the same as that of sex IPP isomerase. Example 5: Screening of IPP Isomerase Inhibitor Using Recombinant Bacillus subtilis (1) Introduction of mevalonate pathway into B. subtilis 168 wild strain

Plasmid pBMV5 containing mevalonate kinase, phosphomevalonate kinase and diphosphomevalonate decarboxylase was introduced into B. subtilis wild strain 168 strain.

First, DNA encoding a protein involved in the mevalonate pathway that functions in Bacillus subtilis was obtained as described in Japanese Patent Application No. 2000-56753. In addition, All the contents described in the specification of Japanese Patent Application No. 2000-56753 are cited herein as the disclosure of this specification.

First, chromosome DNA was isolated and purified from Streptomyces sp. Strain CL190 according to a conventional method. Sense primers and antisense primers having a combination of the nucleotide sequences of SEQ ID NOS: 17 and 18, SEQ ID NOs: 19 and 20, SEQ ID NOs: 21 and 22, and SEQ ID NOs: 23 and 24 were synthesized using a DNA synthesizer. . The sense primer and the antisense primer having a combination of the nucleotide sequences of SEQ ID NOs: 17 and 18, SEQ ID NOs: 19 and 20, SEQ ID NOs: 21 and 22, SEQ ID NOs: 23 and 24 are used to obtain the chromosome of strain CL190. By performing the following PCR using DNA as type II, DNA fragments encoding enzymes involved in the mevalonate pathway can be amplified.

Using chromosome DNA as type I, PCR was performed using these primers and an Expand. High-Fidelity PCR System (manufactured by Behringer's Mannheim). PCR was performed for 1 minute at 95 ° C, followed by 30 cycles at 95 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 1 minute. For 10 minutes.

Each DNA fragment amplified by PCR was obtained by agarose gel electrophoresis, purified, and digested into 5〃1 TE buffer.

To this solution, 0.5 μl of pGEMT-easy vector (promega) was added, and a ligation reaction was performed to obtain a recombinant DNA.

Using the recombinant DNA, Escherichia coli JM109 strain was transformed according to a conventional method, and then the transformant was spread on an LB agar medium containing 50 / g / ml of ampicillin, and cultured at 37 ° C. Some of the growing colonies of the ampicillin-resistant transformant were cultured in 5 ml of an LB liquid medium containing 50 zg / ml of ampicillin at 37 ° C for 1 ° with shaking. The cells were obtained by centrifuging the obtained culture solution. A plasmid was isolated from the cells according to a conventional method. The plasmid isolated by this method is cleaved with various restriction enzymes, the structure is examined, and the nucleotide sequence is determined. It was confirmed that the fragment was an inserted plasmid.

Plasmid containing DNA having the nucleotide sequence of SEQ ID NO: 25 was pGEMM VK Is Plasmid containing DNA having the nucleotide sequence of SEQ ID NO: 26 was replaced with pG EMMDC DNA having the nucleotide sequence of SEQ ID NO: 27. A plasmid containing the plasmid containing the DNA having the nucleotide sequence of pGEMMVK2s SEQ ID NO: 28 was designated as pGEMHYP.

pGEMM VK2 is treated with Bglll and Clal, a fragment having the nucleotide sequence of SEQ ID NO: 27 is obtained by agarose gel electrophoresis, and then subcloned into an expression vector pAA101 (Amersham) by a conventional method. did. The plasmid obtained by the subcloning was named pBMVl.

pGEMHYP was treated with Clal and Sphl, a fragment having the nucleotide sequence of SEQ ID NO: 28 was obtained by agarose gel electrophoresis, and then subcloned into pBMV1 by a conventional method. The plasmid obtained by the subcloning was named pBMV2.

p GEMMD C was treated with Xbal and Bglll, a fragment having the nucleotide sequence of SEQ ID NO: 26 was obtained by agarose gel electrophoresis, and then subcloned into PBMV2 according to a conventional method. The plasmid obtained by the subcloning was named pBM V3.

pGEMMVK1 was treated with Hindlll and Xbal, and subcloned into pBMV3 according to a conventional method. The plasmid obtained by the subcloning was named pBMV4.

A 2.1 kb DNA fragment obtained by digesting PBMV4 with Hindlll and Bglll was inserted between the Hindlll site and the Bglll site of pBMV1 and named pBMV5. P.BMV5 was introduced into B. subtil is 168 strain to obtain B. subtil is 168 (pBMV5). B. subtilis 168 (pBMV5) is capable of converting MVA added to the medium to IPP by IPTG-induced mevalonate kinase, phosphomevalonate kinase, and diphosphomevalonate decarboxylase. Furthermore, Bacillus subtilis originally possesses IPP Since DMAPP can be made by the IPP isomerase used, it can be grown using the mevalonate pathway. In addition, since the wild strain of Bacillus subtilis also has a non-mevalonate pathway, IPP and DMAPP can be produced by the non-mevalonate pathway. In other words, B. subtilis 168 (PBMV5) can make IPP through both mevalonate and non-mevalonate pathways.

(2) Disruption of the DXP reductoisomerase gene of B. subtilis 168 (pBMV5) non-mevalonate pathway (disruption of non-mevalonate pathway)

The Bacillus subtilis yluB gene encodes the DXP reductoisomerase gene (Proc. Natl. Acad. Sci. USA., 95, 9879, 1998).

The following primers specific to the yluB gene:

N-terminal primer: 5, -TCTAGATTGAAAAATATTTGTCTTTTAGG (SEQ ID NO: 29)

C-terminal primer: 5,-TCTAGATCACGMCATACCACCTTATG (SEQ ID NO: 30)

Was used to amplify the full length of the yluB gene by PCR, cloned into the Xbal site of the E. coli vector PUC118, and named it pUCdxr.

Next, the erythromycin resistance gene was amplified by PCR using the following polymerase. Plasmid pMUTIN2 containing an erythromycin resistance gene was used for PCR type II. EcoT221 sites were added to both ends.

N-terminal primer: 5, -ATGCATGMTTGATCCTCTAGCAC (SEQ ID NO: 31)

C-terminal primer: 5, -ATGCATGCCACTCATAGAATTATTTC (SEQ ID NO: 32)

Next, this amplified DNA fragment containing the erythromycin resistance gene was inserted into the EcoT221 site present in the yluB gene of pUCdxr. Thus, _c plasmid pUCdxr :: era where yluB gene was divided by the area Suromaishin resistance gene has been completed pUCdxr:: B. subtilis 168 and (pBMV5) was transformed with erm, was selected Ellis port hygromycin resistant clones . In erythromycin-resistant clones, it is predicted that the genomic yluB gene is disrupted and destroyed by the erythromycin-resistant gene as a result of homologous recombination. Of the obtained erythromycin-resistant clone The disruption of the yluB gene was confirmed by Southern hybridization. This DXP reductoisomerase gene (yluB) disrupted strain was named B. subtil is delyluB (PBMV5). B. subtilis delyluB (pBMV5) can convert MVA added to the medium to IPP by MVA kinases induced by IPTG and PMVA kinase DPMVA decarboxylase. In addition, DMAP can be grown by using IPP isomerase, which has IPP, to create DMAPP. Therefore, B. subtilis delyluB (pBMV5) can grow only in the presence of MVA and IPTG, depending only on the mevalonate pathway.

(3) Screening for inhibitors of IPP isomerase

Compounds that inhibit the growth of B. subtilis delyluB (pBMV5), which has only the mevalonate pathway, but do not inhibit the growth of B. subtil is 168 (pBMV5), which has the mevalon production pathway and the non-mevalonate pathway, Among them, compounds that inhibit mepalonate kinase, phosphomevalonate kinase, diphosphomevalonate decarboxylase or IPP isomerase.

B. subtilis delyluB (pBMV5) was shake-cultured at 37.C in 5 ml of LB liquid medium containing 3.4 zg / ml chloramphenicol and 0.5 jg / ml erythromycin. Agar containing 1/1000 volume of the above culture medium added to a normal broth medium (manufactured by Eiken Chemical Co.) containing 3.4 g / ml chloramphenicol, 0.5 / g / ml erythromycin, 1 mM IPTG and 0.02% MVA. A medium was prepared.

B. subtilis 168 (pBMV5) was shake-cultured at 37.C in 5 ml of LB liquid medium containing 3.4 μg / ml chloramphenicol at 37.C. An agar medium was prepared by adding 1/1000 amount of the above culture solution to a normal broth medium (manufactured by Eiken Chemical Co., Ltd.) containing 3.4 μg / ml chloramphenicol, 1 mM IPTG and 0.02%.

Here, the gene on pBMV5 is expressed only in the presence of IPTG.

50 jl of the test sample was dropped on a paper disc, placed on the above two types of agar medium, and cultured at 37 ° C overnight. After completion of the culture, no growth inhibition circle due to the test substance was observed in the medium supplemented with B. subtilis 168 (pBMV5), and no growth inhibition circle due to the test substance in the medium supplemented with B. subtilis delyluB (pBMV5). If is observed, it is expected that the subject contains a compound that inhibits mevalonate kinase or phosphomevalonate kinase or diphosphomevalonate decarboxylase or IPP isomerase. By determining whether or not the obtained candidate substance inhibits the IPP isomerase activity, the target IPP isomerase inhibitor can be obtained. Industrial applicability

According to the present invention, the function of a gene of unknown function in the gene class encoding a group of enzymes in the mevalonate pathway isolated from Streptomyces sp. Strain CL190 was clarified. Further, according to the present invention, it has become possible to provide a novel isopentenyl diphosphate isomerase and a gene encoding the same. Further, by searching for the inhibitor of isopentenyl diphosphate isomerase of the present invention, substances that inhibit the growth of organisms (for example, Staphylococcus aureus such as methicillin-resistant Staphylococcus aureus, enterococci, pneumonia, etc.) Antibacterial agents and antiprotozoal agents against streptococci, group A hemolytic streptococci or Lyme disease bacteria).

Claims

The scope of the claims

1. An enzyme protein having isopentenyl diphosphate isomerase activity having the following physicochemical properties.

(1) Action:

Isomerize isopentenyl diphosphate (IPP) to produce dimethylaryl diphosphate (DMAPP). DMAPP isomerizes to produce IPP.

(2) Substrate specificity:

Isopentenyl diphosphate (IPP) is used as a substrate. DMAPP is also used as a substrate.

(3) Reaction conditions:

2. The enzyme protein according to claim 1, which is a protein derived from bacteria or protozoa.

3. The enzyme protein according to claim 1 or 2, which exhibits a molecular weight of about 37 to 41 kDa as measured by SDS-PAGE.

4. An enzyme protein having isopentenyl diphosphate isomerase activity having any of the following amino acid sequences:

(B) In the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13, one to several amino acids are deleted, substituted, added and / or Or an inserted amino acid sequence, an amino acid sequence having isopentenyl diphosphate isomerase activity; or

5. A DNA encoding the protein according to any one of claims 1 to 4.

6. A DNA encoding a protein having isopentenyl diphosphate isomerase activity having any one of the following nucleotide sequences:

(C) a nucleotide sequence that can hybridize under stringent conditions to the nucleotide sequence described in SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 14 A nucleotide sequence encoding a protein having isopentenyl diphosphate isomerase activity.

7. A recombinant vector containing the DNA according to claim 5 or 6.

8. A transformant having the recombinant vector according to claim 7.

9. A step of transforming the vector containing the DNA according to claim 5 or 6 into a host, culturing the transformant to produce isopentenyl diphosphate isomerase, and isolating the isopentenyl diphosphate isomerase from the culture. A method for producing isopentenyl diphosphate isomerase, comprising a step of collecting pentenyl diphosphate isomerase.

10. A method for producing dimethylaryl diphosphate (DMAPP) and IPP, comprising using the enzyme protein having isopentenyl diphosphate isomerase activity according to any one of claims 1 to 4.

11. A method for screening for a substance that inhibits the growth of an organism, comprising searching for a substance that inhibits isopentenyl diphosphate isomerase activity.

12. The screening method according to claim 11, wherein the organism is a bacterium or a protozoan.

1 3. A biological growth inhibitor consisting of an inhibitor of isopentenyl diphosphate isomerase.

14. The agent according to claim 13, wherein the organism is a bacterium or a protozoan.