WO2001094403A1

WO2001094403A1 - A new polypeptide- human transcriptional activation subunit 14 and the polynucleotide encoding it

Info

Publication number: WO2001094403A1
Application number: PCT/CN2001/000753
Authority: WO
Inventors: Yumin Mao; Yi Xie
Original assignee: Shanghai Biowindow Gene Development Inc.
Priority date: 2000-05-16
Filing date: 2001-05-14
Publication date: 2001-12-13
Also published as: CN1323827A; AU1358302A

Abstract

The present invention disclose a new polypeptide- human transcriptional activation subunit 14, the polynucleotide encoding it and a method producing the polypeptide by recombinant DNA technology. The present invention further disclose a method using the polypeptide to treat various disorders, e.g. malignant neoplasm, hematopathy, HIV infection and immunological disease and various inflammation etc.. The present invention also disclose an antagonist of the polypeptide and its therapeutic use. The present invention further disclose the use of the polynucleotide encoding the new human transcriptional activation subunit 14.

Description

A new polypeptide-human transfection activating protein subunit 14 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ^ transcript activator protein subunit 14 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. technical background

Transcription of eukaryotic cells requires two types of proteins. Universal transcription factor and activating protein. The former directs basic transcription, while the latter is responsible for cell-, tissue-, and gene-specific transcription that occur after receiving various stimuli. GABP is a transcription-activating protein and it is a member of the ETS family. It consists of two subunits, α and β.

(The -C00H end of the X subunit has an ETS domain, through which it can bind to the promoter's A / CGGAA / TA / GY sequence and activate RNA transcription. The 4 cysteines at the -C00H end are oxidized Reduction of regulatory sites. The modification of these sites affects the binding of proteins to DNA and the binding of alpha and beta subunits (1) Yurr ii Chinenov, Tonya Schmidt, et al (1998) J Biol Chem, 273 (11 ) 6203-6209.

The beta subunit contains 4.5 ankyrin repeats arranged in tandem. Each repeat unit includes a pair of antiparallel curling helixes and a loop with a type I corner at one end. These structures mainly mediate heterodimerization with (subunits), thereby strengthening the binding of (subunits and DNA) (2) Adr ian H. Ba tchelor, Derek E. Piper, Fabienne Char les de la Brous se, Steven L. McKni ght, Cynthia Wolberger (1998) sc ience 279: 1037-1041.

It has now been discovered that GABP is an activator of the utrophin promoter, which is a nutrient protein found at the nerve-muscle junction. Therefore, GABP can be used to increase the expression of utrophinD to treat Duchenne muscular dystrophy (3) Khurana TS, Rosraar in AG, Shang J et al. (1999) Mol Biol Cel l 10 (6): 2075-86.

GABP is also involved in the activation of the OTR (oxytocin receptor) gene promoter, which can mediate childbirth and ejaculation. Therefore GABP can be used for the regulation of reproductive function (4) Hoare S, Copland J A, Wood T G et al (1999) Endocr inology 140 (5) 2268-79.

In addition, GABP is also involved in the transcriptional activation of tumor necrosis factor, which is used for anti-tumor (5) Tomaras GD, Fos ter DA, Burrer CM et al. J Leukoc Biol 1999 66 (1): 183-93 One way is to interfere with the metabolism of polyamines. Because the SSAT gene product required for the growth of eukaryotic cells is the rate-limiting enzyme NRF2 for polyamine metabolism, a homolog of GABP, which can be related to the PRE of the SSAT gene. Combination of response elements to promote the transcription of SSAT genes, (6) Yanl in ¾ng, Le i Xiao, Arunthathi Thiaga l ingam (1998) J Biol Chern 273 (51) 34623-34630 »

Gene chip analysis revealed that thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Bcv304 cell line, non-starved L02 cell line, arsenic stimulated for 1 hour L02 cell line, arsenic stimulated L02 cell line for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, fetal lung and fetal heart However, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human transcriptional activator protein subunit 49, so the functions of the two may also be similar. The invention is named human transcriptional activator protein subunit 14.

As mentioned above, the human transcriptional activation protein subunit 14 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these Processes the human transcriptional activation protein subunit 14 protein, specifically identifying the amino acid sequence of this protein. Isolation of the novel human transcriptional activator sub-single 14 protein coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so isolation of its coding DM is very important. Object of the invention

It is an object of the present invention to provide an isolated novel polypeptide, human transcriptional activating protein subunit 14 and fragments, analogs and derivatives thereof.

Another object of the invention is to provide a polynucleotide encoding the polypeptide.

Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human transcriptional activating protein subunit 14.

Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human transcriptional activator protein subunit 14.

Another object of the present invention is to provide a method for producing human transcriptional activating protein subunit 14.

Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human transcriptional activating protein subunit 14.

Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human transcriptional activating protein subunit 14.

Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human transcriptional activating protein subunit 14. SUMMARY OF THE INVENTION The present invention relates to an isolated polypeptide, which is of human origin, and which comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a);

(c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 123-503 in SEQ ID NO: 1; and (b) a sequence having 1-1 in SEQ ID NO: 1 333-bit sequence.

The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human transcriptional activating protein subunit 14 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

The present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human transcriptional activating protein subunit 14 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.

The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human transcriptional activating protein subunit 14.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims. FIG. 1 is a comparison diagram of gene chip expression profiles of human transcription activator protein subunit 14 and human transcription activator protein subunit 49 of the present invention. The upper graph is a graph of the expression profile of human transcriptional activation protein subunit 14 and the lower graph is the graph of the expression profile of human transcriptional activation protein subunit 49. Among them, 1 indicates fetal kidney, 2 indicates fetal large intestine, 3 indicates fetal small intestine, 4 indicates fetal muscle, 5 indicates fetal brain, 6 indicates fetal bladder, 7 indicates non-starved L02, 8 indicates L02 +, lhr, As ³⁺ , and 9 indicates ECV304 PMA-, 10 means ECV304 PMA +, 11 means fetal liver, 12 means normal liver, 13 means thyroid, 14 means skin, 15 means fetal lung, 16 means lung, 17 means lung cancer, 18 means fetal spleen, 19 means spleen, 20 Indicates prostate, 21 indicates fetal heart, 22 indicates heart, 23 indicates muscle, 24 indicates testis, 25 indicates fetal thymus, and 26 indicates thymus.

Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human transcription activator protein subunit 14. 14 kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

"Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

"Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

"Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell. An "agonist" refers to a molecule that, when combined with human transcriptional activator protein subunit 14, can cause changes in the protein and thereby regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human transcriptional activating protein subunit 14.

An "antagonist" or "inhibitor" refers to a molecule that blocks or regulates the biological or immunological activity of human transcriptional activating protein subunit 14 when combined with human transcriptional activating protein subunit 14. Antagonists and Inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human transcriptional activating protein subunit 14.

"Regulation" refers to a change in the function of human transcriptional activation protein subunit 14, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human transcriptional activation protein subunit 14. change.

"Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human transcriptional activating protein subunits 14 using standard protein purification techniques. Substantially pure human transcription activator protein subunit 14 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human transcription activator subunit 14 polypeptide can be analyzed by amino acid sequence.

"Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues that match between sequences 0 Number of residues in sequence ^ I-Number of interval residues in the sequence-Number of interval residues in the sequence ^x

The assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

"Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

"Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^) ₂ and? 7. It can specifically bind to the epitope of human transcriptional activating protein subunit 14.

A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human transcription activating protein subunit 14" means that human transcription activating protein subunit 14 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human transcriptional activating protein subunits 14 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human transcription activator protein The purity of the unit 14 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, human transcriptional activating protein subunit 14, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.

The invention also includes fragments, derivatives and analogs of the human transcriptional activator protein subunit 14. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human transcriptional activating protein subunit 14 of the present invention. A fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) is one in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1333 bases and its open reading frame of 123-503 encodes 126 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human transcriptional activation protein subunit 49, and it can be deduced that the human transcriptional activation protein subunit 14 has a similar function to human transcriptional activation protein subunit 49. '

The polynucleotide of the present invention may be in the form of DM or RM. DM forms include cDNA, genomic DM, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used in the present invention, "degenerate variant" in the present invention refers to a coding region that encodes a protein or polypeptide having SEQ ID NO: 2 but is identical to the coding region shown in SEQ ID NO: 1 Sequences with different nucleic acid sequences.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (two sequences have at least 50%, preferably 70% identity). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human transcriptional activating protein subunit 14.

The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human transcriptional activating protein subunit 14 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cD libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences Is the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Labora tory Manua, Cold Spruing Harbor Laboratory. New York, 1989). Commercially available CDM libraries are also available, such as different CDM libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RM hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of transcripts of human transcriptional activating protein subunit 14; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used alone or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the (4) method, the protein product of human transcription activator protein subunit 14 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

A method for amplifying DNA / RNA by PCR (Saiki, et al. Sc ience 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-cDM terminal rapid amplification method) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The polynucleotide sequence of the gene of the present invention or various D fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising the polynucleotide of the present invention, and A genetically engineered host cell using the human transcription activator protein subunit 14 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.

In the present invention, a polynucleotide sequence encoding a human transcription activating protein subunit 14 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human transcriptional activator protein subunit 14 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, MA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989). The DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

Those of ordinary skill in the art know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human transcriptional activating protein subunit 14 or containing the polynucleotide The recombinant vector can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a D sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the 01 ₁₂ method. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

By conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human transcription activator protein subunit 14 (Science, 1984; 224: 1431). Generally there are the following steps:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding human human transcriptional activating protein subunit 14 of the present invention, or a recombinant expression vector containing the polynucleotide;

(2) culturing host cells in a suitable medium;

(3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

It is now found that GABP is an activating factor of the ut rophin promoter, and utrophin is a kind of Nutritional protein at the neuromuscular junction. Therefore, GABP can increase the expression of utrophinD to treat Duchenne muscular dystrophy (3) hurana TS, Rosmar in AG, Shang J et al. (1999) Mol Bi ol Ce ll 10 (6): 2075-86.

GABP is also involved in the activation of the OTR (oxytocin receptor) gene promoter, and oxytocin mediates labor and ejaculation. Therefore GABP can be used for the regulation of reproductive function (4) Hoare S, Copland J A, Wood T G et al (1999) Endocr inology 140 (5) 2268-79.

In addition, GABP is also involved in the transcriptional activation of tumor necrosis factor, which is used for anti-tumor (5) TomarasGD, Foster DA, Burrer CM et al. J Leukoc Bio l 1999 66 (1): 183-93 Another approach is to interfere with the metabolism of polyamines. Because the SSAT gene product required for the growth of eukaryotic cells is the rate-limiting enzyme NRF2, a homolog of GABP, which can bind to the PRE response element of the SSAT gene and promote the transcription of the SSAT gene. (6) Yanl in fang , Lei Xiao, Arunthathi Thiaga l ingam (1998) J Biol Chera 273 (51) 34623—3463.

The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the human transcription-activating protein JE unit 14. Agonists enhance human transcriptional activator protein subunit 14 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human transcriptional activation protein subunit 14 can be cultured with labeled human transcriptional activation protein subunit 14 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

Antagonists of human transcriptional activating protein subunit 14 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human transcriptional activating protein subunit 14 can bind to human transcriptional activating protein subunit 14 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.

When screening compounds as antagonists, human transcriptional activation protein subunit 14 can be added to a bioanalytical assay to determine whether a compound is a compound by measuring the effect of the compound on the interaction between human transcriptional activation protein subunit 14 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human transcriptional activating protein subunit 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 14 molecules of human transcriptional activator protein subunits should generally be labeled.

The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against human transcriptional activator protein subunit 14 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments and Fab expression Library-generated snippets.

Polyclonal antibodies can be produced by injecting human transcription activator protein subunit 14 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent. Techniques for preparing monoclonal antibodies to human transcription activator protein subunit 14 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc. Inlay antibodies combining human constant regions and non-human-derived variable regions can be produced using existing technologies (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human transcriptional activator protein subunit 14.

Antibodies against human Transcription Activator Subunit 14 can be used in immunohistochemical techniques to detect human Transcription Activator Subunit 14 in biopsy specimens.

Monoclonal antibodies that bind to human transcriptional activating protein subunit 14 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human transcription activator protein subunit 14 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human transcription activating protein subunit 14 cell.

The antibodies of the present invention can be used to treat or prevent diseases related to the human transcriptional activator protein subunit 14. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human transcriptional activating protein subunit 14.

The invention also relates to a diagnostic test method for quantitative and localized detection of human transcriptional activating protein subunit 14 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The levels of human transcriptional activation protein subunit 14 detected in the test can be used to explain the importance of human transcriptional activation protein subunit 14 in various diseases and to diagnose diseases in which human transcriptional activation protein subunit 14 plays a role.

The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

The polynucleotide encoding human transcriptional activating protein subunit 14 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat non-expressed or abnormal / inactive forms of human transcriptional activating protein subunit 14 Cell proliferation, development, or metabolism. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human transcription activating protein subunit 14 to inhibit endogenous human transcription activating protein subunit 14 activity. For example, a variant human transcriptional activator protein subunit 14 may be a shortened human transcriptional activator protein subunit 14 lacking a signaling functional domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human transcriptional activating protein subunit 14. Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer a polynucleotide encoding human transcription activating protein subunit 14 into a cell. Construction method of carrying the transcriptional activator protein encoding polynucleotide of 14 subunits of recombinant viral vectors have been found in the literature _{(Samb r ook, et a l} .). Alternatively, a recombinant polynucleotide encoding human transcriptional activating protein subunit 14 can be packaged into liposomes and transferred into cells.

Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DM) that inhibit human transcription activator protein subunit 14 raRNA and ribozymes are also within the scope of the present invention. A ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing MA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

A polynucleotide encoding human transcriptional activating protein subunit 14 can be used for the diagnosis of diseases related to human transcriptional activating protein subunit 14. The polynucleotide encoding human transcriptional activation protein subunit 14 can be used to detect the expression of human transcriptional activation protein subunit 14 or the abnormal expression of human transcriptional activation protein subunit 14 in a disease state. For example, a DNA sequence encoding human transcriptional activation protein subunit 14 can be used to hybridize biopsy specimens to determine the expression of human transcriptional activation protein subunit 14. Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Human transcription activator subunit Position 14 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect the transcription product of human transcriptional activation protein subunit 14.

Detection of mutations in the human transcription activator protein subunit 14 gene can also be used to diagnose human transcription activator protein subunit 14-related diseases. The form of human Transcription Activator Subunit 14 mutation includes point mutations, translocations, deletions, recombination, and any other abnormalities compared to the normal wild-type human Transcription Activator Subunit 14 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

In short, a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manu of Basic Techniques, Pergamon Pres s, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. 'These data can be found in V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins Univer s Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human transcriptional activator protein subunit 14 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human transcription activator protein subunit 14 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally based on conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Labora tory Pres s, 1989), or Follow the conditions recommended by the manufacturer.

Example 1 Cloning of human transcriptional activator protein subunit 14

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total MA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. A Smar t cDNA cloning kit (purchased from C 1 on tech) # cDNA fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 α to form a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Blmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. CDNA The sequence was compared with the existing public DNA sequence database (Genebank), and the cD sequence of one of the clones 0391f04 was found to be new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the 0391f04 clone contains a full-length cD of 1333bp (as shown in Sed IDN0: l), and a 381bp open reading frame (0RF) from 123bp to 503bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0391f 04 and the encoded protein was named human transcriptional activating protein subunit 14. Example 2 Cloning of a gene encoding human transcriptional activating protein subunit 14 by RT-PCR The total RNA from fetal brain cells was used as a template, and oligo-dT was used as a primer for reverse transcription reaction to synthesize cDNA. , Using the following primers for PCR amplification:

Priraerl: 5, one CAAGAGTTTAAAGATAGTAAGCAG -3, (SEQ ID NO: 3)

Priraer2: 5'- TTCTTTTTCTTTTTTTTTTTTTTTGG -3 '(SEQ ID NO: 4)

Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 μl of ol / LKCl, 10 mol / L Tris-HCl pH8.5, 1.5 mmol / L MgCl ₂ , 200 μηιο1 / Ι dNTP, lOpmol primer, 1U Taq DNA in a 50 μ1 reaction volume Polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72. C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-3333bp shown in SEQ ID NO: 1. Example 3 Northern blot analysis of human transcriptional activation protein subunit 14 gene expression Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA was precipitated at 70 ° / °. Wash with ethanol, dry and dissolve in water. , (N- morpholino) propanesulfonic acid (pH7.0) containing _20μ ε RNA with 20mM 3- - electrophoresed on IraM EDTA-2.2M formaldehyde-1.2% agarose gel - 5mM sodium acetate. It was then transferred to a nitrocellulose membrane. A- ³² P dATP with ^{32 Ρ} prepared by random priming Method - labeled DNA probe. The DM probe used was the PCR-encoded human transcriptional activating protein subunit 14 coding region sequence (123bp to 503bp) shown in FIG. 1. 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) The cellulose acetate membrane was hybridized overnight at 42 ° C in a solution containing 50% formamide-25αιΜ KH ₂ P0 ₄ (Η7.4)-5 x SSC-5 x Denhardt's solution and 20 (^ g / ml salmon Sperm DNA. After hybridization, the filter was washed in 1 X SSC-0. 1% SDS for 30 min at 55 ° C. Then, it was analyzed and quantified using a Phosphor Imager. Example 4 Recombinant human transcription activating protein subunit 14 in vitro Expression, isolation, and purification According to the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers was designed. The sequence is as follows:

Pr imer 3: 5'-CCCCATATGATGGATCACGGTGTCTACCAGCCG-3 '(Seq ID No: 5) Pr imer 4: 5,-CATGGATCCTTACCCATGGTTGTAATCTTCATC-3, (Seq ID No: 6) The 5 and 2 ends of these two primers contain Ndel and BamHI digestion respectively Sites, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site. The pBS-0391f 04 plasmid containing the full-length target gene was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0391f 04 plasmid, Primer-3 and Primer-4 primers were 1 Opmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5 0, after (final concentration of _30μ δ / ηι1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced. A positive clone (pET-0391f 04) with a correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. Containing kanamycin (final concentration of 30μ _§ / ηι1) in LB liquid medium, host strain BI (pET-0391f 04) at ³ 7 ° C to logarithmic phase culture, IPTG was added to a final concentration IIMO I / L, continue to cultivate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected using an affinity chromatography column His s. Bind Quick Car tr idge (product of Novagen) capable of binding to 6 histidines (6His-Tag). By chromatography, a purified human transcription activating protein subunit 14 of the target protein was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 14 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of Anti-Human Transcription Activator Subunit 14 Antibody

A peptide synthesizer (product of PE company) was used to synthesize the following human transcriptional activating protein subunit 14-specific peptides:

NH2-Met-Asp-Hi s-Gly-Val-Tyr-Gln-Pro-Ala-Asn-Ser-Gln-Ser-Ser-Pro-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.釆 Using a 15 g / ml bovine serum albumin peptide complex-coated titer plate as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Seph _arOS e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method demonstrated that the purified antibody could specifically bind to human transcriptional activating protein subunit 14. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered: 1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

3, there should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:

Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

5'-TGGATCACGGTGTCTACCAGCCGGCAAATTCACAAAGCAGC-3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

5'-TGGATCACGGTGTCTACCAGCCGGCAAATTCACAAAGCAGC-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Keller; M. Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning laboratory manuals, such as the Guide to Molecular Cloning Experiments (Second Edition 1998) [US] Sambrook et al., Science Press.

Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1000g for 10 minutes. 3) 0.25 mol / L sucrose in cold homogenate buffer; 25 ol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl ₂ ) suspended precipitate (about 10 ml / g 4) used at 4 C The electric homogenizer homogenizes the tissue suspension at full speed until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (l-5ml per 0.1 g of the initial tissue sample), and centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells (1 × ^{10 8} cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS To a final concentration of 1%, if SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoprene (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DM to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1-5 X 10 ⁶ cells extracted about plus lul.

The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 1.5 volume of cold ethanol, mix well and set to -20. C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ . To check the purity and yield of DM. 15) Store at -20 ° C after dispensing.

Preparation of sample film:

1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe for later experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

3) Place on filter paper infiltrated with 0.1mol / L NaOH, 1.5mol / L NaCl for 5 minutes (twice), dry and place in 0.5mol / L Tris-HCl (pH7.0), 3mol / L Filter paper for 5 minutes (twice) and dry. 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1.

2) Incubate at 37 ° C for 2 hours.

3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

4) Pass Sephadex G-50 column.

5) Collect the first peak before ³² P-Probes are washed out (monitorable).

6) 5 drops / tube, collect 10-15 tubes.

7) Monitor the amount of isotope with a liquid scintillator.

8) The ³² P-Probe (the second peak is free γ- ³² P-dATP) to be prepared after the collection solution of the first peak is combined.

Pre-hybridization

The sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.

Cross

Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight. Wash film:

High-intensity washing film:

1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

3) 0. IxSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

4) 0. IxSSC, 0.1% SDS, wash at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1 ° / oSDS, wash at 37 ° C for 15 minutes (twice).

3) 0. IxSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

4) 0. IxSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

-70 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot). Experimental results:

The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

Gene chip or gene microarray (DM Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, see the documents DeRis i, JL, Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

(A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The Cartesian 7500 spotter (purchased from Cartesian Company, USA) was spotted on the glass medium, between the spots. The distance is 280μί «. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

1. Hydration in a humid environment for 4 hours;

2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

5. 95 ^D C water for 2 minutes;

6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

8. Dry and store at 25 ° C in the dark for future use. (Two) probe marking

Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) by one-step method, and the mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen), and the fluorescent reagents were separately reverse-transcribed. Cy 3dUTP (5-Amino-propar gy 1-2 '-deoxyur id ine 5--triphate coupled to Cy3 f luorescent dye, purchased from Araersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5—Amino — Propargyl-2'-deoxyuridine 5'-trip ate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe. For specific steps and methods, see:

Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dar i., Davi s, RW (1995) Sc ience. 270 (20): 467-480.

(Three) cross

The probes from the above two tissues and the chip were respectively hybridized in a UniHyb ™ Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed at room temperature with a washing solution (1 <SSC, 0.2% SDS) Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Iraagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart. Draw a graph based on these 26 Cy3 / Cy5 ratios (Figure 1). It can be seen from the figure that the expression profiles of human transcription activator subunit 14 and human transcription activator subunit 49 according to the present invention are very similar.

Claims

Shuli Yaoli

1. An isolated polypeptide-human transcription activating protein subunit 14, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

(b) a polynucleotide complementary to the polynucleotide (a); or

(c) a polynucleotide that is at least 70% identical to) or (b).

5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 123 to 503 in SEQ ID NO: 1 or positions 1-1 to 333 in SEQ ID NO: 1 the sequence of.

7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

(a) a host cell transformed or transduced with the recombinant vector of claim 7; or

(b) A host cell transformed or transduced with any of the polynucleotides of claim 4-6.

9. A method for preparing a polypeptide having human transcriptional activating protein subunit 14 activity, characterized in that the method includes:

(a) culturing the engineered host cell according to claim 8 under conditions in which human transcription activator protein subunit 14 is expressed;

(b) Isolating a polypeptide having human transcriptional activating protein subunit 14 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human transcriptional activation protein subunit 14.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human transcriptional activating protein subunit 14.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human transcription activating protein subunit 14 in vivo and in vitro.

14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. The use of the polypeptide according to any one of claims 1-3, which is characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human transcriptional activating protein subunit 14; or For identification of peptide fingerprints.

16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used for manufacturing a gene chip. Or microarray.

17. The use of a polypeptide, polynucleotide or compound as claimed in any one of claims 1-6 and Π, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of human transcriptional activating protein subunit 14.

18. The claim of any one of claims 1-6 and 11, the use of the polypeptide, polynucleotide, or compound described in the claim, which is characterized in that the polypeptide, polynucleotide or compound is used for the preparation of a treatment such as malignancy Tumors, blood diseases, HIV infections and immune diseases and various types of inflammation drugs.