WO2001090350A1 - Nouveau polypeptide, cofacteur humain de pliage de beta-tubuline c-9, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, cofacteur humain de pliage de beta-tubuline c-9, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001090350A1
WO2001090350A1 PCT/CN2001/000757 CN0100757W WO0190350A1 WO 2001090350 A1 WO2001090350 A1 WO 2001090350A1 CN 0100757 W CN0100757 W CN 0100757W WO 0190350 A1 WO0190350 A1 WO 0190350A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human beta
folding cofactor
tubulin folding
Prior art date
Application number
PCT/CN2001/000757
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU75635/01A priority Critical patent/AU7563501A/en
Publication of WO2001090350A1 publication Critical patent/WO2001090350A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human beta-tubulin folding cofactor C-9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Microtubules are essential and ubiquitous components of the cytoskeleton. Their filamentous arrangement is related to different biological functions, including cell division, intracellular transport, and maintenance of the cellular framework. Microtubules are assembled from tubulin heterodimers, one alpha- and one beta-tubulin polypeptide. The first step in forming a tubulin heterodimer after transcription is to fold the newly synthesized ⁇ - and ⁇ -tubulin polypeptides into their natural conformation. Tubulin is extremely important for the enzymatic mechanism to convert ATP to hydrolyze into molecules that move along the microtubules.
  • beta-tubulin interacts with the kinesin actuator to regulate microtubule polymerization, movement, and drug sensitivity (Rangana than et a l., 1997, Pros ta te 30: 263-268; Tucker and Golds tein , 1997, J. Biol. Chem. 272: 9481-9488).
  • beta-tubulin plays a role in tumorigenesis, progressive tumors, cell structure and intracellular protein transport, cell differentiation, and intracellular signaling. Beta-tubulin can therefore be used to treat specific cancers and diseases such as autoimmune diseases and neurodegenerative diseases.
  • the beta-tubulin folding intermediate produced by the interaction with ATP-dependent cytoplasmic companion proteins reacts with four proteins (cofactors A, D, E, and C) continuously.
  • the post-accompanying protein step in the cascade does not rely on ATP or GTP hydrolysis, although GTP plays a framework role in tubulin folding.
  • Cofactors A and D function by capturing and fixing beta-tubulin in a quasi-native conformation.
  • Cofactor B binds to the cofactor D-beta-tubulin complex; it interacts with cofactor C and then releases the beta-tubulin polypeptide in its natural state.
  • beta-tubulin folding cofactor C acts as a chaperone protein, which prevents incorrect responses from occurring on the hydrophobic surface of the P-tubulin subunit, or overcomes one or more specific motive obstacles by raising the target protein To complete the correct folding (Guol ing T., Yi H., 1996 Ce ll 86, 287-296).
  • the human beta-tubulin folding cofactor C-9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art. Identification of more human beta-tubulin folding cofactor C-9 proteins involved in these processes, especially the amino acid sequence of this protein.
  • the newcomer's beta-tubulin folding cofactor C-9 protein gene isolation also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human beta-tubulin folding cofactor C-9.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human beta-tubulin folding cofactor C-9.
  • Another object of the present invention is to provide a method for producing human beta-tubulin folding cofactor C-9.
  • Another object of the present invention is to provide an antibody against the polypeptide-human beta-tubulin folding cofactor C-9 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors for the beta-tubulin folding cofactor C-9 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of human beta-tubulin folding cofactor C-9. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 778-1026 in SEQ ID NO: 1; and (b) a sequence having 1-2422 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a co-selected method for mimicking, activating, antagonizing or inhibiting human beta-tubulin folding cofactor C-9 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human beta-tubulin folding cofactor C-9 protein in vitro, which comprises detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of various adenocarcinomas, developmental disorders, cilia, villous dyskinesias, inflammation, immune diseases, blood diseases, HIV infections or other human Use of beta-tubulin folding cofactor C-9 for diseases caused by abnormal expression.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of beta-tubulin folding cofactor C-9 and human beta-tubulin folding cofactor C of the present invention.
  • the upper graph is a graph of the expression profile of human beta-tubulin folding cofactor C-9
  • the lower graph is the graph of the expression profile of human beta-tubulin folding cofactor C.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 is the prostate
  • 21 is the fetal heart
  • 22 is the heart
  • 23 is the muscle
  • 24 is the testis
  • 25 is the fetal thymus
  • 26 is the thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human beta-tubulin folding cofactor C-9.
  • 9KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to the genome or Synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to natural, recombinant or synthetic proteins and fragments thereof in suitable The ability to induce a specific immune response in an animal or cell and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human beta-tubulin folding cofactor C-9, can cause changes in the protein and thereby regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human beta-tubulin folding cofactor C-9.
  • Antagonist refers to a biological activity that blocks or regulates human beta-tubulin folding cofactor C-9 when combined with human beta-tubulin folding cofactor C-9.
  • immunologically active molecules Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind human beta-tubulin folding cofactor C-9.
  • Regular refers to a change in the function of human beta-tubulin folding cofactor C-9, including an increase or decrease in protein activity, a change in binding characteristics, and any of human beta-tubulin folding cofactor C-9 Changes in other biological, functional or immune properties.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human beta-tubulin folding cofactor C-9 using standard protein purification techniques. Essentially pure human beta-tubulin folding cofactor C-9 produces a single main band on a non-reducing polyacrylamide gel. Human beta-tubulin folding cofactor C-9 peptide purity can be analyzed by amino acid sequence
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method checks all The distances arrange the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzyraology 183: 625-645). 0 "Similarity” refers to amino acids The degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between sequences.
  • Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human beta-tubulin folding cofactor C-9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human beta-tubulin folding cofactor C-9 means that human beta-tubulin folding cofactor C-9 is substantially free of other proteins, lipids, and sugars naturally associated with it. Or other substances. Those skilled in the art can purify human beta-tubulin folding cofactor C-9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human beta-tubulin folding cofactor C-9 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide-human beta-tubulin folding cofactor C-9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human beta-tubulin folding cofactor C-9.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human beta-tubulin folding cofactor C-9 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or UI) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such a Species, wherein the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as Leader sequence or secretory sequence or the sequence or protease sequence used to purify this polypeptide).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2422 bases, and its open reading frame 778-1026 encodes 82 amino acids.
  • this peptide has a similar expression profile with human beta-tubulin folding cofactor C, and it can be inferred that the human beta-tubulin folding cofactor C-9 has human beta-tubulin Folding Cofactor C has similar functions.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DM, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region shown in SEQ ID NO: 1
  • the sequences are identical or degenerate variants.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50% (v / v) peptamide, 0.1% calf serum / 0.1% Fico ll, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human beta-tubulin folding cofactor C_9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human beta-tubulin folding cofactor C-9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Sour tablets Paragraph.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many proven techniques for extracting mRM, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua 1, Cold Spoon Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DM or DM-RNA hybridization; (2) the appearance or loss of marker gene function; (3) the transcription of human beta-tubulin folding cofactor C-9 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human beta-tubulin folding cofactor C-9 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) Wait.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) Wait.
  • a method (Saiki, et al. Science 19S5; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Fixed. Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes the CDM sequences of multiple clones need to be determined in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human beta-tubulin folding cofactor C-9 coding sequence, and the present invention is produced by recombinant technology A method of inventing the polypeptide.
  • a polynucleotide sequence encoding human beta-tubulin folding cofactor C-9 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human beta-tubulin folding cofactor C-9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide the synthesis of raRNA. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pairs of the SV40 enhancer on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture. And green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture.
  • GFP green fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human beta-tubulin folding cofactor C-9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a gene containing the polynucleotide or the recombinant vector.
  • Engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human beta-tubulin folding cofactor C-9 (Sc ience, 1984; 224: 1431). Generally speaking, there are the following steps:
  • polynucleotide or variant
  • encoding human beta-tubulin folding cofactor C-9 of the present invention or a suitable host cell transformed or transduced with a recombinant expression vector containing the polynucleotide ;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high Performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • microtubules are an important part of the centrosome and regulate the normal progress of mitosis and amitosis in cells.
  • Microtubules are also essential for endoplasmic reticulum and Golgi apparatus for protein transport channels; microtubules Essential for cilia and villi movement.
  • Microtubules are assembled from tubulin heterodimers, an ⁇ - and a ⁇ -tubulin polypeptide. The C-terminus of p-tubulin interacts with kinesin transducers to regulate tubule polymerization, movement, and drug sensitivity. This function has physiological significance in pathogenesis.
  • Type IV beta-tubulin is highly expressed in prostate cancer; type II beta-tubulin is positively regulated in malignant adenocarcinoma; P-tubulin binds to a protein containing the Src homology 1 (SH2) domain. Assembly plays an important role in the complex of signal molecules involved in cell transformation. In summary, beta-tubulin plays a role in tumorigenesis, progressive tumors, cell structure and intracellular protein transport, cell differentiation, and intracellular signaling.
  • SH2 Src homology 1
  • P-tubulin interacts with its cofactors (Cofactors A, D, E, and C) to regulate the conformation and biological functions of tubulin.
  • Cofactors A, D, E, and C cofactors A, D, E, and C
  • the beta-tubulin folding cofactor C functions as a chaperone and is necessary for correct folding of the tubulin conformation.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human ⁇ -tubulin folding cofactor C, both of which have similar biological functions. It helps the microtubules to fold to form an active spatial configuration in the cell, and then exerts various biological functions of tubulin. Its abnormal expression is usually closely related to abnormalities in embryonic development, cell differentiation, cilia, villous motor tumors, and other related diseases.
  • human beta-tubulin folding cofactor C-9 of the present invention will produce various diseases, especially various adenocarcinomas, developmental disorders, cilia, villous dyskinesia, inflammation, and immunity.
  • Diseases including but not limited to:
  • Tumors of various tissues breast cancer, prostate cancer, stomach cancer, liver cancer, lung cancer, esophageal cancer, leukemia, lymphoma, thyroid tumors, uterine fibroids, astrocytoma, ependymoma, glioblastoma, colon cancer , Melanoma, bladder cancer, uterine cancer, endometrial cancer, nasopharyngeal cancer, laryngeal cancer, tracheal tumor development disorder: congenital abortion, cleft palate, limb absence, limb differentiation disorder, atrial septal defect, neural tube defect, Congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness, mental retardation, brain development disorder, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic defects, staying young Disease, dwarfism, Cushing syndrome, sexual retardation
  • Ciliary and villous dyskinesias chronic bronchitis, pneumonia, intestinal indigestion Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • human beta-tubulin folding cofactor C-9 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various adenocarcinomas, developmental disorders, cilia, villous dyskinesia, inflammation , Immune diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human be t a -tubulin folding cofactor C-9.
  • Agonists increase human be t a-tubulin folding cofactor C-9, which stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human beta-tubulin folding cofactor C-9 can be cultured in the presence of drugs together with labeled human beta-tubulin folding cofactor C-9. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human beta-tubulin folding cofactor C-9 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human be ta-tubulin folding cofactor C_9 can bind to human beta-tubulin folding cofactor C-9 and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Dot binding prevents the polypeptide from functioning biologically.
  • human beta-tubulin folding cofactor C-9 When screening compounds as antagonists, human beta-tubulin folding cofactor C-9 can be added to the bioanalytical assay, and human beta-tubulin folding cofactor C-9 and its receptors can be determined by measuring the compounds. The effects of interactions between humans to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human beta-tubulin folding cofactor C-9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human beta-tubulin folding cofactor C-9 molecule should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human beta-tubulin folding cofactor C-9 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments and Fab tables Dawen library generated fragments.
  • Polyclonal antibodies can be produced by injecting human beta-tubulin folding cofactor C-9 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but It is not limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to human beta-tubulin folding cofactor C-9 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, Human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies ⁇ . S. Pat No. 4946778, can also be used to produce single chain antibodies against human beta-tubulin folding cofactor C-9.
  • Antibodies against human beta-tubulin folding cofactor C-9 can be used in immunohistochemical techniques to detect human be t a-tubulin folding cofactor C-9 in biopsy specimens.
  • Monoclonal antibodies that bind to human beta-tubulin folding cofactor C-9 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human beta-tubulin protein folding cofactor C-9 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the disulfide exchange.
  • This hybrid antibody can be used to kill human beta-tubulin folding cofactor C-9 positive cells.
  • the antibodies in the present invention can be used to treat or prevent diseases related to human beta-tubulin folding cofactor C-9.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human beta-tubulin folding cofactor C-9.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human beta-tubulin folding cofactor C-9.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human beta-tubulin folding cofactor C-9 detected in the test can be used to explain the importance of human beta-tubulin folding cofactor C-9 in various diseases and to diagnose human beta- Diseases in which tubulin folds cofactor C-9.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzyme, and can be analyzed by one-dimensional or two-dimensional or three-dimensional gel electrophoresis, and more preferably by mass spectrometry coding.
  • Human beta-tubulin folding cofactor C-9 polynucleotides can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat non-expression of human beta-tubulin folding cofactor C-9 Or abnormal / inactive expression due to abnormal cell proliferation, development, or metabolism.
  • Recombinant gene therapy vectors can be designed to express mutated human beta-tubulin folding cofactor C-9 to inhibit endogenous human beta-tubulin folding cofactor C-9 activity.
  • a variant human beta-tubulin folding cofactor C-9 may be a shortened human beta-tubulin folding cofactor C-9, although it may interact with downstream substrates. Binding, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human beta-tubulin folding cofactor C-9.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • a polynucleotide encoding human beta-tubulin folding cofactor C-9 can be used to transfer a polynucleotide encoding human beta-tubulin folding cofactor C-9 into cells .
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human beta-tubulin folding cofactor C-9 can be found in existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human beta-tubulin folding cofactor C-9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DM
  • ribozymes that inhibit human beta-tubulin folding cofactor C-9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense MA and DM and ribozymes can be obtained by any existing RNA or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis technology has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DM sequence has been integrated downstream of the RM polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • a polynucleotide encoding human beta-tubulin folding cofactor C-9 can be used for the diagnosis of diseases related to human beta-tubulin folding cofactor C-9.
  • Polynucleotides encoding human beta-tubulin folding cofactor C-9 can be used to detect the expression of human beta-tubulin folding cofactor C-9 or human beta-tubulin folding cofactor in disease states C-9 abnormal expression.
  • the DM sequence encoding human beta-tubulin folding cofactor C-9 can be used to hybridize biopsy specimens to determine the expression of human beta-tubulin folding cofactor C-9.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • Microarray or DM chip (also called “gene chip”) is used to analyze differential expression analysis and gene diagnosis of genes in tissues.
  • Human beta-tubulin folding cofactor C-9 specific primers can be used to perform RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of human beta-tubulin folding cofactor C-9.
  • RT-PCR RM-polymerase chain reaction
  • Human beta-tubulin folding cofactor C-9 mutations include point mutations, translocations, deletions, recombinations and any other abnormalities compared to normal wild-type human beta-tubulin folding cofactor C-9 DNA sequences Wait. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the CDM or genomic sequence differences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human beta-tubulin folding cofactor C-9 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human beta-tubulin folding cofactor C -9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) m was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the 00 fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • the terminate cycle react ion sequencing kit (Perkin-Elmer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones.
  • the determined cDNA sequence was compared with an existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones, 0922b02, was a new DM.
  • a series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments contained in this clone.
  • the 0922b02 clone contains a full-length cDNA of 2422bp (as shown in Seq ID N0: l), and has a 249bp open reading frame (0RF) from 778bp to 1026bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0922b02 and the encoded protein was named human beta-tubulin folding cofactor C-9.
  • Example 2 The gene encoding human beta-tubulin folding cofactor C-9 was cloned by RT-PCR method.
  • RNA from fetal brain cells was used as a template, and ol-igo-dT was used as a primer for reverse transcription to synthesize cDNA.
  • PCR amplification was performed with the following primers:
  • Primer2 5'- GTCACCCTAAGCTTCGTCTTCTCG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Pr1 ⁇ 2er2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L KCl, 10 mraol / L Tri s-HCl pH 8.50, 1.5 mmol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, 1 Opmol primer, 1U Taq DM polymerase (product of Clontech).
  • the reaction was performed on a PE9600 MA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94.C 30sec; 55 ° C 30sec; 72 ° C 2min. At RT ⁇ -act in was set as positive control and template blank as negative control at the same time.
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA With 20 ⁇ RNA, run on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-IraM EDTA-2. 2M formaldehyde Line electrophoresis. It was then transferred to a nitrocellulose membrane. A 32 P dATP was used to prepare 32 P-labeled DM probes by random primer method. The DNA probe used was the human beta-tubulin folding cofactor C-9 coding region sequence (778bp to 1026bp) amplified by PCR as shown in FIG. 1.
  • a 32P-labeled probe (about 2 x 10 6 cpra / ral) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( ⁇ 7 ⁇ 4)-5 38 (-5 ⁇ 061111 ⁇ 21 ( ⁇ , 8 solution and 20 ( ⁇ 1 1 11 salmon sperm 0). After hybridization, filter membrane in 1 x SSC-0. 1% SDS at 55 ° C Wash for 30 min. Then, use Phosphor Imager for analysis and quantification.
  • Example 4 Recombinant human beta-tubulin folding cofactor C-9 in vitro expression, isolation and purification According to SEQ ID NO: 1 and the coding region shown in Figure 1 Sequence, design a pair of specific amplification primers, the sequence is as follows:
  • Pr imer3 5'- CCCCATATGATGCTGCTGATAAAAACATACCTG —3, (Seq ID No: 5)
  • Pr imer4 5'- CCCGAGCTCTCATGAGGGCACGTATGTCCCATG —3, (Seq ID No: 6)
  • the 5 ′ ends of these two primers contain Ndel and Sacl restriction sites respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and Sacl restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • PCR was performed using the pBS-0922b02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions are: pBS- 0922b02 plasmid 10 pg, primers Pr imer-3 and Pr imer-4 points in a total volume of 50 ⁇ l, and U is l Opmol, Advantage polymerase Mix
  • Cycle parameters 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • Ndel and Sacl were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into Ca. bacillus DH5 ⁇ by the calcium chloride method.
  • the titer plate coated with 15 g / ml bovine serum albumin peptide complex was used for ELISA to determine rabbit serum. Titer of antibody in the medium. Isolate total IgG from antibody-positive rabbit sera with protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column and the anti-peptide antibody was isolated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody can specifically bind to human beta-tubulin folding cofactor C-9.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Needle-to-sample hybridization has the strongest specificity and is retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt) :
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps. High strength Conditions and strength conditions wash the film.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
  • the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m.
  • the spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips.
  • the specific method steps have been reported in the literature.
  • the sample post-processing steps in this embodiment are:
  • the probes from the two types of tissues were hybridized with the chip in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and then washed with a washing solution (1 x SSC, 0.2 SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodicovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, and non-starved L0 2 cell line , L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain Fetal lung and fetal heart.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un cofacteur humain de pliage de béta-tubuline C-9, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de toutes sortes de tumeurs, des troubles du développement, des dyskinésies ciliaire et biliaire, des inflammations, des maladies immunitaires, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant le cofacteur humain de pliage de béta-tubuline C-9.
PCT/CN2001/000757 2000-05-16 2001-05-14 Nouveau polypeptide, cofacteur humain de pliage de beta-tubuline c-9, et polynucleotide codant ce polypeptide WO2001090350A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU75635/01A AU7563501A (en) 2000-05-16 2001-05-14 A novel polypeptide, a human beta-microtubulin folding co-factor c-9 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115716 CN1323823A (zh) 2000-05-16 2000-05-16 一种新的多肽——人beta－微管蛋白折叠辅因子C－9和编码这种多肽的多核苷酸
CN00115716.7 2000-05-16

Publications (1)

Publication Number Publication Date
WO2001090350A1 true WO2001090350A1 (fr) 2001-11-29

Family

ID=4585160

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000757 WO2001090350A1 (fr) 2000-05-16 2001-05-14 Nouveau polypeptide, cofacteur humain de pliage de beta-tubuline c-9, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1323823A (fr)
AU (1) AU7563501A (fr)
WO (1) WO2001090350A1 (fr)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE DDBJ [online] 8 January 2000 (2000-01-08), Database accession no. AP000159 *
DATABASE GENBANK [online] 17 March 2000 (2000-03-17), Database accession no. AP001415 *
DATABASE GENBANK [online] 21 December 1999 (1999-12-21), Database accession no. AC005531 *
DATABASE GENBANK [online] 8 May 1999 (1999-05-08), Database accession no. AC007016 *

Also Published As

Publication number Publication date
AU7563501A (en) 2001-12-03
CN1323823A (zh) 2001-11-28

Similar Documents

Publication Publication Date Title
WO2001083688A2 (fr) Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide
WO2001092514A1 (fr) Nouveau polypeptide, interleukine humaine 13 (il-13), et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001090350A1 (fr) Nouveau polypeptide, cofacteur humain de pliage de beta-tubuline c-9, et polynucleotide codant ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2001087972A1 (fr) Nouveau polypeptide, proteine dpc4 humaine 9 du facteur d'inhibition de la croissance tumorale, et polynucleotide codant ce polypeptide
WO2001087954A1 (fr) Nouveau polypeptide, chaine legere de clathrine humaine 9, et polynucleotide codant ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2001083677A2 (fr) Nouveau polypeptide, proteine humaine fh2-13 de deformation des ailes de coq, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001083540A1 (fr) Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide
WO2001075021A2 (fr) Nouveau polypeptide, proteine humaine associee au transport de glucose 10, et polynucleotide codant pour ce polypeptide
WO2001083542A1 (fr) Nouveau polypeptide, proteine humaine p18 21, et polynucleotide codant pour ce polypeptide
WO2001085778A1 (fr) Nouveau polypeptide, cofacteur humain c13 de repliement de la tubuline, et polynucleotide codant pour ce polypeptide
WO2001075012A2 (fr) Nouveau polypeptide, peptide signal humain 10 d'une proteine precurseur de la lipoproteine, et polynucleotide codant pour ce polypeptide
WO2001087916A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s5-13, et polynucleotide codant pour ce polypeptide
WO2001073069A1 (fr) Nouveau polypeptide, proteine humaine 12 associee aux tumeurs, et polynucleotide codant pour ce polypeptide
WO2001075027A2 (fr) Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001081537A2 (fr) Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide
WO2001073041A1 (fr) Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001075059A2 (fr) Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide
WO2001070983A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP