WO2001088112A1 - Nouveau polypeptide, kinase d'adhesion focale humaine (fak) 13, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, kinase d'adhesion focale humaine (fak) 13, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001088112A1 WO2001088112A1 PCT/CN2001/000711 CN0100711W WO0188112A1 WO 2001088112 A1 WO2001088112 A1 WO 2001088112A1 CN 0100711 W CN0100711 W CN 0100711W WO 0188112 A1 WO0188112 A1 WO 0188112A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- fak
- polynucleotide
- focal adhesion
- adhesion kinase
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- a new polypeptide-human focal adhesion kinase (FAK) 13 and a polynucleotide encoding the polypeptide TECHNICAL FIELD A new polypeptide-human focal adhesion kinase (FAK) 13 and a polynucleotide encoding the polypeptide TECHNICAL FIELD
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ ⁇ focal adhesion kinase (FAK) 13 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- Cancer invasion and metastasis is a complex process involving changes in cell adhesion characteristics, which allows transformed cells to invade and migrate through the extracellular matrix (ECM), thereby obtaining growth-independent characteristics (Liot ta, LA, et a l., Cel l 64: 327-336 (1991)). Some of these changes occur in focal plaques, which are cell / ECM contact points that contain cell membrane-related, cytoskeleton, and intracellular signaling molecules.
- Molecules contained in focal spots include cytoskeleton proteins such as actin, paxillin, and tensin; ECM proteins such as fibronectin, laminin, and vitronectin; cell surface receptors such as integrin; and protein tyrosine Kinases such as src family kinases and focal adhesion kinase (FAK).
- cytoskeleton proteins such as actin, paxillin, and tensin
- ECM proteins such as fibronectin, laminin, and vitronectin
- cell surface receptors such as integrin
- protein tyrosine Kinases such as src family kinases and focal adhesion kinase (FAK).
- Focal adhesion kinase (FAK) gene encodes a unique cytosolic protein tyrosine kinase. T and B lymphocytes are activated by their respective antigen receptors and then rapidly stimulated to produce FAK.
- the protein contains highly conserved sequences in the tyrosine kinase domain, flanked by long amino and carboxyl-terminal sequences, and the enzyme lacks the src homology (SH2 and SH3) regions in the amino-terminal sequences of other cytoplasmic kinases.
- Focal adhesion kinase (FAK) is an important molecule in cell signaling that regulates cell adhesion and activity, and is also important in cancer invasion and metastasis (Zachary, I.
- FAK is a major downstream mediator of the invasion and metastasis process in human tumors. Another unusual feature of FAK in invasion and metastasis is that it is related to integrins and integrin-mediated signaling pathways.
- the integrins family of cell surface receptors mediate the mutual adhesion of many tumors and participate in the signal transduction process (Juliano, RL & Varner, JA, Curr. Opin. Cel l Biol. 5: 812-818 (1993) ). Specific integrin expression steps are involved in both cell proliferation and metastasis.
- the third feature of FAK related to cell growth is that it is related to growth stimulation of neuropeptides like bombesin, vasopressin, and endothelin. These molecules produce mitogenic stimulators via receptors that accompany the effector through the heterotrimeric G protein, and effector molecules generate stimulators through FAK. Therefore, FAK for the growth-stimulating neuropeptide is transformed by the V-src oncogene to And integrin-mediated signaling is a convergence pathway.
- the human focal adhesion kinase (FAK) 13 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more participation has been required in the field.
- These processes of the human focal adhesion kinase (FAK) 13 protein in particular, identify the amino acid sequence of this protein.
- Isolation of newcomer focal adhesion kinase (FAK) 13 protein encoding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.
- FAK focal adhesion kinase
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human focal adhesion kinase (FAK) 13.
- FAM focal adhesion kinase
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human focal adhesion kinase (FAK) 13.
- FAM focal adhesion kinase
- Another object of the present invention is to provide a method for producing human focal adhesion kinase (FAK) 13.
- FAK focal adhesion kinase
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human focal adhesion kinase (FAK) 13.
- FAM focal adhesion kinase
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of human focal adhesion kinase (FAK) 13 against the polypeptide of the present invention.
- FAK focal adhesion kinase
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human focal adhesion kinase (FAK) 13.
- FAK focal adhesion kinase
- the invention relates to an isolated polypeptide, which is of human origin, and which comprises: SEQ ID No. 2 Amino acid sequence of a polypeptide, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 288-632 in SEQ ID NO: 1; and (b) a sequence having 1-2096 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human focal adhesion kinase (FAK) 13 protein, which comprises utilizing the polypeptide of the invention.
- FAK focal adhesion kinase
- the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human focal adhesion kinase (FAK) 13 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- FAK focal adhesion kinase
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of various tumors, developmental disorders, inflammation, immune diseases, blood diseases, HIV infection or other expressions due to human focal adhesion kinase (FAK) 13 Use of medicines for diseases caused by abnormalities.
- FAK focal adhesion kinase
- FIG. 1 is a comparison diagram of gene chip expression profiles of human focal adhesion kinase (FAK) 13 and human focal adhesion kinase (FAK) according to the present invention.
- the upper graph is a graph of the expression profile of human focal adhesion kinase (FAK) 13 and the lower graph is human adhesion Plot of expression profile of spotted kinase (FAK).
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 Indicates prostate
- 21 indicates fetal heart
- 22 indicates heart
- 23 indicates muscle
- 24 indicates testis
- 25 indicates fetal thymus
- 26 indicates thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human focal adhesion kinase (FAK) 1 3.
- 1 3KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human focal adhesion kinase (FAK) 13, can cause the protein to change, thereby regulating the activity of the protein.
- Agonists can include proteins, nucleic acids, carbohydrates Or any other molecule that can bind human focal adhesion kinase (FAK) 13.
- Antagonist refers to a molecule that, when combined with human focal adhesion kinase (FAK) 13, can block or regulate the biological or immunological activity of human focal adhesion kinase (FAK) 13.
- Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that binds human focal kinase (FAK) 13.
- “Regulation” refers to changes in the function of human focal adhesion kinase (FAK) 13 including the increase or decrease in protein activity, changes in binding characteristics, and any other biological properties, functions, or immunity of human focal adhesion kinase (FAK) 13 Change of nature.
- Those skilled in the art can purify human focal adhesion kinase (FAK) 13 using standard protein purification techniques. Basically pure human focal adhesion kinase (FAK) 13 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human focal adhesion kinase (FAK) 13 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks each pair by checking the distance between all pairs. Groups of sequences are arranged into clusters. Each cluster is then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzyraology 183: 625-645) 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human focal adhesion kinase (FAK) 13.
- FAK focal adhesion kinase
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human focal adhesion kinase (FAK) 13 means that human focal adhesion kinase (FAK) 13 is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it.
- Those skilled in the art can purify human focal adhesion kinase (FAK) 13 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of human focal adhesion kinase (FAK) 13 peptide can be analyzed by amino acid sequence.
- the present invention provides a novel polypeptide-human focal adhesion kinase (FAK) 13, which is basically composed of SEQ ID It consists of the amino acid sequence shown in NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human focal adhesion kinase (FAK) 13.
- FAK human focal adhesion kinase
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human focal adhesion kinase (FAK) 13 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2,096 bases in length, and its open reading frames 288-632 encode 114 amino acids.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DM, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optionally the additional Plus coding sequences) and non-coding sequences.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% ( ⁇ / ⁇ ) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 .
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human focal adhesion kinase (FAK) 13.
- FAK focal adhesion kinase
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding human spotting kinase (FAK) 13 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DI fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of the CDM sequences.
- the standard method for isolating the CDM of interest is to isolate raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spooning Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- the genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determining the level of human focal adhesion kinase (FAK) 13 transcripts; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human focal adhesion kinase (FAK) 13 gene expression.
- FAK focal adhesion kinase
- a method for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human focal adhesion kinase (FAK) 13 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
- FAM focal adhesion kinase
- a polynucleotide sequence encoding human focal adhesion kinase (FAK) 13 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, which are well known in the art. Transcript virus or other vector.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human focal adhesion kinase (FAK) 13 and appropriate transcription / translation regulatory elements. These methods include in vitro recombination MA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which are used as promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human focal adhesion kinase (FAK) 13 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 2 method used in the step are well known in the art. Alternatively, it is a MgCl 2. If If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human focal adhesion kinase (FAK) 13 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Cancer invasion and metastasis is a complex process involving changes in cell adhesion characteristics, which allows transformed cells to invade and migrate through the extracellular matrix (ECM), thereby obtaining growth-independent characteristics.
- ECM extracellular matrix
- some changes occur in the focal spot, which is a cell / ECM contact point that contains cell membrane-related, cytoskeleton, and intracellular signaling molecules.
- Molecules contained in focal spots include cytoskeleton proteins, ECM proteins, cell surface receptors, and protein tyrosine kinases, focal spot kinases (FAK), and the like. Studies have found that T and B lymphocytes are activated by their respective antigen receptors and then rapidly stimulated to produce FAK.
- FAK is a unique cytoplasmic protein tyrosine kinase that regulates cell adhesion and cell signaling activity. It is also important in invasion and transfer. Specifically, the activity of FAK keeps s rc oncogenes active; FAK is the main downstream mediator of invasion and metastasis in human tumors, and it is related to integrin and integrin-mediated signaling pathways in invasion and metastasis, and cells
- the surface receptor integrin family mediates the mutual adhesion of many tumors and participates in the signal transduction process.
- the specific integrin expression step is related to cell proliferation and metastasis; FAK is similar to bombesin and blood vessels related to cell growth. Growth stimuli are related to neuropeptides such as vasopressin and endothelin.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human focal adhesion kinase, and both have similar biological functions. It has a variety of important functions in the body, mainly regulating cell division, proliferation, and growth and development. Its abnormal expression is usually closely related to tumorigenesis and spread, embryonic developmental disorders, and related diseases.
- FAM focal adhesion kinase 1 3
- diseases include, but are not limited to: various tissues Tumors: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid gland tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, neurofibroma , Colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
- developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital deafness, mental retardation, brain development disorder, skin, fat and muscle development Adverse diseases, Bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome, sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- the abnormal expression of the human focal adhesion kinase (FAK) 1 3 of the present invention will also produce certain hereditary, hematological diseases, and the like.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, development disorders, inflammation, and immune diseases, Certain hereditary, hematological diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human focal adhesion kinase (FAK) 13.
- Agonists enhance human focal adhesion kinase (FAK) 13 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human focal adhesion kinase (FAK) 13 can be cultured with labeled human focal adhesion kinase (FM) 13 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- FM human focal adhesion kinase
- Antagonists of human focal adhesion kinase (FAK) 13 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human focal adhesion kinase (PAK) 13 can bind to human focal adhesion kinase (FAK) 13 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
- human focal adhesion kinase (FAK) 13 can be added to bioanalytical assays to determine compounds by measuring the effect of the compound on the interaction between human focal adhesion kinase (PAK) 13 and its receptors Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
- Polypeptide molecules capable of binding to human focal adhesion kinase (FAK) 13 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. For screening, human focal adhesion kinase (FAK) 13 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human focal adhesion kinase (FAK) 13 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- FAM focal adhesion kinase
- Polyclonal antibodies can be produced by injecting human focal adhesion kinase (FAK) 13 directly into immunized animals (such as rabbits, mice, rats, etc.).
- FAK focal adhesion kinase
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
- Techniques for preparing monoclonal antibodies to human focal adhesion kinase (FAK) 13 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human cell hybridoma technology, hybridization Tumor technology, etc.
- Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human focal adhesion kinase (FAK) 13.
- FAM focal adhesion kinase
- Anti-human focal adhesion kinase (FAK) 13 antibodies can be used in immunohistochemistry to detect human focal adhesion kinase (FAK) 13 in biopsy specimens.
- Monoclonal antibodies that bind to human focal kinase (FAK) 13 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human focal adhesion kinase (FAK) 13 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human focal adhesion kinase (FAK) 13 positive Cell.
- the antibodies of the present invention can be used to treat or prevent human focal adhesion kinase (FAK) 13-related diseases.
- Administration of appropriate doses of antibodies can stimulate or block the production or activity of human focal adhesion kinase (FAK) 13.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human focal adhesion kinase (FAK) 13 levels.
- FISH assays include FISH assays and radioimmunoassays.
- the levels of human focal adhesion kinase (K) 13 detected in the test can be used to explain the importance of human focal adhesion kinase (FAK) 13 in various diseases and to diagnose the role of human focal adhesion kinase (FAK) 13 disease.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human focal adhesion kinase (FAK) 13 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human focal adhesion kinase (FAK) 13.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human focal adhesion kinase (FAK) 13 to inhibit endogenous human focal adhesion kinase (FAK) 13 activity.
- a variant of human focal adhesion kinase (FAK) 13 may be a shortened human focal adhesion kinase (FAK) 13 that lacks a signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human focal adhesion kinase (FAK) 13.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human focal adhesion kinase (FAK) 13 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human focal adhesion kinase (FAK) 13 can be found in the existing literature (Sambrook, et al.).
- recombinantly encoded human focal adhesion kinase (FAK) 13 polynucleotides can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid) and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human focal adhesion kinase (FAK) 13 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM.
- Antisense MA, DNA, and ribozymes can be obtained by any existing MA or DM synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RM. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter.
- nucleic acid molecule In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human focal adhesion kinase (FAK) 13 can be used for diagnosis of diseases related to human focal adhesion kinase (FAK) 1 3.
- a polynucleotide encoding human focal adhesion kinase (FAK) 13 can be used to detect whether human focal adhesion kinase (FAK) 13 is expressed or abnormal expression of human focal adhesion kinase (FAK) 1 3 in a disease state.
- a DNA sequence encoding human focal adhesion kinase (FAK) 1 3 can be used to hybridize biopsy specimens to determine the expression status of human focal adhesion kinase (FAK) 13.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human focal adhesion kinase (FAK) 13 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human focal adhesion kinase (FAK) 13 transcription products.
- Detection of mutations in the human focal adhesion kinase (FAK) 13 gene can also be used to diagnose human focal adhesion kinase (FAK) 13 related diseases.
- Human focal adhesion kinase (FAK) 1 3 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human focal adhesion kinase (FAK) 13 DM sequences. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins, so Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, which can be used to position the sequence for staining. Physically. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by topical, intravenous, intraperitoneal, intramuscular, Subcutaneous, intranasal or intradermal route of administration.
- Human focal adhesion kinase (FAK) 13 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human focal adhesion kinase (FAK) 13 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total RM of human fetal brain was extracted by one step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech
- Dye terminate cycle react Ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequences were compared with existing public DM sequence databases ( Genebank), and found that the cloned cDNA sequence of one of the clones 0718b03 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain cell total RNA as a template and oHgo-dT as a primer for reverse transcription reaction. After purification using Q agene's kit, the following primers were used for PCR amplification:
- Primer 1 5,-GCACCCAACTTATCACCAGACACC -3, (SEQ ID NO: 3)
- Primer2 5,-CTGCTTCTTTCAGATTTTATTTAC-3, (SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification reaction conditions containing 5 0mmol / L KCl in a reaction volume of 50 ⁇ 1, 10mmol / L Tri s-HCl pH8 5, 1. 5mraol / L MgCl 2, 20 ( ⁇ mol / L dNTP, lOpmol primer. , 1U of Taq DNA polymerase (product of Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- RNA precipitate 4M guanidinium isothiocyanate-25 mM sodium citrate, 0.2 M sodium acetate ( P H4. 0) Homogenize the tissue, add 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), mix Centrifuge after combining. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. Wash the obtained RNA precipitate with 70% ethanol, dry and dissolve in water.
- 32P-labeled probes (about 2 x 10 6 cpm / ml) were hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide- 25mM KH 2 P0 4 (pH7. 4)-5 x SSC- 5 x Denhardt, s solution and 20 (g / ml salmon sperm DNA. After hybridization, the filter was placed in 1 x SSC-0.1% SDS at 55 Wash at 30 ° C for 30 minutes. Then, Phosphor Imager was used for analysis and quantification.
- FAM focal adhesion kinase
- Primer3 5'- CATGCTAGCATGGCACTTCAGGAACAAGTCTAC -3, (Seq ID No: 5)
- Primer4 5'- CATGGATCCTTAAAATACAGAGATGTAGGCTGG -3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Nhel and BainHI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Nhel and BamHI restriction sites correspond to the expression vectors on the expression vector plasmid pET- 2 8b (+) (Novagen, Cat. No. 69865. 3). Selective endonuclease site.
- PCR was performed using the pBS-0718b03 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS-0718b03 containing 10pg, primer Primer-3, respectively, and Pr imer- 4 l Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1 .
- Cycle parameters 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
- Nhel and BamHI were used to double-digest the amplified product and pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into the coliform bacteria DH5 cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 (g / ml)), positive clones were screened by colony PCR method and sequenced. The correct positive clone (pET-0718b03) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- LB liquid medium containing kanamycin final concentration 30 ⁇ / ⁇ 1
- the host bacteria BL21 pET-0718b03
- IPTG was added to a final concentration of 1 mmol / L
- the cells were collected by centrifugation, and the supernatant was collected by ultrasonication and centrifugation. Chromatography was performed using His. Bind Quick Cartridge (product of Novagen), which is an affinity chromatography column capable of binding to 6 histidines (6His-Tag), and the purified target protein human focal adhesion kinase (FAK) 13 was obtained.
- Bind Quick Cartridge product of Novagen
- the following peptides specific for human focal adhesion kinase (FAK) 13 were synthesized using a peptide synthesizer (product of PE): NH2-Met-Ala-Leu-Gln-Glu-Gln-Val-Tyr-Thr-Ser-I le- Tyr-Phe-Leu-Lys-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemi stry, 1969; 6: 43.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt): 5'- TGGCACTTCAGGAACAAGTCCACACCTCTATATATTTTTTG -3 '(SEQ ID NO: 9)
- probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt): 5'- TGGCACTTCAGGAACAAGTCCACACCTCTATATATTTTTTG -3 '(SEQ ID NO: 9)
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml) was added.
- CT DM calf thymus DNA
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA) The distance between them is 280 ⁇ m. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen), and another 1 J was separated by reverse transcription.
- the fluorescent reagent Cy3dUTP (5-Araino_propargyl_2'-deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargyl- 2'- Deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and the probe was prepared after purification.
- Cy3dUTP 5-Araino_propargyl_2'-deoxyuridine 5'-triphate coupled to Cy
- the probes from the above two tissues and the chips were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (I, ⁇ SSC, 0.2% SDS) was used at room temperature. After washing, use a ScanArray 3000 scanner (commercially available from General Scanning, USA). Scanning), the scanned images were processed with Imagene software (Biodiscovery, USA) for data analysis, and the Cy3 / Cy5 ratio of each point was calculated.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Bcv304 cell line, and non-starved L02 cell line , L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain Fetal lung and fetal heart.
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU72296/01A AU7229601A (en) | 2000-05-09 | 2001-05-08 | A novel polypeptide, a human focal adhesion kinase (fak) 13 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115650.0 | 2000-05-09 | ||
CN 00115650 CN1322830A (zh) | 2000-05-09 | 2000-05-09 | 一种新的多肽——人粘着斑激酶(fak)13和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001088112A1 true WO2001088112A1 (fr) | 2001-11-22 |
Family
ID=4585095
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000711 WO2001088112A1 (fr) | 2000-05-09 | 2001-05-08 | Nouveau polypeptide, kinase d'adhesion focale humaine (fak) 13, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1322830A (zh) |
AU (1) | AU7229601A (zh) |
WO (1) | WO2001088112A1 (zh) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109112213A (zh) * | 2017-06-22 | 2019-01-01 | 中国科学院动物研究所 | 检测黏着斑激酶结构变异体的pcr引物及其检测方法与应用 |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2013515054A (ja) * | 2009-12-22 | 2013-05-02 | エイボン プロダクツ インコーポレーテッド | パキシリン刺激組成物及びその化粧品としての使用 |
-
2000
- 2000-05-09 CN CN 00115650 patent/CN1322830A/zh active Pending
-
2001
- 2001-05-08 AU AU72296/01A patent/AU7229601A/en not_active Abandoned
- 2001-05-08 WO PCT/CN2001/000711 patent/WO2001088112A1/zh active Application Filing
Non-Patent Citations (5)
Title |
---|
AGOCHIYA M. ET AL., ONCOGENE, vol. 18, no. 41, 7 October 1999 (1999-10-07), pages 5646 - 5653 * |
DATABASE EMBL [online] 23 November 1999 (1999-11-23), PHILLIPS S., Database accession no. AL008627 * |
DATABASE EMBL [online] 9 February 1999 (1999-02-09), RICHARD J., Database accession no. AJ007973 * |
FIEDOREK F.T. JR. ET AL., MAMM. GENOME, vol. 6, no. 2, February 1995 (1995-02-01), pages 123 - 126 * |
WEINER T.M. ET AL., LANCET, vol. 342, no. 8878, 23 October 1993 (1993-10-23), pages 1024 - 1025 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109112213A (zh) * | 2017-06-22 | 2019-01-01 | 中国科学院动物研究所 | 检测黏着斑激酶结构变异体的pcr引物及其检测方法与应用 |
CN109112213B (zh) * | 2017-06-22 | 2021-01-12 | 中国科学院动物研究所 | 检测黏着斑激酶结构变异体的pcr引物及其检测方法与应用 |
Also Published As
Publication number | Publication date |
---|---|
AU7229601A (en) | 2001-11-26 |
CN1322830A (zh) | 2001-11-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001088112A1 (fr) | Nouveau polypeptide, kinase d'adhesion focale humaine (fak) 13, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001083688A2 (fr) | Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide | |
WO2001096560A1 (fr) | Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001081382A1 (fr) | Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001049727A1 (fr) | Nouveau polypeptide, transducteur de signal 9 a effet chemotactique de bacteries, et polynucleotide codant pour ce polypeptide | |
WO2001079423A2 (en) | A novel polypeptide, human bcr protein 10 and the polynucleotide encoding said polypeptide | |
WO2001092540A1 (fr) | Nouveau polypeptide, facteur humain stat2 11, et polynucleotide codant ce polypeptide | |
WO2001079433A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 13 and the polynucleotide encoding the polypeptide | |
WO2001081392A1 (fr) | Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001094402A1 (fr) | Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001075029A2 (fr) | Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001074887A1 (fr) | Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide | |
WO2001077163A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 16, et polynucleotide codant pour ce polypeptide | |
WO2002000698A1 (fr) | Nouveau polypeptide, proteine humaine 12 de transport de l'acide phosphorique, et polynucleotide codant ce polypeptide | |
WO2001088154A1 (fr) | Nouveau polypeptide, facteur humain de regulation 17 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide | |
WO2001087966A1 (fr) | Nouveau polypeptide, proteine pax humaine 22, et polynucleotide codant pour ce polypeptide | |
WO2002012486A1 (fr) | Nouveau polypeptide, recepteur humain de la serine kinase 10.34, et polynucleotide codant ce polypeptide | |
WO2001083742A1 (fr) | Nouveau polypeptide, proteine pax humaine 11.7, et polynucleotide codant pour ce polypeptide | |
WO2001075037A2 (en) | A new polypeptide- human dihydroorotase 40 and the polynucleotide encoding it | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2001079430A2 (en) | A novel polypeptide - human serine protease 9 and the polynucleotide encoding said polypeptide | |
WO2001083676A2 (en) | A novel polypeptide human strip-riched phosphatase 10 and the polynucleotide encoding said polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |