WO2001073013A1

WO2001073013A1 - A novel polypeptide, a human ribosome s7 protein 16 and the polynucleotide encoding the polypeptide

Info

Publication number: WO2001073013A1
Application number: PCT/CN2001/000528
Authority: WO
Inventors: Yumin Mao; Yi Xie
Original assignee: Biowindow Gene Development Inc. Shanghai
Priority date: 2000-03-29
Filing date: 2001-03-26
Publication date: 2001-10-04
Also published as: AU7378101A; CN1315440A

Abstract

The present invention discloses a novel polypeptide, a human ribosome S7 protein 16, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumour, hemopathy, HIV infection, immunological disease, and various inflammations, etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel human ribosome S7 protein 16.

Description

A new polypeptide-human ribosomal S7 protein 16 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide—a human ribosomal S7 protein 16, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique

The correct translation of proteins is very important for all bacteria and higher organisms. The research on the regulation mechanism of protein translation is obtained from E. coli. The protein translation process is mainly completed by various aminoacyl-tRNA synthetases, various tRNAs, and ribosomes. The ribosome and other cofactors together provide the full enzymatic activity of the translation process. Ribosomes are only available if the entire crust is intact. Therefore, the ribosome and its constituent subunits act synergistically in the body and play an important physiological function.

Ribosomes are organelles that synthesize proteins. Their sole function is to synthesize polypeptide chains from amino acids in accordance with the instructions of mRNA. It is called ribosome, and is simply called ribosome or ribosome. Ribosomes are found in almost all cells, whether in prokaryotic or eukaryotic cells, there are a large number of ribosomes. The ribosome is a granular structure without a membrane. Its diameter is 25 nm. The main components are protein and RNA. Ribosomal RNA is called rRNA. The protein content is about 40% and RM is about 60%. Protein molecules are mainly distributed on the surface of the ribosome, while rRNA is located inside, and the two are bound together by non-covalent bonds. (Cell Biology Szhonghe Higher Education Press PP122-129) The function of ribosomes has focused on the ribosome R'A. There are many rRNA functional domains that determine different functions of the ribosome. (Annu Rev Biochem 1991; 60 191-227)

There are two basic types of ribosomes in biological organism cells: one is a 70S (S is the Sverdberg sedimentation coefficient unit) ribosome, and all prokaryotic cells are 70S ribosomes in eukaryotic cells. Approximately 70S. The other is 80S ribosomes. The ribosomes of eukaryotic cells (except for mitochondria and chloroplast ribose) are 80S. Ribosomes, whether 70S or 80S, are composed of two subunits of different sizes.

The ribosome size subunits are often free in the cytoplasmic matrix within the cell. Only when the small subunits are combined with mRNA do the large subunits bind to the small subunits to form a complete ribosome. After the peptide synthesis is terminated, the large and small subunits dissociate and then exist freely in the cytoplasmic matrix.

S7 is one of the small subunits of ribosomal binding protein, and it exists in most prokaryotic cells with homologous proteins Biological and eukaryotic cells.

All ribosomal eggs contain a conserved region at the N-terminus of S7, which contains the following consensus sequence fragments: [DENSK]-X- [LIVMET] — X (3) [LIVMFT] (2) -χ (6 ) -G--[KR] -χ (5)-[LIVMF]-[LIVMFC] -x (2)-[STA]. This sequence fragment is contained in ribosomal protein S7 in many different organisms. This conserved structural motif is of great significance for the binding process of ribosomal protein S7 and ribosomal RNA, and this fragment may play a normal role in ribosomes. Physiological functions play an important regulatory role.

According to the study of E. coli ribosomal protein S7, it was proved that ribosomal protein S7 can directly bind to the 3 'end of 16S ribosomal RNA.

Ribosomal protein S7 plays an important role in the translation process of proteins. If it is deleted or chemically modified, or the gene encoding it is mutated, it will affect the function of ribosomes and reduce the activity of peptide synthesis. Although the research on the function of ribosomal protein S7 is not thorough enough, according to various research results, it can be proved that the functions of ribosomal protein S7 include: (1) It is very important for rRNA to fold into a functional three-dimensional structure; (2 ) In protein synthesis, the spatial conformation of the ribosome undergoes a series of changes, and ribosomal white may play a "fine-tuning" role in the conformation of the ribosome; (3) it may even play a catalytic role in the ribosome binding site, Ribosome proteins work together with rRNA.

Based on the sequence similarity of ribosomal protein S7, it is considered to belong to the ribosomal protein family. Deletion of this protein will slow down cell growth [] ■ Stephen Gantt, Michael D. Thompson, 1990, J. Biol. Chem., 265: 2763-2767] ₀ Therefore, ribosomal protein S7 is transcribed and translated from DNA It plays an extremely important role in cell proliferation. Its abnormal expression will cause the growth rate of the tissue to slow down, which will cause various developmental disorders, such as stunting.

According to the analysis of the gene chip, it was found that in the thymus, testis, muscle, spleen, lung, skin, gonad, salamander, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic stimulation 1 L02 cell line for 6 hours, L02 cell line stimulated for 6 hours for prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, ½ muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, fetal lung, and In the fetal heart, the expression profile of the present invention is very similar to the expression profile of human ribosomal S7 protein 9, and the two functions may be similar. The invention is named human ribosomal S7 protein 16.

As mentioned above, the human nuclear S7 protein 16 protein plays an important role in regulating important functions of the body such as cell division and fetal development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the field. The human ribosomal S7 protein 16 protein involved in these processes, especially the identification of the amino acid sequence of this protein. The isolation of the new human ribosome S7 protein 16 protein encoding gene also provides a basis for studying the role of this protein in health and disease states. . This protein may form the basis for the development of diagnostic and / or therapeutic agents for the disease. 21 It is important to isolate its coding DNA. Disclosure of invention

It is an object of the present invention to provide isolated new polypeptides-human ribosomal S7 protein 16 and fragments, analogs and derivatives thereof.

The present invention also provides a polynucleotide encoding the polypeptide.

Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human nucleosome S7 protein 16.

Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human ribosome S7 protein 16.

Another object of the present invention is to provide a method for producing human ribosomal S7 protein 16.

Another object of the present invention is to provide an antibody against the polypeptide-human ribosomal S7 protein 16 of the present invention.

Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polytitanium-human ribosomal S7 protein 16 of the present invention.

Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human ribosomal S7 protein 16.

The invention includes a step and an isolated polypeptide, the polypeptide is human: it includes: a polypeptide having the amino acid sequence of SEQ ID No. 2 or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

_(a ) a polynucleotide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a);

(c) A polynucleotide having at least 70 identity to a polynucleotide sequence of (a) or (b).

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence of SEQ ID NO: 1 with a sequence of 80 and 122 <MΞΞ ?; and (b) a sequence with SEQ ID NO: i- A sequence of 1-2533 bits;

The present invention further relates to a vector, particularly an expression vector, containing the polynucleoside ¾ of the present invention; a host cell engineered with the vector, including a transformed, transduced or transfected host cell; The method for preparing the main cell and recovering the expressed product is described.

The present invention relates to an antibody capable of specifically binding to the polypeptide of the present invention.

The present invention relates to a screening method for mimicking, activating, anti-or inhibiting or inhibiting the activity of the human ribosome S7 protein 16 protein, which includes the use of the present invention. The invention also relates to compounds obtained by this method. The present invention also relates to a method for in vitro detection of diseases or susceptibility to diseases associated with abnormal expression of human ribosomal S 7 protein 16 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample. Or Detecting the amount or biological activity of the polypeptide of the present invention in a biological product.

The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

The present invention also relates to the use of the polyamidine and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ribosomal S 7 protein 16.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this book; and in the claims, unless specifically stated otherwise, have the following meanings: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide, or a polynucleotide and a fragment or part thereof, and may also refer to the genome Or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence or a polynucleotide sequence that has one or more amino acids or nucleotide changes. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide string. The X-body may have "conservative" changes, in which the substituted amino acid has similar structural or chemical properties as the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

"Deletion" means the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence

"Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more A amino acids or nucleotides by different amino acids or nucleotides.

"Biological activity" refers to proteins that have the structure, regulation, or biochemical function of natural molecules. Similarly, the term "immunological activity :: sheng" refers to the ability of natural, recombinant, or synthetic white matter and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

"Agitated 'r' means when bound to '16 Glycoprotein S 7 protein. One can cause changes in this protein A molecule that regulates the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human ribosomal S7 protein 16.

An "antagonist" or "inhibitor" refers to a molecule that, when combined with human ribosome S7 protein 16, can block or regulate the biological or immunological activity of human ribosome S7 protein 16. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human ribosomal S7 protein 16.

"Regulation" refers to a change in the function of human ribosome S7 protein 16, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human ribosome S7 protein 16.

"Substantially pure '" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human ribosomal S7 protein 16 using standard protein purification techniques. Basically Pure human ribosomal S7 protein 16 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human ribosomal S7 protein 16 polypeptide can be analyzed by amino acid sequence.

"Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern imprinting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require the binding of two sequences to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percentage of identity can be determined electronically, such as through the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Mad Son). Wis.) _; MEGALIGN program can compare two or more sequences according to different methods such as Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244) ₀ Cluster method checks the distance between all pairs The groups of sequences are arranged into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues A matching between sequence A and sequence B

100

Number of residues in sequence A-number of interval residues in sequence A-number of interval residues in sequence B

The percent identity between nucleic acid sequences can also be determined by the Cluster method or by well-known methods such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645).

"Similarity" refers to the degree of amino acid sequence: the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino carboxyls may include lysine and arginine; have uncharged head groups Amino acids with similar hydrophilicity include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

"Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA ^^ 'j. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

"Derivative" means HFP or a chemical modification that encodes it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') ₂ and Fv, which can specifically bind to the antigenic determination of human ribosomal S 7 protein 16.

"Humanized antibody" means non-antigen binding :! The amino acid sequence of the domain has been replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of matter from its environment (for example, its natural environment if it occurs naturally). For example, naturally occurring polynucleotides or polypeptides are not isolated in the presence of two living animals, but Tongxiang polyglycosides or peptides are separated from some or all of the substances that coexist in the natural system. of. The polynucleotide of the zenith may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used in the present invention, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment: such as polynucleotides and polypeptides in their natural state in living cells are It is not isolated and purified, but the same polynucleotide or polypeptide is separated from other substances existing in its natural state. It is isolated and pure.

As used herein, "isolated human ribose ^ S7 protein 16" means that human ribosomal S7 white 16 basically contains other proteins, class ¾, class ¾, or other substances naturally associated with it. Skilled person Humans can purify human ribosomal S7 protein 16 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ribosomal S7 protein 16 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide-human ribosomal S7 protein 16, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

The invention also includes fragments, derivatives and analogs of the human ribosome S7 protein 16. As used herein, the terms "," "derivatives" and "analogs" refer to polypeptides that substantially retain the same biological function or activity of the human ribosome S7 protein 16 of the invention. Fragments, derivations of polypeptides of the invention The analog or analog may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be Encoded by the genetic codon; or (II) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (in) this type, wherein the mature polypeptide Fusion with another compound (such as a compound that prolongs the half-life of a polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide, J 'J (as in the leading column Or secreted sequences or sequences used to purify this polypeptide or protease sequences) As explained herein, these fragments, derivatives and similar It is considered within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide). It consists essentially of a polynucleotide encoding a polynucleotide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1 The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2533 bases, and its open reading frame 801-1229 encodes 142 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human ribosomal S7 protein 9, and it can be deduced that the human ribosomal S7 protein 16 has similar functions to human ribosomal S7 protein 9.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. The DNA may be a coding or non-coding strand. The coding region sequence of a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or it may be a variant. As used in the present invention. "Degenerate variant" in the present invention refers to a protein or polypeptide prepared by SEQ ID NO: 2, ":" blue and the coding sequence shown in SEQ ID NO: 1 Differentiated nucleic acid sequences are listed.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the mature coding sequence and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) And non-coding sequences.

The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

The present invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the present invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially alter the polypeptides it encodes. Features.

The present invention also relates to a polynucleoside carboxylate that hybridizes to the sequence described above (having at least 50. preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ion strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) during hybridization Add denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42'C, etc .; or (3) the identity between the two sequences is at least 95 % Or more, more preferably 97. /. Only when the above hybridization occurs. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological energy and activity as the mature polypeptide shown in SEQ ID NO: 2.

The present invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment 'contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 A nucleotides, most preferably at least 100 A nucleotides Above, nucleic acid fragments can also be amplified by nucleic acid amplification technology (such as PCR) to determine and / or isolate the polynucleotide encoding human ribosomal S7 protein 16.

The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding human ribosomal S7 protein 16 can be obtained by various methods. Example "5. Isolate polynucleotides using hybridization techniques well known in the art. These techniques include but are not limited to: 1) hybridizing a probe to a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) The antibodies of the expression library are screened to detect cloned polynucleotide fragments having common structural characteristics.

The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide _:

Of the methods mentioned above, genomic DNA is the least commonly used: direct chemical synthesis of DNA sequences Is the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRM from donor cells that overexpress this group 3 and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Labora tory Manua 1, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction is used in combination, even very small expression products can be cloned.

The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the transcript of human ribosomal S7 protein 16; (4) ) Detecting protein products of gene expression by immunological techniques or measuring biological activity-The above methods can be used alone or in combination.

In the method (1), the probe for heterozygous hearing is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleosides, preferably at least 30 nucleotides, more Fortunately, at least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2,000 nucleotides, preferably 1,000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The gene itself or a fragment thereof can of course be used as a probe. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the (4) method, the detection of: '' ^: the protein product of human ribosomal S7 protein 16 gene expression can be used immunological techniques such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA), etc. .

Application of PCR technology; # D A / RNA method (Saiki, et al. Science

1985; 230: 1350-1354) were used to obtain the genes of the present invention. Especially when it is difficult to obtain the full-length cDNA from the library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used, and the primers used for PCR can be disclosed according to the present disclosure ^: The polynucleotide sequence of the present invention The information is appropriately selected and synthesized using conventional methods. Isolation and purification of amplified DNA / RNA fragments can be performed by conventional methods: '5 ^ by gel electrophoresis.

Polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments, etc. can be determined by conventional methods such as dideoxy chain termination: ¾ (Sanger et al. PNAS, 1977, 74: 5463-5467). Such assays also commercially polynucleotide ^sequences:: the Sequencing Kit and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes the cDNA sequence of multiple A clones is needed to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human ribosomal S7 protein 16 silk sequence, and the recombinant technology to produce the polypeptide described in the present invention. Party: '^ In the present invention, a polynucleotide sequence encoding a human ribosomal S7 protein lb may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct recombinant expression vectors. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ribosomal S 7 protein 16 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and internal recombination technology (Sanibroook, et al. Molecular Cloning, a Labor Manual, Cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the _PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters , Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DN'A expression, usually about 10 to 300 base pairs, and act on promoters to enhance gene transcription. Examples of Gong include the SV40 enhancer of 100 to 270 base pairs at the late stage of the origin of replication, the polyoma enhancer and the adenovirus enhancer at the late side of the origin of replication.

In addition, the expression vector preferably contains one A or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and Green fluorescent protein (GFP), or tetracycline or ampicillin against Enterobacteriaceae.

Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding a human ribosome S7 protein 16 or a recombinant vector containing the polynucleoside can transform or transduce a host cell into a base-engineered host cell containing the polynucleotide or the recombinant vector. The term "primary cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell: or a higher eukaryotic cell. ^ Mammalian cells. Representative examples are: ¾ Bacillus.

] 0 Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly flies S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

¾ Transformation of a host cell by the DNA sequence of the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the Ca ₂ method. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

After selecting conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant ¾ human ribosome S7 protein 16 (Science, 1984; 224: 1431). Generally there are the following steps:

(1) using the polynucleotide (or variant) encoding human human ribosome S7 protein 16 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing a-:: polynucleotide;

(2) culturing host cells in a suitable medium;

(3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted into a cell: if necessary, its physical and chemical properties may be used to isolate and purify the recombinant by various separation methods Of protein. These methods are well known to those skilled in the art. These methods include but are not limited to: conventional renaturation treatment, protein precipitant treatment (¾ analysis method), centrifugation, osmotic bacteria treatment, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography , Ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. . Brief description of the drawings

The list E is used to describe specific embodiments of the present invention, but not to limit the scope of the invention defined by the claims.

21 is a comparison diagram of gene chip expression profiles of the present human ribosomal S 7 protein 16 and human ribosomal S 7 protein 9. The second figure is the expression profile of the human ribosome S7 protein 16. The figure is the expression profile of the human ribosome S7 protein 9. Among them, 1 indicates fetal kidney, 2 indicates fetal size ^. 3 indicates 骀 small intestine, 4 indicates fetal muscle, 5 indicates brain. 6¾ indicates fetal bladder, 7 indicates non-starved L02, S table L02 +. 1 hr, As 9 indicates ECV304 PMA-. 10 means ECV304 PMA +, 11 means fetal liver, 12 means normal liver, 13 means thyroid, 14 means skin 15, fetal lung, 16 means lung, 17 means lung cancer, 18 means fetal spleen, 19 means spleen, 20 means prostate , 21 is the fetal heart, 22 is the heart, 23 is the muscle, 24 is the testis, 25 is the fetal thymus, and 26 is the thymus.

S 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of isolated human nuclear sperm S7 protein 16.

16kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested Article ^.

Implementation 1: Cloning of human ribosomal S7 protein 16

Human fetal brain total RNA was extracted by a one-step method with guanidine isothiocyanate / phenol / chlorine. Using Quik mRNA Isolation Kit

(Qiegene company product) Poly (A) mRNA _c 2ug poly (A) mRNA was isolated from total RM by reverse transcription to form c DN A. Using the Sma rtc DM cloning kit (purchased from Π on te ch), the c DNA fragment was inserted into a pBSK (+) vector (product of Clontech) at about multiple cloning sites to transform DH5a, and the bacteria formed a cDNA library. The sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic word-detection. 'Pe rki nE 1 mert Division). The determined c DNA sequence was compared with the public DNA word 'f' and 'Database' (Genebank). As a result, one of the clones 0138 a 0 ό c DN A word 'was found: a new sequence of 1 The cloned c DN A fragment was cloned for orientation determination. The results table. The 0138a06 clone contains a full-length cDNA of 2533bp (as shown in Seq ID NO: 1). There is a 428bp open reading frame (0RF) from 801bp to 1229bp. It encodes a new protein (such as Seq ID NO: 2). We named this clone pBS-0138a06, and named the encoded protein. Heliosome S7 protein 16 _; Implemented column 2: RT-PCR method was used to expand the base encoding human ribosomal S7 protein 16

闬 The total RNA of brain cells was used as a template, and oligo-dT was used as a primer to perform reverse transcription reaction to synthesize cDNA. After purification with Qiagene kit, the primers were used for PCR amplification:

Primerl: 5'- GACAACAGAAATTTCAGTTATTAT -3 "(SEQ ID N0: 3)

Primer2: f- TATGTATAAGGTAAAGTATATTTA _3 · (SEQ ID NO: 4) Primerl is a forward sequence starting from the 1st lbp at the 5 ′ end of SEQ ID NO: 1;

Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Conditions for the amplification reaction: 50 mmol / L t (Cl, 10 cryptool / L Tris-CI, (pH 8.5), 1.5 mmol / L MgCI ₂ , 200 μ mol / L dNTP in a reaction volume of 50 μ 1 , lOpmol primer, 1U of Taq DNA polymerase (product of Clomech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Eimer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min. Set β-act in as a positive control and template blank as a negative control at the same time during RT-PCR. The amplification products were purified using a QIAGEN kit, and connected to a PCR vector using a TA cloning kit (InvUrogen). DNA sequence analysis results show that the DNA sequence of the PCR product is exactly the same as the 1-2533bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human ribosomal S7 protein 16 gene expression:

Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4 guanidine cyanocyanate-25m sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7. Q)-5 mM sodium acetate-1 miM EDTA-2.2 M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the sequence of the human ribosome S7 protein 16 coding region (801bp to 1229bp) amplified by PCR shown in FIG. 1. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ^(> C overnight in a solution containing 50 ¾ formamide-25 m κ, ΡΟ (ρΗ7.4) -5 SSC-5 Denhardt's solution and 200 yg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1¾SDS for 30 min. Then, it was analyzed and quantified by Phosphor Imager. Example 4: In vitro expression, isolation and purification of recombinant human ribosomal S7 protein 16

Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer3: 5 *-CATGCTAGCATGACTAGAACTAAAACAGTAAAT -3 '(Seq ID No: 5) Primer4: 5'- CATGGATCCCTATTGTAACGTTGTTAGTAGTTC -3 "(Seq ID No: 6) The 5' ends of these two primers contain Nhel and BamHI restriction sites, respectively. 5 'end of target gene

¾ 3 'coding sequence, N'he I and BamH I restriction sites corresponding to the selectivity on the expression vector plasmid pET-28 b (+) (No va gen product, Cat. No. () 9865.3) Endonuclease site 乂 pBS- The 0138a06 plasmid was used as a template for the PCR reaction. The PCR reaction conditions were: a total volume of 50 μl containing 10 pg of pBS-0138a06 plasmid, primers P mer-3 and Pr inier-4 points, and ¹ J was 1 Opmoi, Advantage polymerase Mix (Clomech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 niin, a total of 25 cycles. Nhe I and BamH I were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into coliform bacteria DH5 CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0138a06) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration of 30 μ g / ml) of LB liquid medium, host strain BL21 _(P ET-0138a06) incubated at 37 ° C to logarithmic phase, IPTG was added to a final concentration of lmmol / L , Continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. Chromatography was performed using an affinity chromatography column His. Bind Quick Cartridge! Novagen company product capable of binding to 6 histidines (6His-Tag). A purified g protein of human ribosomal S7 protein 16 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 16 kDa (Fig. 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. The N-terminal 15 amino acid residues shown in NO: 2 are identical. Example 5 Production of anti-human ribosomal S7 protein 16 antibodies

A peptide synthesizer (product of PE company) was used to combine the peptides specific for the human nucleus S7 protein 16: NH2-Me t-Thr-Arg-Thr-Ly s-Thr-Va 1-Asn-Leu-As p -Asn-11 e-Lys-Pro-G 1 n- C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avrameas, et al. Immunochem istry, 1969; 6: 43. Immunize rabbits with 4mg of the above hemocyanin peptide complex plus complete Freund's adjuvant. After 15 days, use the hemocyanin peptide complex plus incomplete Freund's adjuvant to boost immunity once. E Use a 15 μg / ml bovine serum albumin peptide complex-coated titer plate to make E L I S A to determine the antibody titer in rabbit serum. Total protein IgG was isolated from antibody-positive home-immunized serum using protein A-Sephar 0se. The peptide was bound to a Sepharose 4B column activated by cyanogen bromide, and the anti-peptide antibody was separated from the total gG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to human ribosomal S7 protein 16. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

The suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries from different tissues of royal or pathological tissues. and ^s columns identified polynucleotide sequences homologous to the polynucleotide carrier detected if it contains the present invention, further into a ho This probe is used to detect whether the polynucleotide sequence of the present invention or its homologous polynucleotide sequence is abnormally expressed in cells of normal tissue or pathological tissue.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles to consider:

1. The probe is large ^:: preferably 18-50 nucleotides;

2, GC combined amount is 3 (-70%, non-specific hybridization increases:

3, there should be no complementary regions in the probe;

4. Those that meet the above conditions can be used as preliminary selection probes, and then further computer sequence analysis, including the preliminary selection ^ its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and Compare the homology of the regions with each other. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

After completing the above analysis, select and synthesize the following two A probes:

Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41 t):

2 (probe2), which belongs to the second class of probes, and belongs to the gene fragment of SEQ ID NO: 1 Or its complementary mutant substitution sequence (41Nt):

5'- TGACTAGAACTAAAACAGTACATTTGGACAATATTAAGCCT -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH el ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used manuals of molecular cloning experiments such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

Sample Preparation:

1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Use cold homogenization buffer (0.25mol / L sucrose; 25 sides ol / L Tris-HCl, pH7.5; 25 points ol / LnaCl: 25 hidden ol / L MgCl ₂ ) Suspend the precipitate (about 10nil / g) ₀ 4) Homogenize the tissue suspension at 4 ^U C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (l-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the original tissue), and then follow the phenol extraction method below.

2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) with cold cell lysate pelleted cells were resuspended (1 X 10 ⁸ cells / ml) Minimum application lOOul ¾ buffer solution. 3) Add SDS to a final concentration of 1 /. If SDS is added directly to the ^ ¾ pellet before resuspending the cells, the cells may form large clumps that are difficult to break. And reduce the overall yield. This is particularly serious when pumping ¾> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate the reaction at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Move the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DN'A to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation;

Steps: 1) Add 1/10 volume of 2mo 1 / L sodium acetate ¾ 2 volume cold: 00% ethanol to the DNA solution and mix well. Leave at -20 "C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or lift out the ethanol. 4) Wash the pellet with 70¾ cold ethanol 500ui, and centrifuge for 5 minutes. 5 Carefully lift or lift out Ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol. Then invert on the absorbent paper to drain the residual ethanol. Air dry the mulberry for 10-1 minutes, and make the surface ethanol ¾ .: 'Wang Yi, don't make the precipitation completely Dry, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DN'A pellet with a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1-5 X 10 ⁶ cells extracted about plus lul.

The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 _μg / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. 37. C was held for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, mix well and set to -20. C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) _A26ϋ and _A28 ₍₎ were measured to detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing. Preparation of sample film:

1) Take 4 x 2 sheets of appropriate size nitric acid membrane (NC membrane), and mark the spotting position and sample number on it with a pencil. Two NCs are needed for each probe, so that it can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

2) Aspirate and control 15 microliters each, place on the film, and dry at room temperature.

3) Place on filter paper impregnated with 0, Imol / LNaOH, 1.5mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5mol / L Tris-HCl (pH7.0), 3mol / L NaCl Allow to dry for 5 minutes (twice).

4) Clamp in clean filter paper and wrap with aluminum foil. 60-80. C was dried under vacuum for 2 hours.

Labeling of probes

1) 3 μ IProbe (0.1 OD / 10 μ 1 knife edge into 2 μ IKinase buffer, 8-10 uCi v- ^? P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

2) Incubate at 37 ° C for 2 hours.

3) Add 1/5 volume of bromophenol blue indicator (BPB).

4) Pass Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

6) 5 drops / tube, collect 10-15 tubes.

7) Monitor the amount of isotope with a liquid scintillator

8) After the collection solution of the first peak is merged, ^3: P-Probe (the second peak is free γ--dATP) is prepared.

Pre-hybridization Place the sample in a plastic bag, add eight 3-1 Omg pre-hybridization solution (lOxDenhardf s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C in a water bath 2 hours.

Cross

Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

High-intensity washing film:

1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1% SDS, 40 ^U C for 15 minutes (twice).

3) 0. IxSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

4) 0. IxSSC, 0.1% SDS, wash at 55 ° C for 30 minutes (twice), and dry at room temperature. Low intensity washdown:

1) Out of the hybridized membrane:

2) 2xSSC, 0.1½ SDS, 37. C Wash for 15 minutes (twice).

3) 0. IxSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

4) 0. IxSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (1 time), and dry at room temperature

X-ray autoradiography:

-70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

Experimental results:

Hybridization experiments using ^ intensity membrane washing conditions. The radiation intensity of the hybrid spots on the last two probes has no obvious area; while hybridization experiments using high intensity washing conditions, the radioactive intensity of hybrid spots on probe 1 is significantly ² To the radioactive intensity of the hybridization spot of another probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.

Example 7 D A Microarray

Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. They refer to the orderly and high-density arrangement of a large number of target gene fragments in a glass. And tritium, and then use fluorescence detection and computer software to compare and analyze the data, so as to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target DNA two-gene chip technology to study the function of new genes with two high-throughputs: find and screen for tissue specificity New genes, especially those related to diseases such as tumors; Diagnosis of diseases, such as hereditary diseases. The specific method steps have been reported in the literature. For example, see the literature DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And the literature Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

(A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a sloped glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA) between the points. The distance is 280 μ _Π ι. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:

1. Hydration in a humid environment for 4 hours;

2. 0.2% SDS was washed for 1 minute;

3. ddH.O wash twice, 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

5. 95 ° C water for 2 minutes;

6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

8.: Dry, store at 25 ° C in the dark for future use.

(2) Probe marking

Total niRNA was extracted from human tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). Cy3dUTP (5-Amino-propargy 1-2 '-deoxyur id ine 5 -triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the niRNA of human mixed tissue, and the fluorescent reagent CySdUTP (5-Amino-propargy 1- 2- -deoxyur id ine 5'-tr iphate coupled to Cy5 fluorescent dye, from Amersham Phamacia Biotech company) marker specific tissue (or stimulated cell line) niRNA, and probes were prepared after purification. For specific steps and methods, see:

Schena, M., Shalon, D., Heller, R. (1996) Proc. N tl. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dari., Davis, RW (1995) Science. 270. (20): 467-480.

(Three) cross

^ ^ Probes from both tissues and cores are used in L'niHyb ™ Hybridization Solution (purchased from TeleChem) was used for hybridization for 16 hours, and washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned image Imagene software (Biodiscovery, USA) was used for data analysis and processing to calculate the Cy3 / Cy5 ratio of each point.

The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain Fetal lung and fetal heart. Draw a graph based on these 26 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profile of human ribosomal S7 protein 16 and human ribosomal S7 protein 9 according to the present invention are very similar. Industrial applicability

The polypeptides of the present invention, as well as the multipeptone antagonists, agonists and inhibitors, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

The correct translation of proteins requires the cooperation of various aminoacyl-tRNA synthetases, various tRNAs, and ribosomes. Ribosomes and other cofactors together provide the entire enzymatic activity of the translation process. These enzyme activities are only in the entire ribosome Only when the structure is complete. Ribosomal protein S7 is one of the proteins in the small subunit of the ribosome: it plays a very important role in the correct tRNA selection in the initial stages of protein synthesis. The S7 protein can select the correct tRNA to bind to small ribosomal subunits to avoid mismatches, which is directly related to the stability of the passage of the organism. And the loss of ribosomal protein will slow down the growth of cells.

It can be seen that the abnormal expression of the specific S7 family protein motif will cause the dysfunction of the polypeptide containing the S7 family protein mot if of the present invention, resulting in the mistranslation of mRNA and the generation of related diseases such as tumors, embryonic development disorders, Growth and development disorders.

It can be seen that the abnormal expression of the human ribosomal S7 protein 16 of the present invention will produce various diseases, especially embryonic developmental disorders, growth and development disorders, various tumors, and inflammations. These diseases include, but are not limited to:

Embryonic developmental disorders: congenital 'mainstream births, cleft palate, facial oblique fissures, limb absentness, limb differentiation disorders, gastrointestinal atresia or stenosis, diarrhea, atelectasis, polycystic kidney, ectopic kidney, double ureter, Recessive, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, arterial stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris Defects, congenital cataract, congenital glaucoma or cataract, congenital deafness

Growth and development disorders: mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus development syndrome, strabismus, skin, fat, and muscular dysplasia disorders such as congenital skin relaxation, ^ Oldness, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation

Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, malignant histiocytosis, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, cholecystoma, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Pleural mesothelioma, Fibroid, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma

Various inflammations: stress, adult respiratory distress syndrome, pulmonary eosinophilia, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, dermatomyositis, Polymyositis, Addison's disease, telangiectasia

The abnormal expression of the human ribosomal S7 protein 16 of the present invention will also produce certain hereditary, hematological and immune system diseases.

The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ribosomal S7 protein 16. Agonists increase human ribosomal S7 protein 16 to stimulate biological functions such as cell proliferation, while antagonists block 11 to treat disorders related to excessive cell proliferation, such as various cancers. For example, in the presence of a drug, mammalian cells or formulations expressing human ribosomal S7 protein 16 are cultured with labeled human ribosome S7 protein 16. The ability of a given drug to increase or block this interaction is then determined.

Antagonists of human ribosomal S7 protein 16 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human ribosomal protein 16 can bind to human ribosomal S7 protein 16 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

When screening compounds as antagonists, human ribosomal S7 protein 16 can be added to bioanalytical assays. Whether a compound is an antagonist can be determined by measuring the effect of the compound on the interaction between human ribosome S7 protein 16 and its receptor . In the same manner as described above for screening compounds, analogues of receptor deletions that act as antagonists can be screened. Polynucleotides capable of binding to human ribosomal S7 protein 16 can be obtained by screening random peptides composed of various possible amino acids bound to solids. Generally, human nuclear ^ S7 protein 16 should be screened. mark' The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the human ribosomal S7 protein 16 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting human ribosomal S7 protein 16 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human ribosomal S7 protein 16 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV -Hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et ai, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pat No. .4946778). Single-chain antibodies against human ribosomal S7 protein 16 can be produced using two.

Antibodies against human ribosomal S7 protein 16 can be used in immunohistochemical techniques to detect human ribosomal S7 protein 16 in biopsy specimens.

Monoclonals that bind to human ribosomal S7 protein 16 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radioactive: bio-labeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular but in situ body. For example, human ribosomal S7 protein 16 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is an S thiol crosslinker such as SPDP, which attacks the amino group of an antibody and binds the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human ribosome S7 protein 16 positive cells .

The antibodies in the present invention can be used to treat or predict diseases related to human ribosomal S7 protein 16. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human ribosomal S7 protein 16.

The invention also relates to a diagnostic test method for quantitative and localized detection of human sugar S7 protein 16 levels. These tests are well known in the art and include FISH: determination and radioimmunoassay. The level of human ribosomal S7 protein 16 detected in the test can be used to explain the importance of human ribosome S7 protein 16 in various diseases and to diagnose human ribosome S7 protein 16 and other diseases.

The peptides of the present invention can also be used as spectral spectra. Mi-- Polypeptides can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, preferably mass spectrometry analysis. The polynucleotide encoding human ribosomal S7 protein 16 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human ribosomal S7 protein 16. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human ribosome S7 protein 16 to inhibit endogenous human ribosome S7 protein 16 activity. For example, a variant human ribosome S7 protein 16 may be a shortened human ribosome S7 protein 16 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human ribosomal S7 protein 16. Virus-derived expression vectors ½ retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ribosomal S7 protein 16 into cells. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding the human ribosomal S7 protein 16 can be found in existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human ribosomal S7 protein 16 can be packaged into liposomes and transferred into cells.

Methods for introducing polynucleotides into tissues or cells include: directly injecting the polynucleotides into tissues in vivo; or introducing the polynucleotides into cells in vitro through a vector (such as a virus, phage, or plasmid), and then introducing the cells Transplanted into the body, etc.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human ribosomal S7 protein 16 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as the solid-phase phosphoramidite chemical synthesis method for oligonucleotide synthesis. Antisense RNA molecules can be transcribed outside or in vivo by DNA sequences encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

Polynucleosides encoding human ribosomal S7 protein 16 can be used for the diagnosis of diseases related to human ribosome S7 protein 16. The polynucleotide encoding human ribosomal S7 protein 16 can be used to detect the expression of human ribosome S7 protein 16 or the abnormal expression of human ribosome S7 protein 16 in a disease state. For example, the DNA sequence encoding human ribosomal S7 protein 16 can be used to hybridize biopsy specimens to determine the expression status of human ribosome S7 protein 16. Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DNA core (also known as a "base S core"). Differential expression of genes in tissues can be analyzed by tritium analysis and gene diagnosis . Human ribosomal S7 protein 16 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human ribosomal S7 protein 16 transcription products.

Detection of mutations in the human ribosomal S7 protein 16 gene can also be used to diagnose human ribosome S7 protein 16-related diseases. Human ribosome S7 protein 16 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ribosome S7 protein 16 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect the expression of proteins, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to this article, in order to associate these sequences with disease-related genes, the important first step is to locate these DNA sequences on the chromosome.

In short, PCR primers (preferably 15-35bp) can be used to prepare sequences based on cDNA, which can be used to locate sequences on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

The c D N A clone was subjected to fluorescence in situ hybridization (F I S H) with the metaphase chromosome. The chromosome localization can be accurately performed in a step A. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequence between the affected and unaffected individuals need to be determined. If a mutation is observed in some or some patients, and the mutation is not observed in any normal eight body, then the mutation may be a disease of the disease: 1K is more diseased and not diseased, usually, : 'Step and first look for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with c DNA sequence-based PCR. According to the resolution capabilities of current physical mapping and base mapping technology, the cDNA accurately mapped to the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase Figure resolution and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human ribosomal S 7 protein 16 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human ribosomal S 7 protein 16 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician

Claims

Claim

1. An isolated polypeptide-human ribosomal S7 protein 16, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an active fragment, analog or derivative thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

3. The polypeptide according to claim 2, characterized in that it comprises a polytitanium having the amino acid sequence shown in SEQ ID NO: 2.

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

(b) a polynucleotide complementary to a polyglycolic acid; or

(c) A polynucleotide that is at least 70% identical to (a) or (b).

5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 801-2229 in SEQ ID NO: 1 or the sequence of positions 1-2533 in SEQ ID NO: 1 .

7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, which is characterized in that it is selected from a host S3 cell:

(a) a host cell transformed or transduced with the recombinant vector of claim 7; or

(b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human ribosomal S7 protein 16 activity, characterized in that the method includes:

(a) culturing the engineered host cell according to claim 8 under the conditions of epidermal human ribosome S7 protein 16;

(b) Isolating a polypeptide having human ribosomal S7 protein 16 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to human ribosomal S7 protein 16

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human ribosomal S7 protein 16.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human ribosomal S7 protein 16 in vivo and in vitro.

14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human ribosomal S7 protein 16; or for peptides Fingerprint identification.

16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human ribosomal S7 protein 16 abnormality.

18. Use of a polytitanium, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is prepared for use in treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.