WO2001066720A1 - Genes de souris d'origine adipocyte - Google Patents

Genes de souris d'origine adipocyte Download PDF

Info

Publication number
WO2001066720A1
WO2001066720A1 PCT/JP2001/001863 JP0101863W WO0166720A1 WO 2001066720 A1 WO2001066720 A1 WO 2001066720A1 JP 0101863 W JP0101863 W JP 0101863W WO 0166720 A1 WO0166720 A1 WO 0166720A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
dna
present
seq
amino acid
Prior art date
Application number
PCT/JP2001/001863
Other languages
English (en)
Japanese (ja)
Inventor
Toshio Kitamura
Hiromichi Tsuruga
Original Assignee
Toshio Kitamura
Hiromichi Tsuruga
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Toshio Kitamura, Hiromichi Tsuruga filed Critical Toshio Kitamura
Priority to AU2001241080A priority Critical patent/AU2001241080A1/en
Publication of WO2001066720A1 publication Critical patent/WO2001066720A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention relates to a novel protein derived from an adipocyte and having a signal sequence, a gene thereof, and their production and use.
  • Adipose tissue is simply fat-free until it is known that the mutation causes hereditary obesity in mice (Zhang, Y. et al. (1994) Nature 372, 425-432). It was thought to be just a storage. At present, adipose tissue is recognized as the largest secretory organ.
  • TNF-chicken plasminogen activator inhibitor PAI-1
  • TNF-H affects the metabolism of lipids and darcos and is overexpressed in adipose tissue of genetically obese rodents (Hotamisligil, GS et al. (1993) Science 259, 87-91 ), Leads to insulin resistance (Hotamisligil 3 GS et al. (1995) J. Clin. Invest. 95, 240 9-2415)
  • PAI-1 is highly expressed in visceral adipocytes and It has been implicated in the onset of the disease (Shimomura J. et al. (1996) Nature medicine 2, 800-803).
  • the present invention provides novel proteins derived from adipocytes and having a signal sequence, their genes, molecules functionally equivalent thereto, and their production and use.
  • 3T3-L1 cell line (Meuth 5 M. and Green, H. (1974) Cell 3, 367-A) which is a well-characterized model for adipocyte differentiation. 374; Green 5 H. and Kehinde 3 0. (1975) Cell 5, a cDNA library prepared from 19-27), retrovirus-mediated expression cloning system (. Kojima, T and K itamura 3 T. (1999) Nature Biotechnol.17, 487-490), and has a signal peptide (von Heijne, (1985) J. Mol. Biol. 184, 99-105) using an efficient signal sequence trapping method. Molecular screening was performed.
  • a cDNA encoding a protein capable of expressing MPL on the cell surface is searched for by screening a library that expresses a fusion protein with the constitutively active cytokine receptor MPL.
  • the target clone can be easily selected because the expression of the autonomic proliferation ability to an IL-3-dependent cell line by expression of MPL on the cell surface is used as an index.
  • genes showed expression associated with adipocyte differentiation.
  • the expressed tissues were different, they showed tissue-specific expression. Therefore, although these genes have different functional sites, they are thought to be molecules that play a role related to adipocyte differentiation in vivo.
  • the present invention relates to a novel protein derived from an adipocyte and having a signal sequence, a gene thereof, a molecule functionally equivalent thereto, and production and use thereof, and more specifically,
  • a DNA according to any of the following (a) to (f), (a) a DNA encoding a protein consisting of the amino acid sequence of any one of SEQ ID NOs: 8 to 11;
  • a host cell carrying the DNA of (1) or (2) or the vector of (4) (6)
  • the method for producing the protein or peptide according to (3) comprising culturing the host cell according to (5) and recovering the expressed protein from the host cell or a culture supernatant thereof.
  • a polynucleotide comprising at least 15 nucleotides complementary to a DNA consisting of the nucleotide sequence of any one of SEQ ID NOs: 1 to 7 or a complementary strand thereof, and
  • the present invention provides a gene encoding a novel protein derived from an adipocyte and having a signal sequence.
  • the present inventors searched for fat cell-derived cDNAs encoding secretory and membrane proteins by the recently established novel signal sequence trapping method, SST-REX method, and found 63 known cDNAs and 8 novel cDNAs. Got a piece.
  • novel cDNAs isolated by the present inventors using the SST-REX method seven cDNAs (these clones were named “# 101” to “# 107”, respectively. Are collectively referred to as "# 10X.")
  • the nucleotide sequences of The amino acid sequence of the protein encoded by the # 103 to # 106 cDNA is shown in SEQ ID NOs: 8-11.
  • Collagen sph-1 (IV) and sph-2 (IV) synthesis and secretion are negligible in fibroblasts, but markedly increased in adipocytes. Enhancement of endocin secretion was also observed (Aratani, Y. and Kitagawa 3 Y. (1988) J. Biol. Chem. 263, 16163-16169). The results shown by the present inventors are consistent with these results, and suggest that the synthesis of extracellular matrix proteins is important for adipose tissue morphogenesis.
  • LPL lipoprotein lipase
  • the level of clone # 106 mRNA increased during differentiation.
  • this may be related to adipocyte differentiation.
  • the expression of clone # 105 is interesting. Two transcripts were detected by Northern blot analysis. The two transcripts can be from different genes.
  • this gene may be involved in insulin-mediated signal transduction, which has important implications for the treatment and prevention of diabetes and other diseases. There may be.
  • the nucleotide sequence of the human homolog of the # 104 gene has been registered in the gene bank, and according to the description, the expression is enhanced by canceration in the liver system. Expression of # 104 was observed in various cancer cell lines, and their expression patterns were different. Depending on the type of cancer, the expression of the # 104 gene may or may not be seen, and there may be some causal relationship between the # 104 gene and cancer.
  • # 101, key, and # 107 are not full-length sequences.
  • those skilled in the art will Techniques for isolating full-length genes have become common technical knowledge. For example, those skilled in the art can isolate the full-length gene by performing colony hybridization using these fragments as probes. Therefore, the present invention includes full-length genes corresponding to these fragments.
  • the present invention also provides a functionally equivalent to # 10X protein (a protein consisting of the amino acid sequence of SEQ ID NOs: 8 to 11; a protein encoded by full-length MA corresponding to SEQ ID NOs: 1, 2, and 7).
  • # 10X protein a protein consisting of the amino acid sequence of SEQ ID NOs: 8 to 11; a protein encoded by full-length MA corresponding to SEQ ID NOs: 1, 2, and 7.
  • proteins include, for example, mutants of these proteins, homologs of organisms other than mice, and the like.
  • “functionally equivalent” means that the target protein has a function as a protein having a signal sequence, like the # 10X protein.
  • a function for example, a function described in International Publication No. WO 00/00610 or a function as a secretory protein can be considered. Whether or not the target protein is a secretory protein can be determined by the following method.
  • a fusion gene in which a gene encoding a commercially available peptide (eg, His-tag or FLAG) is ligated to the 3rd end of the # 10X gene is prepared.
  • the fusion gene is introduced into animal cells (eg, COS cells, etc.) using an expression vector for animal cells (eg, pcDNA3 or pCOS-1), and the # 10X protein is converted as a fusion protein with the peptide. To be expressed. Whether or not this fusion protein is secreted into the culture supernatant is evaluated by ELISA, Western blotting or immunoprecipitation using an antibody against the peptide.
  • Secretory protein S has various industrial advantages. For example, when it is desired to obtain a certain recombinant protein, if the protein is expressed in a cell as a fusion protein with a secretory protein or a partial peptide capable of secreting the same, the fusion protein is secreted out of the cell. However, there is an advantage that the purification of the recombinant protein is facilitated. In addition, since many secreted proteins are useful drugs, they can be applied as drugs themselves.
  • the protein of the present invention was derived from adipocytes and showed expression associated with adipocyte differentiation. Accordingly, the gene or protein of the present invention, or a compound that regulates the expression or activity of the protein, is not limited thereto. For example, for the treatment or prevention of diseases such as obesity, hyperlipidemia, diabetes, and arteriosclerosis. The application of is considered.
  • a method of introducing a mutation into a protein is known.
  • those skilled in the art can use a site-directed mutagenesis method (Hashimoto-Gotoh 5 T. et al. (1995) Gene 152, 271-275, Zoller, MJ, and Smith, M. (1983) Methods Enzymol. 100).
  • 468-500 Kramer, W. et al. (1984) Nucleic Acids Res. 12, 944 9456, Kramer W, and Fritz HJ (1987) Methods.Enzymol. 154, 350-367, Kunkel, TA (1985) ) Proc Natl Acad Sci USA.
  • a protein functionally equivalent to the protein can be prepared by appropriately mutating amino acids of the protein (a protein encoded by full-length DNA corresponding to SEQ ID NOs: 1, 2, and 7). Amino acid mutations can also occur in nature.
  • a protein having an amino acid sequence in which one or more amino acids are mutated in the amino acid sequence of the # 10X protein and functionally equivalent to the protein is also included in the protein of the present invention.
  • the number of amino acids to be mutated in such a mutant is usually within 50 amino acids, preferably within 30 amino acids, and more preferably within 10 amino acids (eg, within 5 amino acids).
  • the amino acid residue to be mutated is mutated to another amino acid that preserves the properties of the amino acid side chain.
  • the properties of amino acid side chains include hydrophobic amino acids (A, I, L, M, F, P, W, Y, V) and hydrophilic amino acids (R, D, N, C, E, QG, H, K, S, T), an amino acid having an aliphatic side chain (A, V, L, I, P), an amino acid having a hydroxyl group-containing side chain (S, ⁇ , ⁇ ), an amino acid having a sulfur atom-containing side chain Acids ( ⁇ ), carboxylic acids and amino acids with amide-containing side chains (D, N, E, Q ), Amino acids having base-containing side chains (R, K, ⁇ ), and amino acids having aromatic-containing side chains (H, F, Y,). Character mark).
  • the fusion protein is a fusion of these proteins with another peptide or protein, and is included in the present invention.
  • the fusion protein is prepared by encoding the # 10X protein (a protein consisting of the amino acid sequence of SEQ ID NOs: 8 to 11; a protein encoded by the full-length DNA corresponding to SEQ ID NOs: 1, 2, and 7).
  • DNA and DNA encoding another peptide or protein may be ligated in frame so that they are introduced into an expression vector and expressed in a host, and a method known to those skilled in the art can be used.
  • Other peptides or proteins to be fused with the protein of the present invention are not particularly limited.
  • peptides to be fused to the protein of the present invention include, for example, FLAG (H ⁇ , ⁇ . ⁇ . et al., BioTechnology (1988) 6, 1204-1210) and 6 His (histidine).
  • Residues consisting of 6 xHis,! O xHiS influenza agglutinin (HA), human cmyc fragment, VSV-GP fragment, pl8HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen
  • peptides such as fragments, lck tags, a-tubulin fragments, B-tags, and Protein C fragments can be used.
  • proteins to be fused with the protein of the present invention include, for example, GST (Gluythione-S-transferase), H A (influenza agglutinin), immunoglobulin constant region, ⁇ -galactosidase, MBP (maltose binding protein) and the like.
  • a fusion protein can be prepared by fusing commercially available MA encoding the peptide or the protein with DNA encoding the protein of the present invention, and expressing the fusion DNA prepared thereby. .
  • proteins in which a plurality of amino acid residues are deleted from the amino acid sequence of the # 10X protein include proteins in which signal sequences have been removed from these proteins.
  • the present invention includes proteins encoded by DNA that hybridizes to MA encoding the protein and functionally equivalent to the # 10X protein.
  • proteins include, for example, homologs of mouse and other mammals (eg, proteins encoded by humans, rodents, rabbits, magpies, etc.).
  • Hybridization conditions for isolating MA encoding a protein functionally equivalent to the # 10X protein can be appropriately selected by those skilled in the art.
  • the conditions for the hybridization include, for example, low stringent conditions.
  • the low stringent conditions are, for example, conditions of 42 ° C and 0.1% SDS of O.l SSC in washing after hybridization, preferably 50 ° C, 0.1 x SSC and 0.1% SDS. Is the condition.
  • More preferable hybridization conditions include high stringent conditions. Highly stringent conditions are, for example, conditions of 65 ° C., 5 ⁇ SSC and 0.1% SDS. In these conditions Thus, it can be expected that DNA with higher homology can be obtained more efficiently as the temperature is increased. However, a plurality of factors such as temperature and salt concentration can be considered as factors affecting the stringency of the hybridization, and those skilled in the art can realize similar stringency by appropriately selecting these factors. It is possible to
  • a gene amplification method using primers synthesized based on the sequence information of DNA (SEQ ID NOS: 1 to 7) encoding the # 10X protein instead of the hybridization method, for example, polymerase chain reaction (PCR) method It can also be used for isolation.
  • PCR polymerase chain reaction
  • Proteins functionally equivalent to the # 10X protein encoded by DNA isolated by these hybridization techniques or gene amplification techniques are usually the # 10X protein (the amino acid sequence described in SEQ ID NOs: 8 to 11).
  • the proteins of the present invention also include proteins that are functionally equivalent to the # 10X protein and that have high homology to the amino acid sequence of the protein. High homology usually means at least 50% identity, preferably 75% identity, more preferably 85% identity, and even more preferably 95% identity at the amino acid level. .
  • the identity of amino acid sequences and nucleotide sequences can be determined by the algorithm BLAST (Proc.
  • the protein of the present invention may differ in amino acid sequence, molecular weight, isoelectric point, presence / absence and form of sugar chains, etc., depending on the cell, host, or purification method for producing the protein described below. However, as long as the obtained protein has a function equivalent to that of the # 10X protein, it is included in the present invention.
  • a prokaryotic cell for example, Escherichia coli
  • a methionine residue is added to the N-terminal of the amino acid sequence of the original protein.
  • the proteins of the present invention also include such proteins.
  • the protein of the present invention can be prepared as a recombinant protein or a natural protein by methods known to those skilled in the art. If it is a recombinant protein, a DNA encoding the protein of the present invention (for example, a DNA having the nucleotide sequence of SEQ ID NOS: 1 to 7) is inserted into an appropriate expression vector and introduced into an appropriate host cell. The resulting transformant is collected and an extract is obtained, which is then subjected to chromatography such as ion exchange, reverse phase, gel filtration, or affinity chromatography in which an antibody against the protein of the present invention is immobilized on a column.
  • chromatography such as ion exchange, reverse phase, gel filtration, or affinity chromatography in which an antibody against the protein of the present invention is immobilized on a column.
  • the protein of the present invention can be used as a fusion protein with glutathione S-transferase protein or histidine.
  • host cells eg, animal cells, E. coli, etc.
  • the set seen recombinant protein expressed can and child purified using Guru evening Chionkaramu or nickel column. After purification of the fusion protein, if necessary, regions of the fusion protein other than the target protein can be cleaved with thrombin or Factor Xa and removed.
  • the protein is a natural protein, a method known to those skilled in the art, for example, an affinity in which an antibody that binds to the protein of the present invention described below is bound to a tissue or cell extract expressing the protein of the present invention, as described below. Isolation can be achieved by purifying using one column. it can.
  • the antibody may be a polyclonal antibody or a monoclonal antibody.
  • the present invention also includes partial peptides of the protein of the present invention.
  • the partial peptide of the present invention has an amino acid sequence of at least 7 amino acids or more, preferably 8 amino acids or more, and more preferably 9 amino acids or more.
  • the partial peptide can be used, for example, for preparing an antibody against the protein of the present invention, for screening a compound binding to the protein of the present invention, and for screening for a promoter or inhibitor of the protein of the present invention. Further, it can be an antagonist of the protein of the present invention or a competitive inhibitor.
  • the partial peptide of the present invention can be produced by a genetic engineering technique, a known peptide synthesis method, or by cleaving the protein of the present invention with an appropriate peptidase.
  • the peptide may be synthesized by, for example, either a solid phase synthesis method or a liquid phase synthesis method.
  • the DNA encoding the protein of the present invention is used for in vivo and in vitro production of the protein of the present invention as described above, and also includes, for example, diseases caused by abnormalities in the gene encoding the protein of the present invention. And gene therapy for diseases treatable by the protein of the present invention.
  • the DNA of the present invention may be in any form as long as it can encode the protein of the present invention. That is, it does not matter whether it is cDNA synthesized from mRNA, genomic DNA, or chemically synthesized DNA. Also, as long as it can encode the protein of the present invention, MA having an arbitrary nucleotide sequence based on the degeneracy of the genetic code is included.
  • the DNA of the present invention can be prepared by a method known to those skilled in the art. For example, it is prepared by preparing a cDNA library from cells expressing the protein of the present invention and performing hybridization using a part of the sequence of the DNA of the present invention (for example, SEQ ID NOS: 1 to 7) as a probe. it can.
  • the cDNA library may be prepared, for example, by the method described in the literature (Sambrook, J. et al., Molecular Clonings Cold Spring Harbor Laboratory Press (1989)), or using a commercially available DNA library. Good.
  • oligo DNA is synthesized based on the sequence of the DNA of the present invention (for example, SEQ ID NOS: 1 to 7), and the PCR reaction is performed using this as a primer. It can also be prepared by amplifying a cDNA encoding the protein of the present invention.
  • Genomic DNA can be isolated by screening a genomic DNA library using the obtained cDNA as a probe.
  • mRNA is isolated from a cell, tissue, or organ that expresses the protein of the present invention (eg, an adipocyte or a tissue in which expression has been observed by Northern blotting in this example).
  • mRNA can be isolated by known methods, for example, guanidine ultracentrifugation (Chirgwin, JM et al., Biochemistry (1979) 18, 5294-5299), and AGPC method (Chomczynski, P. and Sacchi, N. 3 Anal.
  • Total RNA is prepared by Biochem. (1987) 162, 156-159) and the like, and mRNA is purified from the total RNA using the mRNA Purification Kit (Pharmacia).
  • mRNA can be directly prepared by using the QuickPrep mRNA Purification Kit (Pharmacia).
  • CDNA is synthesized from the obtained mRNA using reverse transcriptase. cDNA synthesis, AMV
  • Reverse Transcriptase First-strand cDNA Synthesis Kit (Seikagaku Corporation) can also be used.
  • the 5, -RACE method (Frohman, MA) using the 5, -Ampli FINDER RACE Kit (manufactured by Clontech) and the polymerase chain reaction (polymerase chain reaction; PCR).
  • cDNA can be synthesized and amplified.
  • a target DNA fragment is prepared from the obtained PCR product, and ligated to a vector DNA. Furthermore, a recombinant vector is prepared from this, introduced into E. coli, etc., and colonies are selected. To prepare the desired recombinant vector.
  • the base sequence of the target DNA can be confirmed by a known method, for example, the dideoxynucleotide chain termination method.
  • a nucleotide sequence with higher expression efficiency can be designed in consideration of the codon usage of the host used for expression (Grantham, R. et al. 3 Nucelic Acids Research ( 1981) 9, r43-74).
  • the MA of the present invention can be modified by a commercially available kit or a known method. Modifications include, for example, digestion with restriction enzymes, insertion of synthetic oligonucleotides or appropriate DNA fragments, addition of a linker, insertion of an initiation codon (ATG) and / or stop codon (TAA, TGA, or TAG). And the like.
  • the DNA of the present invention is a DNA consisting of a base sequence from base c at position 1 to base g at position 165 in the base sequence of SEQ ID NO: 1, or a DNA containing the base sequence, A DNA consisting of a base sequence from the 1st base to the 438th base t in the base sequence or a DNA containing the base sequence, and a base sequence from the 83rd base a to the 1408th base a in the base sequence of SEQ ID NO: 3 DNA consisting of a base sequence or DNA containing said base sequence, DNA consisting of a base sequence from base a at position 214 to base g at position 1662 in base sequence of SEQ ID NO: 4, or DNA containing said base sequence, SEQ ID NO: A DNA consisting of the base sequence from the base a at position 289 to the base c at position 1407 in the base sequence of 5, or a DNA containing the base sequence, and the base a from position 86 to position 3244 of base 86 at position 86 in the base
  • DNA consisting of a base sequence up to base a or Nucleotide sequence including MA encompasses DNA containing the DNA or nucleotide sequence consisting of the nucleotide sequence of the 7 from nucleotide position 1 of the nucleotide c to 522-positional base c.
  • the DNA of the present invention also includes a DNA that hybridizes with the MA having the nucleotide sequence shown in SEQ ID NOs: 1 to 7, and that encodes a protein functionally equivalent to the protein of the present invention.
  • the conditions for the hybridization can be appropriately selected by those skilled in the art. Specifically, the conditions described above can be used. You. Under these conditions, DNA with higher homology can be obtained as the temperature is increased.
  • the hybridizing DNA is preferably a naturally occurring DNA, for example, cDNA or chromosomal DNA.
  • the present invention also provides a vector into which the MA of the present invention has been inserted.
  • the vector of the present invention is useful for retaining the DNA of the present invention in a host cell or expressing the protein of the present invention.
  • the vector when E. coli is used as a host, the vector
  • E.g., DH9, DH5, Ver.1, XLlBlue for large-scale amplification and preparation of large amounts of E. coli for ⁇ ori '' amplification and selection of transformed E. coli
  • a gene for example, a drug resistance gene that can be identified by any drug (ampicillin, tetracycline, kanamycin, chloramphenicol)
  • vectors include M13-based vectors, pUC-based vectors, pBR322. PBluescript, pCR-Script, and the like.
  • examples include pGEM-T, pDIRECT, pT7, and the like.
  • an expression vector is particularly useful.
  • the expression vector may have the above-mentioned characteristics such that the vector is amplified in E. coli, and may be used in a host such as JM109, DH5a, HB101, or XU-Blue.
  • a promoter that can be efficiently expressed in Escherichia coli for example, lacZ promoter, Yuichi (Ward et al., Nature (1989) 341,
  • the vector may also include a signal sequence for polypeptide secretion.
  • the pelB signal sequence Lei, SP et al J. Bacteriol. (1987) 169, 4379
  • the introduction of the vector into the host cell can be performed using, for example, a calcium chloride method or an electroporation method.
  • a mammalian expression vector for example, pcDNA3 (manufactured by Invitrogen) or pEGF-BOS (Nucleic Acids. Res.
  • insect cells eg, “Bac-to-BAC baculovairus expression systemj (manufactured by Gibco BRL), pBacPAK8), plant-derived expression vector ( For example, ⁇ 1, pMH2), an expression vector derived from an animal virus (eg, pHSV, pMV, pAdexLcw), an expression vector derived from a retrovirus (eg, pZIPneo), an expression vector derived from a yeast (eg, rpichia Expression Kitj (Invitrogen) ), PNVU, SP-Q01) and Bacillus subtilis-derived expression vectors (eg, pPL608, pKTH50).
  • insect cells eg, “Bac-to-BAC baculovairus expression systemj (manufactured by Gibco BRL), pBacPAK8), plant-derived expression vector ( For example, ⁇ 1, pMH2), an expression vector derived from an animal virus (eg, pH
  • promoters necessary for expression in cells such as the SV40 promoter (Muligan et al., Nature (1979) 277, 108) ), MMLV-LTR promoter, EF1 promoter Yuichi (Mizushima et al., Nucleic Acids Res. (1990) 18, 5322), CMV promoter — It is essential to have a promoter and transform cells. It is more preferable to have a gene (for example, a drug resistance gene that can be discriminated by a drug (neomycin, G418, etc.)) for selecting Cp. Examples of vectors with such characteristics include, p negation, pDR2, pBK-RSV, can be mentioned up such pBK-CMV ⁇ p0PRSV s p0P13.
  • a vector having a DHFR gene complementing the nucleic acid synthesis pathway-deficient CH0 cell is used.
  • pCHOI pCHOI
  • methotrexe MTX
  • replication of SV40 is performed using COS cells having a gene expressing the SV40 T antigen on the chromosome. Transformation can be performed using a single vector (eg, pcD) having an origin.
  • pcD a single vector having an origin.
  • the replication origin those derived from poliovirus, adenovirus, sipapirovirus (BPV) and the like can also be used.
  • the expression vector is used as a selection marker for amplification of gene copy number in the host cell system, such as aminoglycoside transferase (APH) gene, thymidine kinase (TK) gene, and Escherichia coli xanthinguanine phosphoribosyltransferase (Ecogp t). Gene, dihydrofolate reductase (dhfr) gene and the like.
  • the DNA of the present invention is incorporated into an appropriate vector, for example, by a retrovirus method, a ribosome method, a cationic ribosome method, an adenovirus method, or the like.
  • a retrovirus method for introduction into a living body.
  • the vector used include, but are not limited to, an adenovirus vector (eg, pAdexlcw) and a retrovirus vector (eg, pZIPneo).
  • General genetic manipulations such as insertion of the DNA of the present invention into a vector can be performed according to a conventional method (Molecular Cloning, 5.61-5.63).
  • Administration into a living body may be an ex vivo method or an in vivo method.
  • the present invention also provides a host cell into which the vector of the present invention has been introduced.
  • the host cell into which the vector of the present invention is introduced is not particularly limited, and for example, Escherichia coli and various animal cells can be used.
  • the host cell of the present invention can be used, for example, as a production system for producing or expressing the protein of the present invention.
  • Production systems for protein production include in vitro and in vivo production systems. Examples of in vitro production systems include production systems using eukaryotic cells and production systems using prokaryotic cells.
  • eukaryotic cells for example, animal cells, plant cells, and fungal cells can be used as hosts.
  • mammalian cells for example, CHO (J. Exp. Med.
  • CH0 cells in particular, dhfr-CHO (Proc. Natl. Acad. Scad. USA (1980) 77, 4216-4220) and CHO K-1 (Proc. Natl. Acad. Sci. USA (1968) 60, 1275) can be suitably used.
  • CH0 cells are particularly preferred.
  • Vector vectors can be introduced into host cells by, for example, the calcium phosphate method, the DEAE dextran method, the method using Cationic Ribosome D0TAP (manufactured by Behringer Mannheim), the electoral poration method, or the Lipofexion method. Is possible.
  • Nicotiana tabacum As plant cells, for example, cells derived from Nicotiana tabacum (Nicotiana tabacum) are known as protein production systems, which may be callus cultured.
  • Fungal cells include yeast, for example, the genus Saccharomyces, for example, Saccharomyces cerevisiae, filamentous fungi, for example, the genus Aspergillus, for example, Aspergillus niger s. are known.
  • bacterial cells When prokaryotic cells are used, there are production systems using bacterial cells.
  • bacterial cells include Escherichia coli (E. coli) such as JM109, DH5 and HB101, and Bacillus subtilis.
  • the protein is obtained by transforming these cells with the target DNA and culturing the transformed cells in vitro.
  • the culturing can be performed according to a known method.
  • a culture solution of animal cells for example, DMEM, MEM, RPMI1640, and IMDM can be used.
  • serum replacement fluid such as fetal calf serum (FCS) They may be used in combination, or may be serum-free culture.
  • FCS fetal calf serum
  • the pH during culturing is preferably about 6-8. Culture is usually performed at about 30 to 40 ° C for about 15 to 200 hours, and the medium is replaced, aerated, and agitated as necessary.
  • examples of a system for producing a protein in vivo include a production system using animals and a production system using plants.
  • the target DNA is introduced into these animals or plants, and proteins are produced and recovered in the animals or plants.
  • the “host” in the present invention includes these animals and plants.
  • mice When using animals, there are production systems using mammals and insects. As mammals, goats, bushes, ovines, mice, and mice can be used (Vicki Glaser, SPECTRUM Biotechnology Applications, 1993). When a mammal is used, a transgenic animal can be used.
  • the target DNA is prepared as a fusion gene with a gene encoding a protein that is specifically produced in milk, such as goat casein.
  • the DNA fragment containing the fusion gene is injected into a goat embryo, and the embryo is transplanted into a female goat.
  • the target protein can be obtained from milk produced by the transgenic goat born from the goat that has received the embryo or its progeny. Hormones may be used in transgenic goats as appropriate to increase the amount of milk containing proteins produced by transgenic goats (Ebert J. M. et al., Bio / Technology (1994) 12, 699-702).
  • silkworms can be used as insects, for example.
  • the target protein can be obtained from the body fluid of the silkworm by infecting the silkworm with a baculovirus into which DNA encoding the target protein has been inserted (Sus picture, M. et al. ., Nature (1985) 315, 592-594).
  • tobacco when using a plant, for example, tobacco can be used.
  • the DNA encoding the target protein is inserted into a plant expression vector, for example, pMON530, and this vector is inserted into Agrobacterium 'mmfemaciens. (Agrobacterium tumefaciens).
  • the bacterium is infected with tobacco, for example, Nicotiana tabacum, and the desired polypeptide can be obtained from the leaves of this tobacco (Julian K. -C. Ma et al., Eur. J. Immunol. (1994) 24, 131-138).
  • the protein of the present invention thus obtained can be isolated from inside or outside the host cell (such as a medium) and purified as a substantially pure and homogeneous protein.
  • the separation and purification of the protein may be carried out by using the separation and purification methods used in ordinary protein purification, and is not limited at all. For example, chromatography columns, filters, ultrafiltration, salting out, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, isoelectric focusing, dialysis, recrystallization, etc. When combined, proteins can be separated and purified.
  • chromatography examples include affinity chromatography, ion-exchange chromatography, hydrophobic chromatography, gel filtration, reversed-phase chromatography, and adsorption chromatography (Strategies for Protein Purification). and Cnaracterization: A Laboratory Course Manual. Ed Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press, 1996).
  • chromatographys can be performed using liquid phase chromatography, for example, liquid phase chromatography such as HPLC and FPLC.
  • the present invention also includes highly purified proteins using these purification methods.
  • the protein can be arbitrarily modified or partially removed by reacting the protein with an appropriate protein modifying enzyme before or after purification.
  • an appropriate protein modifying enzyme for example, trypsin, chymotrypsin, lysylendopidase, protein kinase, glucosidase and the like are used.
  • the present invention also provides an antibody that binds to the protein of the present invention.
  • the form of the antibody of the present invention is not particularly limited, and includes a monoclonal antibody as well as a polyclonal antibody.
  • antiserum obtained by immunizing an immunized animal such as a heron with the protein of the present invention; This includes all classes of polyclonal and monoclonal antibodies, as well as human and recombinant humanized antibodies.
  • the protein of the present invention used as a sensitizing antigen for obtaining an antibody is not limited to the animal species from which it is derived, but is preferably a protein derived from a mammal, for example, a human, a mouse or a rat, and particularly preferably a protein derived from a human.
  • a human-derived protein can be obtained using the gene sequence or amino acid sequence disclosed herein.
  • the protein used as the sensitizing antigen may be a complete protein or a partial peptide of the protein.
  • the partial peptide of the protein include an amino group (N) terminal fragment and a carboxy (C) terminal fragment of the protein.
  • antibody refers to an antibody that reacts with the full length or fragment of a protein.
  • a gene encoding the protein of the present invention or a fragment thereof is inserted into a known expression vector system, and the vector is used to transform the host cell described in the present specification. Fragments may be obtained by a known method, and these may be used as a sensitizing antigen. Further, a cell expressing the protein, a lysate thereof, or a chemically synthesized protein of the present invention may be used as the sensitizing antigen. It is preferable that the short peptide is appropriately bound to a carrier protein such as keyhole lysine hepatocyanin, pepsin albumin, ovalbumin, etc. to form an antigen.
  • a carrier protein such as keyhole lysine hepatocyanin, pepsin albumin, ovalbumin, etc.
  • the mammal to be immunized with the sensitizing antigen is not particularly limited, but is preferably selected in consideration of compatibility with the parent cell used for cell fusion. In general, rodents are used. Eyes, egrets, and primates are used.
  • mice for example, mice, rats, hamsters and the like are used.
  • a heronoid animal for example, a heron is used.
  • monkeys are used as primates.
  • monkeys of the lower nose old world monkeys
  • cynomolgus monkeys macaques, baboons, and chimpanzees are used.
  • Immunization of an animal with a sensitizing antigen is performed according to a known method.
  • a sensitizing antigen is injected intraperitoneally or subcutaneously into a mammal.
  • the sensitizing antigen is diluted and suspended in an appropriate amount with PBS (Phosphate-Buffered Saline) or physiological saline, and then mixed with an appropriate amount of a normal adjuvant, for example, Freund's complete adjuvant, if desired. After emulsification, it is administered to mammals. Thereafter, it is preferable to administer the sensitizing antigen mixed with an appropriate amount of incomplete Freund's adjuvant several times every 4 to 21 days.
  • a suitable carrier can be used at the time of immunization with the sensitizing antigen. Immunization is performed in this manner, and an increase in the desired antibody level in the serum is confirmed by a conventional method.
  • the blood of a mammal sensitized with the antigen is taken out after confirming that the desired antibody repel in serum has been increased.
  • the serum is separated from the blood by a known method.
  • a serum containing the polyclonal antibody may be used.
  • a fraction containing the polyclonal antibody may be further isolated from this serum and used. .
  • immunoglobulin G or M can be prepared.
  • the immune cells may be removed from the mammal and subjected to cell fusion.
  • preferred immune cells used for cell fusion include splenocytes in particular.
  • the other parent cell to be fused with the immunocyte is preferably a mammalian myeloma cell, more preferably a myeloma cell that has acquired the properties for fusion cell selection by a drug.
  • Cell fusion between the immune cells and myeloma cells is basically performed according to a known method, for example, the method of Milstein et al. (Galfre, G. and Milstein, C, Methods Enzymol. (1981) 73, 3-46). It can be carried out.
  • the hybridoma obtained by cell fusion is selected by culturing it in a normal selective culture medium, for example, a HAT culture medium (a culture medium containing hypoxanthine, aminopterin and thymidine). Culturing in the HAT culture solution is continued for a period of time sufficient to kill cells other than the target hybridoma (non-fused cells), usually for several days to several weeks. Next, screening and cloning of hybridomas producing the desired antibody are performed by the usual limiting dilution method.
  • a HAT culture medium a culture medium containing hypoxanthine, aminopterin and thymidine
  • human lymphocytes for example, human lymphocytes infected with EB virus are sensitized in vitro with proteins, protein-expressing cells or lysates thereof. It is also possible to fuse a sensitized lymphocyte with a human-derived myeloma cell having permanent division ability, for example, U266, to obtain a hybridoma that produces a desired human antibody having a protein binding activity (Japanese Patent Application Laid-Open No. -17 688 publication).
  • the obtained hybridoma is transplanted into the peritoneal cavity of a mouse, ascites is collected from the mouse, and the obtained monoclonal antibody is subjected to, for example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, and the present invention. It can be prepared by purifying the above protein using a coupled affinity column or the like.
  • the antibody of the present invention is used for purification and detection of the protein of the present invention, and is also a candidate for an agonist and an angoniist of the protein of the present invention. It is also conceivable to apply this antibody to antibody therapy for diseases involving the protein of the present invention.
  • a human antibody or a humanized antibody is preferable in order to reduce immunogenicity.
  • a transgenic animal having a human antibody gene repertoire is immunized with a protein serving as an antigen, protein-expressing cells or a lysate thereof to obtain antibody-producing cells.
  • a human antibody against the protein can be obtained using a hybridoma fused with myeloma cells (International Publication Nos. W092--03918, W093-2227, W094-02602, W094-25585, W096-33735 and W096). -See 34096).
  • cells in which immune cells such as sensitized lymphocytes that produce antibodies are immortalized by oncogenes may be used.
  • the thus obtained monoclonal antibody can also be obtained as a recombinant antibody produced using a genetic recombination technique (for example, Borrebaeck, AK and Larrick, JW, THERAPEUTIC MONOCLONAL ANTIBODIES, Published in the United Kingdom by MCMILLAN PUBLISHERS LTD, 1990).
  • Recombinant antibodies are produced by cloning the DNA encoding them from hybridomas or immunized cells such as sensitized lymphocytes that produce the antibody, inserting the DNA into an appropriate vector, and introducing it into a host.
  • the present invention includes this recombinant antibody.
  • the antibody of the present invention may be a modified antibody fragment thereof as long as it binds to the protein of the present invention.
  • Fab, F (ab ') 2, Fv, or a single chain Fv (scFv) in which an Fv of an H chain and an L chain are linked by an appropriate linker Huston, JS et al., Proc. Natl. Acad. Sci. USA (1988) 85, 5879-5883.
  • the antibody is treated with an enzyme, for example, papain or pepsin, to generate an antibody fragment, or a gene encoding these antibody fragments is constructed and introduced into an expression vector. Expressed in cells (for example, Co, MS et al., J.
  • modified antibody an antibody bound to various molecules such as polyethylene glycol (PEG) can be used.
  • PEG polyethylene glycol
  • the “antibody” of the present invention also includes these modified antibodies. Such a modified antibody can be obtained by subjecting the obtained antibody to chemical modification. These methods are already established in this field.
  • the antibody of the present invention can be prepared by using a chimeric antibody comprising a non-human antibody-derived variable region and a human antibody-derived constant region or a non-human antibody-derived CDR (complementarity determining region) and a human It can be obtained as a humanized antibody consisting of antibody-derived FR (framework region) and constant region.
  • the antibody obtained as described above can be purified to homogeneity.
  • the separation and purification of the antibody used in the present invention may be performed by the separation and purification methods used for ordinary proteins. For example, chromatography columns such as affinity chromatography, filtration, ultrafiltration, salting out, dialysis, SDS polyacrylamide gel electrophoresis, isoelectric focusing, etc. can be appropriately selected and combined.
  • Antibodies can be separated and purified (Antibodies: A Laboratory Manual; Ed Harlow and David Lane, Cold Spring Harbor Laboratory, 1988), but are not limited thereto.
  • the concentration of the antibody obtained above can be measured by measuring the absorbance or by using an enzyme-linked immunosorbent assay (ELISA) or the like.
  • Columns used for affinity chromatography include a protein A column and a protein G column.
  • columns using a protein A column include Hyper D, POROS, Sepharose F.F. (Pharmacia), and the like.
  • Examples of chromatography other than affinity chromatography include, for example, ion exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, and adsorption chromatography (Strategies for Protein Purification and Characterization: A Laboratory Course Manual.Ed Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press, 1996). These chromatographys can be performed using liquid phase chromatography such as HPI and FPLC.
  • Methods for measuring the antigen-binding activity of the antibody of the present invention include, for example, measurement of absorbance, enzyme-linked immunosorbent assay (ELISA), EIA (enzyme-linked immunosorbent assay), Immunoassay) or a fluorescent antibody method can be used.
  • ELISA enzyme-linked immunosorbent assay
  • EIA enzyme-linked immunosorbent assay
  • Immunoassay a fluorescent antibody method
  • the protein of the present invention is added to a plate on which the antibody of the present invention is immobilized, and then a sample containing the target antibody, for example, a culture supernatant of antibody-producing cells or a purified antibody is added.
  • a secondary antibody that recognizes an enzyme for example, an antibody labeled with alkaline phosphatase, etc.
  • an enzyme substrate such as P-nitrophenylphosphoric acid and measure the absorbance.
  • Antigen binding activity can be evaluated.
  • a protein fragment for example, a fragment comprising the C-terminus thereof may be used.
  • BI Acore Pharmacia
  • the antibody of the present invention is brought into contact with the sample contained in the sample which is expected to contain the protein of the present invention, and an immune complex of the antibody and the protein is detected or measured.
  • the method for detecting or measuring a protein of the present invention can be carried out.
  • INDUSTRIAL APPLICABILITY The method for detecting or measuring a protein of the present invention can specifically detect or measure a protein, and thus is useful for various experiments and the like using proteins.
  • the present invention also provides a polynucleotide comprising at least 15 nucleotides complementary to the DNA encoding the # 10X protein (SEQ ID NOS: 1 to 7) or its complementary strand.
  • the “complementary strand” refers to one strand of a double-stranded nucleic acid consisting of A: T (U in the case of RNA) and G: C base pairs with respect to the other strand.
  • the term “complementary” is not limited to a case where the sequence is completely complementary to at least 15 contiguous nucleotide regions, but is at least 70 °, preferably at least 80%, more preferably 90%, and more preferably It is preferable that they have a homology of 95% or more on the base sequence.
  • the algorithm for determining homology may use the algorithm described in this specification.
  • nucleic acids include probes and primers used for detection and amplification of DNA encoding the protein of the present invention, probe primers for detecting the expression of the DNA, and expression of the protein of the present invention.
  • Nucleotides or nucleotide derivatives eg, antisense oligonucleotides, ribozymes, or DNA encoding them
  • Such a nucleic acid can also be used for producing a DNA chip.
  • the 3′-side region is complementary, and a restriction enzyme recognition sequence, a tag, or the like can be added to the 5′-side.
  • Antisense oligonucleotides include, for example, antisense oligonucleotides that hybridize at any position in the base sequence of SEQ ID NOs: 1 to 7.
  • This antisense oligonucleotide is preferably an antisense oligonucleotide for at least 15 or more consecutive nucleotides in the nucleotide sequence of SEQ ID NOs: 1 to 7. More preferably, it is an antisense oligonucleotide in which at least 15 or more consecutive nucleotides contain a translation initiation codon.
  • the antisense oligonucleotide derivatives and modifications thereof can be used.
  • the modified product include a modified lower alkyl phosphonate such as a methylphosphonate type or an ethylphosphonate type, a phosphorothioate modified product, a phosphoroamidate modified product, and the like.
  • Antisense oligonucleotides include not only those whose nucleotides corresponding to nucleotides constituting a predetermined region of DNA or mRNA are all complementary sequences, but also DNAs or mRNAs and oligo nucleotides shown in SEQ ID NOs: 1 to 7. As long as it can specifically hybridize to the base sequence to be used, one including one or more nucleotide mismatches is also included.
  • the antisense oligonucleotide derivative of the present invention acts on cells producing the protein of the present invention to bind to DNA or mRNA encoding the protein, thereby inhibiting the transcription or translation of the protein or producing mA. By suppressing the expression of the protein of the present invention, for example, by promoting the degradation, the effect of suppressing the action of the protein of the present invention is obtained.
  • the antisense oligonucleotide derivative of the present invention can be mixed with a suitable base material which is inactive against the derivative to prepare an external preparation such as a liniment or a poultice.
  • excipients may be added to tablets, splinters, granules, capsules, ribosome capsules, It can be a lyophilized agent such as a propellant, a liquid, a nasal drop and the like. These can be prepared according to a conventional method.
  • the antisense oligonucleotide derivative of the present invention is applied directly to the affected area of the patient, or is applied to the patient so as to be able to reach the affected area as a result of intravenous administration or the like.
  • an antisense-encapsulated material that enhances durability and membrane permeability can be used. Examples include liposomes, poly-L-lysine, lipids, cholesterol, ribofectin or derivatives thereof.
  • the dosage of the antisense oligonucleotide derivative of the present invention can be appropriately adjusted according to the condition of the patient, and a preferred amount can be used. For example, it can be administered in the range of 0.1 to 100 mg / kg, preferably 0.1 to 50 mg / kg.
  • the antisense oligonucleotide of the present invention inhibits the expression of the protein of the present invention and is therefore useful in suppressing the biological activity of the protein of the present invention. Further, the expression inhibitor containing the antisense oligonucleotide of the present invention is useful in that it can suppress the biological activity of the protein of the present invention.
  • the protein of the present invention is useful for screening for a compound that binds to the protein. That is, the protein of the present invention is brought into contact with a test sample expected to contain a compound binding to the protein, and a compound having an activity of binding to the protein of the present invention is selected. And a method of screening for a compound that binds to the protein of the present invention.
  • the protein of the present invention used for the screening may be a recombinant protein or a protein of natural origin. It may be a partial peptide. It may also be a form expressed on the cell surface or a form as a membrane fraction.
  • the test sample is not particularly limited and includes, for example, a cell extract, a cell culture supernatant, a fermentation microorganism product, a marine organism extract, a plant extract, a purified or crude protein, a peptide, a non-peptidic compound, and a synthesis. Low molecular weight compounds and natural compounds.
  • the protein of the present invention which is brought into contact with a test sample, may be, for example, a purified protein, a soluble protein, a form bound to a carrier, a fusion protein with another protein, or a form expressed on a cell membrane.
  • the sample can be brought into contact with a test sample as a membrane fraction.
  • a method for screening a protein that binds to the protein using the protein of the present invention for example, many methods known to those skilled in the art can be used. Such screening can be performed, for example, by immunoprecipitation. Specifically, it can be performed as follows.
  • the gene encoding the protein of the present invention is introduced into a vector for expression of a foreign gene such as pSV2neo, pcDNA I, or pCD8, so that the gene is expressed in animal cells or the like.
  • Promoters used for expression include SV40 early promoter (Rigoy In Williamson ea.), Genetic Engineering, Vol. 3. Academic Press, London, p. 83-141 (1982)), EF-1 promoter (Kim et al.
  • CAG promoter Niwa et al. Gene 108, p.193-200 (1991)
  • SR a promoter Takebe et al. Mol. Cell. Biol. 8, p. 66 (1988)
  • SV40 late promoter Gheysen and Fiers J. Mol. A ppl. Genet. II, p. 385-394 (1982)
  • Adenovirus late promoter Kaufman et a 1. Mol. Cell. Biol. 9, p. 946 (1989)
  • HSV TK promoter any other commonly used promoters can be used.
  • the protein of the present invention is expressed as a fusion protein having a monoclonal antibody recognition site by introducing a recognition site (epitope) of the monoclonal antibody of which specificity is known into the N-terminal or C-terminal of the protein of the present invention. be able to .
  • a commercially available epitope-antibody system can be used (Experimental Medicine 1 ⁇ , 85-90 (1995)).
  • Vectors that can express a fusion protein with ⁇ -galactosidase, maltose binding protein, glutathione S-transferase, green fluorescent protein (GFP), and the like via a multicloning site are commercially available.
  • an immune complex is formed by adding these antibodies to a cell lysate prepared using an appropriate surfactant.
  • This immune complex comprises the protein of the present invention, a protein capable of binding thereto, and an antibody.
  • immunoprecipitation can also be performed using antibodies against the protein of the present invention.
  • Antibodies against the protein of the present invention include, for example, a gene encoding the protein of the present invention introduced into an appropriate E. coli expression vector, expressed in E. coli, and the expressed protein is purified. It can be prepared by immunizing goats and chickens. Alternatively, it can be prepared by immunizing the above animal with the synthesized partial peptide of the protein of the present invention.
  • the immune complex can be precipitated using Protein A Sepharose or Protein G Sepharose.
  • an epitope such as GST
  • a substance specifically binding to these epitopes such as glutathione-Sepharose 4B is used to prepare the protein of the present invention.
  • An immune complex can be formed in the same manner as in the case where an antibody of the above protein is used.
  • SDS-PAGE is generally used for analysis of immunoprecipitated proteins.
  • the bound proteins can be analyzed by the molecular weight of the protein.
  • the protein of interest can be purified directly from the SDS-polyacrylamide gel and its sequence determined.
  • Examples of the method for isolating a protein that binds to the protein using the protein of the present invention include, for example, the West Western blotting method (Skolnik, EY et al., Cell (1991) 65, 83-90). ). That is, cells, tissues, and organs that are expected to express the protein that binds to the protein of the present invention (for example, fat cells and tissues in which expression has been observed by Northern blotting in the Examples) are phage-derived.
  • a cDNA library using a vector human gtll, ZAP, etc.
  • the protein expressed on a filter was fixed, purified and labeled with the protein of the present invention.
  • the plaque expressing the protein bound to the protein of the present invention may be detected by labeling by reacting the above-mentioned filter with the protein.
  • the method for labeling the protein of the present invention include a method utilizing the binding property of biotin and avidin, a method of specifically binding to the protein of the present invention or a peptide or polypeptide fused to the protein of the present invention (for example, GST).
  • the method include a method using an antibody, a method using a radioisotope, and a method using fluorescence.
  • a 2-hybrid system using cells Yields, S., and Sternglanz, R., Trends. Genet. (1994) 10, 286-292, Dalton S, and Treisman R (1992) Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element.Cell 68, 597-612, ⁇ MATCHMARKER Two-Hybrid Systemj, '' Mamm alian MATCHMAKER Two-Hybrid Assay Kit ”,“ MATCHMAKEE One-Hybrid System ”(all manufactured by Clontech), and“ HybriZAP Two-Hybrid Vector Systemj ”(Strata Gene) are used.
  • the protein of the present invention or a partial peptide thereof is fused with an SRF DNA binding region or GAL4 DNA binding region and expressed in yeast cells, and the protein of the present invention and From the cells that are expected to express the protein to be bound, a cDNA library was prepared that could be expressed in a form fused with the VP16 or GAL4 transcription activation region, and introduced into the yeast cells described above for detection.
  • the library-derived cDNA is isolated from the obtained positive clones (when the protein that binds to the protein of the present invention is expressed in yeast cells, the binding of the two activates the reporter gene, and a positive clone can be confirmed).
  • the protein encoded by the cDNA can be obtained by introducing the isolated cDNA into Escherichia coli for expression. As a result, it is possible to prepare a protein that binds to the protein of the present invention or a gene thereof.
  • the repo overnight gene used in the 2-hybrid system includes, for example, the HIS3 gene, Ade2 gene, LacZ gene, CAT gene, luciferase gene, PAI-1 (Plasminogen activator inhibitor typel) gene, etc. But not limited to these. Screening by the two-hybrid method can be performed using mammalian cells in addition to yeast cells.
  • Screening for a compound that binds to the protein of the present invention can also be performed by affinity mouth chromatography.
  • the protein of the present invention is immobilized on an affinity carrier, and a test sample which is expected to express a protein that binds to the protein of the present invention is applied thereto.
  • the test sample in this case includes, for example, a cell extract, a cell lysate, and the like. After applying the test sample, the column is washed to prepare a protein bound to the protein of the present invention.
  • the obtained protein is analyzed for its amino acid sequence, an oligo DNA is synthesized based on the amino acid sequence, and a DNA encoding the protein can be obtained by screening a cDNA library using the DNA as a probe. .
  • a biosensor utilizing the surface plasmon resonance phenomenon can be used as a means for detecting or measuring the bound compound.
  • a biosensor utilizing the surface plasmon resonance phenomenon can be used to detect the interaction between the protein of the present invention and a test compound using a trace amount of protein and without labeling the surface plasmon resonance signal. It can be observed in real time as a null (for example, BIAcore, manufactured by Pharmacia). Therefore, it is possible to evaluate the binding between the protein of the present invention and a test compound by using a biosensor such as BIAcore.
  • Methods for isolating not only proteins but also compounds that bind to the protein of the present invention include, for example, immobilized protein of the present invention, synthetic compounds, and natural compounds.
  • a method for screening molecules that bind to the protein of the present invention using a product bank or a random phage peptide display library, and a screening method using high throughput by combinatorial chemistry technology (Wrighton NC; Farrell FX; Chang R Kashyap AK; Barbone FP; Mulcahy LS Johnson DL; Barrett RW; Jolliffe LK; Dower WJ.
  • the compound that can be isolated by the screening of the present invention is a candidate for the agent for regulating the activity of the protein of the present invention, and is a disease caused by abnormal expression or dysfunction of the protein of the present invention or the activity of the protein of the present invention. It can be applied to the treatment of diseases that can be treated by controlling the disease. Substances that can be converted by addition, deletion, and / or substitution of a part of the structure of a compound that can be isolated using the screening method of the present invention are also included in the compounds that bind to the protein of the present invention.
  • the protein of the present invention or a compound that can be isolated by the screening of the present invention, is used in a human mammal, such as a mouse, a rat, a guinea pig, a heron, a chicken, a cat, a dog, a sheep, a bush, a monkey, a monkey, a baboon,
  • a human mammal such as a mouse, a rat, a guinea pig, a heron, a chicken, a cat, a dog, a sheep, a bush, a monkey, a monkey, a baboon
  • the protein or isolated compound itself can be administered directly to a patient, or can be formulated and administered by a known pharmaceutical method.
  • pharmacologically acceptable carriers or vehicles specifically, sterile water or saline, vegetable oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, It is possible to formulate the drug product by combining it with a preservative, binder and the like as appropriate and mixing it in the unit dosage form required for accepted pharmaceutical practice.
  • the effective components of these preparations are intended to provide a suitable volume in the specified range.
  • Additives that can be incorporated into tablets and capsules include, for example, binders such as gelatin, corn starch, tragacanth gum, acacia, excipients such as crystalline cellulose, corn starch, gelatin, and alginic acid. Suitable leavening agents, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, and flavoring agents such as peppermint, cocoa oil or cherry are used.
  • the unit dosage form is a capsule, the above-mentioned materials may further contain a liquid carrier such as an oil or fat.
  • a sterile composition for injection can be formulated using a potable vehicle such as distilled water for injection according to normal pharmaceutical practice.
  • Aqueous injection solutions include, for example, physiological saline, isotonic solutions containing pudose and other adjuvants, such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride. It may be used in combination with an agent, for example, an alcohol, specifically ethanol, a polyalcohol, for example, propylene glycol, polyethylene glycol, a nonionic surfactant, for example, polysorbate 80 (TM) or HC0-50.
  • an agent for example, an alcohol, specifically ethanol, a polyalcohol, for example, propylene glycol, polyethylene glycol, a nonionic surfactant, for example, polysorbate 80 (TM) or HC0-50.
  • the oily liquid includes sesame oil and soybean oil, and may be used in combination with benzyl benzoate or benzyl alcohol as a solubilizer.
  • buffers such as phosphate buffers, sodium acetate buffers, soothing agents such as proforce hydrochloride, stabilizers, such as It may be blended with benzyl alcohol, phenol and antioxidants.
  • the prepared injection solution is usually filled into an appropriate ampoule.
  • Administration to patients can be performed, for example, by intraarterial injection, intravenous injection, subcutaneous injection, etc., or intranasally, transbronchially, intramuscularly, transdermally, or orally by methods known to those skilled in the art. It can do better.
  • the dose varies depending on the weight and age of the patient, the administration method, and the like, but those skilled in the art can appropriately select an appropriate dose.
  • the compound can be encoded by DNA
  • the DNA may be incorporated into a gene therapy vector to perform gene therapy.
  • the dose and administration method vary depending on the patient's body weight, age, symptoms, etc., but those skilled in the art can appropriately select the dose of the protein of the present invention.
  • target organ, symptoms and method of administration for example, in the form of an injection, it is generally considered to be about 100 to 20 mg per day for an adult (with a body weight of 60 kg).
  • the dose of the compound that binds to the protein of the present invention or the compound that modulates the activity of the protein of the present invention varies depending on the symptoms. However, in the case of oral administration, in general, in adults (with a body weight of 60 kg), 1 It is believed to be about 0.1 to 100 mg per day, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg.
  • FIG. 1 is an electrophoretic photograph showing the result of detecting the expression of the gene of the present invention in 3T3-LI cells by Northern blot analysis. Lane 1 shows proliferating 3T3-L1 cells, lane 2 shows confluent 3T3-L1 cells, and lane 3 shows 3T3-L1 cells induced to differentiate into adipocytes.
  • FIG. 2 is an electrophoretic photograph showing the results of detecting the expression of the gene of the present invention in various tissues by Northern blot analysis.
  • the lanes are as follows: 1: heart, 2: brain, 3: spleen, 4: lung, 5: liver, 6: skeletal muscle, :: kidney, 8: testis.
  • Figure 3 shows the expression of # 103 to # 106 and GAPDH in 3T3-L1 in log phase, 3T3-Ll in confluent state, and 3T3-L1 1 to 9 days after induction of differentiation into fat cells.
  • It is an electrophoresis photograph which shows the result detected by Northern blot analysis.
  • FIG. 4 is an electrophoretic photograph showing the results of Northern blot analysis of the expression of # 105 and GAPDH in adipocytes to which OnM (control: MOCK), 25 nM, and 250 nM insulin was added.
  • FIG. 5 is an electrophoretic photograph showing the results of detecting the expression of # 104 in various cancer cell lines, adipocytes and 3T3-L1 by Northern blot analysis.
  • a cDNA library was constructed and expressed using the retroviral vector pMX-SST (Kojima. And Kitamura 5 T. (1999) Nature Biotechnol. 17, 487-490).
  • Differentiated ST3-L1 cells were extracted using Fast Track 2.0 mRNA isolation kit (Invitrogen, Lisbad, Calif.) According to the manufacturer's protocol.
  • Complementary DNA (cDNA) was synthesized from poly (A) + RNA using random hexamers using the Superscript 'Thiois' system (Gibco-BRL, Rockville, Maryland, USA).
  • the BstXI adapter was used to insert into the BstXI site of the pMX-SST vector (Invitrogen, Lisbad, CA).
  • the ligated DNA was amplified into DH10B cells (Electromax, Gibco-BRL) and the Qiagen Plasmid kit (Qiagen-Inc, Valencia, CA) was used. To prepare library DNA.
  • a cell line containing a high-potency retrovirus presenting the SST-REX library was packaged (Pear, W. S. et al. (1993) Proc. Natl. Acad. Sci. U. S.A. 90, 839
  • genomic DNA was extracted from factor-independent Ba / F3 clones, subjected to genomic PCR, and the integrated cDNA was recovered using vector primers (GGGG GTGGACCATCCTCTA / SEQ ID NO: 12, and CGCGCAGCTGTAAACGGTAG / sequence). Number: 1 3).
  • GeneAmp PCR System 2400 Perkin Elmer, Norwalk, Conn.
  • LA Taq Polymerase Yukara, Kyoto, Japan
  • the obtained PCR fragments were sequenced using the Taq Dye Mineral One-Day Cycle Sequencing Kit (Applied Biosystems, Inc., Foss Yuichi City, Calif-Ornier) to obtain an automated sequencer (310 Analyzed by Gene Analyzer, Applied'Biosystems, Inc.). We screened 9 ⁇ 10 5 clones. Cells growing in a total of 71 cells out of 1152 cells generated a single PCR band, which was subjected to further analysis. The differentiated 3T3-LI cells used in the experiment were prepared as follows.
  • the 3T 3-L1 cells were cultured in 10% FCS, 50 units / ml penicillin, and 50 ⁇ G / ml Sutorebutoma containing leucine DMEM (DMEM-FCS) 5% C0 2 at 37 ° C in. Cells were grown to confluence and maintained for 2 days. To induce differentiation, the medium was changed to DMEM-FCS containing 0.5 IDM trimethyl-3-isobutylxanthine, 0.25 / M dexamethasone, and 10 ⁇ g / ml insulin. Two days later, the medium was changed to DMEM-; FCS to differentiate the cells.
  • Ba / F3, a mouse IL-3 dependent pre-B cell line was cultured in RPMI 1640 medium containing 10% FCS and 2 ng / ml mouse IL-3 (MD Systems).
  • 63 out of 71 integrants contained the 5 'sequence of the cDNA for 28 known proteins, all of which contained the signal sequence (Table 1).
  • FKBP23 FK506-binding protein
  • Amyloid precursor-like protein 2 (APLP2) 4
  • RNA 1 ⁇ g of poly (A) + RNA is electrophoresed on a 1.0% agarose gel containing 2% formaldehyde, and then transferred to Hybond-N-nylon membrane (Amersham Pharmacia-Biotech). did.
  • Membrane is incubated at 42 ° C in hybridization buffer (50% formamide, 10X Denhardt's reagent, 5x SSC, 0.1% SDS, 200 ⁇ g / ml denatured salmon sperm DNA) at 42 ° C. the 3 2 P- labeled DNA fragments derived from examined as a probe.
  • hybridization buffer 50% formamide, 10X Denhardt's reagent, 5x SSC, 0.1% SDS, 200 ⁇ g / ml denatured salmon sperm DNA
  • One of the membranes was used as a loading control to evaluate the amount of RNA in each lane.
  • the cDNA for hydrogenase (GAPDH) was probed. After hybridization, the filter was washed in
  • Clone # 105 showed two bands.
  • low molecular mass mA was significantly expressed.
  • clone # 103 the only increase in mRNA was sufficient for 3T3-L1 cells to grow to confluence.
  • FIG. 2 The expression profile of the novel adipocyte-derived gene in multiple mouse tissues was examined by Northern plot analysis (FIG. 2).
  • Mouse multi-tissue Northern plots were purchased from Clontech (Palo Alto, CA).
  • Example 5 Daily change of mRNA Northern blot analysis was performed by the usual method (samples in each lane were 3T3-Ll in log phase, 3T3-Ll in confluent state, and 1 to 9 days after induction of adipocyte differentiation) This is 3T3-L1 of the eye, and # 103 to # 106, GAPDH was used as the probe.
  • Northern plot analysis was performed by the usual method.
  • the samples in each lane are control adipocytes, adipocytes supplemented with 25 nM and 250 nM insulin, respectively.
  • # 105, GAPDH was used as a probe.
  • cancer cell lines showed low molecular weight bands and some did not.
  • a gene encoding a novel protein derived from an adipocyte and having a signal sequence is provided. These genes may be important molecules involved in adipocyte differentiation due to their expression characteristics.
  • the protein of the present invention is a target for drug development
  • the compound that regulates the function of the protein of the present invention is expected to be applied as a pharmaceutical.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne 8 nouveaux gènes codant éventuellement pour des membranes ou des protéines solubles, identifiés avec succès par criblage de molécules possédant des peptides de signaux, à l'aide d'un procédé de piégeage de séquence de signaux efficace développé originellement.
PCT/JP2001/001863 2000-03-10 2001-03-09 Genes de souris d'origine adipocyte WO2001066720A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001241080A AU2001241080A1 (en) 2000-03-10 2001-03-09 Mouse adipocyte-origin genes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2000-72502 2000-03-10
JP2000072502 2000-03-10

Publications (1)

Publication Number Publication Date
WO2001066720A1 true WO2001066720A1 (fr) 2001-09-13

Family

ID=18590896

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2001/001863 WO2001066720A1 (fr) 2000-03-10 2001-03-09 Genes de souris d'origine adipocyte

Country Status (2)

Country Link
AU (1) AU2001241080A1 (fr)
WO (1) WO2001066720A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003018805A1 (fr) * 2001-08-23 2003-03-06 Japan Science And Technology Agency Regulateurs de la proliferation de cellules souches hematopoietiques et polynucleotides codant ces regulateurs
EP1703917A2 (fr) * 2003-12-22 2006-09-27 Amgen, Inc. Molecules heh4 et utilisations
US7632935B2 (en) 2002-10-30 2009-12-15 Chungai Seiyaku Kabushiki Kaisha DNA encoding a mast cell-derived membrane protein

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000012708A2 (fr) * 1998-09-01 2000-03-09 Genentech, Inc. Nouveaux pro-polypeptides et sequences correspondantes
WO2000021986A2 (fr) * 1998-10-09 2000-04-20 Incyte Pharmaceuticals, Inc. Genes de remodelage de matrice
WO2000053750A1 (fr) * 1999-03-08 2000-09-14 Genentech, Inc. Compositions et procedes pour le traitement de tumeurs
WO2000063438A2 (fr) * 1999-04-20 2000-10-26 Curagen Corporation Procede de classification d'un carcinome de la thyroide utilisant l'expression genique differentielle

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000012708A2 (fr) * 1998-09-01 2000-03-09 Genentech, Inc. Nouveaux pro-polypeptides et sequences correspondantes
WO2000021986A2 (fr) * 1998-10-09 2000-04-20 Incyte Pharmaceuticals, Inc. Genes de remodelage de matrice
WO2000053750A1 (fr) * 1999-03-08 2000-09-14 Genentech, Inc. Compositions et procedes pour le traitement de tumeurs
WO2000063438A2 (fr) * 1999-04-20 2000-10-26 Curagen Corporation Procede de classification d'un carcinome de la thyroide utilisant l'expression genique differentielle

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003018805A1 (fr) * 2001-08-23 2003-03-06 Japan Science And Technology Agency Regulateurs de la proliferation de cellules souches hematopoietiques et polynucleotides codant ces regulateurs
US7262026B2 (en) 2001-08-23 2007-08-28 Japan Science And Technology Agency Hematopoietic stem cell proliferation regulators and polynucleotides encoding the same
US7632935B2 (en) 2002-10-30 2009-12-15 Chungai Seiyaku Kabushiki Kaisha DNA encoding a mast cell-derived membrane protein
EP1703917A2 (fr) * 2003-12-22 2006-09-27 Amgen, Inc. Molecules heh4 et utilisations
AU2004308908B2 (en) * 2003-12-22 2009-02-26 Amgen Inc. HEH4 molecules and uses thereof

Also Published As

Publication number Publication date
AU2001241080A1 (en) 2001-09-17

Similar Documents

Publication Publication Date Title
JP2020036596A (ja) 新規ヘモポエチン受容体蛋白質、ｎｒ１０
DE60025241T2 (de) HäMOPOIETINREZEPTOR-PROTEIN, NR12
US7829083B2 (en) Antibodies to brain specific membrane protein
WO2002077230A1 (fr) Variants d'epissage nr10
WO2001009315A1 (fr) Nouveau gene participant au maintien de la differenciation des cellules des muscles lisses
JP4838961B2 (ja) トランスポーター遺伝子ｏａｔｐ−ｂ、ｃ、ｄ、およびｅ
US20090197317A1 (en) TSG-Like Gene
US20090275082A1 (en) Mast Cell-Derived Membrane Proteins
WO2001066720A1 (fr) Genes de souris d'origine adipocyte
US20070105143A1 (en) Novel bHLH type transcription factor genes
EP1120426A1 (fr) Nouveaux recepteurs couples a la proteine g
JP4632953B2 (ja) Ｎｋ細胞に発現するタンパク質
JP4590107B2 (ja) 新規胎児性遺伝子
JP2008099690A (ja) 新規ヘモポエチン受容体蛋白質、ｎｒ１２
US7794973B2 (en) YS68 gene involved in primitive hematopoiesis
WO2001012808A1 (fr) Nouveaux genes 584 de la famille frizzled
JP2002000279A (ja) 初期造血に関わるｙｓ６８遺伝子
WO2001083738A1 (fr) Facteur de regulation de differenciation et de determination du sexe
EP1260584A1 (fr) Nouvelle proteine comportant une sequence signal
JP2004267003A (ja) ヒト白血球型抗原領域に存在する新規遺伝子

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 565876

Kind code of ref document: A

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase