WO2001055377A1

WO2001055377A1 - A novel polypeptide, a human zinc finger protein 44 containing rubredoxin characteristic sequence and the polynucleotide encoding the polypeptide

Info

Publication number: WO2001055377A1
Application number: PCT/CN2001/000055
Authority: WO
Inventors: Yumin Mao; Yi Xie
Original assignee: Biodoor Gene Technology Ltd. Shanghai
Priority date: 2000-01-26
Filing date: 2001-01-15
Publication date: 2001-08-02
Also published as: CN1307025A; AU2999101A

Abstract

The present invention discloses a novel polypeptide, a human zinc finger protein 44 containing rubredoxin characteristic sequence, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumour, hemopathy, HIV infection, immunological disease, and various inflammation etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel human zinc finger protein 44 containing rubredoxin characteristic sequence.

Description

A new peptide-a zinc finger protein 44 containing a characteristic sequence of redoxin and a polynucleotide encoding the polypeptide

Technical field

The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a zinc finger protein 44 containing a characteristic sequence of redoxin, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique

Zinc atom-binding domains are found in many proteins, and these proteins are involved in protein-nucleic acid and protein-protein interactions in vivo. Zinc-binding proteins are usually involved in the expression and regulation of genes as transcription factors and signal transduction molecules. Such proteins constitute a large family of proteins, called zinc finger proteins. A zinc atom binding domain usually consists of 25 to 30 amino acid residues, which make up one or more atomic binding sites. The binding of zinc atoms makes the protein fold into certain structural units, and these structures can be well adapted to the interaction between macromolecules (Berg, JM et al., 1996, Sc ience, 271: 1081-1085). ₀ Studies have found that zinc Finger protein is expressed in various tissues of different organisms, including hematopoietic cells, brain, nervous system, various tumor-related tissues, and tissues of immortalized cell lines. It plays an extremely important role in the gene expression process of these tissues.

Zinc finger proteins and their domains can be divided into different categories according to the number and position of their zinc atom binding. The C2H2 type zinc atom binding domain was first obtained in protein transcription factors ΙΠΑ, and it is the most widely distributed DM binding domain among eukaryotic transcription factors. The protein sequence of C2H2 zinc finger protein contains the following conserved sequence features: (Tyr 'Phe) -X-Cys-X (2, 4) -Cys-X3-Phe-X5-Leu-X2-Hi sX (3 , 5) -His (where X represents any amino acid residue; cysteine forms a coordination bond with histidine and a zinc atom, and binds to the zinc atom; the other three conservative amino acid residues form a hydrophobic central region; other Changing amino acid residues are responsible for mediating protein interactions with other molecules). A zinc finger protein may contain one or more zinc finger domains, which independently perform their own physiological functions in the body. In many cases, proteins containing zinc finger domains interact with special double-stranded and single-stranded DNA sequences and act as transcriptional regulators. Existing studies have found that C2H2 type zinc finger domains not only play an important regulatory role in the gene expression process of some tissues, but also play a very critical role in the developmental regulation process.

The members of the zinc finger protein family are widely distributed in organisms, and different types of zinc finger proteins are contained in various tissues. Zinc finger proteins can also be divided into various subfamilies according to their structural characteristics. Kruppel zinc finger proteins form an independent subfamily in the body, and members of this subfamily contain zinc finger motifs that are conserved by the zinc finger protein family, and each motif is connected by a conserved H / C junction region. This region contains a conserved amino acid sequence: TGEKPY / F [Schuh R., Aicher W. Et al., Cel l, 1986, 47: 1025-1032] ₀ In addition, Bel lefroid et al. Pointed out in 1991 that about one-third of the subfamily The member also contains a conserved motif consisting of 75 amino acids at the N-terminus of its protein sequence, and named this motif as a KRAB (Kruppel-as sociated box) domain. This domain is a domain that binds the N-terminus of zinc finger protein to DNA and is highly conserved in evolution [Judi th F. Margol in et al., Proc. Nat l. Acad. Sci. USA, 1994, 91: 4509-4513 ]. This domain is divided into two box structures, A and B, which are rich in changing amino acid residues and form two hydrophilic helices. Some members of the zinc finger protein KRAB subfamily contain both KRAB A-boxes and KRAB B-boxes, and some contain only KRAB A-boxes. The study found that the KRAB domain is a potential transcriptional repression domain, in which a 45-amino-acid hydrophilic helical segment is necessary for transcriptional repression. The substitution of amino acids in the helical structure will weaken the protein's transcriptional repression function, thus Causes dysregulation of gene transcription and triggers various diseases related to development and malignant disorders [N. Tommerup et al., Genomics, 1995, 27: 259-264] _{0 The} KRAB domain in proteins interacts with zinc finger structures to regulate each other Gene expression in vivo. The KRAB domain and the first zinc finger structure also contain a conserved linking region that contains at least one nucleic acid localization signal, which is related to the correct localization and function of the protein.

The novel human protein of the present invention, in addition to the characteristic sequence of the KRAB subfamily of C2H2 zinc finger proteins, also contains a characteristic sequence fragment of a redoxin. Redoxin is an electron transporter in the body. It contains an iron atom and four cysteine residues to form a coordination bond to complete the electron transport process. Its characteristic sequence fragments consist of consensus sequence fragments as shown below:

[LIVMJ -X (3) -W-X-C-P-X-C- [AGD]; where two cysteine residues combine with an iron atom to form a coordination bond. This domain is involved in various physiological and metabolic processes related to electron transport in the body. Abnormal expression of this domain will lead to abnormal function of the protein, which will affect the expression regulation of various related tissue genes and some related material metabolic processes.

The novel human protein of the present invention contains both the characteristic sequence fragment of the Kruppel zinc finger protein subfamily and the characteristic sequence fragment of the red hemoglobin family, so it is a new human zinc finger protein, and Named human zinc finger protein containing characteristic sequence of redoxin. The protein may be highly expressed in related tissues such as the respiratory chain. The protein of the present invention mainly regulates the development of some related tissues by regulating the expression of some genes in the body, and its abnormal expression is related to some developmental disorders of the organism, the occurrence of tumors and cancers in related tissues, and disorders of the respiratory metabolic system. Happen closely related.

As mentioned above, the human zinc finger protein 44 containing the characteristic sequence of redoxin plays an important role in important functions in the body, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art The zinc finger protein 44 protein that contains human redoxin-specific sequences is involved in these processes, and the amino acid sequence of this protein is particularly identified. Newcomer zinc finger protein 44 protein containing characteristic sequence of redoxin The isolation of the coding genes also provides the basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

It is an object of the present invention to provide isolated novel polypeptides-human zinc finger protein 44 containing characteristic sequences of redoxin, and fragments, analogs and derivatives thereof.

Another object of the invention is to provide a polynucleotide encoding the polypeptide.

Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human zinc-redoxin-containing characteristic sequence of zinc finger protein 44.

Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a zinc finger protein 44 sequence characteristic of a human redoxin-containing protein.

Another object of the present invention is to provide a method for producing human zinc finger protein 44 containing a characteristic sequence of redoxin.

Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human zinc finger protein 44 containing a characteristic sequence of redoxin.

Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the zinc finger protein 44 which is a characteristic sequence of human redoxin-containing polypeptides of the polypeptide of the present invention.

Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human zinc finger protein 44 containing characteristic sequences of redoxin.

The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a);

The polynucleotide sequences of (c) and (a) or (b) have at least 70 ° /. Identical polynucleotides.

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 228-1427 in SEQ ID NO: 1; and (b) a sequence having 1-2581 in SEQ ID NO: 1 Sequence of bits.

The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product. The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

The present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human zinc-redoxin-containing zinc finger protein 44 protein sequence, which comprises utilizing the polypeptide of the present invention. The invention also relates to compounds obtained by this method.

The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of zinc finger protein 44 protein containing human redoxin-containing characteristic sequence in vitro, which comprises detecting the polypeptide or a polynucleoside encoded therein in a biological sample. Mutations in the acid sequence, or the amount or biological activity of a polypeptide of the invention in a biological sample.

The present invention also relates to a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

The present invention also relates to the polypeptides and / or polynucleotides of the present invention which are caused by abnormal expression of zinc finger protein 44 in human redoxin-containing characteristic sequences during preparation for use in the treatment of cancer, developmental or immune diseases, or other diseases. Use of medicine for disease.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and a fragment or part thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

"Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

"Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similar The term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.

An "agonist" refers to a molecule that, when combined with zinc finger protein 44 which is a characteristic sequence of human redoxin, causes the protein to change, thereby regulating the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to a zinc finger protein 44 that is characteristic of a human redoxin-containing protein.

"Antagonist" or "inhibitor" refers to a zinc finger that can block or regulate the characteristic sequence of human redoxin-containing protein when combined with zinc finger protein 44 of human redoxin-containing characteristic sequence. A biologically or immunologically active molecule of protein 44. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to a zinc finger protein 44 that is characteristic of a human redoxin-containing protein.

"Regulation" refers to a change in the function of human zinc-redoxin-containing characteristic sequences of zinc finger protein 44, including an increase or decrease in protein activity, a change in binding characteristics, and the characteristic sequence of human red-redoxin-containing sequences. Changes in any other biological, functional or immune properties of zinc finger protein 44.

¹¹ Substantially pure '' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can use standard protein purification techniques to purify human zinc finger protein 44 containing characteristic sequences of redoxin. The substantially pure human zinc finger protein 44 containing characteristic sequences of redoxin can produce a single main band on a non-reducing polyacrylamide gel. The purity of the zinc finger protein 44 polypeptide containing the characteristic sequence of human redoxin can be analyzed by amino acid sequence.

"Complementary" or "complementary" refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244) ₅ The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100

(The number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B) The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by a method known in the art such as Jotun Hein ( Hein J., (1990) Methods in emzumology 183: 625-645).

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

"Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

"Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives encode codes that retain the main biological properties of natural molecules

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and?, Which can specifically bind to the epitope of zinc finger protein 44 which is a characteristic sequence of human redoxin-containing protein.

A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

As used herein, "isolated human zinc finger protein containing a characteristic sequence of redoxin. 4" means human The zinc finger protein 44 containing the characteristic sequence of the redoxin is substantially free of other proteins, lipids, carbohydrates or other substances naturally associated with it. Those skilled in the art can use standard protein purification techniques to purify human zinc finger protein 44 containing characteristic sequences of redoxin. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human zinc-redoxin-containing zinc finger protein 44 polypeptide-containing sequences can be analyzed by amino acid sequence.

The present invention provides a new polypeptide—a human zinc finger protein 44 containing a characteristic sequence of redoxin, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated, or they may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

The invention also includes fragments, derivatives, and analogs of human zinc finger protein 44 containing characteristic sequences of redoxin. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a zinc finger protein 44 that substantially maintains the same biological function or activity of the human reddoxin-containing characteristic sequence of the present invention. Peptide. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) As set forth herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2581 bases, and its open reading frames 228-1427 encode 399 amino acids. This polypeptide has the characteristic sequence of the K2B subfamily of C2H2 type zinc finger proteins. It can be deduced that the zinc finger protein 44 containing the characteristic sequence of redoxin in human has the structure and function represented by the KRAB subfamily of C2H2 type zinc finger proteins.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or it may be degenerate Variant. As used in the present invention, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that encodes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1 1½ calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) the same between the two sequences Crossing occurs only when the sex is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human zinc-redoxin-containing characteristic sequences of zinc finger protein 44.

The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the zinc finger protein 44 of human redoxin-containing characteristic sequence of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from genomic DM; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide. Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRM, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Labora tory Manua 1, Col d Harbor Harbora tory. New York, 1989). Commercially available CDM libraries are also available, such as different CDM libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) determination of human zinc finger protein containing characteristic sequences of redoxin 44 transcript levels; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used singly or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the method (4), the protein product for detecting the expression of the zinc finger protein 44 gene containing the characteristic sequence of human redoxin can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay. (ELISA) and so on.

A method for amplifying DNA / RNA using PCR technology (Sa ik i, et al. Science 1985; 230: 1350-1 354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length CDM from a library, the RACE method (RACE-rapid amplification of cDNA ends) may be preferably used. The primers for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length CDM sequence. The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 coding sequence, and recombinant Technology A method of producing a polypeptide of the invention.

In the present invention, the polynucleotide sequence encoding the zinc finger protein 44 which is a human redoxin-containing characteristic sequence can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Na thans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a characteristic sequence of human red-redoxin-containing zinc finger protein 44 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Labora tory Manua, cold Harbor Harbora tory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRM synthesis. Representative examples of these promoters are: the l ac or trp promoter of E. coli; the lambda phage PL promoter; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters , Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding a human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 or The recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS, or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

By the conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce a recombinant human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 (Scence, 1984; 224: 1431). Generally there are the following steps:

(1) Use the polynucleotide (or variant) of the present invention encoding a human-human red-redoxin-containing characteristic sequence of zinc finger protein 44 or transform or transduce it with a recombinant expression vector containing the polynucleotide A suitable host cell;

(2) culturing host cells in a suitable medium;

(3) Isolate and purify protein from culture medium or cells.

In step (2), the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of the amino acid sequences of the functional domains of the zinc finger protein 44 and C2H2 type zinc finger protein KRAB subfamily containing the characteristic sequence of redoxin of the present inventors.

Figure 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of an isolated human zinc finger protein 44 containing a characteristic sequence of redoxin. 44KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions such as Sambrook et al., Molecular cloning: the conditions described in the laboratory manual (New York: Cold Harbor Harbor Laboratory Press, 1989), or according to the manufacturing conditions Conditions recommended by the manufacturer. Example 1: Cloning of human zinc finger protein 44 containing characteristic sequences of redoxin

Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Quik mRNA Isolat ion Ki t

(Qiegene product) Isolate poly (A) mRNA from total RM. 2ug poly (A) mRNA forms c-ship through reverse transcription. The Smart cDNA Cloning Kit (purchased from Clontech) was used to insert the cDM fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDM sequence was compared with the public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0539a05 was new DNA. The inserted cDM fragments contained in this clone were assayed in both directions by synthesizing a series of primers. The results showed that the 0539a05 clone contained a full-length cDNA of 2581bp (as shown in Seq ID NO: 1), and a 1200bp open reading frame (0RF) from 228bp to 1427bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS- 0539a05, and the encoded protein was named human zinc finger protein containing a characteristic sequence of redoxin 44. Example 2: Domain analysis of cDNA clones

The sequence of the human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 of the present invention and the protein sequence encoded by the same were performed using the profil i le scan program (Basiclocal Alignment search tool) in GCG [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in a database such as Proste. Human zinc finger protein 44 containing characteristic sequence of redoxin of the present invention and domain C2H2 type zinc finger protein KRAB The subfamilies are homologous, and the homology results are shown in Figure 1. Example 3: Cloning of a gene encoding a human zinc-redoxin-containing zinc finger protein 44 gene by RT-PCR using fetal brain cells total RM as a template and 01 i go-dT as a primer for reverse transcription reaction synthesis cDNA, using

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

Pr imerl: 5'- GGGGTCAGTCCCGCGATAGCTTCA -3 '(SEQ ID NO: 3)

Pr iraer2: 5'- GATATACAAAATGATTTTATTAGA -3 '(SEQ ID NO: 4)

Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

Pr iraer2 is the 3'-end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: 50 μl / L KC1, 10 mmol / L Tris s-

Cl, (pH8. 5), 1. 5 leg _{ol / L MgCl 2, 200 μ} mol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech Co.). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72. C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2581bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of human zinc redoxin-containing zinc finger protein 44 gene expression sequence:

Total RNA was extracted in one step [Ana l. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. 20 μ _§ RNA was used for electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (PH7. 0)-5 mM sodium acetate-1 mM EDTA-2. 2M formaldehyde . It was then transferred to a nitrocellulose membrane. ^{32 Ρ} dATP Preparation ^{32 Ρ-} DNA probe labeled by the random primer Method - with α. The DNA probe used was the zinc finger protein 44 coding region sequence (228 bp to 1427 bp) of the human ame redox protein-containing characteristic sequence amplified by PCR as shown in FIG. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7. 4)-5 x SSC-5 x Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0. Γ / oSDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant human zinc finger protein 44 containing characteristic sequences of redoxin, according to the sequence of the coding region shown in SEQ ID NO: 1 and FIG. Primers, the sequence is as follows:

Primer3: 5-CATGCTAGCATGTCTCAGGTGACATTTAGTGAT -3 '(Seq ID No: 5)

Primer4: 5'- CATGGATCCCTAAACTTCAAACGGTTTTTCTTC -3 '(Seq ID No: 6) The 5' ends of these two primers contain Nhel and BamHI digestion sites, respectively, followed by the coding sequences of the 5, 5, and 3 'ends of the target gene. The Nhel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865. 3). PCR was performed using the pBS-0539a05 plasmid containing the full-length target gene as a template. The PCR reaction conditions are as follows: a total volume of 50 μ1 contains pBS-0539a05 plasmid 10pg, primers 1: 1016]: -3 and? ]: 1 [116: 1: -4 points and another!] Is 1 (^ 11101, Advantage polymerase Mix

(Clontech) 1 μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli bacteria M5α using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 μ _§ / ιη1), positive clones were selected by colony PCR method and sequenced. Select positive clones with the correct sequence (pET-0539a05) and transform the recombinant plasmid into E. coli by calcium chloride method

BL21 (DE3) plySs (product of Novagen). In LB liquid culture medium containing kanamycin (final concentration 30 μg / ml), the host strain BL21 (pET-0539a05) was 37. C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue incubating for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. Chromatography was performed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified human protein zinc finger protein 44 containing the characteristic sequence of redoxin was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 44 KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-human zinc finger protein 44 containing characteristic sequences of redoxin

A peptide synthesizer (product of PE company) was used to synthesize the following human zinc-redoxin-containing characteristic sequences of zinc finger protein 44-specific peptides:

NH2-Met-Ser-Gln-Val-Thr-Phe-Ser-Asp-Val-Ala-I le-Asp-Phe-Ser-His-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immimochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. 15 g / ml bovine serum albumin peptide complex-coated titer plate for ELISA for rabbit serum determination The titer of the antibody. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to the zinc finger protein 44 of human redoxin-containing characteristic sequence. Example 7: Use of a polynucleotide fragment of the present invention as a hybridization probe

Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

3. There should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as preliminary selection probes, and then further computer sequence analysis, including the preliminary selection The selected probes are compared for homology with their source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions. If the homology with the non-target molecular region is greater than 85% or more than 15% Two consecutive bases are completely the same, the primary probe should generally not be used;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

After completing the above analysis, select and synthesize the following two probes:

Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

5'- TGTCTCAGGTGACATTTAGTGATGTGGCTATAGACTTCTCT -3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment or its complementary fragment (41Nt) of SEQ ID NO: 1:

5'- TGTCTCAGGTGACATTTAGTCATGTGGCTATAGACTTCTCT -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA (USA) ) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) cold homogenization buffer (0.25raol / L sucrose; leg 25 ol / L Tris-HCl, pH7.5 ; 25mmol / LnaCl; 25mmol / L MgCl 2) was suspended precipitate (approximately 10ml / g). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (l-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the initial tissue sample), and then follow the following phenol extraction method.

2, DM phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1GGGg for 10 minutes. 2) with cold cell lysate pelleted cells were resuspended (1 X 10 ⁸ cells / ml) Minimum application lOOul lysis buffer. 3) Add SDS to a final concentration of 1 ° /. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

Steps: 1) Chill 1/10 volume of 2mol / L sodium acetate and 2 times volume by 100 ° /. Add ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper while gradually increasing TE, mix until the DNA is fully lysed, and add approximately 1 ul per 1-5 x 10 ^δ cells.

The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml, respectively. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2raol / L sodium acetate and 2.5 volume of cold ethanol, mix and let stand at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A _28fl to detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

Preparation of sample film:

1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe for later experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

3) Place on filter paper impregnated with Q. Imol / LNaOH, 1.5raol / LNaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5mol / L Tris-HCl (pH7.0), 3mol / LNaCl Allow to dry for 5 minutes (twice).

4) Clamp in clean filter paper, wrap with aluminum foil, and dry at 60-S0 ° C for 2 hours.

Labeling of probes

1) 3 μl Probe (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

2) Incubate at 37 ° C for 2 hours. 3) Add 1/5 volume of bromophenol blue indicator (BPB).

4) Pass Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (moni tor can be used for monitoring).

6) 5 drops / tube, collect 10-15 tubes.

7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared. Pre-hybridization

Place the sample membrane in a plastic bag, add 3-1 Omg pre-hybridization solution (l OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA).), Seal the bag, 68 ° C Shui Luo shake for 2 hours.

Cross

Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C in water overnight.

Wash film:

High-intensity washing film:

1) Take out the hybridized sample membrane.

2) 2xSSC, 0. P / oSDS, 40. C Wash for 15 minutes (twice).

3) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

4) 0.1xSSC, 0.1 ° /. SDS, 55. Wash for 30 minutes (twice) and dry at room temperature.

Low-intensity washing film:

1) Take out the hybridized sample membrane.

2) 2xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

3) Wash in 0.1xSSC, 0.125SDS at 37 ° C for 15 minutes (twice).

4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray autoradiography:

-70 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

Experimental results:

的 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. To the radioactive intensity of the hybridization spot of another probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Example 8 DNA Mi croarray

Gene microarrays or DNA microarrays are currently used by many national laboratories and large pharmaceutical companies. The company is working on a new technology developed and developed, which refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, silicon and other carriers, and then uses fluorescence detection and computer software to compare and analyze data. In order to achieve the purpose of fast, efficient and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature, for example, see the literature DeRi si, JL, Lyer, V. & Brown, P. 0.

(1997) Science 278 ₅ 680-686. And documents Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

(A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated, dried, and cross-linked in an ultraviolet cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been reported in the literature, and the post-spot processing steps of this embodiment are:

1. Hydration in a humid environment for 4 hours;

2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaB is blocked for 5 minutes;

5. 95 ° C water for 2 minutes;

6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

8. Dry and store at 25 ° C in the dark for future use.

(Two) probe marking

Total mRNA was extracted from normal liver and liver cancer in one step, and mRM was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP (5- Amino- propargyl-2'- deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label mRNA of normal liver tissue. Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5 '-triphate coupled to Cy5 f luorescent) was used as a fluorescent reagent. Dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see:

Schena, M., Shalon, D., Heller, R. (1996) Proc. Nat l. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dar i., Davi s, RW (1995) Science. 270. (20): 467-480. (3) Hybridization

The probes from the two types of tissues and the chip were hybridized in a UniHyb ™ Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and then washed with a washing solution (lx SSC, 0.2 SDS) at room temperature before use. ScanArray 3000 scanner (purchased from General Scanning Company, USA) was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The ratio was less than 0.5 and greater than 2. The dots are considered to be genes with differential expression.

The experimental results show that Cy3 signal = 2943. 1 (take the average of four experiments), Cy5s ignal = 3256. 54 (take the average of four experiments), Cy3 / Cy5 = 0. 90375, the polynucleoside of the present invention There was no significant difference in the expression of acid in the above two tissues. Industrial applicability

The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases. Zinc-binding proteins are usually involved in gene expression and regulation as transcription factors and signal transduction molecules. Zinc finger proteins are expressed in various tissues of different organisms, including hematopoietic cells, brain, nervous system, various tumors and tumors. Related tissues and tissues of immortalized cell lines. The protein containing C2H2 type zinc finger domain not only plays an important role in regulating gene expression in some tissues, but also plays a very important role in developmental regulation. The Kruppel-type zinc finger proteins containing the KRAB domain constitute a subfamily. The KRAB domain is related to the correct localization and function of the protein.

Studies have found that some proteins containing C2H2 type zinc finger domains are related to the following diseases: solid tumors such as thyroid adenoma, uterine fibroids, neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia, nerve cells Tumors, glioblastomas, hematological malignancies such as leukemia, non-Hodgkin's lymphoma, developmental disorders such as Williams syndrome, cleft-hand and cleft foot disease, Bayer's syndrome, other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.

The polypeptide of the present invention is a C2H2 type zinc finger protein containing a KRAB domain, and at the same time, it also contains a characteristic sequence fragment of a redoxin family. The physiological metabolic process affects the metabolism of matter and energy.

It can be seen that the expression of the zinc finger protein 44 containing the characteristic sequence of human redoxin of the present invention is different. It will often produce various diseases, especially solid tumors, neurological diseases, hematological malignancies, developmental disorders, other tumors, and diseases related to material and energy metabolism. These diseases include but are not limited to:

Tumors of various tissues: thyroid tumors, uterine fibroids, neuroblastomas, ependymoma, colon cancer, breast cancer, leukemia, lymphoma, malignant histiocytosis, melanoma, sarcoma, myeloma, teratoma , Adrenal cancer, bladder cancer, bone cancer, bone marrow cancer, brain cancer, uterine cancer, gallbladder cancer, liver cancer, lung cancer, thymic tumor

Developmental disorders: extrapyramidal dysfunction, teratology, Wi l liams syndrome, Alagi l le syndrome, cleft foot and cleft foot disease, and Bayer syndrome

Neurological disorders: Parkinson's syndrome, ataxia, neuroblastoma, glioblastoma

Hematological malignancies: Leukemia, non-Hodgkin's lymphoma

Substance and energy metabolism related diseases: isovalerate, propionate, methylmalonic aciduria, combined carboxylase deficiency, glutarate type I, phenylketonuria, albinism, tryptophan Disease, glycinemia

Abnormal expression of the zinc finger protein 44 containing the characteristic sequence of redoxin of the present invention will also cause certain genetic diseases, endocrine system diseases such as endocrine adenoma, and immune system diseases.

The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially solid tumors, neurological diseases, hematological malignant diseases, developmental disorders, and other tumors. Diseases related to substances and energy, certain genetic diseases, diseases of the endocrine system such as endocrine adenomas, diseases of the immune system, etc.

The invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human zinc redoxin-containing characteristic sequences of zinc finger protein 44. Agonists increase human zinc finger protein containing characteristic sequences of redoxin 44 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, in the presence of a drug, a mammalian cell or a membrane preparation expressing human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 and a labeled human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 Cultivate together. The ability of the drug to increase or suppress this interaction is then determined.

Antagonists of human zinc finger protein 44 containing characteristic sequences of redoxin include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human zinc finger protein 44 containing characteristic sequences of redoxin can bind to human zinc finger protein 44 characteristic sequences of redoxin and eliminate its function, or inhibit the production of the polypeptide, or It is the binding to the active site of the polypeptide that makes the polypeptide unable to perform biological functions.

When screening compounds as antagonists, zinc finger protein 44, which is a human redoxin-containing redox characteristic sequence, may be added to the bioanalytical assay, and the human redox redoxin characteristic sequence may be determined by determining the compound. The effect of the interaction between zinc finger protein 44 and its receptor to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human zinc-redoxin-containing characteristic sequences of zinc finger protein 44 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the zinc finger protein 44 molecule containing the characteristic sequence of human redoxin should generally be labeled.

The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against a zinc finger protein 44 epitope containing a characteristic sequence of human redoxin. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting human zinc finger protein containing the characteristic sequence of redoxin 44 into human immunized animals (such as rabbits, mice, rats, etc.). Various adjuvants can be used to enhance the immune response. , Including but not limited to Freund's adjuvant. Techniques for preparing human monoclonal antibodies to zinc finger protein 44 containing characteristic sequences of redoxin include but are not limited to hybridoma technology (Kohler and 'Miste in. Nature, 1975, 256: 495-497), three Tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human zinc finger protein 44 containing the characteristic sequence of redoxin.

Antibodies against human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 can be used in immunohistochemical techniques to detect human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 in biopsy specimens.

Monoclonal antibodies that bind to zinc finger protein 44, a characteristic sequence of human redoxin, can also be labeled with radioisotopes, and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human zinc finger protein containing a characteristic sequence of redoxin 44 has a high affinity monoclonal antibody that can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as -SPDP, and toxins are bound to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human redoxin-containing redox proteins. Sex sequence of zinc finger protein 44 positive cells.

The antibodies of the present invention can be used to treat or prevent diseases related to zinc finger protein 44 containing human redoxin-containing characteristic sequences. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human zinc finger protein 44 containing a characteristic sequence of redoxin. The present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of zinc finger protein 44 containing a characteristic sequence of human redoxin. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of zinc finger protein 44 containing the characteristic sequence of human redoxin detected in the test can be used to explain the importance of the zinc finger protein 44 of characteristic sequence of human redoxin in various diseases and It is used to diagnose a disease in which zinc finger protein 44 containing a characteristic sequence of human redoxin functions. .

The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.

Polynucleotides encoding the zinc finger protein 44 sequence characteristic of human redoxin-containing proteins can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of zinc finger protein 44 containing human redoxin-containing characteristic sequences. Recombinant gene therapy vectors (such as viral vectors) can be designed to express a variant human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 to inhibit endogenous human red-redoxin-specific sequences. Zinc finger protein 44 activity. For example, a variant human zinc finger protein with a characteristic sequence of redoxin 44 may be a shortened human zinc finger protein with a characteristic sequence of redoxin 44 that lacks a signaling domain, although Can bind to downstream substrates, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of zinc finger protein 44 containing characteristic sequences of redoxin in humans. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding zinc finger protein 44 that is characteristic of human redoxin-containing sequences Into the cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding human zinc redoxin-containing characteristic zinc finger protein 44 can be found in the existing literature (Sambrook, et al.). In addition, a polynucleotide encoding human zinc finger protein 44 containing a characteristic sequence of redoxin can be packaged into liposomes and transferred into cells.

Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human zinc finger protein 44 mRNA containing characteristic sequences of redoxin are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation. Antisense RNA and DNA and ribozymes can be obtained by any RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. To increase the stability of a nucleic acid molecule, it can be performed in a variety of ways. Modifications, such as increasing the sequence length on both sides, link the ribonucleosides with phosphorothioate or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding the zinc finger protein 44 characteristic sequence of human redoxin is useful for diagnosis of diseases related to the zinc finger protein 44 characteristic of human redoxin. A polynucleotide encoding a human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 can be used to detect the expression of human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 or human redness in a disease state Abnormal expression of zinc finger protein 44, a characteristic sequence of avidin. For example, the DNA sequence encoding the human zinc redox protein-containing characteristic sequence of zinc finger protein 44 can be used to hybridize biopsy specimens to determine the expression status of human zinc redox protein-containing characteristic sequence of zinc finger protein 44. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array (Mi croar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues . RM-polymerase chain reaction (RT-PCR) in vitro amplification using human zinc finger protein containing characteristic sequence of zinc redoxin 44 specific primers can also detect human zinc finger protein containing characteristic sequence of redox redoxin 44 transcripts.

Mutations in the zinc finger protein 44 gene characteristic of human redoxin-containing sequences can also be used to diagnose human zinc finger protein 44-specific zinc finger protein-related diseases. Human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 mutant forms include point mutations, translocations, deletions compared to normal wild-type human zinc-redoxin-containing characteristic zinc finger protein 44 DNA sequences , Reorganization, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

In short, PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome can be utilized Or a large number of genomic clones to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manu l of Basic Techniques, Pergamon Pres s, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human zinc finger protein containing a characteristic sequence of redoxin 44 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of zinc finger protein 44 containing the characteristic sequence of redoxin in humans administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Request for Profit

1. An isolated polypeptide-human zinc finger protein containing a characteristic sequence of redoxin 44, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment of the polypeptide , Analogs or derivatives.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

(b) a polynucleotide complementary to polynucleotide (a); or

(c) A polynucleotide that is at least 70% identical to (a) or (b).

5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence at positions 228-1427 in SEQ ID NO: 1 or a sequence at positions 1-2581 in SEQ ID NO: 1. .

7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from a polynucleotide, a plasmid, a virus or a vector expression vector according to any one of claims 4-6. Recombinant vector.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

(a) a host cell transformed or transduced with the recombinant vector of claim 7; or

(b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having zinc finger protein 44 activity characteristic of a human redoxin-containing sequence, characterized in that the method comprises:

(a) culturing the engineered host cell according to claim 8 under the condition of expressing zinc finger protein 44 containing human redoxin-specific sequences;

(b) Isolating a polypeptide having human zinc-redoxin-containing characteristic sequence of zinc finger protein 44 from the culture. '

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human zinc finger protein 44 containing a characteristic sequence of redoxin.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they mimic, promote, and antagonize A compound that inhibits or inhibits the activity of human zinc finger protein 44 containing a characteristic sequence of redoxin.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. The use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human zinc-containing protein redoxin-containing characteristic sequence of zinc finger protein 44 in vivo and in vitro.

14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. The use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, and antagonists of zinc finger protein 44 containing human redoxin-containing characteristic sequences. Agents or inhibitors; or for peptide fingerprinting.

16. The use of a nucleic acid molecule as claimed in any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used to make a gene Chip or microarray.

17. Use of a polypeptide, polynucleotide or compound as claimed in any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose and a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of zinc finger protein 44 containing a characteristic sequence of human redoxin.

18. Use of a polypeptide, polynucleotide or compound as claimed in any one of claims 1 to 6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor , Blood diseases, infections and immune diseases and drugs of various inflammations.