WO2001051610A1 - Production de cellules ectodermiques - Google Patents

Production de cellules ectodermiques Download PDF

Info

Publication number
WO2001051610A1
WO2001051610A1 PCT/AU2001/000029 AU0100029W WO0151610A1 WO 2001051610 A1 WO2001051610 A1 WO 2001051610A1 AU 0100029 W AU0100029 W AU 0100029W WO 0151610 A1 WO0151610 A1 WO 0151610A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
expression
ectoderm
dee
ebm
Prior art date
Application number
PCT/AU2001/000029
Other languages
English (en)
Inventor
Catherine Luisa Orana Long
Peter David Rathjen
Joy Rathjen
Original Assignee
Bresagen Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AUPQ5098A external-priority patent/AUPQ509800A0/en
Priority claimed from AUPQ7045A external-priority patent/AUPQ704500A0/en
Priority claimed from AUPQ7143A external-priority patent/AUPQ714300A0/en
Application filed by Bresagen Limited filed Critical Bresagen Limited
Priority to AU2001226543A priority Critical patent/AU2001226543A1/en
Publication of WO2001051610A1 publication Critical patent/WO2001051610A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0622—Glial cells, e.g. astrocytes, oligodendrocytes; Schwann cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0619—Neurons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/05—Inorganic components
    • C12N2500/10—Metals; Metal chelators
    • C12N2500/20—Transition metals
    • C12N2500/24—Iron; Fe chelators; Transferrin
    • C12N2500/25—Insulin-transferrin; Insulin-transferrin-selenium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/11—Epidermal growth factor [EGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/155—Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60—Transcription factors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/14—Coculture with; Conditioned medium produced by hepatocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells

Definitions

  • the present invention relates to definitive ectoderm equivalent cells produced in vitro, to marker genes, including novel marker genes, for definitive ectoderm and to differentiated cells or partially differentiated cells derived therefrom.
  • the present invention also relates to methods of producing, differentiating and culturing the cells of the present invention, and to uses thereof.
  • dpc post coitum
  • the outer, surviving cells, or early primitive ectoderm continue to proliferate and by 6.0-6.5 dpc have formed a pseudo-stratified epithelial layer of pluripotent cells, termed the primitive or embryonic ectoderm.
  • Primitive ectoderm cells are pluripotent, and distinct from cells of the ICM, giving rise to the germ cells and acting as a substrate for the generation of the primary germ layers of the embryo proper (mesoderm, endoderm and ectoderm) and the extra-embryonic mesoderm during gastrulation.
  • dpc pluripotent cells exposed to the blastocoelic cavity have differentiated to form primitive endoderm.
  • the primitive endoderm gives rise to two distinct endodermal cell populations, visceral endoderm, which remains in contact with the epiblast, and parietal endoderm, which migrates away from the pluripotent cells to form a layer of endoderm adjacent to the trophectoderm. Formation of these endodermal layers is coincident with the formation of primitive ectoderm and the creation of an inner cavity.
  • formation of the blastocyst including development of ICM cells and their progression to pluripotent cells of the primitive ectoderm and subsequent differentiation to form the embryonic germ layers, follow a similar developmental process.
  • the transition of ICM cells to primitive ectoderm represents a differentiation event whereby the cell population which comprises the primitive ectoderm is distinct from that of the ICM.
  • Cells of the primitive ectoderm are no longer totipotent, being limited in their differentiation potential in that they are unable to form some extra-embryonic lineages, such as trophectoderm (Gardner and Rossant 1979).
  • the primitive ectoderm exhibits a higher rate of cell division than the ICM (Snow 1977) and the repertoire of genes expressed is distinct.
  • Rex1 and Gbx2 are expressed exclusively in the ICM (Chapman et al. 1997; Rogers et al. 1991) whereas Fgf5 is up regulated upon conversion to primitive ectoderm (Haub and Goldfarb 1991 ; Hebert et al. 1991).
  • the primitive ectoderm is converted into a trilaminar structure, consisting of ectoderm, mesoderm and an inner layer of endoderm.
  • These primary germ layers form a variety of tissues which embody the basic design of the foetus.
  • the onset of gastrulation is marked by appearance of the primitive streak at 6.5 dpc in the primitive ectoderm.
  • the mesodermal cells emerging from the primitive streak migrate laterally towards the anterior end of the embryo between the epiblast basal surface and the visceral endoderm. It is the differentiation of this mesoderm germ layer which results in the formation of vertebrae, ribs, dermis, kidney and muscle tissues in the developing foetus and adult.
  • Neurectoderm is the progenitor tissue of the central and peripheral nervous system and is generated from cells in the dorsal region of the definitive ectoderm (Weinstein et al. 1997). Neuralization is initiated at 7.5 dpc when the ectoderm in this region becomes flattened and develops a thick ridge around its periphery to form the neural plate.
  • the neural tube is produced by an infolding of the neural plate, whose lateral margins meet and then fuse at the dorsal mid-line. At the time of closure, the neural tube consists of a single layer of neuroepithelial cells which forms neural precursor cells and the neural crest. Together, these cells constitute the predecessors of the nervous system (Beddington 1983).
  • EPL early primitive ectoderm-like cells formed in suspension culture in the presence of factors in a conditioned medium MEDII, for a time insufficient to form neurectoderm cells
  • MEDII conditioned medium MEDII
  • Definitive ectoderm cells express lower levels of Oct4 than pluripotent cells, and do not express neural lineage markers.
  • a method for preparing definitive ectoderm equivalent (DEE) cells in vitro which method includes providing a source of early primitive ectoderm-like (EPL) cells; and a conditioned medium as hereinafter described; or an extract therefrom exhibiting neural inducing properties; and culturing the EPL cells in the conditioned medium or extract for a time sufficient to permit controlled differentiation to definitive ectoderm equivalent cells.
  • EPL early primitive ectoderm-like
  • ES cells may be cultured as aggregates on non-gelatinised bacterial dishes in incomplete ES cell media supplemented with conditioned media, e.g. 50% MEDII for seven days.
  • conditioned media e.g. 50% MEDII for seven days.
  • the Embryoid Bodies cultured in MEDII (EBMs) may be passaged, e.g. every 3-4 days and the conditioned medium replenished e.g. every second day.
  • Day 0 (EBM°) represents undifferentiated ES cells. Gene expression is assayed daily.
  • DEE definitive ectoderm equivalent
  • conditioned medium includes within its scope a fraction thereof including medium components below approximately 5 kDa, and/or a fraction thereof including medium components above approximately 10 kDa
  • the conditioned medium is prepared using a hepatic or hepatoma cell or cell line, more preferably a human hepatocellular carcinoma cell line such as Hep G2 cells (ATCC HB-8065) or Hepa-1c1c-7 cells (ATCC CRL- 2026), primary embryonic mouse liver cells, primary adult mouse liver cells, or primary chicken liver cells, or an extraembryonic endodermal cell or cell line such as the cell lines END-2 and PYS-2.
  • the biologically active factor may be isolated from a medium conditioned by liver or other cells from any appropriate species, preferably mammalian or avian.
  • the activity may also be derived by contributions from two or more different conditioned media from cells which express one or the other of the components.
  • the conditioned medium MEDII is particularly preferred.
  • neural inducing extract from the conditioned medium may be used in place of the conditioned medium.
  • neural inducing extract includes within its scope a natural or synthetic molecule or molecules which exhibit(s) similar biological activity, e.g. a molecule or molecules which compete with molecules within the conditioned medium that bind to a receptor on EPL cells responsible for neural induction.
  • the method may include the preliminary steps of including providing a source of pluripotent cells, a source of a biologically active factor including a low molecular weight component selected from the group consisting of proline and peptides including proline and functionally active fragments and analogues thereof; and a large molecular weight component selected from the group consisting of extracellular matrix proteins and functionally active fragments or analogues thereof, or the low or large molecular weight component thereof; and contacting the pluripotent cells with the biologically active factor, or the large or low molecular weight component thereof, or the conditioned medium, or the extracellular matrix and/or the low molecular weight component, to produce early primitive ectoderm-like (EPL) cells.
  • EPL early primitive ectoderm-like
  • the source of the biologically active factor includes a partially or substantially purified form of the biologically active factor, a conditioned medium including the low and/or large molecular weight component thereof; or an extracellular matrix including at least a large molecular weight component thereof, as described in WO99/53021.
  • the pluripotent cells from which the EPL cells may be derived may be selected from one or more of the group consisting of embryonic stem (ES) cells, in vivo or in vitro derived ICM/epiblast, in vivo or in vitro derived primitive ectoderm, primordial germ cells, EG cells, teratocarcinoma cells, EC cells, and pluripotent cells derived by dedifferentiation or by nuclear transfer. EPL cells may also be derived from differentiated cells by dedifferentiation.
  • ES embryonic stem
  • ICM/epiblast in vivo or in vitro derived primitive ectoderm
  • primordial germ cells primordial germ cells
  • EG cells teratocarcinoma cells
  • EC cells teratocarcinoma cells
  • pluripotent cells derived by dedifferentiation or by nuclear transfer.
  • EPL cells may also be derived from differentiated cells by dedifferentiation.
  • the step of contacting the pluripotent cells with the biologically active factor, etc. to produce EPL cells may be conducted in any suitable manner.
  • EPL cells may be generated in adherent culture or as cell aggregates in suspension culture. It is particularly preferred that the EPL cells are produced in suspension culture in a culture medium such as Dulbecco's Modified Eagles Medium (DMEM), supplemented with the biologically active factor etc. It is also preferred that there is little or no disruption of cell to cell contact (i.e. trypsinisation).
  • DMEM Dulbecco's Modified Eagles Medium
  • the method includes the further step of identifying the DEE cells by procedures including gene expression profiles and differentiation potential.
  • EPL cells to DEE cells may be characterised by down regulation of Oct4 expression relative to embryonic stem (ES) cells; substantial absence of neurectoderm marker expression; and up regulation of expression of DEE marker genes as hereinafter described.
  • EPL cells to DEE cells may be further characterised by a substantial absence of Rex, an ES cell marker.
  • Specific gene expression profiles identified a period between EBM 5 and EBM 7 , corresponding to the loss of high Oct4 gene expression at day 5 and up regulation of expression of the neurectoderm marker Sox1, at day 7, in which a definitive ectoderm-like cell population may be present.
  • DEE definitive ectoderm equivalent
  • the novel intermediate cell population formed during the differentiation of early primitive ectoderm-like (EPL) cells to neurectoderm in vitro is representative of embryonic definitive ectoderm.
  • the DEE cell may be further characterised in being capable of differentiation into neurectoderm or surface ectoderm cells, but not mesoderm cells.
  • the in vitro differentiation system represents a model of the ICM to neurectoderm transition in vivo.
  • Specific gene expression profiles of the entire transition period examined by Northern blot, RNase protection and in situ hybridisation analysis identified a period of 2/3 days, between the loss of high Oct4 gene expression at day 5 and the up regulation of the earliest known neurectodermal marker Sox1, at day 7, in which transition to a novel intermediate cell population was postulated.
  • the definitive ectoderm equivalent (DEE) cell may accordingly exhibit down regulation of Oct4 expression relative to ES cells; substantial absence of neurectoderm marker expression; and expression of DEE marker genes.
  • Applicant has for the first time identified marker genes, including novel marker genes, for definitive ectoderm. Accordingly, in a further aspect of the present invention, there is provided a marker gene for embryonic definitive ectoderm or a definitive ectoderm equivalent (DEE) cell. Each marker gene may exhibit expression in DEE cells. Each marker gene may exhibit up regulation of expression on day 4, 5 or 6 after initiation of culturing of ES cells in conditioned medium, as hereinbefore described, and/or down regulation of expression on day 7 or 8 after initiation of culturing.
  • DEE definitive ectoderm equivalent
  • the DEE marker gene is selected from one or more of the group consisting of known genes including CD24Q, DBI, Rp123, and novel genes A1712, A17113A, A091 , A191 , A193 and A205 and gene products thereof, and functionally active fragments or analogues thereof, and molecules which compete therewith for biological activity.
  • a gene sequence selected from one or more of the group consisting of A1712, A17113A, A091 , A191 , A193 and A205 and functionally active fragments or analogues thereof and molecules which compete therewith for biological activity.
  • the gene markers described herein may be isolated by screening for specific transcripts with expression within the definitive ectoderm cell population postulated to be present during days 5-7, preferably excluding transcripts expressed in ES, EPL and neurectoderm cells. In order to achieve this, the gene expression of EBM 0 to EBM 9 may be compared by ddPCR.
  • the EBM 0"9 series was generated and is described in detail below.
  • RNA samples may be reverse transcribed with an anchored oligo-dTi2 primer and first strand cDNA was PCR amplified with the oligo-dT-j2 primer in combination with one of the six different arbitrary 5' primers (OPERON primer kits OPA and OPB).
  • Figures 4, 5 and 6 below show the ddPCR profile of EBM 0"9 using the OPB-07, OPB-09 and OPA-17 5' oligonucleotides respectively.
  • Each duplicated banding profile was generated from independent reverse transcriptions, demonstrating consistency in amplification and detection of differential gene expression during differentiation.
  • samples were re-run on a second denaturing gel and displayed the same expression profiles (data not shown). Amplified products were labelled according to the arbitrary 5' primer used (kit "A" or "B” and oligo number) and the differentially expressed band number on the gel.
  • the banding profile of individual transcripts may be grouped into distinct classes of expression patterns.
  • transcripts are therefore likely to represent housekeeping genes.
  • Class III and class IV products were selected for further analysis and are denoted by asterisks in Figure 7 and Figure 8. While up regulation of class III products at day 2 or 3 did not coincide with the putative definitive ectoderm, three class III products (A091 , A193 and B078) were down regulated at day 7, providing a potential marker for late definitive ectoderm.
  • Class IV transcripts are predicted to be up regulated within ectoderm but not EPL cells and were segregated into three subclasses (Figure 8).
  • Products B072 ( Figure 4), B094, B095, B099, B0910 ( Figure 5), A175, A1712 ( Figure 6) and A208 (not shown) comprised subclass IV(i) and were upregulated in EBM 4 .
  • Subclass IV(ii) consisted of mRNA transcripts up regulated at day 5.
  • A191 , A194 (Figure 9), B074 ( Figure 4), A204 (not shown) and A1715 ( Figure 6) were up regulated at day 5 and remained expressed throughout the time course ( Figure 9).
  • A191 was cloned as a representative of this group.
  • A1711 ( Figure 6) was detected at low levels in EBM 5 to EBM 7 and was also cloned.
  • neurontoderm refers to undifferentiated neural progenitor cells substantially equivalent to cell populations comprising the neural plate and/or neural tube.
  • Neurectoderm cells referred to herein retain the capacity to differentiate into all neural lineages, including neurons and glia of the central nervous system, and neural crest cells able to form all cell types of the peripheral nervous system.
  • the step of contacting the EPL cells with the conditioned medium may be conducted in any suitable manner.
  • definitive ectoderm cells may be generated in adherent culture or as cell aggregates in suspension culture.
  • the neurectoderm cells are produced in suspension culture in a culture medium such as DMEM, supplemented with the biologically active factor etc.
  • the cells are cultured for approximately 1 to 7 days, more preferably approximately 4 to 6 days.
  • a conditioned medium as hereinbefore described may be used to derive and maintain the definitive ectoderm cells or the conditioned medium may be fractionated to yield an extract therefrom exhibiting neural inducing properties, which may be added alone or in combination to other media to provide the neurectoderm cell deriving medium.
  • the conditioned medium may be used undiluted or diluted (e.g. approx. 10-80%, preferably approximately 40-60%, more preferably approximately 50%).
  • a method for selectively producing neurectoderm cells or surface ectoderm cells from DEE cells which method includes providing a source of DEE cells as hereinbefore described, and a suitable culture medium; a growth factor capable of promoting development of surface ectoderm; and further culturing the DEE cells in the presence or absence of the growth factor, and optionally in the presence of additional growth factors and/or differentiation agents, to produce, in the presence of the growth factor, surface ectoderm cells, and in the absence of the growth factor, neurectoderm cells.
  • the method according to this aspect of the present invention is supportive of a 'default' model of neural induction recently proposed which states that neuralization of definitive ectoderm results from the inhibition of an epidermal inductive signal (Weinstein and Hemmati-Brivanlou 1999).
  • the growth factor capable of inducing development of surface ectoderm may be a member of the transforming growth factor or epidermal growth factor families.
  • TGF- ⁇ Transforming Growth Factor- ⁇
  • BMP4 Bone Morphogenetic Protein 4
  • BMP2 Bone Morphogenetic Protein 2
  • Activin may be used.
  • EGF Epidermal Growth Factor
  • epidermal growth factor members of the epidermal growth factor family which may be used include epidermal growth factor (EGF), TGF- ⁇ and ⁇ -cellulin.
  • the effect of the growth factor, e.g. BMP4 on differentiation of the definitive ectoderm cell population in vitro may be ascertained by: a) morphological alterations in differentiated cells, b) relative effect on neuron formation, c) induction of surface ectoderm markers within the differentiated tissue and (d) down regulation of neurectodermal/neural markers within the differentiated tissue.
  • the concentration of the growth factor when present is preferably in the range approximately 1 to 100 ng/ml, more preferably approximately 5 to 50 ng/ml.
  • the concentration of the BMP4 growth factor may, for example, be of the order of 10 ng/ml.
  • concentration of the EGF growth factor may, for example, be of the order of 10 ng/ml.
  • both growth factors may be included, e.g. at similar concentrations.
  • EBM 6 which were determined to be the most likely population to represent definitive ectoderm, were cultured in the presence of the exogenous factors with aggregates and differentiated products examined morphologically until day 12. The relative formation of neurectoderm and surface ectoderm was assayed by expression of marker genes that distinguish these populations.
  • the neurectoderm cells so formed may in turn differentiate to form neuronal cells such as neurons and glia with high frequency.
  • the step of further culturing the DEE cells in the presence or absence of a growth factor and in the presence of additional growth factors and/or differentiation agents may be conducted in any suitable manner.
  • the cellular aggregates are removed from FCS and then cultured in the presence or absence of a growth factor in the presence of additional growth factors and/or differentiation agents, and in the absence of the conditioned medium.
  • differentiated cells may be generated in adherent culture or as cell aggregates in adherent culture.
  • the differentiated cells are produced in suspension culture in a suitable culture medium, e.g. containing insulin, transferrin and/or sodium selenite, such as DMEM: Ham's F12 nutrient mixture (F12), supplemented additional growth factors and/or differentiation agents and optionally with the growth factor.
  • a suitable culture medium e.g. containing insulin, transferrin and/or sodium selenite, such as DMEM: Ham's F12 nutrient mixture (F12), supplemented additional growth factors and/or differentiation agents and optionally with the growth factor.
  • the suitable culture medium may contain approximately 50:50 DMEM:F12.
  • the cells are cultured for approximately a further 1 to 10 days, more preferably approximately 1 to 5 days.
  • a surface ectoderm cell derived in vitro and characterised by two or more of early epidermal-like morphology; expression of Keratin 18 (K18); and/or expression of Keratin 14 (K14); substantial absence of expression of Sox1 and nestin.
  • a method for producing genetically modified definitive ectoderm equivalent (DEE) cells which method includes providing a source of early primitive ectoderm-like (EPL) cells; and a conditioned medium as hereinbefore defined; or an extract therefrom exhibiting neural inducing properties; and culturing the EPL cells in the conditioned medium or extract for a time sufficient to permit controlled differentiation to DEE cells; and modifying one or more genes in the DEE cells; or modifying one or more genes in the EPL cells prior to culturing in conditioned medium or extract, to produce generitally modified definitive ectoderm equivalent (DEE) cells.
  • EPL early primitive ectoderm-like
  • Modification of the genes includes any changes to the genetic make-up of the cell thereby resulting in a cell genetically different to the original cell.
  • the cells have a number of uses, including the following:
  • ectoderm cells or their differentiated or partially differentiated progeny produced from DEE cells may be used to replace or assist the normal function of diseased or damaged tissue.
  • ectoderm cells or their differentiated or partially differentiated progeny produced from DEE cells may be used to replace or assist the normal function of diseased or damaged tissue.
  • Parkinson's disease the dopaminergic cells of the substantia nigra are progressively lost.
  • the dopaminergic cells in Parkinson's patients could be replaced by implantation of neural cells, produced from ectoderm in the manner described in this application.
  • corneal transplant precursors of adult skin, hairs, lens and cornea of the eye, including surface ectoderm and its derivatives may be used for transplantation therapy.
  • a number of corneal disorders may be treated by corneal transplant, including corneal clouding, degeneration following cataract surgery, keratoconus, bullous keratopathy and chemical burns.
  • corneas for transplant are sourced from deceased donors.
  • skin grafts are used to treat a number of conditions, most notably burns.
  • Surface ectoderm derived in vitro may be further differentiated into a number of surface tissues including corneal epithelia, skin and lens, providing an alternative source in potentially unlimited amounts of those tissues for transplant.
  • surface ectoderm may be induced to produce skin cells, lens or corneal cells of the eye and hair which potentially may be used for transplants.
  • neurectoderm cells or their differentiated and partially differentiated products may be genetically modified so that they provide functional biological molecules.
  • the genetically modified cells can be implanted, thus allowing appropriate delivery of therapeutically active molecules.
  • neurectoderm and ectoderm cells described herein are potentially capable of forming differentiated cells of non-neural or non-ectoderm lineages, including cells of mesodermal lineage, such as haematopoietic cells and muscle.
  • Reprogramming technology using neural or ectodermal cells potentially offers a range of approaches to derive cells for autologous transplant.
  • karyoplasts from differentiated cells are obtained from the patient, and reprogrammed in neurectoderm or ectoderm cytoplasts to generate autologous neurectoderm.
  • the autologous neurectoderm or ectoderm cells or their differentiated or partially differentiated progeny could then be used in cell therapy to treat neurodegenerative diseases.
  • a method for the preparation of tissue or organs for transplant which method includes providing surface ectoderm cells produced as described above; culturing the surface ectoderm cells to produce skin cells, lens or corneal cells of the eye, or hair cells; and transplanting the cells produced to a selected site within the patient's body.
  • ES cells were aggregated in suspension in incomplete ES cell media supplemented with 50% MEDII and cultured for seven days. On day 7, EBMs were transferred to 50% DMEM: 50% Hams F12 supplemented with ITSS and 10 ng/ml FGF2 and cultured for a further two days.
  • the ball of cells had converted into an epithelial sheet of cells and comprised a convoluted cell layer.
  • the cell layer appeared to thicken and organise into a stratified epithelial sheet of columnar cells.
  • RNA from EBM 1 " 9 was analysed by Northern blot for the expression of Rex1, brachyury and mGAP.
  • Rex1 transcripts were 1.9 kb (Hosier et al., 1989), brachyury 2.1 kb (Lake et al., 2000) and mGAP 1.5 kb.
  • B. 20 ⁇ g RNA from EBM 4"8 was analysed for the expression of Oct4 and mGAP by Northern blot analysis. Oct4 transcripts were 1.55 kb (Rosner et al., 1990) and mGAP 1.5 kb.
  • Oct-4 and correlated with the ICM in vivo The down regulation of Rex1 at day 2 indicates the formation of EPL cells, which correlates with the beginning of primitive ectoderm formation in vivo.
  • Neurectoderm is present at day 7, indicated by up regulation of Sox1 and corresponds to 7.5 dpc in the embryo.
  • RNA was reverse transcribed with 3'-anchored oligo dT 12 primer for 50 min at 42°C in a 20 ⁇ l volume.
  • 1/10 th of undiluted first strand cDNA was used as the template for ddPCR with OPB-07.
  • [ ⁇ - 33 P] dATP was incorporated.
  • ddPCR products were labelled by the arbitrary primer and differentially expressed band number on the gel. EBM 0"9 ddPCR reactions were run on the same gel. Sizes are indicated.
  • Class III B078 Class IV: B072, B074
  • RNA was reverse transcribed with 3'-anchored oligo dTi 2 primer for 50 min at 42°C in a 20 ⁇ l volume.
  • 1/10 th of undiluted first strand cDNA was used as the template for ddPCR with OPB-09.
  • [ - 33 P] dATP was incorporated.
  • ddPCR products were labelled by the arbitrary primer and differentially expressed bbaanndd nnuummbbeerr oonn tthe gel. EBM 0"9 ddPCR reactions were run on the same gel. Sizes are indicated.
  • Class II B096 Class IV: B092, B094, B095, B098, B099, B0910
  • RNA was reverse transcribed with 3'-anchored oligo dT-
  • Class IV A175, A178, A1711, A1712
  • RNA was reverse transcribed with 3'-anchored oligo dT ⁇ 2 primer for 50 min at 42°C in a 20 ⁇ l volume. 1/10 th of undiluted first strand cDNA was used as the template for ddPCR with OPA-19. [ - 33 P] dATP was incorporated. ddPCR products were labelled by the arbitrary primer and differentially expressed band number on the gel. EBM 0"9 ddPCR reactions were run on the same gel. Sizes are indicated.
  • Class III A193 Class IV: A191 , A194
  • A193, B078, A175, A1712, B098 and A205 ddPCR products were excised, eluted and reamplified by PCR using the original oligonucleotides (2.3.14). 1 ⁇ l of the 25 ⁇ l PCR reaction was run on a 2% TAE agarose gel and the sizes of reamplified fragments determined by pUC marker DNA.
  • Detection and localisation of A175, B072, A17113A and A1712 expression in embryoid bodies cultured in the presence of MEDII at day 6 (EBM 6 ) and day 9 (EBM 9 ) was carried out by in situ hybridisation. Transcript expression was detected using DIG labelled antisense riboprobes of the cDNA clones. Cells that expressed A175, B072, A17113A or A1712 were indicated by pink staining. Photographs were taken under Hoffman optics at 200 X magnification.
  • BMP4 was added and the bodies cultured until day 12. Neuron differentiation was assessed morphologically by the presence of neurons within individual embryoid bodies. Photographs were taken under Hoffmann optics at 200 X magnification.
  • A Morphology of EBMs on day 12 of differentiation. Bundles of axons were visible emanating from individual bodies.
  • BMP4 The addition of 10 ng/ml BMP4 in the culture media significantly reduced (p ⁇ 0.05) neuronal differentiation such that only 18.1% of the 44 bodies examined exhibited any morphological sign of neuron formation. Statistical significance was determined by analysis using Students unpaired T-test. Figure 13
  • Photographs were taken on day 8 under Phase Contrast optics at (A) 100 X and (B) 200 X magnification.
  • Photographs were taken on day 8 under Phase Contrast optics at (A) 100 X and (B) 200 X magnification.
  • Sox1 expression in embryoid bodies cultured with and without 10 ng/ml BMP4 was carried out by in situ hybridisation. Transcript expression was detected using DIG labelled antisense riboprobes generated from the Sox1 cDNA plasmid. Cells that expressed Sox1 were indicated by purple staining. Photographs were taken under Phase Contrast optics at 100 X magnification.
  • Detection and localisation of K18 expression in embryoid bodies cultured with and without 10 ng/ml BMP4 was carried out by in situ hybridisation. Transcript expression was detected using DIG labelled antisense riboprobes generated from the K18 cDNA plasmid. Cells that expressed K18 were indicated by purple staining. Photographs were taken under Phase Contrast optics at 100 X and 200 X magnification.
  • Detection and localisation of K14 expression in embryoid bodies cultured with and without 10 ng/ml BMP4 was carried out by in situ hybridisation. Transcript expression was detected using DIG labelled antisense riboprobes generated from the K14 cDNA plasmid. Cells that expressed K14 were indicated by purple staining. Photographs were taken under Brightfield optics at 200 X magnification. A EBM 8 cultured without BMP4.
  • brachyury expression was detected using DIG labelled antisense riboprobes generated from the brachyury cDNA plasmid. Photographs were taken under Phase Contrast optics at 200 X magnification.
  • Sox1 expression in embryoid bodies cultured with and without 10 ng/ml BMP4 and/or 10 ng/ml EGF was carried out by in situ hybridisation. Transcript expression was detected using DIG labelled antisense riboprobes generated from the Sox1 cDNA plasmid. Cells that expressed Sox1 were indicated by pink staining. Photographs were taken under Phase Contrast optics at 100 X and 200 X magnification.
  • E/F EBM 8 cultured with 10 ng/ml EGF at (A) 100 X magnification and (B) 200 X magnification.
  • G/H EBM 8 cultured with 10 ng/ml BMP4 + 10 ng/ml EGF at (G) 100 X magnification and (H) 200 X magnification.
  • Detection and localisation of nestin expression in embryoid bodies cultured with and without 10 ng/ml BMP4 and/or 10 ng/ml EGF was carried out by in situ hybridisation. Transcript expression was detected using DIG labelled antisense riboprobes generated from the nestin cDNA plasmid. Cells that expressed nestin were indicated by pink staining. Photographs were taken under Phase Contrast optics at 100 X magnification.
  • Detection and localisation of K18 expression in embryoid bodies cultured with and without 10 ng/ml BMP4 and/or 10 ng/ml EGF was carried out by in situ hybridisation. Transcript expression was detected using DIG labelled antisense riboprobes generated from the K18 cDNA plasmid. Cells that expressed K18 were indicated by purple staining. Photographs were taken under Phase Contrast optics at 100 X and 200 X magnification.
  • E/F EBM 8 cultured with 10 ng/ml EGF at (A) 100 X magnification and (B) 200 X magnification.
  • Detection and localisation of K14 expression in embryoid bodies cultured with and without 10 ng/ml BMP4 was carried out by in situ hybridisation. Transcript expression was detected using DIG labelled antisense riboprobes generated from the K14 cDNA plasmid. Cells that expressed K14 were indicated by purple staining. Photographs were taken under Brightfield optics at 100 X, 200 X and 400 X magnification.
  • F/G EBM 8 cultured with 10 ng/ml BMP4 + 10 ng/ml EGF at (E) 100 X magnification and (F) 200 X magnification.
  • brachyury expression was carried out by in situ hybridisation. Transcript expression was detected using DIG labelled antisense riboprobes generated from the brachyury cDNA plasmid. Photographs were taken under Phase Contrast optics at 100 X magnification.
  • a EBM 8 A EBM 8 .
  • IPTG isopropyl- ⁇ -D-thiogalactopyranoside kb kilobase pairs min minute mLIF mouse leukaemia inhibitory factor
  • Sources for other important reagents were as follows: Acrylamide; GeneWorks. IPTG, BCIG; Progen. Anti-DIG Fab antibody-alkaline phosphatase conjugate, BCIP, glycogen, ITSS, NBT and tRNA; Roche Molecular Biochemicals. Ammonium acetate, APS, chloroform, formaldehyde, formamide, methanol, magnesium acetate, NP-40, PEG 6000 and phenol, Tris-HCI, Triton X-100; BDH Chemicals. Isopropanol; Ajax Chemicals. Paraformaldehyde; Merck. Blue Dextran, Poly dT 12- ⁇ s primer, Sephadex G-50 fine and Sepharose CL-6B; Pharmacia. Gluteraldehyde; Probing and Structure. Dithioerythritol and DTT; Diagnostic Chemicals Ltd. Sequagel 6; National Diagnostics.
  • Buffer 1 100 mM Tris-HCI pH 7.4, 100 mM NaCl
  • Buffer 2 Tris-HCI pH 9.5, 100 mM NaCl, 5 mM MgC_2
  • Buffer 3 Buffer 1 , 1 mM EDTA.
  • FLB Deionised formamide, 0.02% bromophenol blue, 0.02% xylene cyanol Fragment Elution Buffer: 0.5 M NH4AC, 10 mM MgAc2, 1 mM EDTA pH
  • GET buffer 25 mM Tris pH 8.0, 10 mM EDTA pH 8.0, 50 mM glucose GLB: 50% glycerol, 0.1% SDS, 0.05% bromophenol blue, 0.05% xylene cyanol ⁇ -ME/PBS: 100 mM ⁇ -ME (Sigma) in 14 ml PBS.
  • Fresh solution prepared fortnightly 25 mM Tris pH 8.0, 10 mM EDTA pH 8.0, 50 mM glucose GLB: 50% glycerol, 0.1% SDS, 0.05% bromophenol blue, 0.05% xylene cyanol ⁇ -ME/PBS: 100 mM ⁇ -ME (Sigma) in 14 ml PBS. Fresh solution prepared fortnightly
  • MOPS 23 mM MOPS pH 7.0, 50 mM NaAc, 10 mM EDTA pH 8.0
  • PBS 136 mM NaCl, 2.6 mM KCI, 1.5 mM KH2PO4, 8 mM
  • Ste buffer 150 mM NaCl, 10 mM Tris pH 8.0, 1 mM EDTA TAE: 40 mM Tris-acetate, 20 mM NaAc, 1 mM Na2EDTA pH 8.2
  • TBE 90 mM Tris-HCI, 90 mM boric acid, 2.5 mM EDTA pH 8.3
  • Trypsin 0.1% trypsin (Difco) and 1 x EDTA Versene buffer solution
  • the brachyury cDNA clone was provided by Dr B. Herrmann.
  • the plasmid contained a 1764 bp of brachyury cDNA cloned into the EcoRI site of Bluescript II SK (Herrmann 1991).
  • mGAP mouse Gluteraldehyde Phosphate Dehydrogenase
  • pGEM3Z The mGAP (mouse Gluteraldehyde Phosphate Dehydrogenase) cDNA clone in pGEM3Z was from Prof. P. Rathjen and contained a 300 bp HindlW/Psti fragment from the 5' end of mouse GAPDH gene (Rathjen et al. 1990b).
  • the Oct-4 cDNA clone in pBluescript was provided by Dr H. Sch ⁇ ler and contained a 462bp Stu ⁇ cDNA fragment of positions 491 to 953 of the Oct-4 cDNA sequence (Sch ⁇ ler et al., 1990b).
  • Rex1 was donated by Dr N. Clarke and contained 848 bp of Rex1 cDNA in the EcoRI site of pCRTMII (Hosier et al. 1989).
  • Sox1 was obtained from Dr R. Lovell-Badge and contained 1.1 kb of the
  • Sox1 sequence in Bluescript KS was subcloned into Bluescript KSII (J. Rathjen; unpublished data).
  • the K18 cDNA clone was donated by Dr R. Oshima (Singer et al., 1986) and contained a 1163 bp fragment cloned into the HindlW site of pT7/T319U.
  • the K14 clone was obtained from Prof. G. Rogers and contained a 450 bp fragment of the 3' non-coding region of the mouse K14 gene cloned into pGEM3.
  • Radioactive riboprobes were synthesised as described below. The generation of DIG labelled riboprobes is described below. Oct-4
  • Riboprobes for in situ hybridisation were generated from the Oct-4 cDNA plasmid.
  • the antisense transcript was generated by digestion with Hindlll and transcription with T7 polymerase.
  • the sense transcript was generated by restriction with Xho ⁇ and transcription with T7 polymerase.
  • Riboprobes for in situ hybridisation were generated from the Sox- 7 cDNA plasmid containing the 1.1 kb Sox1 sequence.
  • the antisense transcript was generated by digestion with BamHl and transcription with T3 polymerase.
  • the sense transcript was generated by restriction with HindlU and transcribed with T7 polymerase.
  • Riboprobes for ribonuclease protection were obtained from the Sox-1 cDNA plasmid containing the 450 bp R ⁇ IXho ⁇ fragment.
  • the antisense transcript was generated by digestion with Kpnl and transcription with T7 polymerase.
  • the sense transcript was generated by restriction with Pst and transcription with T3 polymerase.
  • Riboprobes for Northern blot and in situ hybridisation were generated from the brachyury plasmid.
  • the antisense transcript was generated by digestion with Sa/nHI and transcription with T7 polymerase.
  • the sense transcript was obtained by restriction with Sail and transcription with T3 polymerase.
  • Riboprobes for in situ hybridisation were generated from the K18 plasmid.
  • the antisense transcript was generated by digestion with EcoRI and transcription with T7 polymerase.
  • the sense transcript was generated by restriction with Kpnl and transcribed with T3 polymerase.
  • Riboprobes for in situ hybridisation were generated from the K14 plasmid.
  • the antisense transcript was generated by digestion with EcoRI and transcription with sp6 polymerase.
  • the sense transcript was generated by restriction with Hindlll and transcribed with T7 polymerase.
  • Riboprobes for in situ hybridisation and northern blot were generated from the N500 plasmid.
  • the antisense transcript was generated by Ncol digestion and transcription with sp6 polymerase.
  • the sense transcript was generated by digestion with Sail and transcription with T7 RNA polymerase.
  • Riboprobes for ribonuclease protection were generated from the mGAP cDNA plasmid.
  • the plasmid was linearised with Psti and transcribed with T3 polymerase.
  • DNA primers were synthesised by GeneWorks. 5' arbitrary ddPCR primers, OPA and OPB 10mer kits were purchased from Operon technologies. Primer sequences are shown 5'-3'. EcoRI restriction sites are in bold.
  • T7 TAATACGACTCACTATAGGGAGA
  • T3 ATTAACCCTCACTAAAGGGA ddPCR primers
  • OPA-09 GGGTAACGCC
  • OPA-20 GTTGCGATCC
  • OPA-17 GACCGCTTGT OPB-07: GGTGACGCAG
  • OPA-19 CAAACGTCGG OPB-09: TGGGGGACTC
  • Growth media were prepared in milliQ filtered water and sterilised by autoclaving. Antibiotics and other labile chemicals were added after the media solution had cooled to 50°C.
  • Luria broth 1% (w/v) Bacto-tryptone (Difco), 0.5% (w/v) yeast extract (Difco), 1% (w/v) NaCl, pH 7.0 (adjusted with NaOH).
  • Psi broth 2% (w/v) Bacto-tryptone (Difco), 0.5% (w/v) yeast extract
  • Solid Media Agar plates were prepared by supplementing the above media with 1.5% Bacto-agar (Difco).
  • Ampicillin 100 mg/ml (Sigma Chemical Co.) was added where appropriate for growth of transformed bacteria to maintain selective pressure for recombinant plasmids.
  • the ES cell lines used throughout the course of this work were D3 and were derived from the ICM of the preimplantation 129 strain mouse embryo blastocyst (Doetschmann et al. 1985; Kindly donated by Dr L. Williams, Ludwig Institute, Melbourne, Australia).
  • the Hep G2 cell line was derived from a human hepatoblastoma primary tumour (Knowles et al. 1980; ATCC HB-8065).
  • ES cell media Complete ES cell media: DMEM (Gibco BRL), pH 7.4, containing glucose; 10% FCS (Commonwealth Serum Laboratories), 1 mM L-glutamine, 0.1 mM ⁇ - ME/PBS, 1000 units of LIF (Rathjen et al. 1999) under 10% CO2 in a humidified incubator.
  • DMEM Gibco BRL
  • FCS Commonwealth Serum Laboratories
  • 1 mM L-glutamine 1 mM L-glutamine
  • 0.1 mM ⁇ - ME/PBS 1000 units of LIF (Rathjen et al. 1999) under 10% CO2 in a humidified incubator.
  • MEDII conditioned medium medium was isolated from Hep G2 cells cultured in incomplete ES cell medium for 4 days (Rathjen et al. 1999). All tissue culture media were filter sterilised.
  • Hpall digested pUC19 markers were purchased from GeneWorks. Band sizes (bp): 501 , 489, 404, 331 , 242, 190, 147, 111 , 110, 67, 34, 26.
  • EcoRI digested SPP-1 phage markers were purchased from GeneWorks.
  • Plasmid DNA was digested in SD buffer with 1-2 U of enzyme/ ⁇ g DNA and incubation at the appropriate temperature for 30 min to 3 hours. Complete digestion of DNA was assayed by agarose gel electrophoresis (Sambrook et al. 1989).
  • TBE for RNA was carried out using horizontal mini-gels prepared by pouring 10 ml of gel solution onto a 7.5 cm x 5.0 cm glass microscope slide. Agarose mini- gels were submerged in 1 x TAE or 1 x TBE and samples containing 1 x GLB were electrophoresed at 100 mA. Nucleic acid was visualised by staining gels with EtBr (4 mg/ml in water) and exposure to medium wavelength UV light. Appropriate bands were removed from preparative gels using a sterile scalpel blade (Sambrook et al. 1989).
  • 6% polyacrylamide sequencing gels (20 cm x 40 cm x 0.37 mm, or 35 cm x 40 cm x 0.37 mm) were prepared from Sequagel 6 solutions according to the manufacturer's instructions. Prior to pouring the gel, 1/100 10% APS and 1/8000 TEMED were added to the gel solution to initiate polymerisation. Once the gel had set (60-90 min), the comb was removed and the wells flushed with water. Denaturing gels were pre-electrophoresed for 60 min at 45 W (small gel) or 90 min at 60 W (large gel) in order to heat the gel to 50°C.
  • the wells were flushed with 1 x TBE before loading samples and electrophoresis was carried out at the same setting (approximately 50°C). After the gel had run, the glass plates were prised apart and the gel transferred to dry 3MM Whatmann paper. The gel was dried at 65°C under vacuum. Radioactivity was detected by exposure to X-ray film at RT.
  • Linear DNA fragments were purified from agarose gels using the
  • the DNA band of interest was excised from an agarose gel and the agarose dissolved.
  • the DNA was bound to a uniform size silica matrix under high salt conditions and then recovered in water.
  • the fragment was amplified from 10.5 dpc mouse embryo cDNA (kindly provided by Stephen Rodda) using the RT-PCR method.
  • the amplified product was purified by agarose gel electrophoresis and Bresaclean, then ligated into pGEM-T easy.
  • the orientation of the insert was determined by digestion with Seal and Pst restriction enzymes.
  • PCR DNA was purified by agarose gel electrophoresis and Bresaclean and ligated into pGEM-T easy (Promega).
  • Ligation reactions contained 50 ng purified vector, 3 mg purified PCR product, ligation buffer (60 mM Tris pH 7.8, 20 mM MgC_2, 20 mM DTT, 2 mM ATP, 10% polyethylene glycol) and 1 U T4 DNA ligase, and were incubated at RT for 1 hour.
  • ligation buffer 60 mM Tris pH 7.8, 20 mM MgC_2, 20 mM DTT, 2 mM ATP, 10% polyethylene glycol
  • a single E.coli colony was used to inoculate 5 ml Psi broth and grown in an orbital shaker O/N at 37°C.
  • a 1 :30 subculture was made in 15 ml Psi broth and grown for 90 min at 37°C, or until O.D. 0.6 at ⁇ 6 oonm was obtained.
  • a 1 :20 subculture was made in 100 ml Psi broth and grown at 37°C until the O.D. was 0.5-0.6 at ⁇ oonm.
  • the bacterial cells were chilled on ice for 5 min and harvested by centrifugation at 6000 rpm for 5 min at 4°C. The cells were resuspended in 0.4 volume of Tfb 1 and chilled on ice for a further 5 min.
  • Plasmid DNA was precipitated by addition of isopropanol and incubated at -20°C for 10 min. Plasmid DNA was pelleted by centrifugation for 15 min and resuspended in 50 ⁇ l TE buffer containing 1 :500 RNase A (10 mg/ml).
  • Plasmid DNA was extracted using the Midiprep kit according to manufacturer's instructions. Briefly, bacterial cells were alkaline lysed and the plasmid DNA bound to a silica matrix and then recovered in water. Plasmid DNA was stored at -20°C. Double Stranded Sequencing of Plasmid DNA
  • 1 ⁇ g plasmid DNA was subjected to PCR based cycle sequencing in the presence of 100 ng USP or RSP primer and 8 ⁇ l Dye terminator ready reaction mix (Perkin Elmer) in a total volume of 10 ml.
  • the reactions were amplified in a MJ Research PTC-100 thermal cycler for 25 cycles of: (1) 96°C for 10 sec; (2) 50°C for 5 sec; (3) 60°C for 4 min and the DNA precipitated in 1/10 volume 3 M NaAc, pH 4.6 and 2.5 volume 100% ethanol for 30 min at -80°C.
  • Precipitated DNA was pelleted by centrifugation at 14,000 rpm for 20 min, washed in 70% ethanol, and dried by vacuum centrifugation. Reactions were analysed at the Institute for Medical and Veterinary Science Sequencing Centre, Sydney, Australia and viewed on the Editview program (Perkin Elmer).
  • RNA was reverse transcribed using Superscript II RNase H " reverse transcriptase according to the manufacturer's instructions.
  • RT-PCR Reverse Transcription PCR
  • 2 ⁇ l of the reverse transcription mix was used as template in 20 ⁇ l PCR reactions containing 1 x Taq buffer, 1.8 mM MgCl2, 250 ⁇ M each dNTP, 100 ng 3'-anchored oligo dT-
  • the ddPCR reactions were amplified in a MJ Research PTC-100 thermal cycler for 40 cycles of: (1) 94°C for 1 min; (2) 42°C for 1 min; (3) 72°C for 30 sec followed by a final extension at 72°C for 5 min.
  • 1% agarose gels for northern blot analysis were prepared by dissolving 2.5 g agarose in 210 ml MQ water. Once the gel solution had cooled to 60°C, 25 ml 10 x MOPS and 15 ml 20 % formaldehyde (freshly prepared by dissolving 4 g paraformaldehyde in 20 ml MQ water) were added before pouring the gel. 20 ⁇ g RNA was prepared for electrophoresis in 50 ⁇ l samples containing 1x MOPS, 6.5% formaldehyde (pH 4.5) and 50% deionised formamide. RNA samples were denatured by heating at 65°C for 15 min and snap cooled on ice. GLB was added before loading into wells. 5 ⁇ g EcoRI digested SPP-1 phage markers were also loaded. Northern gels were run at 6 V/cm gel length in 1 x MOPS until the bromophenol blue dye had reached the bottom of the gel.
  • the lane containing the DNA markers was removed from the gel, stained in EtBr for 45 min and destained in water O/N before photographing under medium wavelength UV light. The remainder of the gel was blotted onto Hybond-XL nylon membrane using capillary transfer. Two pieces of Whatmann 3MM paper were pre-wetted in 20 x SSC and placed over a platform so that the edges of the paper were submerged in 20 x SSC. The gel was orientated with wells facing down on the damp Whatmann paper (avoiding bubbles) and parafilm placed around the gel to avoid short circuiting. The nylon membrane was pre-wetted in 20 x SSC and then carefully placed over the gel such that no air bubbles were trapped between the filter and the gel.
  • DNA probes were synthesised using the Gigaprime labelling kit with 50 ⁇ Ci
  • [ - 32 P] dATP in 24 ⁇ l reactions.
  • the reactions were made up to 100 ⁇ l with MQ water and unincorporated label was removed from the probe by centrifugation on a Sephadex G-50 column (Amersham Pharmacia Biotech Inc.) centrifuged at 3000 rpm for 5 min.
  • Riboprobes were synthesised as described by Kreig and Melton (1987), using 60 ⁇ Ci [ ⁇ - 32 P] UTP. Unincorporated label was removed using a Sephadex G-50 column centrifuged at 3000 rpm for 5 min. Hybridisation of Radioactive Probes to Nylon Filter
  • Filters were prehybridised in 7 ml UltraHyb (Ambion) for a minimum of 4 hours at 42°C in a Xtron hybridisation oven. DNA probes were heated to 100 Q C for 5 min and snap-cooled on ice before adding to the filters. Filters were probed O/N at 42°C and the radioactive filter washed the next day in 2 x SSC, 0.1% SDS for 15 min at 42°C followed by 3 x 15 min washes of 0.2 x SSC, 0.1% SDS at 42°C.
  • RNA probes were denatured by heating at 85°C for 2 min and snap-cooled on ice before addition to the filters.
  • Hybridisation reactions were carried out O/N at 65°C. Radioactive filters were washed the following day using the same protocol described for DNA probed filters.
  • Embryoid bodies were washed once in PBS and fixed for 30 min in 4% PFA/PBS solution. Embryoid bodies were then dehydrated in 50% ethanol for 30 min and stored in 70% ethanol at -20°C. The in situ protocol consisted of a 2 min wash in 70% ethanol, followed by rehydration in H 2 0 for 5 min and PBS for 5 min at room temperature. Embryoid bodies were then permeabilised with RIPA buffer for 15 min and washed in 5 x SSC for 10 min.
  • Bodies were then equilibrated for 1 h at 60°C in prehybridisation solution containing 50% deionized formamide, 5 x SSC, 50 ⁇ g/ml heparin and 100 ⁇ g/ml denatured salmon sperm DNA to block any non-specific hybridisation.
  • DIG labelled riboprobes were denatured at 80°C for 10 min, snap cooled on ice and added to fresh prehybridisation solution.
  • Bodies were hybridised O/N AT 60°C. Prehybridisation and hybridisation steps were carried out in a sealed humidified box containing paper towels soaked in 50% formamide, 2x SSC.
  • Post-hybridisation washes were as follows: 2x SSC for 30 min at RT, 2x SSC for 1 h at 65°C and 0.1x SSC for 1 h at 65°C. Finally bodies were equilibrated for 5 min in buffer 1 at RT. Anti-digoxygenin IgG antibody conjugated to alkaline phosphatase (Boehringer Mannheim) was diluted 1 :2000 in buffer 1 + 0.5% blocking reagent (BM) and incubated at RT with bodies for 2 h. Embryoid bodies were then washed twice in buffer 1 at RT for 15 min and once in buffer 2 for 5 min.
  • BM blocking reagent
  • the bodies were developed in buffer 2 containing 0.45 mg/ml NBT, 0.18 mg/ml BCIP and 5 mM levamisole in the dark until purple staining appeared (2 h - O/N).
  • the staining reaction was terminated by rinsing several times with buffer 3. Destaining, if necessary, was achieved by washing bodies in 100% ethanol. Embryoid bodies were viewed and photographed under phase contrast, Hoffman and bright field optics using a Nikon TE300 inverted microscope with Ektachrome 100 slide film.
  • Photographic slides of in situ hybridisation analysis were scanned. Scanned images were manipulated using the Adobe PhotoshopTM, CanvasTM, and MacDraw ProTM programs and converted to photographic images.
  • Sequencing reactions were read using a digitiser and MacDNASIS software (Hitachi). Contiguous sequence alignments were performed using MacDNASIS.
  • ES cells were routinely maintained as described by Smith (1991). Cells were cultured in complete ES cell medium at 37°C in 10% CO2 on gelatinised plates. ES complete cell medium was replaced every second day. Cells were passaged by washing twice in 10 ml PBS and incubating with 1 ml trypsin for 1 min. Trypsination of cells was terminated by the addition of 1 ml ES cell medium and cells were sedimented at 1200 rpm for 4 min before resuspension in 10 ml complete ES cell medium and re-seeding. ES cells were re-seeded (20-40 fold dilution) every 3-4 days. Cells were harvested for RNA extraction as for passaging but cells were resuspended in PBS and resedimented at 1200 rpm for 4 min. Cells for RNA extraction were stored as a pellet at -20°C until use.
  • ES cells were aggregated as a single cell suspension at a density of 1 x 10 5 cells/ml in bacterial plates in 50% MEDII conditioned medium in DMEM supplemented with 10% FCS, 1 mM L-glutamine and 0.1 mM ⁇ -ME at 37°C in 10% C0 2 . Medium was replaced every second day and free-floating EBM were split 1 in 2 every 3-4 days. After 7 days, EBM were transferred to 50% DMEM:50% Hams F12 supplemented with ITSS and 10 ng/ml FGF2 for a further 2 days of culture. This results in the lineage specific differentiation of pluripotent cells to neurectodermal lineages as described in Australian patent application PQ7143.
  • EBM were harvested by spinning at 1200 rpm for 1 min, resuspending in 10 ml PBS and pelleting the bodies for storage at -20°C until use.
  • the nomenclature used for the ES to EPL and neurectoderm cell conversion was based on the number of days bodies were grown in MEDII.
  • the number of days in culture in MEDII was denoted as a superscript, for example 1 day in culture was represented by EBM 1 .
  • the temporal expression of marker genes specific ICM, pluripotent cells, neurectoderm and nascent mesoderm during differentiation of pluripotent cells as EBM was determined by Northern analysis or RNase protection (Fig. 2).
  • 20 ⁇ g total RNA extracted from ES cells and EBM 1"9 was analysed by Northern blot for the expression of Rex1 and brachyury, and RNA from EBM 4"8 for the expression of Oct4.
  • the expression of Sox1 was determined by RNase protection of 10 ⁇ g of total RNA isolated from EBM 4"9 .
  • the expression of mGAP was used as a loading control in both Northern analysis and RNase protections.
  • Pluripotent cells of the ICM and ES cells are characterised by expression of the zinc-finger transcription factor Rex1 (Rathjen et al. 1999; Rogers et al. 1990) and the pluripotent cell marker Oct4 (Rosner et al. 1990).
  • Northern blot analysis of total RNA from ES cells and EBM 1"9 revealed expression of Rex1 in ES cells and EBM 1 . This expression was down regulated in EBM 2 and undetectable in EBM 3"9 ( Figure 2A).
  • Oct4 expression was observed in ES cells and EBM 1"4 ( Figure 2B, data not shown) and down regulated to a low but detectable level in EBM 5'9 .
  • Brachyury is expressed in nascent mesoderm formed during gastrulation of the mammalian embryo (Herrmann, 1991).
  • Northern blot analysis of total RNA from EBM 1"9 did not detect the expression of the nascent mesoderm marker, brachyury ( Figure 2A).
  • Sox1 has been shown to be expressed in neurectoderm at the time of neural plate formation and expression is maintained in all undifferentiated neural cells (Pevney et al., 1998). Sox1 was used as a marker for the formation of ectodermal lineages in EBM. RNase protection analysis of RNA isolated from EBM 4"9 with an anti-sense Sox1 probe (Figure 2C) revealed up regulation of Sox1 expression on day 7-9 of EBM development.
  • Oct-4 expression was maintained on all days of EBM development but was significantly down regulated from day 5. The low expression maintained during day 5-9 correlated with expression reported in vivo. In the embryo, Oct4 expression is down regulated during gastrulation at 7 dpc and expression is maintained in ectodermal derivatives until 9 dpc (Sch ⁇ ler et al. 1990; Yeom et al. 1996). This suggests that a definitive ectoderm equivalent (DEE) is formed at day 5/6 in the EBM differentiation system.
  • DEE definitive ectoderm equivalent
  • Sox1 The expression profile of Sox1 indicates conversion of the definitive ectoderm to a neurectoderm equivalent population at day 7.
  • Sox1 is one of the earliest transcription factors to be expressed in cells committed to the neural fate, with the onset of expression coinciding with neurectoderm induction at 7.5 dpc (Pevny et al. 1998) ( Figure 3).
  • In situ hybridisation demonstrated that Sox1 expression was maintained by all cells in the EBMs until at least day 9.
  • the lack of detectable brachyury expression over the entire 9 day transition indicates the absence of mesoderm formation as brachyury expression is observed throughout nascent mesoderm underlying the primitive streak in the embryo.
  • FIG. 3 relates the temporal order of gene expression changes during EBM differentiation in vitro, and events in vivo.
  • the data indicate a gap in the window of gene expression from day 4 (primitive ectoderm, Oct-4+) to day 7 (neurectoderm, Sox1 + ).
  • Cells at this stage, between day 5 and day 7 of EBM development, are Oct-4 low, Rex1 ⁇ and Sox1 ⁇ and may represent definitive ectoderm.
  • ddPCR Differential display PCR
  • the key strategy in this approach was to screen for specific transcripts with expression restricted to the definitive ectoderm cell population postulated to be present during days 5-7, and to exclude transcripts expressed in ES, EPL and neurectodermal cells.
  • gene expression within EBM 0 to EBM 9 was compared by ddPCR.
  • the EBM 0"9 series was generated as described in example 1.
  • RNA samples were reverse transcribed with an anchored oligo-dTi2 primer and first strand cDNA was PCR amplified with the oligo-dT-
  • FIGS 4, 5 and 6 show the ddPCR profile of EBM 0"9 using the OPB-07, OPB-09 and OPA-17 5' oligonucleotides respectively.
  • Each duplicated banding profile was generated from independent reverse transcriptions, demonstrating consistency in amplification and detection of differential gene expression during differentiation.
  • samples were re-run on a second denaturing gel and displayed the same expression profiles (data not shown).
  • Amplified products were labelled according to the arbitrary 5' primer used (kit "A” or "B” and oligo number) and the differentially expressed band number on the gel.
  • A175, A091, A193, A1712, A191 , A205, A1711 and B098 were excised, eluted and reamplified by PCR using the original oligonucleotides.
  • A1711 was renamed A17113A. All products reamplified as single products of the expected size ( Figure 10). All reamplified fragments were purified by agarose gel electrophoresis and Bresaclean and ligated into pGEM-T easy vectors. A single clone for each cDNA fragment was sequenced in both directions. All sequences are presented in Appendix I.
  • B095, B072 and A175 represented cDNA fragments derived from the murine CD24a gene (99% homology and 99% identity over 461 nucleotides) (Wenger et al. 1993; Accession no. MMCD24A). All three fragments spanned the same 6939 bp to 7399 bp region in the 3' untranslated region (UTR) of the CD24a gene, and resulted from amplification with the oligo dT primer on both strands.
  • the B095, B072 and A175 fragments displayed extremely similar expression profiles in the ddPCR screen ( Figure 4; Figure 5; Figure 6).
  • A178 corresponded to the l ⁇ 00'1 (Shintani et al. 2000; Accession no. AF011644) mouse oral tumour suppressor homologue (98% identical over 277 nucleotides) and spanned positions 702 bp to 978 bp of the 3'UTR.
  • A1712, A17113A, A091 , A191 , A193 and A205 were novel sequences, not homologous to any described sequences or functional domains.
  • Sequenced Tag search detected each of these sequences in multiple and diverse mouse cDNA libraries.
  • A17113A expression was detected in mouse ES cell, one-cell and two-cell embryos, and 9-, 12- and 15-day embryonic libraries.
  • EBM development This technique has the added advantage in that the uniformity of gene expression within bodies can be assessed.
  • Direct visualisation of A175, A171 , A17113A and B072 expressing cells was therefore carried out by in situ hybridisation analysis of EBM 6 and EBM 9 .
  • Expression was detected using digoxygenin labelled antisense riboprobes generated from the cDNA clones.
  • the A175 and B072 transcripts exhibited expression patterns consistent with those observed by ddPCR. Expression was relatively low but detected in all cells in EBM 6 and EBM 9 ( Figures 11 A, B, C and D). Expression of the A17113A transcript was detectable in all cells of EBM 6 and was down regulated in EBM 9 ( Figure 11 E and F), consistent with the ddPCR expression pattern ( Figure 8). Expression of the A1712 transcript was prominent and also in accordance with the expression profile predicted from ddPCR. Strong expression in all cells of the bodies at EBM 6 was followed by down regulated expression in EBM 9 ( Figure 11 G and H). The detection of transcript expression in all cells of EBM 6 was consistent with the described homogeneity of the differentiation system.
  • DdPCR was used to identify genes that were expressed in EBM cells equivalent to definitive ectoderm (DEE).
  • DEE definitive ectoderm
  • the timing of upregulation and downregulation of some of these suggest that they could be used as markers to define the temporal and spatial existence of definitive ectoderm in vitro and in vivo.
  • Verification of expression patterns by in situ hybridisation confirmed the expression patterns demonstrated by ddPCR.
  • expression of the markers in all cells of EBM 6 confirmed the homogeneity of definitive ectoderm formed by directed differentiation of pluripotent cell aggregates in response to MEDII.
  • BMP4 Bone Morphogenetic Protein 4
  • TGF-b Transforming Growth Factor-b
  • BMP4 Bone Morphogenetic Protein 4
  • This is expressed in ventral ectoderm of the midgastrula stage Xenopus embryo (Hemmati-Brivanlou and Thomsen 1995) has been shown to be an endogenous neural inhibitor and epidermal inducer in dissociated ectodermal explants (Hawley et al. 1995; Sasai et al. 1995; Suzuki et al. 1995; Wilson and Hemmati-Brivanlou 1995; Xu et al. 1995) and has been implicated in lens induction in the mouse by knockout studies (Furuta and Hogan 1998).
  • EBM 6 were generated as described in example 1. Early on day 6, bodies were transferred to gelatinised wells and left to adhere in 50% MEDII for 8-10 hours, after which the media was removed and replaced with 50%F12: 50%DMEM supplemented with 1/1000 ITSS and 1/1000 glutamine, conditions which have previously been demonstrated to support homogeneous neurectoderm formation (J. Rathjen; unpublished data). To test the effect of BMP4, 10 ng/ml BMP4 was added to EBM 6 and bodies were cultured until day 12, fixed in 4% PFA and stored at -4°C. Morphological Alterations in Differentiated Cells
  • EBM 6 cultured for a further 2 days in the absence of BMP4 exhibited morphology typical of neurectoderm differentiated from ES cells in vitro in response to MEDII (example 1).
  • the central mass of cells comprised a convoluted epithelial sheet of columnar cells and individual differentiated cells did not generally migrate far from the outer edge of bodies ( Figure 13A and 13B).
  • EBM 6 cultured for a further 2 days in the presence of BMP4 displayed a distinct morphology.
  • the central mass of cells comprised a convoluted epithelial layer which in general was more dispersed and spread out (Figure 13C).
  • EBM 6 cultured as described above were fixed in 4% PFA on days 7, 8 and 9, dehydrated and stored in 70% ethanol at -20°C prior to gene expression analysis by in situ hybridisation for the expression of Sox1, nestin, K18, K14 and brachyury.
  • Sox1 a marker which delineates the neural plate and is expressed by all undifferentiated neural cells and nestin, which encodes an intermediate filament protein expressed in the developing central nervous system (CNS) from 7.75 dpc in the neural plate and maintained in many proliferating CNS progenitor cells (Dahlstrand et al. 1995), were used to assess the formation of neurectoderm in EBM.
  • Sox1 ( Figure 14A) and nestin (Figure 15A) expression was detected in all cells of EBM 6 cultured for a further 2 or 3 days in the absence of BMP4. In the presence of BMP4, Sox1 expression was significantly reduced with little expression being detected in any of the cells surrounding the bodies ( Figure 14B). Expression of nestin was also reduced by ectopic BMP4 however a low but constant level was maintained ( Figure 15B and C). This suggests that addition of BMP4 directs differentiation of definitive ectoderm away from a neural/neurectodermal fate.
  • Keratin 18 is expressed early in embryonic development (Oshima et al. 1986) and serves as a marker for simple epithelium. K14 expression is up regulated later during development by mitotically active keratinocytes of the epidermis which can undergo stratification (Fuchs and Green 1980; Sinha et al. 2000). K18 and K14 expression were not detected by in situ hybridisation in the absence of BMP4 ( Figure 16A; Figure 17A) with background staining equivalent to in situ hybridisation using the sense probes (data not shown).
  • brachyury a transcription factor up regulated in nascent mesoderm (Herrmann 1991). Brachyury transcripts were not upregulated in either culture condition ( Figure 18A and B), confirming the ectodermal lineage specificity of EBM differentiation.
  • epidermal markers and reduction in neural marker expression in conjunction with the absence of brachyury expression and prominent epithelial morphology suggests that definitive ectoderm derived by differentiation of pluripotent cells in the presence of MEDII differentiates in response to BMP4 to form a surface ectoderm equivalent population. This bipotential differentiation provides direct evidence that the starting population was representative of embryonic definitive ectoderm.
  • EGF Epidermal Growth Factor
  • Epidermal Growth Factor has been proposed to play an important role in epidermal development in the adult mouse by promoting proliferation and differentiation (keratinization) of the epidermis, and is required for the culture of epithelial cells in vitro (Partanen 1990; Sibilia and Wagner 1995).
  • EBM 6 were generated as described in example 1. Early on day 6, bodies were transferred to gelatinised wells and left to adhere in 50% MEDII for 8-10 hours, after which the media was removed and replaced with 50%F12: 50%DMEM supplemented with 1/1000 ITSS and 1/1000 glutamine, conditions which have previously been demonstrated to support homogeneous neurectoderm formation (J. Rathjen; unpublished data). The effect of EGF on cell differentiation was tested by addition of 10 ng/ml EGF, 10 ng/ml EGF + 10 ng/ml BMP4, or 10ng/ml BMP4 to EBM 6 which were cultured until day 12, fixed in 4% PFA and stored at -4°C.
  • EBM cultured in the presence of BMP4 + EGF formed cells with morphology characteristic of cells induced in response to BMP4 or EGF alone ( Figure 19G-H; Figure 21 H; Figure 22G). Neurons were not observed following differentiation of EBM in the presence of EGF or BMP4/EGF.
  • EGF induces differentiation of definitive ectoderm, formed by differentiation of pluripotent cells in response to MEDII, to surface ectoderm.
  • the fact that K18 expression was not detected may indicate that differentiation into epidermis is more advanced in the presence of EGF than BMP4, or that a distinct surface ectoderm differentiation endpoint is induced by EGF.
  • these data confirm the bipotential ectodermal differentiation of the starting population, consistent with designation of EBM 6 as equivalent to definitive ectoderm in vivo.
  • Gbx-2 genomic organization and expression in pluripotent cells in vitro and in vivo. Genomics 46, 223-233.
  • PCR differential display identifies a rat brain mRNA that is transcriptionally regulated by cocaine and amphetamine. J. Neurosci. 15, 2471-2481.
  • BMP4 is essential for lens induction in the mouse embryo. Genes & Dev. 12, 3764-3775.
  • Rex-1 a gene containing zinc finger motifs, is rapidly reduced by retinoic acid in F-9 teratocarcinoma cells. Mol. Cell. Biol. 9, 5623-5629.
  • Nectadrin the heat-stable antigen, is a cell adhesion molecule. J. Cell Biol. 118, 1245-1258.
  • the head inducer Cerberus is a multifunctional antagonist of Nodal, BMP and Wnt signals. Nature 397, 707-710.
  • DIA/LIF Differentiation inhibiting activity/leukaemia inhibitory factor
  • Rathjen P. D., Nichols, J., Toth, S., Edwards, D. R., Heath, J. K. and Smith, A. G. (1990b). Developmentally programmed induction of differentiation inhibiting activity and the control of stem cell populations. Genes Dev. 4, 2308- 2318.
  • Rathjen J. Lake, J.-A., Bettess, M. D., Washington, J. M., Chapman, G. and Rathjen, P. D. (1999). Formation of a primitive ectoderm like cell population from ES cells in response to biologically derived factors. J. Cell Sci. 112, 601-612.
  • Muscle cell differentiation of embryonic stem cells reflects myogenesis in vivo: developmentally regulated expression of myogenic determination genes and functional expression of ionic currents. Dev. Biol. 164,
  • the murine heat-stable antigen a differentiation antigen expressed in both the hematolymphoid and neural cell lineages. Eur J Immunol. 21,1397-1402.
  • Leukemia inhibitory factor is expressed by the preimplantation uterus and selectively blocks primitive ectoderm formation in vitro. Proc. Natl. Acad. Sci. (USA) 89, 8240-8244.
  • the heat stable antigen ( Mouse CD24) gene is differentially regulated but has a housekeeping promoter. J. Biol. Chem. 268, 23345-23352.
  • Pluripotent mouse embryonic stem cells are able to differentiate into cardio-myocytes expressing chronotropic responses to adrenergic and cholinergic agents and Ca 2 channel blockers. Differentiation 48, 173-182.
  • a dominant negative bone morphogenetic protein 4 receptor causes neuralization in Xenopus ectoderm. Biochem, Biophys. Res. Commun. 212, 212-219.
  • Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Neurology (AREA)
  • General Health & Medical Sciences (AREA)
  • Neurosurgery (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne un procédé permettant de produire des cellules équivalentes à l'ectoderme définitif (definitive ectoderm equivalent / DEE), ledit procédé comprenant les étapes suivantes : utilisation d'une source de cellules primitives précoces analogues à l'ectoderme (early primitive ectoderm-like / EPL), d'un milieu conditionné comme défini préalablement, ou d'un extrait de celui-ci présentant des propriétés de neuralisation ; et mise en contact des cellules EPL avec le milieu conditionné, pendant une durée suffisante pour produire la différentiation contrôlée des cellules neurectodermiques.
PCT/AU2001/000029 2000-01-14 2001-01-12 Production de cellules ectodermiques WO2001051610A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001226543A AU2001226543A1 (en) 2000-01-14 2001-01-12 Ectoderm cell production

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
AUPQ5098 2000-01-14
AUPQ5098A AUPQ509800A0 (en) 2000-01-14 2000-01-14 Cell production
AUPQ7045 2000-04-20
AUPQ7045A AUPQ704500A0 (en) 2000-04-20 2000-04-20 Cell production
AUPQ7143 2000-04-27
AUPQ7143A AUPQ714300A0 (en) 2000-04-27 2000-04-27 Cell production

Publications (1)

Publication Number Publication Date
WO2001051610A1 true WO2001051610A1 (fr) 2001-07-19

Family

ID=27158200

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/AU2001/000030 WO2001051611A1 (fr) 1998-04-09 2001-01-12 Production de cellules
PCT/AU2001/000029 WO2001051610A1 (fr) 2000-01-14 2001-01-12 Production de cellules ectodermiques

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/AU2001/000030 WO2001051611A1 (fr) 1998-04-09 2001-01-12 Production de cellules

Country Status (3)

Country Link
EP (1) EP1254211A4 (fr)
CA (1) CA2397292A1 (fr)
WO (2) WO2001051611A1 (fr)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003000868A1 (fr) 2001-06-21 2003-01-03 Geron Corporation Neurones dopaminergiques et cellules precuseurs competentes en proliferation destines au traitement de la maladie de parkinson
WO2003050249A2 (fr) 2001-12-07 2003-06-19 Geron Corporation Cellules d'ilots pancreatiques provenant de cellules souches embryonnaires humaines
US7015037B1 (en) 1999-08-05 2006-03-21 Regents Of The University Of Minnesota Multiponent adult stem cells and methods for isolation
US7153650B2 (en) 2003-03-13 2006-12-26 Geron Corporation Marker system for preparing and characterizing high-quality human embryonic stem cells
WO2007002136A2 (fr) 2005-06-22 2007-01-04 Geron Corporation Differenciation de cellules souches pluripotentes en cellules a lignage cardiomyocyte
WO2007002086A2 (fr) 2005-06-22 2007-01-04 Geron Corporation Culture en suspension de cellules souches embryonnaires humaines
US7285415B2 (en) 2002-07-11 2007-10-23 The Regents Of The University Of California Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US7579188B2 (en) 2002-07-11 2009-08-25 The Regents Of The University Of California Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US7799324B2 (en) 2001-12-07 2010-09-21 Geron Corporation Using undifferentiated embryonic stem cells to control the immune system
WO2010116148A1 (fr) 2009-04-09 2010-10-14 Antoxis Limited Utilisation de composés pour la différenciation de cellules
US7838289B2 (en) 2001-02-14 2010-11-23 Abt Holding Company Assay utilizing multipotent adult stem cells
EP2267116A1 (fr) 2004-07-13 2010-12-29 Geron Corporation Milieu de croissance pour cellules souches embryonnaires de primates
EP2292734A1 (fr) 2001-12-07 2011-03-09 Geron Corporation Cellules hématopoïétiques à partir de cellules souches embryonnaires humaines
WO2011124894A1 (fr) 2010-04-08 2011-10-13 The University Court Of The University Of Edinburgh Cellules progénitrices chondrogènes, protocole pour la dérivation de cellules et leurs utilisations
US8093049B2 (en) 2008-03-27 2012-01-10 Geron Corporation Differentiation of primate pluripotent stem cells to hematopoietic lineage cells
US8097458B2 (en) 1998-10-23 2012-01-17 Geron Corporation Micro-carrier culture system for rapid expansion of human embryonic stem cells
US8252280B1 (en) 1999-08-05 2012-08-28 Regents Of The University Of Minnesota MAPC generation of muscle
US8415153B2 (en) 2006-06-19 2013-04-09 Geron Corporation Differentiation and enrichment of islet-like cells from human pluripotent stem cells
US8426200B2 (en) 2003-07-02 2013-04-23 Regents Of The University Of Minnesota Neuronal differentiation of stem cells
US9005964B2 (en) 2006-11-24 2015-04-14 Regents Of The University Of Minnesota Endodermal progenitor cells
DE202014011287U1 (de) 2013-06-11 2019-02-06 The President And Fellows Of Harvard College SC-ß Zellen und Zusammensetzungen zur Erzeugung der Zellen
US10221390B2 (en) 2008-01-30 2019-03-05 Asterias Biotherapeutics, Inc. Synthetic surfaces for culturing stem cell derived oligodendrocyte progenitor cells
US10638734B2 (en) 2004-01-05 2020-05-05 Abt Holding Company Multipotent adult stem cells, sources thereof, methods of obtaining and maintaining same, methods of differentiation thereof, methods of use thereof and cells derived thereof
WO2022221051A1 (fr) 2021-04-11 2022-10-20 President And Fellows Of Harvard College Myocytes cardiaques et compositions et procédés de production associés

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9057053B2 (en) 2010-01-19 2015-06-16 The Board Of Trustees Of The Leland Stanford Junior University Direct conversion of cells to cells of other lineages
PT2561078T (pt) 2010-04-23 2018-12-03 Cold Spring Harbor Laboratory Sharn com uma conceção estrutural inovadora
GB201206773D0 (en) * 2012-04-17 2012-05-30 Cambridge Entpr Ltd Stem cells from the mammalian neural plate

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999032606A2 (fr) * 1997-12-19 1999-07-01 Bruestle Oliver Cellules precurseurs neurales, leur procede de production et leur utilisation pour la therapie d'anomalies neurales
WO1999053021A1 (fr) * 1998-04-09 1999-10-21 Bresagen Limited Facteur de differentiation/de proliferation et de conservation des cellules et procedes d'utilisation correspondants

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU678988B2 (en) * 1992-07-27 1997-06-19 California Institute Of Technology Mammalian multipotent neural stem cells

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999032606A2 (fr) * 1997-12-19 1999-07-01 Bruestle Oliver Cellules precurseurs neurales, leur procede de production et leur utilisation pour la therapie d'anomalies neurales
WO1999053021A1 (fr) * 1998-04-09 1999-10-21 Bresagen Limited Facteur de differentiation/de proliferation et de conservation des cellules et procedes d'utilisation correspondants

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
CARNINCI P. ET AL.: "Normalization and substraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes", GENOME RES., vol. 10, no. 10, 2000, pages 1617 - 1630 *
DATABASE GENBANK [online] 2 November 1994 (1994-11-02), "Human diazepam binding inhibitor (DBI) mRNA, complete cds", Database accession no. M14200 *
DATABASE GENBANK [online] 29 October 1999 (1999-10-29), "M. musculus Cd24a gene", Database accession no. X27910 *
DATABASE GENBANK [online] 29 September 1998 (1998-09-29), Database accession no. AC004771 *
DATABASE GENBANK [online] 5 August 1999 (1999-08-05), "Mus musculus cosmid MPMGc12IL12287 containing the syntenic region of the human AIRE gene", Database accession no. AF073797 *
KLEITER N. ET AL.: "Genomic organization and chromosome location of the murine Rp123 gene", CYTOGENET CELL GENET, vol. 90, no. 3-4, 2000, pages 227 - 230 *
LAKE J.A. ET AL.: "Reversible progamming of pluripotent cell differentiation", J. CELL. SCIENCE, vol. 113, 2000, pages 555 - 566 *
RATHJEN J. ET AL.: "Formation of a primitive ectoderm like cell population, EPL cells, from ES cells in response to biologically derived factors", J. CELL SCIENCE, vol. 112, 1999, pages 601 - 612 *
TSUJI T. ET AL.: "Cloning, mapping, expression, function and mutation analyses of the human ortholog of the hamster putative tumor suppressor gene doc-1", J. BIOL. CHEM., vol. 273, no. 12, 1998, pages 6704 - 6709 *

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10059939B2 (en) 1998-10-23 2018-08-28 Asterias Biotherapeutics, Inc. Screening methods for human embryonic stem cells
US8951800B2 (en) 1998-10-23 2015-02-10 Asterias Biotherapeutics, Inc. Primate pluripotent stem cell expansion without feeder cells and in the presence of FGF and matrigel or Engelbreth-Holm-Swarm tumor cell preparation
US8097458B2 (en) 1998-10-23 2012-01-17 Geron Corporation Micro-carrier culture system for rapid expansion of human embryonic stem cells
US8637311B2 (en) 1998-10-23 2014-01-28 Asterias Biotherapeutics, Inc. Human embryonic stem cells genetically modified to contain a nucleic acid and cultured with fibroblast growth factor
US7015037B1 (en) 1999-08-05 2006-03-21 Regents Of The University Of Minnesota Multiponent adult stem cells and methods for isolation
US10226485B2 (en) 1999-08-05 2019-03-12 Abt Holding Company Multipotent adult stem cells and methods for isolation
US7659118B2 (en) 1999-08-05 2010-02-09 Abt Holding Company Multipotent adult stem cells
US8252280B1 (en) 1999-08-05 2012-08-28 Regents Of The University Of Minnesota MAPC generation of muscle
US7838289B2 (en) 2001-02-14 2010-11-23 Abt Holding Company Assay utilizing multipotent adult stem cells
WO2003000868A1 (fr) 2001-06-21 2003-01-03 Geron Corporation Neurones dopaminergiques et cellules precuseurs competentes en proliferation destines au traitement de la maladie de parkinson
US7326572B2 (en) 2001-12-07 2008-02-05 Geron Corporation Endoderm cells from human embryonic stem cells
US9085756B2 (en) 2001-12-07 2015-07-21 Asterias Biotherapeutic, Inc. Drug screening using islet cells and islet cell progenitors from human embryonic stem cells
US7799324B2 (en) 2001-12-07 2010-09-21 Geron Corporation Using undifferentiated embryonic stem cells to control the immune system
EP2292734A1 (fr) 2001-12-07 2011-03-09 Geron Corporation Cellules hématopoïétiques à partir de cellules souches embryonnaires humaines
EP2264146A1 (fr) 2001-12-07 2010-12-22 Geron Corporation Cellules d'îlots de Langerhans à partir de cellules souches embryonnaires humaines
WO2003050249A2 (fr) 2001-12-07 2003-06-19 Geron Corporation Cellules d'ilots pancreatiques provenant de cellules souches embryonnaires humaines
US7033831B2 (en) 2001-12-07 2006-04-25 Geron Corporation Islet cells from human embryonic stem cells
US7285415B2 (en) 2002-07-11 2007-10-23 The Regents Of The University Of California Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US7579188B2 (en) 2002-07-11 2009-08-25 The Regents Of The University Of California Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US10611998B2 (en) 2002-07-11 2020-04-07 The Regents Of The University Of California Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
EP2273268A2 (fr) 2002-07-11 2011-01-12 The Regents of The University of California Oligodendrocytes dérivés de cellules souches embryonnaires humaines pour remyélinisation et traitement de lésion de la moelle épinière
US7153650B2 (en) 2003-03-13 2006-12-26 Geron Corporation Marker system for preparing and characterizing high-quality human embryonic stem cells
US8426200B2 (en) 2003-07-02 2013-04-23 Regents Of The University Of Minnesota Neuronal differentiation of stem cells
US10638734B2 (en) 2004-01-05 2020-05-05 Abt Holding Company Multipotent adult stem cells, sources thereof, methods of obtaining and maintaining same, methods of differentiation thereof, methods of use thereof and cells derived thereof
EP2267116A1 (fr) 2004-07-13 2010-12-29 Geron Corporation Milieu de croissance pour cellules souches embryonnaires de primates
EP3599277A1 (fr) 2005-06-22 2020-01-29 Asterias Biotherapeutics, Inc. Culture de suspension de cellules souches embryonnaires humaines
WO2007002136A2 (fr) 2005-06-22 2007-01-04 Geron Corporation Differenciation de cellules souches pluripotentes en cellules a lignage cardiomyocyte
US9074181B2 (en) 2005-06-22 2015-07-07 Asterias Biotherapeutics, Inc. Suspension culture of human embryonic stem cells
WO2007002086A2 (fr) 2005-06-22 2007-01-04 Geron Corporation Culture en suspension de cellules souches embryonnaires humaines
US10676714B2 (en) 2005-06-22 2020-06-09 Asterias Biotherapeutics, Inc. Suspension culture of human embryonic stem cells
US8415153B2 (en) 2006-06-19 2013-04-09 Geron Corporation Differentiation and enrichment of islet-like cells from human pluripotent stem cells
US9005964B2 (en) 2006-11-24 2015-04-14 Regents Of The University Of Minnesota Endodermal progenitor cells
US10221390B2 (en) 2008-01-30 2019-03-05 Asterias Biotherapeutics, Inc. Synthetic surfaces for culturing stem cell derived oligodendrocyte progenitor cells
US10344262B2 (en) 2008-03-27 2019-07-09 Asterias Biotherapeutics, Inc. Differentiation of primate pluripotent stem cells to hematopoietic lineage cells
EP3293255A1 (fr) 2008-03-27 2018-03-14 Asterias Biotherapeutics, Inc. Différenciation de cellules souches pluripotentes de primates en cellules de lignage hématopoïétique
US8093049B2 (en) 2008-03-27 2012-01-10 Geron Corporation Differentiation of primate pluripotent stem cells to hematopoietic lineage cells
WO2010116148A1 (fr) 2009-04-09 2010-10-14 Antoxis Limited Utilisation de composés pour la différenciation de cellules
WO2011124894A1 (fr) 2010-04-08 2011-10-13 The University Court Of The University Of Edinburgh Cellules progénitrices chondrogènes, protocole pour la dérivation de cellules et leurs utilisations
DE202014011287U1 (de) 2013-06-11 2019-02-06 The President And Fellows Of Harvard College SC-ß Zellen und Zusammensetzungen zur Erzeugung der Zellen
EP3569694A1 (fr) 2013-06-11 2019-11-20 President and Fellows of Harvard College Cellules sc-beta et compositions et procédés pour les générer
WO2022221051A1 (fr) 2021-04-11 2022-10-20 President And Fellows Of Harvard College Myocytes cardiaques et compositions et procédés de production associés

Also Published As

Publication number Publication date
CA2397292A1 (fr) 2001-07-19
WO2001051611A1 (fr) 2001-07-19
EP1254211A4 (fr) 2003-07-16
EP1254211A1 (fr) 2002-11-06

Similar Documents

Publication Publication Date Title
WO2001051610A1 (fr) Production de cellules ectodermiques
Bernardo et al. BRACHYURY and CDX2 mediate BMP-induced differentiation of human and mouse pluripotent stem cells into embryonic and extraembryonic lineages
Dyce et al. Stem cells with multilineage potential derived from porcine skin
Verfaillie et al. Stem cells: hype and reality
Itskovitz-Eldor et al. Differentiation of human embryonic stem cells into embryoid bodies comprising the three embryonic germ layers
EP1734112B1 (fr) Procede de proliferation de cellules souches pluripotentes
Perin et al. Characterization of human amniotic fluid stem cells and their pluripotential capability
JP2002517982A (ja) 細胞の分化／増殖および維持因子ならびにそれらの使用
US20020136709A1 (en) In vitro-derived adult pluripotent stem cells and uses therefor
EP1176189A1 (fr) Cellules de type cellules souches
US20230174929A1 (en) Method for generating mesoderm and/or endothelial colony forming cell-like cells having in vivo blood vessel forming capacity
JP2022105142A (ja) 哺乳動物種における誘導組織再生のための組成物および方法
Xiao et al. Directed differentiation of zebrafish pluripotent embryonic cells to functional cardiomyocytes
KR20230025005A (ko) 만능 줄기세포의 제조를 위한 재료 및 방법
EP2139989B1 (fr) Population isolee de cellules et procedes de generation et d'utilisation de celle-ci
JP2005333904A (ja) 羊膜由来因子による胚性幹細胞の培養方法
Pellicano et al. Induced pluripotent stem cells from spermatogonial stem cells: potential applications
Tada Nuclear reprogramming: an overview
US20040053272A1 (en) Methods of constructing a model of cellular development and differentiation using homozygous stem cell systems, methods of assessing and cataloging proteins expressed therein, cDNA libraries generated therefrom, and materials and methods using same
Tandukar Melanocyte Stem Cell Subpopulations Show Distinct Pigmentation and Regenerative Potential
D'Amour Sox2 defines distinct functional classes of stem cells
Margulies et al. Chapter III: In vitro Hematopoietic and Neuronal Differentiation of Mouse Embryonic Stem Cells
Schmandt et al. Lineage selection and transplantation of mouse ES cell-derived neural precursors
Xu Early Cell Fate Determination in Zebrafish
Tada Nuclear Reprogramming

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP